#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA1	19	genome.wustl.edu	37	9	107581886	107581886	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:107581886C>A	ENST00000374736.3	-	22	3616	c.3222G>T	c.(3220-3222)ctG>ctT	p.L1074L		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1074	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ATTTCAGCAGCAGCTCCCATA	0.517																																																	0													113.0	118.0	116.0					9																	107581886		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.3222G>T	9.37:g.107581886C>A			Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L1074	ENST00000374736.3	37	c.3222	CCDS6762.1	9																																																																																			ABCA1	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000165029		0.517	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1	-	0.00	87	0	C	NM_005502		107581886	-1	tier1	-	no_errors	ENST00000374736	ensembl	human	known	74_37	silent	14.08	61	10	SNP	1.000	A
ACE	1636	genome.wustl.edu	37	17	61557763	61557763	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:61557763G>T	ENST00000290866.4	+	5	745	c.721G>T	c.(721-723)Gaa>Taa	p.E241*	ACE_ENST00000428043.1_Nonsense_Mutation_p.E241*|ACE_ENST00000538928.1_Nonsense_Mutation_p.E241*|ACE_ENST00000584529.1_3'UTR	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	241	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GGACGATCTGGAACACCTCTA	0.612																																																	0													168.0	139.0	149.0					17																	61557763		2203	4300	6503	SO:0001587	stop_gained	0			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.721G>T	17.37:g.61557763G>T	ENSP00000290866:p.Glu241*		B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Nonsense_Mutation	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.E241*	ENST00000290866.4	37	c.721	CCDS11637.1	17	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434708	0.83885	.	.	ENSG00000159640	ENST00000538928;ENST00000290866;ENST00000428043	.	.	.	4.03	4.03	0.46877	.	0.115428	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-28.1821	16.3741	0.83379	0.0:0.0:1.0:0.0	.	.	.	.	X	241	.	ENSP00000290866:E241X	E	+	1	0	ACE	58911495	1.000000	0.71417	0.993000	0.49108	0.771000	0.43674	9.646000	0.98474	2.079000	0.62486	0.561000	0.74099	GAA	ACE	-	pfam_Peptidase_M2	ENSG00000159640		0.612	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE	HGNC	protein_coding	OTTHUMT00000337675.2	-	0.00	87	0	G			61557763	+1	tier1	-	no_errors	ENST00000290866	ensembl	human	known	74_37	nonsense	14.69	122	21	SNP	1.000	T
ACTL9	284382	genome.wustl.edu	37	19	8808653	8808653	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:8808653C>A	ENST00000324436.3	-	1	519	c.399G>T	c.(397-399)ctG>ctT	p.L133L		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	133						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						GGTCGTGCTCCAGCAGGTGGC	0.692																																																	0													32.0	38.0	36.0					19																	8808653		2202	4296	6498	SO:0001819	synonymous_variant	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.399G>T	19.37:g.8808653C>A			A8K893|Q6X960	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.L133	ENST00000324436.3	37	c.399	CCDS12207.1	19																																																																																			ACTL9	-	pfam_Actin-related,smart_Actin-related	ENSG00000181786		0.692	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	-	0.00	34	0	C	NM_178525		8808653	-1	tier1	-	no_errors	ENST00000324436	ensembl	human	known	74_37	silent	20.69	23	6	SNP	1.000	A
ACTR2	10097	genome.wustl.edu	37	2	65454994	65454994	+	5'UTR	SNP	G	G	C	rs368070570	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:65454994G>C	ENST00000260641.5	+	0	108				ACTR2_ENST00000377982.4_5'UTR|ACTR2_ENST00000476840.1_3'UTR|ACTR2_ENST00000542850.1_5'UTR	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)						Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						ACGGCCGGGCGGCGGTGGCTG	0.682																																																	0													10.0	12.0	12.0					2																	65454994		2095	4102	6197	SO:0001623	5_prime_UTR_variant	0			AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.-50G>C	2.37:g.65454994G>C			B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	RNA	SNP	-	NULL	ENST00000260641.5	37	NULL	CCDS1881.1	2																																																																																			ACTR2	-	-	ENSG00000138071		0.682	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR2	HGNC	protein_coding	OTTHUMT00000251730.1	-	0.00	126	0	G	NM_001005386		65454994	+1	tier1	-	no_errors	ENST00000471552	ensembl	human	known	74_37	rna	7.65	181	15	SNP	0.993	C
ACVRL1	94	genome.wustl.edu	37	12	52306268	52306268	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:52306268G>T	ENST00000388922.4	+	2	293	c.10G>T	c.(10-12)Ggc>Tgc	p.G4C	ACVRL1_ENST00000550683.1_Missense_Mutation_p.G18C|ACVRL1_ENST00000419526.2_Missense_Mutation_p.G18C	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	4					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	CATGACCTTGGGCTCCCCCAG	0.582																																																	0													69.0	58.0	61.0					12																	52306268		2203	4300	6503	SO:0001583	missense	0			L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.10G>T	12.37:g.52306268G>T	ENSP00000373574:p.Gly4Cys		A6NGA8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_TGFB_receptor	p.G18C	ENST00000388922.4	37	c.52	CCDS31804.1	12	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145305	0.37825	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000547400;ENST00000550683;ENST00000548659;ENST00000419526	D;D;D;D	0.92545	-2.03;-3.06;-2.07;-2.19	5.28	2.41	0.29592	.	0.590250	0.14171	N	0.336719	T	0.81903	0.4921	N	0.08118	0	0.19300	N	0.999976	P;B	0.36086	0.536;0.39	B;B	0.36418	0.045;0.224	T	0.74665	-0.3589	10	0.72032	D	0.01	.	7.7188	0.28721	0.2673:0.0:0.7327:0.0	.	18;4	E7EN07;P37023	.;ACVL1_HUMAN	C	4;4;18;18;18;18	ENSP00000373574:G4C;ENSP00000446724:G18C;ENSP00000447884:G18C;ENSP00000392492:G18C	ENSP00000267008:G4C	G	+	1	0	ACVRL1	50592535	0.001000	0.12720	0.895000	0.35142	0.534000	0.34807	0.497000	0.22514	0.791000	0.33826	0.655000	0.94253	GGC	ACVRL1	-	NULL	ENSG00000139567		0.582	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVRL1	HGNC	protein_coding	OTTHUMT00000404520.2	-	0.00	61	0	G			52306268	+1	tier1	-	no_errors	ENST00000550683	ensembl	human	known	74_37	missense	10.29	61	7	SNP	0.620	T
ADAD1	132612	genome.wustl.edu	37	4	123302179	123302179	+	Missense_Mutation	SNP	C	C	A	rs62000437	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:123302179C>A	ENST00000296513.2	+	4	390	c.205C>A	c.(205-207)Ctt>Att	p.L69I	ADAD1_ENST00000388725.2_Missense_Mutation_p.L51I|ADAD1_ENST00000388724.2_Missense_Mutation_p.L69I|ADAD1_ENST00000492454.1_3'UTR	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	69					multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTCCAAGAATCTTTCATCTAT	0.318																																																	0													69.0	73.0	71.0					4																	123302179		2203	4300	6503	SO:0001583	missense	0			AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.205C>A	4.37:g.123302179C>A	ENSP00000296513:p.Leu69Ile		A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.L69I	ENST00000296513.2	37	c.205	CCDS34058.1	4	.	.	.	.	.	.	.	.	.	.	C	8.484	0.860354	0.17178	.	.	ENSG00000164113	ENST00000446706;ENST00000296513;ENST00000439307;ENST00000388724;ENST00000388725	T;T;T	0.27557	1.67;1.66;1.67	5.23	3.41	0.39046	.	0.238237	0.29293	N	0.012575	T	0.11367	0.0277	N	0.03608	-0.345	0.23003	N	0.998441	B;B	0.11235	0.004;0.002	B;B	0.13407	0.009;0.004	T	0.24261	-1.0165	10	0.16420	T	0.52	-22.2044	7.0328	0.24977	0.3664:0.4799:0.1537:0.0	.	69;69	Q96M93-2;Q96M93	.;ADAD1_HUMAN	I	69;69;69;69;51	ENSP00000296513:L69I;ENSP00000373376:L69I;ENSP00000373377:L51I	ENSP00000296513:L69I	L	+	1	0	ADAD1	123521629	0.882000	0.30256	1.000000	0.80357	0.657000	0.38888	0.561000	0.23515	2.423000	0.82170	0.563000	0.77884	CTT	ADAD1	-	NULL	ENSG00000164113		0.318	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD1	HGNC	protein_coding	OTTHUMT00000316452.1	-	0.00	100	0	C	NM_139243		123302179	+1	tier1	-	no_errors	ENST00000296513	ensembl	human	known	74_37	missense	13.45	103	16	SNP	0.728	A
DCST1	149095	genome.wustl.edu	37	1	155023056	155023056	+	Intron	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:155023056C>T	ENST00000295542.1	+	17	1965				ADAM15_ENST00000449910.2_5'Flank|ADAM15_ENST00000368413.1_5'Flank|ADAM15_ENST00000359280.4_5'Flank|ADAM15_ENST00000360674.4_5'Flank|DCST1_ENST00000423025.2_Intron|ADAM15_ENST00000355956.2_5'Flank|ADAM15_ENST00000368410.2_5'Flank|ADAM15_ENST00000356955.2_5'Flank|ADAM15_ENST00000368412.3_5'Flank|ADAM15_ENST00000531455.1_5'Flank|ADAM15_ENST00000271836.6_5'Flank|ADAM15_ENST00000447332.3_5'Flank	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TTTCCCGCCTCGCTCCCGGGC	0.672											OREG0013846	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													5.0	6.0	6.0					1																	155023056		1977	4013	5990	SO:0001627	intron_variant	0			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1870-37C>T	1.37:g.155023056C>T		1767	B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	RNA	SNP	-	NULL	ENST00000295542.1	37	NULL	CCDS1083.1	1																																																																																			ADAM15	-	-	ENSG00000143537		0.672	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM15	HGNC	protein_coding	OTTHUMT00000099006.1	-	0.00	58	0	C	NM_152494		155023056	+1	tier1	-	no_errors	ENST00000473905	ensembl	human	known	74_37	rna	7.58	60	5	SNP	0.013	T
ADAMTSL3	57188	genome.wustl.edu	37	15	84539610	84539610	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:84539610G>A	ENST00000286744.5	+	9	1083	c.859G>A	c.(859-861)Ggc>Agc	p.G287S	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.G287S	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	287						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TAACAGCCCCGGCGTCTTTCT	0.378																																																	0													57.0	63.0	61.0					15																	84539610		2203	4300	6503	SO:0001583	missense	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.859G>A	15.37:g.84539610G>A	ENSP00000286744:p.Gly287Ser		A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS	p.G287S	ENST00000286744.5	37	c.859	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917445	0.52546	.	.	ENSG00000156218	ENST00000286744	T	0.66995	-0.24	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.84379	0.5459	M	0.88181	2.935	0.48087	D	0.999581	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87922	0.2704	10	0.72032	D	0.01	.	16.3709	0.83357	0.0:0.0:1.0:0.0	.	287;287	P82987-2;P82987	.;ATL3_HUMAN	S	287	ENSP00000286744:G287S	ENSP00000286744:G287S	G	+	1	0	ADAMTSL3	82330614	1.000000	0.71417	0.052000	0.19188	0.058000	0.15608	6.768000	0.74980	2.129000	0.65627	0.462000	0.41574	GGC	ADAMTSL3	-	NULL	ENSG00000156218		0.378	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2	-	0.00	112	0	G	NM_207517		84539610	+1	tier1	-	no_errors	ENST00000286744	ensembl	human	known	74_37	missense	6.21	136	9	SNP	0.866	A
ADCY10	55811	genome.wustl.edu	37	1	167792265	167792265	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:167792265C>A	ENST00000367851.4	-	29	4333	c.4149G>T	c.(4147-4149)ttG>ttT	p.L1383F	ADCY10_ENST00000545172.1_Missense_Mutation_p.L1230F|ADCY10_ENST00000367848.1_Missense_Mutation_p.L1291F|RP1-313L4.3_ENST00000451545.1_RNA	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1383					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						GCAGGATGTCCAAGCAGACAA	0.493																																																	0													111.0	104.0	106.0					1																	167792265		2203	4300	6503	SO:0001583	missense	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4149G>T	1.37:g.167792265C>A	ENSP00000356825:p.Leu1383Phe		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,superfamily_P-loop_NTPase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.L1383F	ENST00000367851.4	37	c.4149	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.775402	0.31411	.	.	ENSG00000143199	ENST00000545172;ENST00000271426;ENST00000367851;ENST00000367848	T;T;T	0.76316	-1.01;-1.01;-1.01	5.09	2.17	0.27698	.	0.000000	0.39615	N	0.001316	T	0.78483	0.4290	M	0.72894	2.215	0.32388	N	0.553644	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.76394	-0.2975	9	0.44086	T	0.13	-15.2552	7.4621	0.27302	0.0:0.7104:0.0:0.2896	.	1291;1383	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	F	1230;284;1383;1291	ENSP00000441992:L1230F;ENSP00000356825:L1383F;ENSP00000356822:L1291F	ENSP00000271426:L284F	L	-	3	2	ADCY10	166058889	1.000000	0.71417	1.000000	0.80357	0.358000	0.29455	0.302000	0.19192	0.666000	0.31087	-0.136000	0.14681	TTG	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.493	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	-	0.00	96	0	C	NM_018417		167792265	-1	tier1	-	no_errors	ENST00000367851	ensembl	human	known	74_37	missense	10.22	123	14	SNP	1.000	A
ADCY4	196883	genome.wustl.edu	37	14	24798662	24798662	+	Missense_Mutation	SNP	C	C	A	rs146439456		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:24798662C>A	ENST00000310677.4	-	10	1408	c.1295G>T	c.(1294-1296)cGg>cTg	p.R432L	ADCY4_ENST00000418030.2_Missense_Mutation_p.R432L|ADCY4_ENST00000554068.2_Missense_Mutation_p.R432L|ADCY4_ENST00000396747.3_Missense_Mutation_p.R125L	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	432					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		GTAGGGGTCCCGATGCTCCAT	0.632																																																	0													65.0	64.0	65.0					14																	24798662		2203	4300	6503	SO:0001583	missense	0			AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.1295G>T	14.37:g.24798662C>A	ENSP00000312126:p.Arg432Leu		B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R432L	ENST00000310677.4	37	c.1295	CCDS9627.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.8|28.8	4.949772|4.949772	0.92660|0.92660	.|.	.|.	ENSG00000129467|ENSG00000129467	ENST00000556932|ENST00000310677;ENST00000554068;ENST00000418030;ENST00000396747	.|D;D;D;D	.|0.85258	.|-1.56;-1.56;-1.56;-1.96	5.13|5.13	5.13|5.13	0.70059|0.70059	.|Adenylyl cyclase class-3/4/guanylyl cyclase (3);	.|0.172458	.|0.27986	.|N	.|0.017059	D|D	0.90164|0.90164	0.6926|0.6926	L|L	0.52126|0.52126	1.63|1.63	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.90815|0.90815	0.4704|0.4704	5|10	.|0.87932	.|D	.|0	.|.	16.1244|16.1244	0.81382|0.81382	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|432	.|Q8NFM4	.|ADCY4_HUMAN	W|L	5|432;432;432;125	.|ENSP00000312126:R432L;ENSP00000452250:R432L;ENSP00000393177:R432L;ENSP00000379971:R125L	.|ENSP00000312126:R432L	G|R	-|-	1|2	0|0	ADCY4|ADCY4	23868502|23868502	0.985000|0.985000	0.35326|0.35326	1.000000|1.000000	0.80357|0.80357	0.790000|0.790000	0.44656|0.44656	7.597000|7.597000	0.82733|0.82733	2.670000|2.670000	0.90874|0.90874	0.655000|0.655000	0.94253|0.94253	GGG|CGG	ADCY4	-	pfam_A/G_cyclase,superfamily_A/G_cyclase	ENSG00000129467		0.632	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY4	HGNC	protein_coding	OTTHUMT00000073200.4		0.00	51	0	C			24798662	-1			no_errors	ENST00000310677	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.993	A
ADH7	131	genome.wustl.edu	37	4	100350696	100350696	+	Missense_Mutation	SNP	C	C	A	rs148026590	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:100350696C>A	ENST00000209665.4	-	2	389	c.149G>T	c.(148-150)cGc>cTc	p.R50L	ADH7_ENST00000482593.1_5'UTR|ADH7_ENST00000476959.1_Missense_Mutation_p.R58L|ADH7_ENST00000437033.2_Missense_Mutation_p.R38L	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	50					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		TACCTTAATGCGAACTTCTTT	0.408																																																	0													98.0	85.0	89.0					4																	100350696		2203	4300	6503	SO:0001583	missense	0			X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.149G>T	4.37:g.100350696C>A	ENSP00000209665:p.Arg50Leu		A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like	p.R50L	ENST00000209665.4	37	c.149	CCDS34034.1	4	.	.	.	.	.	.	.	.	.	.	c	16.92	3.254704	0.59212	.	.	ENSG00000196344	ENST00000437033;ENST00000209665;ENST00000476959	T;T;T	0.03635	3.86;3.86;3.86	4.05	-2.8	0.05823	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.171784	0.52532	D	0.000065	T	0.04227	0.0117	N	0.13140	0.3	0.58432	D	0.999998	D	0.69078	0.997	D	0.74674	0.984	T	0.34825	-0.9813	10	0.02654	T	1	-16.1279	9.9497	0.41631	0.0:0.5119:0.0:0.4881	.	50	P40394	ADH7_HUMAN	L	38;50;58	ENSP00000414254:R38L;ENSP00000209665:R50L;ENSP00000420269:R58L	ENSP00000209665:R50L	R	-	2	0	ADH7	100569719	0.140000	0.22579	0.001000	0.08648	0.974000	0.67602	0.662000	0.25038	-0.859000	0.04105	-0.119000	0.15052	CGC	ADH7	-	pfam_ADH_GroES-like,superfamily_GroES-like	ENSG00000196344		0.408	ADH7-201	KNOWN	basic|CCDS	protein_coding	ADH7	HGNC	protein_coding		-	0.00	130	0	C	NM_000673		100350696	-1	tier1	-	no_errors	ENST00000209665	ensembl	human	known	74_37	missense	9.45	115	12	SNP	0.648	A
AHNAK2	113146	genome.wustl.edu	37	14	105418587	105418587	+	Silent	SNP	C	C	A	rs536223749	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:105418587C>A	ENST00000333244.5	-	7	3320	c.3201G>T	c.(3199-3201)ccG>ccT	p.P1067P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1067						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGTGGCCCTCCGGGAGCTTCA	0.617																																																	0													94.0	107.0	103.0					14																	105418587		1904	4114	6018	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3201G>T	14.37:g.105418587C>A			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P1067	ENST00000333244.5	37	c.3201	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	139	0	C	NM_138420		105418587	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	silent	10.98	146	18	SNP	0.000	A
AIMP1	9255	genome.wustl.edu	37	4	107248633	107248633	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:107248633G>C	ENST00000442366.1	+	3	187	c.135G>C	c.(133-135)gaG>gaC	p.E45D	AIMP1_ENST00000394701.4_Missense_Mutation_p.E69D|AIMP1_ENST00000358008.3_Missense_Mutation_p.E45D	NM_001142415.1	NP_001135887.1	Q12904	AIMP1_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 1	45	Required for fibroblast proliferation.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of endothelial cell proliferation (GO:0001937)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(1)|endometrium(2)|kidney(1)|lung(5)|skin(1)|urinary_tract(1)	11						TGAGGGAAGAGAAGAAACTTC	0.313																																																	0													56.0	61.0	59.0					4																	107248633		2203	4297	6500	SO:0001583	missense	0			U10117	CCDS3674.1, CCDS47121.1	4q24	2009-05-20	2009-05-20	2009-05-20	ENSG00000164022	ENSG00000164022			10648	protein-coding gene	gene with protein product	"""EMAP II"", ""ARS-interacting multifunctional protein 1"""	603605	"""small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)"""	SCYE1		7929199, 7545917	Standard	NM_004757		Approved	EMAPII, EMAP-2, p43	uc011cfg.2	Q12904	OTTHUMG00000131217	ENST00000442366.1:c.135G>C	4.37:g.107248633G>C	ENSP00000405248:p.Glu45Asp		B3KTR2|B4E1S7|Q6FG28|Q96CQ9	Missense_Mutation	SNP	pfam_tRNA-bd_dom,superfamily_NA-bd_OB-fold,superfamily_t-SNARE,pfscan_tRNA-bd_dom	p.E69D	ENST00000442366.1	37	c.207	CCDS3674.1	4	.	.	.	.	.	.	.	.	.	.	G	21.9	4.209622	0.79240	.	.	ENSG00000164022	ENST00000510207;ENST00000442366;ENST00000432345;ENST00000358008;ENST00000394701	T;T;T;T	0.28895	1.59;1.85;1.85;1.82	5.19	4.34	0.51931	.	0.198698	0.51477	D	0.000081	T	0.55924	0.1951	M	0.80982	2.52	0.58432	D	0.999997	D;D	0.69078	0.997;0.986	D;P	0.72625	0.978;0.864	T	0.61282	-0.7094	10	0.59425	D	0.04	-21.6675	13.1684	0.59583	0.0786:0.0:0.9214:0.0	.	45;45	B4DNK3;Q12904	.;AIMP1_HUMAN	D	45;45;45;45;69	ENSP00000423681:E45D;ENSP00000405248:E45D;ENSP00000350699:E45D;ENSP00000378191:E69D	ENSP00000350699:E45D	E	+	3	2	AIMP1	107468082	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.472000	0.60189	1.292000	0.44672	0.655000	0.94253	GAG	AIMP1	-	superfamily_t-SNARE	ENSG00000164022		0.313	AIMP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AIMP1	HGNC	protein_coding	OTTHUMT00000253961.1	-	0.00	126	0	G	NM_004757		107248633	+1	tier1	-	no_errors	ENST00000394701	ensembl	human	known	74_37	missense	12.96	141	21	SNP	1.000	C
AKAP3	10566	genome.wustl.edu	37	12	4737521	4737521	+	Missense_Mutation	SNP	C	C	T	rs140759485		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:4737521C>T	ENST00000545990.2	-	5	1071	c.547G>A	c.(547-549)Gtc>Atc	p.V183I	AKAP3_ENST00000228850.1_Missense_Mutation_p.V183I|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	183					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						CATGCAGAGACGGTCTCATTC	0.478																																																	0								C	ILE/VAL	0,4406		0,0,2203	140.0	130.0	133.0		547	4.8	0.1	12	dbSNP_134	133	2,8598	2.2+/-6.3	0,2,4298	no	missense	AKAP3	NM_006422.2	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	183/854	4737521	2,13004	2203	4300	6503	SO:0001583	missense	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.547G>A	12.37:g.4737521C>T	ENSP00000440994:p.Val183Ile		O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.V183I	ENST00000545990.2	37	c.547	CCDS8531.1	12	.	.	.	.	.	.	.	.	.	.	C	12.44	1.940079	0.34283	0.0	2.33E-4	ENSG00000111254	ENST00000228850;ENST00000545990	T;T	0.11930	2.73;2.73	4.75	4.75	0.60458	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.52532	D	0.000070	T	0.17704	0.0425	M	0.78049	2.395	0.09310	N	0.999999	P	0.52577	0.954	B	0.40741	0.339	T	0.36114	-0.9761	10	0.87932	D	0	.	9.1003	0.36664	0.0:0.9018:0.0:0.0982	.	183	O75969	AKAP3_HUMAN	I	183	ENSP00000228850:V183I;ENSP00000440994:V183I	ENSP00000228850:V183I	V	-	1	0	AKAP3	4607782	0.615000	0.27026	0.095000	0.20976	0.224000	0.24922	1.295000	0.33377	2.615000	0.88500	0.650000	0.86243	GTC	AKAP3	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000111254		0.478	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	-	0.00	70	0	C	NM_006422		4737521	-1	tier1	rs140759485	no_errors	ENST00000228850	ensembl	human	known	74_37	missense	11.11	64	8	SNP	0.203	T
AKR1A1	10327	genome.wustl.edu	37	1	46033797	46033797	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:46033797G>T	ENST00000372070.3	+	6	1247	c.500G>T	c.(499-501)cGg>cTg	p.R167L	AKR1A1_ENST00000351829.4_Missense_Mutation_p.R167L|AKR1A1_ENST00000473038.1_3'UTR	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	167					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	TTCAACAGTCGGCAGATTGAT	0.567																																																	0													92.0	77.0	82.0					1																	46033797		2203	4300	6503	SO:0001583	missense	0			J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.500G>T	1.37:g.46033797G>T	ENSP00000361140:p.Arg167Leu		A8KAL8|D3DQ04|Q6IAZ4	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.R167L	ENST00000372070.3	37	c.500	CCDS523.1	1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741362	0.49151	.	.	ENSG00000117448	ENST00000372070;ENST00000351829	T;T	0.24723	1.84;1.84	5.75	2.79	0.32731	NADP-dependent oxidoreductase domain (3);	0.167749	0.48286	N	0.000192	T	0.18087	0.0434	L	0.37897	1.145	0.58432	D	0.999994	B	0.06786	0.001	B	0.14023	0.01	T	0.05468	-1.0883	10	0.30078	T	0.28	.	8.4496	0.32862	0.1326:0.0:0.7412:0.1262	.	167	P14550	AK1A1_HUMAN	L	167	ENSP00000361140:R167L;ENSP00000312606:R167L	ENSP00000312606:R167L	R	+	2	0	AKR1A1	45806384	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.681000	0.68175	0.800000	0.34041	0.650000	0.86243	CGG	AKR1A1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000117448		0.567	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1A1	HGNC	protein_coding	OTTHUMT00000020851.1	-	0.00	48	0	G	NM_006066		46033797	+1	tier1	-	no_errors	ENST00000351829	ensembl	human	known	74_37	missense	13.24	59	9	SNP	1.000	T
AKR1C4	1109	genome.wustl.edu	37	10	5260694	5260694	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:5260694C>A	ENST00000380448.1	+	11	1196	c.943C>A	c.(943-945)Cct>Act	p.P315T	AKR1C4_ENST00000263126.1_Missense_Mutation_p.P315T			P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	315					androgen metabolic process (GO:0008209)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|bile acid transmembrane transporter activity (GO:0015125)|chlordecone reductase activity (GO:0047743)|electron carrier activity (GO:0009055)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|retinal dehydrogenase activity (GO:0001758)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	18						TATGGACCATCCTGATTATCC	0.393																																																	0													152.0	129.0	137.0					10																	5260694		2203	4300	6503	SO:0001583	missense	0			M33375	CCDS7064.1	10p15.1	2012-12-04	2012-12-04		ENSG00000198610	ENSG00000198610	1.1.1.225	"""Aldo-keto reductases"""	387	protein-coding gene	gene with protein product	"""chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4"""	600451	"""aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)"""	CHDR		7789999	Standard	NM_001818		Approved	DD4, HAKRA, C11, 3-alpha-HSD, CDR, MGC22581	uc001ihw.2	P17516	OTTHUMG00000017591	ENST00000380448.1:c.943C>A	10.37:g.5260694C>A	ENSP00000369814:p.Pro315Thr		Q5T6A3|Q8WW84|Q9NS54	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.P315T	ENST00000380448.1	37	c.943	CCDS7064.1	10	.	.	.	.	.	.	.	.	.	.	C	7.755	0.704233	0.15172	.	.	ENSG00000198610	ENST00000380448;ENST00000263126	T;T	0.50001	0.76;0.76	2.83	1.79	0.24919	NADP-dependent oxidoreductase domain (2);	0.104164	0.40640	N	0.001044	T	0.48205	0.1487	M	0.86097	2.795	0.09310	N	1	B	0.30686	0.29	B	0.27715	0.082	T	0.53034	-0.8495	10	0.66056	D	0.02	.	9.7692	0.40578	0.0:0.7875:0.2124:0.0	.	315	P17516	AK1C4_HUMAN	T	315	ENSP00000369814:P315T;ENSP00000263126:P315T	ENSP00000263126:P315T	P	+	1	0	AKR1C4	5250694	0.000000	0.05858	0.003000	0.11579	0.011000	0.07611	0.437000	0.21543	1.272000	0.44329	0.313000	0.20887	CCT	AKR1C4	-	superfamily_NADP_OxRdtase_dom	ENSG00000198610		0.393	AKR1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C4	HGNC	protein_coding	OTTHUMT00000046543.2	-	0.00	53	0	C	NM_001818		5260694	+1	tier1	-	no_errors	ENST00000263126	ensembl	human	known	74_37	missense	12.50	56	8	SNP	0.007	A
ALDOB	229	genome.wustl.edu	37	9	104187755	104187755	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:104187755G>T	ENST00000374855.4	-	7	903	c.779C>A	c.(778-780)aCt>aAt	p.T260N	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	260					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				TGCAGGAACAGTACGGTGGAG	0.493																																																	0													230.0	181.0	198.0					9																	104187755		2203	4300	6503	SO:0001583	missense	0			X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.779C>A	9.37:g.104187755G>T	ENSP00000363988:p.Thr260Asn		Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	pfam_Aldolase_I	p.T260N	ENST00000374855.4	37	c.779	CCDS6756.1	9	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949729	0.73787	.	.	ENSG00000136872	ENST00000374855;ENST00000374853;ENST00000430164	D	0.87103	-2.21	6.06	6.06	0.98353	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.93180	0.7828	M	0.80982	2.52	0.80722	D	1	B	0.33103	0.397	P	0.50231	0.635	D	0.92068	0.5662	10	0.72032	D	0.01	-23.7343	19.6279	0.95687	0.0:0.0:1.0:0.0	.	260	P05062	ALDOB_HUMAN	N	260;187;260	ENSP00000363988:T260N	ENSP00000363986:T187N	T	-	2	0	ALDOB	103227576	1.000000	0.71417	0.248000	0.24265	0.324000	0.28378	9.869000	0.99810	2.880000	0.98712	0.650000	0.86243	ACT	ALDOB	-	pfam_Aldolase_I	ENSG00000136872		0.493	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDOB	HGNC	protein_coding	OTTHUMT00000053434.2	-	0.00	89	0	G			104187755	-1	tier1	-	no_errors	ENST00000374855	ensembl	human	known	74_37	missense	13.59	89	14	SNP	0.999	T
ALKBH1	8846	genome.wustl.edu	37	14	78142116	78142116	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:78142116C>A	ENST00000216489.3	-	5	638	c.623G>T	c.(622-624)gGa>gTa	p.G208V		NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	208	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		ATCCTCAAATCCACAGGCAGC	0.473																																																	0													94.0	94.0	94.0					14																	78142116		2203	4300	6503	SO:0001583	missense	0			X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.623G>T	14.37:g.78142116C>A	ENSP00000216489:p.Gly208Val		Q8TAU1|Q9ULA7	Missense_Mutation	SNP	tigrfam_Alkb	p.G208V	ENST00000216489.3	37	c.623	CCDS32127.1	14	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573278	0.86542	.	.	ENSG00000100601	ENST00000216489	T	0.12569	2.67	6.03	6.03	0.97812	Oxoglutarate/iron-dependent oxygenase (1);	0.000000	0.85682	D	0.000000	T	0.49184	0.1542	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.54596	-0.8270	10	0.72032	D	0.01	-19.2516	20.5568	0.99304	0.0:1.0:0.0:0.0	.	208	Q13686	ALKB1_HUMAN	V	208	ENSP00000216489:G208V	ENSP00000216489:G208V	G	-	2	0	ALKBH1	77211869	1.000000	0.71417	0.994000	0.49952	0.710000	0.40934	7.391000	0.79828	2.861000	0.98227	0.655000	0.94253	GGA	ALKBH1	-	tigrfam_Alkb	ENSG00000100601		0.473	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH1	HGNC	protein_coding	OTTHUMT00000414037.1	-	0.00	78	0	C	NM_006020		78142116	-1	tier1	-	no_errors	ENST00000216489	ensembl	human	known	74_37	missense	9.23	118	12	SNP	1.000	A
ALOX12	239	genome.wustl.edu	37	17	6901872	6901872	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:6901872C>A	ENST00000251535.6	+	3	435	c.382C>A	c.(382-384)Cga>Aga	p.R128R	RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399541.2_Intron	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	128	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CCAGAAGCATCGAGAGAAGGA	0.582																																																	0													68.0	53.0	58.0					17																	6901872		2203	4300	6503	SO:0001819	synonymous_variant	0			M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.382C>A	17.37:g.6901872C>A			O95569|Q6ISF8|Q9UQM4	Silent	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.R128	ENST00000251535.6	37	c.382	CCDS11084.1	17																																																																																			ALOX12	-	superfamily_LipOase_C	ENSG00000108839		0.582	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12	HGNC	protein_coding	OTTHUMT00000219922.2	-	0.00	46	0	C			6901872	+1	tier1	-	no_errors	ENST00000251535	ensembl	human	known	74_37	silent	14.29	36	6	SNP	0.996	A
AMFR	267	genome.wustl.edu	37	16	56396854	56396854	+	Silent	SNP	C	C	G	rs540896367	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:56396854C>G	ENST00000290649.5	-	14	2109	c.1899G>C	c.(1897-1899)gcG>gcC	p.A633A		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	633	VCP/p97-interacting motif (VIM).				aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						GCCTCCGTTCCGCGGCGGCAG	0.642																																					Pancreas(2;144 323 39528)												0													45.0	36.0	39.0					16																	56396854		2198	4300	6498	SO:0001819	synonymous_variant	0			L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.1899G>C	16.37:g.56396854C>G			P26442|Q8IZ70	Silent	SNP	pfam_CUE,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_CUE,pfscan_CUE,pfscan_Znf_RING	p.A633	ENST00000290649.5	37	c.1899	CCDS10758.1	16	.	.	.	.	.	.	.	.	.	.	C	8.886	0.952897	0.18431	.	.	ENSG00000159461	ENST00000314566	.	.	.	5.8	-11.6	0.00059	.	.	.	.	.	T	0.53690	0.1812	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76260	-0.3024	5	0.72032	D	0.01	-18.6453	7.3027	0.26430	0.1031:0.3113:0.4552:0.1304	.	.	.	.	P	56	.	ENSP00000313137:R56P	R	-	2	0	AMFR	54954355	0.000000	0.05858	0.003000	0.11579	0.924000	0.55760	-3.719000	0.00384	-4.313000	0.00057	-0.344000	0.07964	CGG	AMFR	-	NULL	ENSG00000159461		0.642	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMFR	HGNC	protein_coding	OTTHUMT00000256978.2	-	0.00	87	0	C			56396854	-1	tier1	-	no_errors	ENST00000290649	ensembl	human	known	74_37	silent	5.36	106	6	SNP	0.014	G
AMOT	154796	genome.wustl.edu	37	X	112059028	112059028	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:112059028C>A	ENST00000524145.1	-	3	1024	c.950G>T	c.(949-951)gGg>gTg	p.G317V	AMOT_ENST00000371958.1_Missense_Mutation_p.G85V|AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371959.3_Missense_Mutation_p.G317V|AMOT_ENST00000371962.1_Missense_Mutation_p.G85V			Q4VCS5	AMOT_HUMAN	angiomotin	317					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						CAAGGACCCCCCAGAGGTCAG	0.567																																																	0													68.0	63.0	64.0					X																	112059028		692	1591	2283	SO:0001583	missense	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.950G>T	X.37:g.112059028C>A	ENSP00000429013:p.Gly317Val		Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.G317V	ENST00000524145.1	37	c.950	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232103	0.58777	.	.	ENSG00000126016	ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T	0.13657	2.57;2.57;2.57;2.57	5.11	4.18	0.49190	.	0.529823	0.20928	N	0.083153	T	0.09069	0.0224	L	0.29908	0.895	0.58432	D	0.999998	B	0.21071	0.051	B	0.17433	0.018	T	0.15492	-1.0435	10	0.12766	T	0.61	-15.5865	9.5704	0.39425	0.3864:0.6136:0.0:0.0	.	317	Q4VCS5	AMOT_HUMAN	V	317;85;317;85	ENSP00000361027:G317V;ENSP00000361030:G85V;ENSP00000429013:G317V;ENSP00000361026:G85V	ENSP00000361026:G85V	G	-	2	0	AMOT	111945684	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.753000	0.62183	2.374000	0.81015	0.529000	0.55759	GGG	AMOT	-	NULL	ENSG00000126016		0.567	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	-	0.00	88	0	C	NM_133265		112059028	-1	tier1	-	no_errors	ENST00000371959	ensembl	human	known	74_37	missense	9.28	88	9	SNP	1.000	A
ANGEL2	90806	genome.wustl.edu	37	1	213180441	213180442	+	Intron	INS	-	-	A	rs116147385|rs71147054|rs397982836|rs202124670	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:213180441_213180442insA	ENST00000366962.3	-	4	867				ANGEL2_ENST00000360506.2_Intron|ANGEL2_ENST00000535388.1_Intron|ANGEL2_ENST00000540642.1_Intron|ANGEL2_ENST00000544555.1_Intron	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)											central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		tctcaaaaaagaaaaaaaaaaa	0.431																																																	0																																										SO:0001627	intron_variant	0			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.712+28->T	1.37:g.213180452_213180452dupA			B7Z2U4|D3DTA3|Q86X13|Q8NHH3	RNA	INS	-	NULL	ENST00000366962.3	37	NULL	CCDS1512.1	1																																																																																			ANGEL2	-	-	ENSG00000174606		0.431	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1		0.00	13	0	-	NM_144567		213180442	-1	tier1		no_errors	ENST00000460337	ensembl	human	known	74_37	rna	14.71	29	5	INS	0.003:0.007	A
ANKEF1	63926	genome.wustl.edu	37	20	10030541	10030541	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:10030541G>T	ENST00000378380.3	+	6	1653	c.1324G>T	c.(1324-1326)Gcg>Tcg	p.A442S	ANKEF1_ENST00000378392.1_Missense_Mutation_p.A442S|SNAP25-AS1_ENST00000603542.1_RNA|SNAP25-AS1_ENST00000421143.2_RNA|ANKEF1_ENST00000488991.1_3'UTR	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	442							calcium ion binding (GO:0005509)										TCCTGAGTACGCGTTTCCACG	0.463																																																	0													80.0	77.0	78.0					20																	10030541		2203	4300	6503	SO:0001583	missense	0			AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.1324G>T	20.37:g.10030541G>T	ENSP00000367631:p.Ala442Ser		B3KUQ0|Q9H6Y9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EF_hand_dom,prints_Ankyrin_rpt	p.A442S	ENST00000378380.3	37	c.1324	CCDS13108.1	20	.	.	.	.	.	.	.	.	.	.	G	0.300	-0.974324	0.02215	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	T;T	0.65916	-0.18;-0.18	5.87	4.87	0.63330	Ankyrin repeat-containing domain (1);	1.224580	0.05073	N	0.481993	T	0.54334	0.1852	L	0.34521	1.04	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.28586	-1.0039	10	0.14252	T	0.57	-6.8847	13.9895	0.64357	0.0:0.0:0.6954:0.3046	.	442	Q9NU02	ANKR5_HUMAN	S	442	ENSP00000367644:A442S;ENSP00000367631:A442S	ENSP00000367631:A442S	A	+	1	0	ANKRD5	9978541	0.033000	0.19621	0.008000	0.14137	0.007000	0.05969	2.439000	0.44846	2.941000	0.99782	0.655000	0.94253	GCG	ANKEF1	-	pfscan_Ankyrin_rpt-contain_dom	ENSG00000132623		0.463	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ANKEF1	HGNC	protein_coding	OTTHUMT00000077968.2		0.00	42	0	G	NM_022096		10030541	+1			no_errors	ENST00000378380	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.000	T
ANKRA2	57763	genome.wustl.edu	37	5	72849262	72849262	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:72849262C>A	ENST00000296785.3	-	8	1513	c.855G>T	c.(853-855)atG>atT	p.M285I		NM_023039.4	NP_075526.1	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2	285						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	low-density lipoprotein particle binding (GO:0030169)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		CAGCTAGATCCATAGAATTAT	0.353																																																	0													83.0	78.0	80.0					5																	72849262		2203	4300	6503	SO:0001583	missense	0			AA442702	CCDS4020.1	5q12-q13	2013-01-10			ENSG00000164331	ENSG00000164331		"""Ankyrin repeat domain containing"""	13208	protein-coding gene	gene with protein product		605787				10965114	Standard	NM_023039		Approved		uc003kcu.2	Q9H9E1	OTTHUMG00000102030	ENST00000296785.3:c.855G>T	5.37:g.72849262C>A	ENSP00000296785:p.Met285Ile			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.M285I	ENST00000296785.3	37	c.855	CCDS4020.1	5	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177501	0.78564	.	.	ENSG00000164331	ENST00000296785	T	0.69435	-0.4	6.04	6.04	0.98038	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.70002	0.3174	L	0.32530	0.975	0.80722	D	1	P	0.35507	0.506	P	0.46419	0.516	T	0.69734	-0.5065	10	0.72032	D	0.01	-21.9018	20.5948	0.99439	0.0:1.0:0.0:0.0	.	285	Q9H9E1	ANRA2_HUMAN	I	285	ENSP00000296785:M285I	ENSP00000296785:M285I	M	-	3	0	ANKRA2	72885018	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.338000	0.79269	2.873000	0.98535	0.563000	0.77884	ATG	ANKRA2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000164331		0.353	ANKRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRA2	HGNC	protein_coding	OTTHUMT00000219814.2		0.00	21	0	C	NM_023039		72849262	-1			no_errors	ENST00000296785	ensembl	human	known	74_37	missense	13.51	32	5	SNP	1.000	A
ANKRD12	23253	genome.wustl.edu	37	18	9255003	9255003	+	Missense_Mutation	SNP	C	C	A	rs148294667	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr18:9255003C>A	ENST00000262126.4	+	9	1978	c.1738C>A	c.(1738-1740)Ctt>Att	p.L580I	ANKRD12_ENST00000383440.2_Missense_Mutation_p.L557I|ANKRD12_ENST00000400020.3_Missense_Mutation_p.L557I	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	580						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L580V(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						ACAGCCTGATCTTGTTCGGTA	0.333																																																	1	Substitution - Missense(1)	lung(1)						C	ILE/LEU,ILE/LEU,ILE/LEU	1,4401	2.1+/-5.4	0,1,2200	65.0	66.0	65.0		1669,1669,1738	5.7	1.0	18	dbSNP_134	65	3,8591	3.0+/-9.4	0,3,4294	yes	missense,missense,missense	ANKRD12	NM_001083625.2,NM_001204056.1,NM_015208.4	5,5,5	0,4,6494	AA,AC,CC		0.0349,0.0227,0.0308	possibly-damaging,possibly-damaging,possibly-damaging	557/2040,557/2040,580/2063	9255003	4,12992	2201	4297	6498	SO:0001583	missense	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1738C>A	18.37:g.9255003C>A	ENSP00000262126:p.Leu580Ile		O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L580I	ENST00000262126.4	37	c.1738	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524644	0.44969	2.27E-4	3.49E-4	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158	D;D	0.94650	-3.48;-3.48	5.71	5.71	0.89125	.	0.285463	0.33792	N	0.004551	D	0.95007	0.8384	L	0.57536	1.79	0.34214	D	0.674596	D;P;P	0.63046	0.992;0.867;0.791	P;P;B	0.57009	0.811;0.461;0.272	D	0.96668	0.9494	10	0.52906	T	0.07	-12.443	10.8832	0.46951	0.0:0.8864:0.0:0.1136	.	207;557;580	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	I	557;580;287	ENSP00000372932:L557I;ENSP00000262126:L580I	ENSP00000262126:L580I	L	+	1	0	ANKRD12	9245003	0.998000	0.40836	0.996000	0.52242	0.992000	0.81027	3.435000	0.52849	2.704000	0.92352	0.585000	0.79938	CTT	ANKRD12	-	NULL	ENSG00000101745		0.333	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2		0.00	23	0	C	NM_015208		9255003	+1			no_errors	ENST00000262126	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.945	A
ANKRD2	26287	genome.wustl.edu	37	10	99338020	99338020	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:99338020G>T	ENST00000307518.5	+	3	561	c.294G>T	c.(292-294)acG>acT	p.T98T	ANKRD2_ENST00000298808.5_Silent_p.T98T|ANKRD2_ENST00000455090.1_Silent_p.T71T|ANKRD2_ENST00000370655.1_Silent_p.T71T			Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 (stretch responsive muscle)	98	May mediate interaction with PML, p53/TP53 and YBX1.				muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|euchromatin (GO:0000791)|I band (GO:0031674)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	protein kinase B binding (GO:0043422)|structural constituent of muscle (GO:0008307)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)		TGCGCAAGACGTCCCTGGACC	0.657																																																	0													24.0	25.0	25.0					10																	99338020		2191	4287	6478	SO:0001819	synonymous_variant	0			AJ304805	CCDS7466.1, CCDS44468.1	10q23	2013-01-10			ENSG00000165887	ENSG00000165887		"""Ankyrin repeat domain containing"""	495	protein-coding gene	gene with protein product		610734				10873377, 15136035, 15677738	Standard	NM_001129981		Approved	ARPP	uc001knw.3	Q9GZV1	OTTHUMG00000018860	ENST00000307518.5:c.294G>T	10.37:g.99338020G>T			Q3B778|Q5T456|Q70EZ9|Q8WUD7|Q96MG0|Q9NQC9	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T98	ENST00000307518.5	37	c.294	CCDS7466.1	10																																																																																			ANKRD2	-	NULL	ENSG00000165887		0.657	ANKRD2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD2	HGNC	protein_coding		-	0.00	51	0	G			99338020	+1	tier1	-	no_errors	ENST00000307518	ensembl	human	known	74_37	silent	7.81	59	5	SNP	0.796	T
ANKRD27	84079	genome.wustl.edu	37	19	33090932	33090932	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:33090932G>T	ENST00000306065.4	-	27	2950	c.2792C>A	c.(2791-2793)cCa>cAa	p.P931Q		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	931					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					AGGCTCATCTGGTAGATCATA	0.338																																																	0													87.0	77.0	81.0					19																	33090932		2203	4300	6503	SO:0001583	missense	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2792C>A	19.37:g.33090932G>T	ENSP00000304292:p.Pro931Gln		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.P931Q	ENST00000306065.4	37	c.2792	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	G	13.97	2.394962	0.42512	.	.	ENSG00000105186	ENST00000306065	T	0.62105	0.05	6.11	5.06	0.68205	.	0.333481	0.25765	N	0.028447	T	0.55513	0.1925	L	0.60455	1.87	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.51204	-0.8735	10	0.13470	T	0.59	-8.4767	12.8199	0.57688	0.0:0.0:0.8367:0.1633	.	931	Q96NW4	ANR27_HUMAN	Q	931	ENSP00000304292:P931Q	ENSP00000304292:P931Q	P	-	2	0	ANKRD27	37782772	1.000000	0.71417	0.691000	0.30163	0.990000	0.78478	3.378000	0.52432	1.565000	0.49641	0.655000	0.94253	CCA	ANKRD27	-	NULL	ENSG00000105186		0.338	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	-	0.00	43	0	G	NM_032139		33090932	-1	tier1	-	no_errors	ENST00000306065	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.889	T
ANKRD27	84079	genome.wustl.edu	37	19	33119650	33119650	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:33119650C>T	ENST00000306065.4	-	14	1473	c.1315G>A	c.(1315-1317)Gac>Aac	p.D439N		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	439					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					TTCTCACAGTCATCGCAGAAG	0.532																																																	0													201.0	164.0	176.0					19																	33119650		2203	4300	6503	SO:0001583	missense	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1315G>A	19.37:g.33119650C>T	ENSP00000304292:p.Asp439Asn		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.D439N	ENST00000306065.4	37	c.1315	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	C	7.892	0.732576	0.15507	.	.	ENSG00000105186	ENST00000306065	T	0.61859	0.07	5.13	3.87	0.44632	Ankyrin repeat-containing domain (1);	0.176065	0.39210	N	0.001437	T	0.30885	0.0779	N	0.11064	0.09	0.80722	D	1	B	0.13145	0.007	B	0.16289	0.015	T	0.15521	-1.0434	10	0.13108	T	0.6	-34.5503	6.5908	0.22646	0.0:0.7375:0.0:0.2625	.	439	Q96NW4	ANR27_HUMAN	N	439	ENSP00000304292:D439N	ENSP00000304292:D439N	D	-	1	0	ANKRD27	37811490	0.754000	0.28360	0.969000	0.41365	0.306000	0.27790	1.360000	0.34125	2.564000	0.86499	0.650000	0.86243	GAC	ANKRD27	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000105186		0.532	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	-	0.00	82	0	C	NM_032139		33119650	-1	tier1	-	no_errors	ENST00000306065	ensembl	human	known	74_37	missense	13.04	80	12	SNP	0.890	T
ANKRD49	54851	genome.wustl.edu	37	11	94231384	94231384	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:94231384G>A	ENST00000544612.1	+	3	903	c.406G>A	c.(406-408)Gca>Aca	p.A136T	ANKRD49_ENST00000538535.1_3'UTR|ANKRD49_ENST00000544253.1_3'UTR|ANKRD49_ENST00000302755.4_Missense_Mutation_p.A136T	NM_017704.2	NP_060174.2	Q8WVL7	ANR49_HUMAN	ankyrin repeat domain 49	136					positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|urinary_tract(1)	12		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CGATGTTCATGCAGTGACTGT	0.493																																					Melanoma(113;823 1621 4352 9582 22033)												0													116.0	105.0	109.0					11																	94231384		2201	4298	6499	SO:0001583	missense	0			AF025354	CCDS8300.1	11q21	2013-01-10				ENSG00000168876		"""Ankyrin repeat domain containing"""	25970	protein-coding gene	gene with protein product						11162141	Standard	NM_017704		Approved	FLJ20189, FGIF, GBIF	uc001pew.3	Q8WVL7		ENST00000544612.1:c.406G>A	11.37:g.94231384G>A	ENSP00000440396:p.Ala136Thr		Q8NDF2|Q96JE5|Q9NXK7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A136T	ENST00000544612.1	37	c.406	CCDS8300.1	11	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841365	0.91197	.	.	ENSG00000168876	ENST00000544612;ENST00000535502;ENST00000302755	T;T;T	0.66995	-0.24;-0.24;-0.24	6.07	6.07	0.98685	Ankyrin repeat-containing domain (4);	0.047516	0.85682	D	0.000000	T	0.79215	0.4408	L	0.59436	1.845	0.80722	D	1	D	0.59767	0.986	P	0.62014	0.897	T	0.76724	-0.2854	10	0.48119	T	0.1	-20.3902	20.6593	0.99626	0.0:0.0:1.0:0.0	.	136	Q8WVL7	ANR49_HUMAN	T	136;95;136	ENSP00000440396:A136T;ENSP00000442449:A95T;ENSP00000303518:A136T	ENSP00000303518:A136T	A	+	1	0	ANKRD49	93871032	1.000000	0.71417	0.646000	0.29493	0.890000	0.51754	6.921000	0.75805	2.885000	0.99019	0.655000	0.94253	GCA	ANKRD49	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000168876		0.493	ANKRD49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD49	HGNC	protein_coding	OTTHUMT00000396314.2	-	0.00	75	0	G	NM_017704		94231384	+1	tier1	-	no_errors	ENST00000302755	ensembl	human	known	74_37	missense	8.65	95	9	SNP	1.000	A
ANPEP	290	genome.wustl.edu	37	15	90347795	90347795	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:90347795G>T	ENST00000300060.6	-	5	1264	c.951C>A	c.(949-951)gcC>gcA	p.A317A	ANPEP_ENST00000558177.1_5'Flank	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	317	Interaction with HCoV-229E.|Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TCACGTTCAGGGCATAATCGC	0.592																																					NSCLC(30;827 977 2459 19669 26125)												0													79.0	83.0	81.0					15																	90347795		2200	4299	6499	SO:0001819	synonymous_variant	0			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.951C>A	15.37:g.90347795G>T			Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.A317	ENST00000300060.6	37	c.951	CCDS10356.1	15																																																																																			ANPEP	-	pfam_Peptidase_M1_N	ENSG00000166825		0.592	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANPEP	HGNC	protein_coding	OTTHUMT00000313425.1	-	0.00	45	0	G			90347795	-1	tier1	-	no_errors	ENST00000300060	ensembl	human	known	74_37	silent	9.26	49	5	SNP	0.997	T
AP4B1	10717	genome.wustl.edu	37	1	114442519	114442519	+	Intron	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:114442519C>A	ENST00000369569.1	-	5	1395				AP4B1_ENST00000462591.1_5'Flank|AP4B1_ENST00000256658.4_Intron|AP4B1_ENST00000369566.3_Missense_Mutation_p.C281F|AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000369567.1_Intron	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGGAGCAGACACCTACCTAT	0.502																																																	0													169.0	167.0	168.0					1																	114442519		2203	4300	6503	SO:0001627	intron_variant	0			AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1114+6G>T	1.37:g.114442519C>A			B7Z4X3|Q59EJ4|Q96CL6	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold	p.C281F	ENST00000369569.1	37	c.842	CCDS865.1	1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.339554	0.60963	.	.	ENSG00000134262	ENST00000369566	T	0.13307	2.6	4.84	-6.32	0.01995	.	.	.	.	.	T	0.02418	0.0074	.	.	.	0.09310	N	1	B	0.26400	0.148	B	0.15484	0.013	T	0.45731	-0.9241	8	0.72032	D	0.01	.	6.849	0.24005	0.1121:0.3949:0.0:0.493	.	281	B7Z4X3	.	F	281	ENSP00000358579:C281F	ENSP00000358579:C281F	C	-	2	0	AP4B1	114244042	0.995000	0.38212	0.003000	0.11579	0.966000	0.64601	0.290000	0.18975	-1.069000	0.03153	0.462000	0.41574	TGT	AP4B1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold	ENSG00000134262		0.502	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP4B1	HGNC	protein_coding	OTTHUMT00000033037.1	-	0.00	44	0	C	NM_006594		114442519	-1	tier1	-	no_errors	ENST00000369566	ensembl	human	known	74_37	missense	14.55	47	8	SNP	0.000	A
API5	8539	genome.wustl.edu	37	11	43342370	43342370	+	Splice_Site	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:43342370G>C	ENST00000531273.1	+	3	370		c.e3-1		API5_ENST00000455725.2_Splice_Site|API5_ENST00000420461.2_Splice_Site|API5_ENST00000534600.1_Splice_Site|API5_ENST00000534695.1_Intron|API5_ENST00000378852.3_Splice_Site			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						ATCATGCCCAGATTCGACGTC	0.338																																					Pancreas(1;98 122 5625 20895 49453)												0													94.0	99.0	97.0					11																	43342370		2203	4300	6503	SO:0001630	splice_region_variant	0			U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.232-1G>C	11.37:g.43342370G>C			B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Splice_Site	SNP	-	e3-1	ENST00000531273.1	37	c.232-1	CCDS44572.1	11	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424246	0.83667	.	.	ENSG00000166181	ENST00000455725;ENST00000531273;ENST00000420461;ENST00000378852;ENST00000534600	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1473	0.86769	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	API5	43298946	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.667000	0.83888	2.890000	0.99128	0.650000	0.86243	.	API5	-	-	ENSG00000166181		0.338	API5-002	KNOWN	basic|CCDS	protein_coding	API5	HGNC	protein_coding	OTTHUMT00000389545.1	-	0.00	160	0	G	NM_006595	Intron	43342370	+1	tier1	-	no_errors	ENST00000531273	ensembl	human	known	74_37	splice_site	6.29	149	10	SNP	1.000	C
APOB	338	genome.wustl.edu	37	2	21230801	21230801	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:21230801G>C	ENST00000233242.1	-	26	9066	c.8939C>G	c.(8938-8940)tCc>tGc	p.S2980C		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2980					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAGTTGAGGGAGCCAGATTC	0.428																																																	0													107.0	112.0	110.0					2																	21230801		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8939C>G	2.37:g.21230801G>C	ENSP00000233242:p.Ser2980Cys		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.S2980C	ENST00000233242.1	37	c.8939	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	6.718	0.501157	0.12822	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00737	5.76	5.74	4.51	0.55191	.	0.189896	0.37178	N	0.002216	T	0.00580	0.0019	N	0.08118	0	0.80722	D	1	P	0.36495	0.556	B	0.34038	0.174	T	0.78922	-0.2013	10	0.54805	T	0.06	.	10.2568	0.43403	0.8612:0.0:0.1388:0.0	.	2980	P04114	APOB_HUMAN	C	2980	ENSP00000233242:S2980C	ENSP00000233242:S2980C	S	-	2	0	APOB	21084306	0.993000	0.37304	0.210000	0.23637	0.637000	0.38172	3.648000	0.54410	0.993000	0.38866	-0.459000	0.05422	TCC	APOB	-	NULL	ENSG00000084674		0.428	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	82	0	G			21230801	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	12.16	65	9	SNP	0.746	C
AR	367	genome.wustl.edu	37	X	66931399	66931399	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:66931399A>G	ENST00000374690.3	+	4	2565	c.2041A>G	c.(2041-2043)Att>Gtt	p.I681V	AR_ENST00000396044.3_Missense_Mutation_p.I681V|AR_ENST00000396043.2_Missense_Mutation_p.I149V	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	680	Interaction with KAT7.|Interaction with LPXN.		E -> K (in AIS). {ECO:0000269|PubMed:10221692, ECO:0000269|PubMed:8325950}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CCTGGAAGCCATTGAGCCAGG	0.532									Androgen Insensitivity Syndrome																																								0													124.0	87.0	99.0					X																	66931399		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2041A>G	X.37:g.66931399A>G	ENSP00000363822:p.Ile681Val		A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.I681V	ENST00000374690.3	37	c.2041	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	a	21.1	4.096103	0.76870	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396044;ENST00000396043	D;D;D	0.99766	-6.69;-2.42;-6.69	5.18	5.18	0.71444	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	H	0.95816	3.725	0.58432	D	0.999996	D;P	0.56521	0.976;0.919	D;P	0.72075	0.976;0.79	D	0.96920	0.9673	10	0.87932	D	0	.	11.7744	0.51977	1.0:0.0:0.0:0.0	.	149;680	F1D8N5;P10275	.;ANDR_HUMAN	V	491;681;681;149	ENSP00000363822:I681V;ENSP00000379359:I681V;ENSP00000379358:I149V	ENSP00000363822:I681V	I	+	1	0	AR	66848124	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.136000	0.94489	1.909000	0.55274	0.478000	0.44815	ATT	AR	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000169083		0.532	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1		0.00	70	0	A	NM_000044		66931399	+1			no_errors	ENST00000374690	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	G
ARHGAP33	115703	genome.wustl.edu	37	19	36269201	36269201	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:36269201G>T	ENST00000007510.4	+	4	353	c.209G>T	c.(208-210)cGt>cTt	p.R70L	ARHGAP33_ENST00000378944.5_5'UTR|ARHGAP33_ENST00000221905.1_3'UTR|ARHGAP33_ENST00000314737.5_Missense_Mutation_p.R70L			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	70	PX; atypical.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						TCTCCAGACCGTGAAGGGCCC	0.597																																																	0													60.0	61.0	61.0					19																	36269201		2203	4300	6503	SO:0001583	missense	0			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.209G>T	19.37:g.36269201G>T	ENSP00000007510:p.Arg70Leu		O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.R70L	ENST00000007510.4	37	c.209		19	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059285	0.76074	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000221905	T;T	0.11277	3.15;2.79	5.34	5.34	0.76211	.	0.088734	0.47852	D	0.000204	T	0.16854	0.0405	L	0.36672	1.1	0.41278	D	0.986893	D;D	0.56035	0.974;0.974	P;P	0.55545	0.778;0.778	T	0.00395	-1.1766	10	0.72032	D	0.01	.	10.1264	0.42652	0.0917:0.0:0.9083:0.0	.	88;70	O14559-12;O14559-11	.;.	L	70;70;88	ENSP00000007510:R70L;ENSP00000320038:R70L	ENSP00000007510:R70L	R	+	2	0	ARHGAP33	40961041	0.997000	0.39634	0.988000	0.46212	0.871000	0.50021	3.365000	0.52335	2.483000	0.83821	0.655000	0.94253	CGT	ARHGAP33	-	NULL	ENSG00000004777		0.597	ARHGAP33-201	KNOWN	basic	protein_coding	ARHGAP33	HGNC	protein_coding		-	0.00	57	0	G	NM_052948		36269201	+1	tier1	-	no_errors	ENST00000007510	ensembl	human	known	74_37	missense	6.25	58	4	SNP	0.899	T
ARHGAP6	395	genome.wustl.edu	37	X	11204402	11204402	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:11204402C>A	ENST00000337414.4	-	5	2099	c.1227G>T	c.(1225-1227)caG>caT	p.Q409H	ARHGAP6_ENST00000303025.6_Missense_Mutation_p.Q206H|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.Q234H|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.Q218H|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.Q441H|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.Q206H|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.Q409H	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	409	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						GCCTAGGGACCTGTCTGTAAA	0.413																																																	0													151.0	133.0	139.0					X																	11204402		2203	4300	6503	SO:0001583	missense	0			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1227G>T	X.37:g.11204402C>A	ENSP00000338967:p.Gln409His		B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.Q409H	ENST00000337414.4	37	c.1227	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428583	0.62844	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.66	3.83	0.44106	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.51477	D	0.000096	T	0.54367	0.1854	L	0.53671	1.685	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.997;0.988;0.999;0.992;0.999	T	0.48340	-0.9044	10	0.40728	T	0.16	.	7.9885	0.30226	0.0:0.6651:0.0:0.3349	.	218;206;409;409;409	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	H	234;206;206;409;245;409;218;441	ENSP00000438135:Q234H;ENSP00000370112:Q206H;ENSP00000302312:Q206H;ENSP00000338967:Q409H;ENSP00000370093:Q245H;ENSP00000370094:Q409H;ENSP00000389394:Q218H;ENSP00000370108:Q441H	ENSP00000302312:Q206H	Q	-	3	2	ARHGAP6	11114323	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	1.861000	0.39438	0.509000	0.28195	-0.380000	0.06706	CAG	ARHGAP6	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000047648		0.413	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	-	0.00	91	0	C	NM_013427		11204402	-1	tier1	-	no_errors	ENST00000337414	ensembl	human	known	74_37	missense	5.43	87	5	SNP	1.000	A
ARRB2	409	genome.wustl.edu	37	17	4619267	4619267	+	Splice_Site	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:4619267G>C	ENST00000269260.2	+	3	287		c.e3-1		ARRB2_ENST00000346341.2_Splice_Site|ARRB2_ENST00000570718.1_Splice_Site|ARRB2_ENST00000571206.1_5'UTR|ARRB2_ENST00000572457.1_Intron|ARRB2_ENST00000381488.6_Splice_Site|ARRB2_ENST00000575877.1_Splice_Site|ARRB2_ENST00000574954.1_Splice_Site|ARRB2_ENST00000412477.3_Splice_Site	NM_001257328.1|NM_001257330.1|NM_004313.3	NP_001244257.1|NP_001244259.1|NP_004304.1	P32121	ARRB2_HUMAN	arrestin, beta 2						adult walking behavior (GO:0007628)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell chemotaxis (GO:0060326)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|Notch signaling pathway (GO:0007219)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|receptor internalization (GO:0031623)|regulation of androgen receptor signaling pathway (GO:0060765)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	angiotensin receptor binding (GO:0031701)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|ubiquitin protein ligase binding (GO:0031625)			large_intestine(1)|liver(2)|lung(3)|prostate(1)	7						GACATCCTCAGCTCACCGTGT	0.592																																																	0													102.0	86.0	92.0					17																	4619267		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS11050.1, CCDS11051.1, CCDS58504.1, CCDS58505.1, CCDS59276.1	17p13	2008-12-11			ENSG00000141480	ENSG00000141480			712	protein-coding gene	gene with protein product	"""arrestin 3"""	107941		ARR2		7695743	Standard	NM_001257329		Approved	BARR2, DKFZp686L0365	uc002fyl.3	P32121	OTTHUMG00000090759	ENST00000269260.2:c.55-1G>C	17.37:g.4619267G>C			B4DLW0|B5B0C0|B7WPL3|D3DTK2|H0Y688|Q0Z8D3|Q2PP19|Q6ICT3|Q8N7Y2|Q9UEQ6	Splice_Site	SNP	-	e3-1	ENST00000269260.2	37	c.55-1	CCDS11050.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166675	0.78339	.	.	ENSG00000141480	ENST00000381488;ENST00000269260;ENST00000346341;ENST00000412477	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7228	0.77728	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARRB2	4566016	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.441000	0.97557	2.314000	0.78098	0.563000	0.77884	.	ARRB2	-	-	ENSG00000141480		0.592	ARRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRB2	HGNC	protein_coding	OTTHUMT00000439552.1	-	0.00	62	0	G	NM_004313	Intron	4619267	+1	tier1	-	no_errors	ENST00000269260	ensembl	human	known	74_37	splice_site	8.22	65	6	SNP	1.000	C
ARHGEF15	22899	genome.wustl.edu	37	17	8215691	8215691	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:8215691C>A	ENST00000361926.3	+	2	444	c.334C>A	c.(334-336)Cct>Act	p.P112T	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.P112T	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	112	Pro-rich.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						CTCCCCAGAACCTGCTCCCCG	0.662																																																	0													92.0	98.0	96.0					17																	8215691		2203	4300	6503	SO:0001583	missense	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.334C>A	17.37:g.8215691C>A	ENSP00000355026:p.Pro112Thr		A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.P112T	ENST00000361926.3	37	c.334	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	C	4.042	0.005434	0.07866	.	.	ENSG00000198844	ENST00000361926;ENST00000421050	T;T	0.71934	-0.61;-0.61	4.7	1.48	0.22813	.	0.746779	0.11812	N	0.527116	T	0.49474	0.1559	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.37430	-0.9706	10	0.48119	T	0.1	-3.9086	5.5959	0.17327	0.3468:0.5599:0.0:0.0934	.	112;112	D3DTR7;O94989	.;ARHGF_HUMAN	T	112	ENSP00000355026:P112T;ENSP00000412505:P112T	ENSP00000355026:P112T	P	+	1	0	ARHGEF15	8156416	0.044000	0.20184	0.714000	0.30535	0.414000	0.31173	0.426000	0.21363	0.281000	0.22233	-0.263000	0.10527	CCT	ARHGEF15	-	NULL	ENSG00000198844		0.662	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	-	0.00	123	0	C	NM_173728		8215691	+1	tier1	-	no_errors	ENST00000361926	ensembl	human	known	74_37	missense	11.59	122	16	SNP	0.205	A
ASB2	51676	genome.wustl.edu	37	14	94405565	94405565	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:94405565G>C	ENST00000315988.4	-	6	1850	c.1362C>G	c.(1360-1362)ggC>ggG	p.G454G	ASB2_ENST00000556337.1_5'Flank|RP11-131H24.4_ENST00000557646.1_5'Flank|ASB2_ENST00000555019.1_Silent_p.G502G	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	454					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		AGCAGGGCTCGCCGTCGCAGC	0.682																																																	0													29.0	29.0	29.0					14																	94405565		2201	4298	6499	SO:0001819	synonymous_variant	0			AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1362C>G	14.37:g.94405565G>C			B2RDP9|B4E166|Q9NSU5|Q9Y567	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.G454	ENST00000315988.4	37	c.1362	CCDS9915.1	14																																																																																			ASB2	-	NULL	ENSG00000100628		0.682	ASB2-001	KNOWN	basic|CCDS	protein_coding	ASB2	HGNC	protein_coding	OTTHUMT00000412845.1	-	0.00	59	0	G			94405565	-1	tier1	-	no_errors	ENST00000315988	ensembl	human	known	74_37	silent	16.44	61	12	SNP	0.993	C
ASIC1	41	genome.wustl.edu	37	12	50453616	50453616	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:50453616G>T	ENST00000447966.2	+	3	666	c.437G>T	c.(436-438)aGc>aTc	p.S146I	ASIC1_ENST00000228468.4_Missense_Mutation_p.S146I	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1	146					associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	AACTTCCGCAGCTTCAAACCC	0.562																																																	0													141.0	112.0	122.0					12																	50453616		2203	4300	6503	SO:0001583	missense	0			U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.437G>T	12.37:g.50453616G>T	ENSP00000400228:p.Ser146Ile		A3KN86|E5KBL7|P78349|Q96CV2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.S146I	ENST00000447966.2	37	c.437	CCDS44876.1	12	.	.	.	.	.	.	.	.	.	.	G	10.29	1.310428	0.23821	.	.	ENSG00000110881	ENST00000228468;ENST00000447966	T;T	0.64085	-0.08;-0.08	5.03	5.03	0.67393	.	1.414340	0.04026	N	0.300518	T	0.62636	0.2444	L	0.59436	1.845	0.80722	D	1	B;B	0.20550	0.046;0.002	B;B	0.28709	0.093;0.009	T	0.44892	-0.9298	10	0.21014	T	0.42	-17.5621	9.6839	0.40087	0.1635:0.0:0.8365:0.0	.	146;146	P78348;P78348-1	ACCN2_HUMAN;.	I	146	ENSP00000228468:S146I;ENSP00000400228:S146I	ENSP00000228468:S146I	S	+	2	0	ACCN2	48739883	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	2.559000	0.45888	2.732000	0.93576	0.655000	0.94253	AGC	ASIC1	-	pfam_Na+channel_ASC	ENSG00000110881		0.562	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC1	HGNC	protein_coding	OTTHUMT00000406004.2	-	0.00	58	0	G	NM_020039		50453616	+1	tier1	-	no_errors	ENST00000228468	ensembl	human	known	74_37	missense	10.39	69	8	SNP	1.000	T
ASXL2	55252	genome.wustl.edu	37	2	25994388	25994388	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:25994388G>C	ENST00000435504.4	-	6	718	c.425C>G	c.(424-426)tCa>tGa	p.S142*	ASXL2_ENST00000497092.1_5'UTR|ASXL2_ENST00000404843.1_5'UTR|ASXL2_ENST00000336112.4_Nonsense_Mutation_p.S114*|ASXL2_ENST00000272341.4_5'UTR			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	142	Ser-rich.				adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.S142*(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGGCAGCCTGACTGCGGGGA	0.453																																																	1	Substitution - Nonsense(1)	urinary_tract(1)											166.0	162.0	164.0					2																	25994388		2031	4179	6210	SO:0001587	stop_gained	0					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.425C>G	2.37:g.25994388G>C	ENSP00000391447:p.Ser142*		Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Nonsense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.S142*	ENST00000435504.4	37	c.425		2	.	.	.	.	.	.	.	.	.	.	G	38	7.002838	0.97994	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	.	.	.	5.66	5.66	0.87406	.	0.151709	0.46145	D	0.000317	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.2846	18.309	0.90192	0.0:0.0:1.0:0.0	.	.	.	.	X	142;114	.	ENSP00000337250:S114X	S	-	2	0	ASXL2	25847892	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	7.533000	0.81994	2.672000	0.90937	0.591000	0.81541	TCA	ASXL2	-	NULL	ENSG00000143970		0.453	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	-	0.00	91	0	G	NM_018263		25994388	-1	tier1	-	no_errors	ENST00000435504	ensembl	human	known	74_37	nonsense	12.00	110	15	SNP	1.000	C
ATAD1	84896	genome.wustl.edu	37	10	89514503	89514503	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:89514503T>C	ENST00000308448.7	-	10	1405	c.1027A>G	c.(1027-1029)Atg>Gtg	p.M343V	ATAD1_ENST00000328142.3_Missense_Mutation_p.M343V|ATAD1_ENST00000400215.3_Missense_Mutation_p.M255V	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	343					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		GATTTCTTCATCTTTTCAATT	0.358																																																	0													99.0	86.0	90.0					10																	89514503		2203	4300	6503	SO:0001583	missense	0			AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.1027A>G	10.37:g.89514503T>C	ENSP00000339017:p.Met343Val		D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.M343V	ENST00000308448.7	37	c.1027	CCDS7386.1	10	.	.	.	.	.	.	.	.	.	.	T	14.37	2.514445	0.44763	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215	D;D;D	0.97791	-4.54;-4.54;-4.54	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.89181	0.6642	N	0.00991	-1.07	0.80722	D	1	B;B	0.17852	0.024;0.011	B;B	0.15870	0.014;0.01	D	0.86843	0.2018	10	0.02654	T	1	-17.773	15.6558	0.77133	0.0:0.0:0.0:1.0	.	255;343	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	V	343;343;255	ENSP00000339017:M343V;ENSP00000339016:M343V;ENSP00000412968:M255V	ENSP00000339017:M343V	M	-	1	0	ATAD1	89504483	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.206000	0.65192	2.153000	0.67306	0.460000	0.39030	ATG	ATAD1	-	superfamily_P-loop_NTPase	ENSG00000138138		0.358	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD1	HGNC	protein_coding	OTTHUMT00000049235.1	-	0.00	73	0	T	NM_032810		89514503	-1	tier1	-	no_errors	ENST00000308448	ensembl	human	known	74_37	missense	7.14	78	6	SNP	1.000	C
ATF7IP	55729	genome.wustl.edu	37	12	14577456	14577456	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:14577456G>T	ENST00000540793.1	+	1	762	c.607G>T	c.(607-609)Gat>Tat	p.D203Y	ATF7IP_ENST00000536444.1_Missense_Mutation_p.D203Y|ATF7IP_ENST00000261168.4_Missense_Mutation_p.D203Y|ATF7IP_ENST00000543189.1_Missense_Mutation_p.D203Y|ATF7IP_ENST00000544627.1_Missense_Mutation_p.D211Y|ATF7IP_ENST00000541654.1_3'UTR			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	203					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						CTCCTCTGGTGATCCCACCTC	0.532																																																	0													157.0	123.0	134.0					12																	14577456		2203	4300	6503	SO:0001583	missense	0			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.607G>T	12.37:g.14577456G>T	ENSP00000444589:p.Asp203Tyr		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.D203Y	ENST00000540793.1	37	c.607	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203851	0.58234	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000396279;ENST00000540793	T;T;T;T;T;T	0.31247	1.79;1.7;1.69;1.79;1.5;1.79	5.85	3.93	0.45458	.	0.534882	0.17351	N	0.177404	T	0.32194	0.0821	L	0.36672	1.1	0.09310	N	0.999997	D;D;P;P;P	0.59767	0.986;0.986;0.955;0.955;0.955	P;P;B;B;P	0.54100	0.742;0.742;0.44;0.44;0.66	T	0.11275	-1.0594	10	0.66056	D	0.02	-0.3601	5.4423	0.16515	0.1835:0.0:0.6543:0.1622	.	211;203;203;203;203	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2	.;.;.;MCAF1_HUMAN;.	Y	203;203;203;211;203;203	ENSP00000261168:D203Y;ENSP00000443179:D203Y;ENSP00000445955:D203Y;ENSP00000440440:D211Y;ENSP00000379575:D203Y;ENSP00000444589:D203Y	ENSP00000261168:D203Y	D	+	1	0	ATF7IP	14468723	0.004000	0.15560	0.065000	0.19835	0.018000	0.09664	0.583000	0.23849	1.543000	0.49345	0.655000	0.94253	GAT	ATF7IP	-	NULL	ENSG00000171681		0.532	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding	OTTHUMT00000401400.1	-	0.00	100	0	G	NM_018179		14577456	+1	tier1	-	no_errors	ENST00000261168	ensembl	human	known	74_37	missense	9.45	115	12	SNP	0.178	T
ATM	472	genome.wustl.edu	37	11	108122714	108122714	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:108122714G>T	ENST00000452508.2	+	12	1947	c.1758G>T	c.(1756-1758)gaG>gaT	p.E586D	ATM_ENST00000278616.4_Missense_Mutation_p.E586D			Q13315	ATM_HUMAN	ATM serine/threonine kinase	586					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ATCAGTTAGAGGGTGACTTAG	0.338			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													92.0	100.0	97.0					11																	108122714		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1758G>T	11.37:g.108122714G>T	ENSP00000388058:p.Glu586Asp		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E586D	ENST00000452508.2	37	c.1758	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	5.492	0.275790	0.10403	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.59224	0.28;0.28;0.28	6.03	-0.873	0.10635	Armadillo-type fold (1);	0.230138	0.45867	D	0.000336	T	0.43322	0.1242	L	0.53249	1.67	0.24096	N	0.995893	B	0.13145	0.007	B	0.10450	0.005	T	0.28073	-1.0055	10	0.16420	T	0.52	.	7.4752	0.27371	0.3818:0.0:0.516:0.1023	.	586	Q13315	ATM_HUMAN	D	586	ENSP00000435747:E586D;ENSP00000278616:E586D;ENSP00000388058:E586D	ENSP00000278616:E586D	E	+	3	2	ATM	107627924	1.000000	0.71417	0.996000	0.52242	0.096000	0.18686	0.662000	0.25038	-0.047000	0.13423	-0.259000	0.10710	GAG	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.338	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1		0.00	44	0	G	NM_000051		108122714	+1			no_errors	ENST00000278616	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.982	T
ATP10D	57205	genome.wustl.edu	37	4	47562981	47562981	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:47562981G>T	ENST00000273859.3	+	14	2826	c.2557G>T	c.(2557-2559)Gaa>Taa	p.E853*	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	853					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GAGTGACACTGAATATGCAGA	0.413																																																	0													147.0	137.0	140.0					4																	47562981		2203	4300	6503	SO:0001587	stop_gained	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2557G>T	4.37:g.47562981G>T	ENSP00000273859:p.Glu853*		A2RRC8|D6REN2|Q8NC70|Q96SR3	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.E853*	ENST00000273859.3	37	c.2557	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	42	9.270416	0.99120	.	.	ENSG00000145246	ENST00000273859	.	.	.	5.11	5.11	0.69529	.	0.053482	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-21.0633	17.7053	0.88308	0.0:0.0:1.0:0.0	.	.	.	.	X	853	.	ENSP00000273859:E853X	E	+	1	0	ATP10D	47257738	1.000000	0.71417	0.936000	0.37596	0.514000	0.34195	8.412000	0.90232	2.665000	0.90641	0.655000	0.94253	GAA	ATP10D	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000145246		0.413	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	-	0.00	75	0	G	NM_020453		47562981	+1	tier1	-	no_errors	ENST00000273859	ensembl	human	known	74_37	nonsense	8.41	98	9	SNP	0.996	T
ATP13A5	344905	genome.wustl.edu	37	3	193052744	193052744	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:193052744G>T	ENST00000342358.4	-	10	1205	c.1088C>A	c.(1087-1089)cCt>cAt	p.P363H		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	363						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TGCTCGTACAGGCCCCTGCCC	0.433																																																	0													109.0	108.0	108.0					3																	193052744		2203	4300	6503	SO:0001583	missense	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1088C>A	3.37:g.193052744G>T	ENSP00000341942:p.Pro363His		Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.P363H	ENST00000342358.4	37	c.1088	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925378	0.52759	.	.	ENSG00000187527	ENST00000342358	D	0.90004	-2.6	5.87	4.99	0.66335	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.371203	0.26156	N	0.026017	D	0.90734	0.7092	L	0.48986	1.54	0.31328	N	0.685126	D	0.53312	0.959	P	0.59115	0.852	D	0.88885	0.3342	10	0.25751	T	0.34	-3.2339	14.1771	0.65549	0.0732:0.0:0.9268:0.0	.	363	Q4VNC0	AT135_HUMAN	H	363	ENSP00000341942:P363H	ENSP00000341942:P363H	P	-	2	0	ATP13A5	194535438	1.000000	0.71417	0.940000	0.37924	0.605000	0.37080	3.883000	0.56168	1.468000	0.48064	0.655000	0.94253	CCT	ATP13A5	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000187527		0.433	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	-	0.00	59	0	G	NM_198505		193052744	-1	tier1	-	no_errors	ENST00000342358	ensembl	human	known	74_37	missense	42.05	51	37	SNP	0.985	T
ATP1A3	478	genome.wustl.edu	37	19	42492163	42492163	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:42492163C>A	ENST00000302102.5	-	4	432	c.282G>T	c.(280-282)ctG>ctT	p.L94L	ATP1A3_ENST00000543770.1_Silent_p.L105L|ATP1A3_ENST00000545399.1_Silent_p.L107L|ATP1A3_ENST00000468774.2_5'Flank|ATP1A3_ENST00000602133.1_Silent_p.L64L	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	94					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						CCCCGATCCACAGCAGGATGG	0.652																																																	0													102.0	112.0	108.0					19																	42492163		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.282G>T	19.37:g.42492163C>A			B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.L94	ENST00000302102.5	37	c.282	CCDS12594.1	19																																																																																			ATP1A3	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000105409		0.652	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	ATP1A3	HGNC	protein_coding	OTTHUMT00000268107.1	-	0.00	85	0	C	NM_152296		42492163	-1	tier1	-	no_errors	ENST00000302102	ensembl	human	known	74_37	silent	11.30	102	13	SNP	1.000	A
ATP2A3	489	genome.wustl.edu	37	17	3850765	3850765	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:3850765C>A	ENST00000352011.3	-	8	1069	c.1015G>T	c.(1015-1017)Gtg>Ttg	p.V339L	ATP2A3_ENST00000397043.3_Missense_Mutation_p.V339L|ATP2A3_ENST00000397035.3_Missense_Mutation_p.V339L|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000309890.7_Missense_Mutation_p.V339L|ATP2A3_ENST00000359983.3_Missense_Mutation_p.V339L|ATP2A3_ENST00000397041.3_Missense_Mutation_p.V339L			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	339					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		AGGGTCTCCACGGACGGCAGG	0.657																																					GBM(32;29 774 15719 37967)												0													95.0	75.0	81.0					17																	3850765		2203	4300	6503	SO:0001583	missense	0				CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.1015G>T	17.37:g.3850765C>A	ENSP00000301387:p.Val339Leu		A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.V339L	ENST00000352011.3	37	c.1015	CCDS11041.1	17	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633887	0.87660	.	.	ENSG00000074370	ENST00000397043;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63;-2.63;-2.63	3.88	3.88	0.44766	ATPase, P-type, cytoplasmic domain N (1);ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.95701	0.8602	M	0.88450	2.955	0.80722	D	1	D;D;D;D;D;D	0.76494	0.996;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.73380	0.98;0.96;0.976;0.96;0.96;0.96	D	0.96497	0.9368	10	0.87932	D	0	.	16.1086	0.81244	0.0:1.0:0.0:0.0	.	339;339;339;339;339;339	Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;AT2A3_HUMAN;.;.;.	L	339	ENSP00000380236:V339L;ENSP00000301387:V339L;ENSP00000353072:V339L;ENSP00000380234:V339L;ENSP00000312577:V339L;ENSP00000380229:V339L	ENSP00000312577:V339L	V	-	1	0	ATP2A3	3797514	1.000000	0.71417	0.951000	0.38953	0.863000	0.49368	7.604000	0.82830	2.428000	0.82296	0.563000	0.77884	GTG	ATP2A3	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000074370		0.657	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	ATP2A3	HGNC	protein_coding	OTTHUMT00000438401.1	-	0.00	67	0	C	NM_174953		3850765	-1	tier1	-	no_errors	ENST00000359983	ensembl	human	known	74_37	missense	9.86	64	7	SNP	1.000	A
ATP2B1	490	genome.wustl.edu	37	12	89998032	89998032	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:89998032C>T	ENST00000428670.3	-	16	2990	c.2534G>A	c.(2533-2535)gGa>gAa	p.G845E	ATP2B1_ENST00000348959.3_Missense_Mutation_p.G845E|ATP2B1_ENST00000359142.3_Missense_Mutation_p.G845E|ATP2B1_ENST00000393164.2_Missense_Mutation_p.G588E|ATP2B1_ENST00000261173.2_Missense_Mutation_p.G845E			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	845					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						GACATTTCGTCCCCACATAAC	0.388																																																	0													122.0	114.0	117.0					12																	89998032		2203	4300	6503	SO:0001583	missense	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2534G>A	12.37:g.89998032C>T	ENSP00000392043:p.Gly845Glu		Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.G845E	ENST00000428670.3	37	c.2534	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914403	0.92178	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	D;D;D;D;D	0.98028	-4.67;-4.67;-4.67;-4.67;-4.53	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.99515	0.9827	H	0.99884	4.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.97620	1.0135	10	0.87932	D	0	-20.5297	20.3046	0.98621	0.0:1.0:0.0:0.0	.	845;845;845	P20020-3;P20020-2;P20020-6	.;.;.	E	845;845;845;845;588	ENSP00000261173:G845E;ENSP00000343599:G845E;ENSP00000352054:G845E;ENSP00000392043:G845E;ENSP00000376869:G588E	ENSP00000261173:G845E	G	-	2	0	ATP2B1	88522163	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.878000	0.98634	0.650000	0.86243	GGA	ATP2B1	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000070961		0.388	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406653.1	-	0.00	68	0	C	NM_001682		89998032	-1	tier1	-	no_errors	ENST00000261173	ensembl	human	known	74_37	missense	10.75	83	10	SNP	1.000	T
ATP2B4	493	genome.wustl.edu	37	1	203669405	203669405	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:203669405G>C	ENST00000357681.5	+	5	1844	c.721G>C	c.(721-723)Ggg>Cgg	p.G241R	ATP2B4_ENST00000341360.2_Missense_Mutation_p.G241R|ATP2B4_ENST00000391954.2_Missense_Mutation_p.G241R|ATP2B4_ENST00000367219.3_Missense_Mutation_p.G241R|ATP2B4_ENST00000367218.3_Missense_Mutation_p.G241R	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	241					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CTCTCTGACAGGGGAATCTGA	0.517																																																	0													107.0	102.0	104.0					1																	203669405		2203	4300	6503	SO:0001583	missense	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.721G>C	1.37:g.203669405G>C	ENSP00000350310:p.Gly241Arg		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.G241R	ENST00000357681.5	37	c.721	CCDS1440.1	1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536199	0.85812	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.99311	-5.73;-5.73;-5.73;-5.73;-5.73	5.03	5.03	0.67393	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.51477	D	0.000095	D	0.99704	0.9887	H	0.98466	4.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.97158	0.9836	10	0.87932	D	0	-25.8455	18.3362	0.90288	0.0:0.0:1.0:0.0	.	241;241;241	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	R	241	ENSP00000350310:G241R;ENSP00000356187:G241R;ENSP00000356188:G241R;ENSP00000375816:G241R;ENSP00000340930:G241R	ENSP00000340930:G241R	G	+	1	0	ATP2B4	201936028	1.000000	0.71417	0.769000	0.31535	0.666000	0.39218	9.807000	0.99171	2.497000	0.84241	0.655000	0.94253	GGG	ATP2B4	-	pfam_ATPase_P-typ_transduc_dom_A,prints_Cation_transp_P_typ_ATPase,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000058668		0.517	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	-	0.00	60	0	G	NM_001001396		203669405	+1	tier1	-	no_errors	ENST00000357681	ensembl	human	known	74_37	missense	19.74	61	15	SNP	1.000	C
ATXN2	6311	genome.wustl.edu	37	12	111990213	111990213	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:111990213C>G	ENST00000377617.3	-	5	1083	c.922G>C	c.(922-924)Gca>Cca	p.A308P	ATXN2_ENST00000542287.2_Missense_Mutation_p.A43P|ATXN2_ENST00000608853.1_Missense_Mutation_p.A148P|ATXN2_ENST00000389153.4_Missense_Mutation_p.A43P|ATXN2_ENST00000535949.1_Missense_Mutation_p.A19P|ATXN2_ENST00000549455.1_Intron|ATXN2_ENST00000550104.1_Missense_Mutation_p.A308P	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	308					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						TTCTCATGTGCGGCATCAAGT	0.348																																																	0													78.0	78.0	78.0					12																	111990213		2203	4300	6503	SO:0001583	missense	0			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.922G>C	12.37:g.111990213C>G	ENSP00000366843:p.Ala308Pro		A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.A308P	ENST00000377617.3	37	c.922	CCDS31902.1	12	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650990	0.87958	.	.	ENSG00000204842	ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949;ENST00000548492	T;T;T;T;T	0.70631	0.69;-0.45;-0.5;0.69;0.69	5.54	5.54	0.83059	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	D	0.82393	0.5027	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.79553	-0.1756	10	0.36615	T	0.2	-10.8382	19.8254	0.96616	0.0:1.0:0.0:0.0	.	43;308;19;43	B3KT59;Q99700;Q24JQ7;F8VQP2	.;ATX2_HUMAN;.;.	P	43;308;308;43;19;51	ENSP00000373805:A43P;ENSP00000366843:A308P;ENSP00000446576:A308P;ENSP00000445583:A43P;ENSP00000449566:A51P	ENSP00000366843:A308P	A	-	1	0	ATXN2	110474596	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.105000	0.77031	2.754000	0.94517	0.655000	0.94253	GCA	ATXN2	-	superfamily_LSM_dom	ENSG00000204842		0.348	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	-	0.00	82	0	C	NM_002973		111990213	-1	tier1	-	no_errors	ENST00000377617	ensembl	human	known	74_37	missense	5.45	104	6	SNP	1.000	G
BABAM1	29086	genome.wustl.edu	37	19	17379661	17379661	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:17379661G>T	ENST00000359435.4	+	2	239	c.46G>T	c.(46-48)Gaa>Taa	p.E16*	BABAM1_ENST00000448635.2_3'UTR|BABAM1_ENST00000598188.1_Nonsense_Mutation_p.E16*|CTD-2278I10.6_ENST00000596542.1_5'UTR|BABAM1_ENST00000595632.1_Nonsense_Mutation_p.E16*|BABAM1_ENST00000447614.2_Nonsense_Mutation_p.E16*|BABAM1_ENST00000601043.1_Nonsense_Mutation_p.E16*	NM_001033549.1	NP_001028721.1	Q9NWV8	BABA1_HUMAN	BRISC and BRCA1 A complex member 1	16					chromatin modification (GO:0016568)|double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5						GGAGGAGGAGGAAGAGGAGCA	0.657																																																	0													11.0	15.0	14.0					19																	17379661		2028	4160	6188	SO:0001587	stop_gained	0			AK000578	CCDS46012.1, CCDS74310.1	19p13.11	2011-02-21	2011-02-21	2011-01-31	ENSG00000105393	ENSG00000105393			25008	protein-coding gene	gene with protein product	"""Mediator of Rap80 Interactions and Targeting 40 kD"", ""new component of the BRCA1 A complex"""	612766	"""chromosome 19 open reading frame 62"""	C19orf62		11042152	Standard	NM_001288756		Approved	FLJ20571, HSPC142, NBA1, MERIT40	uc002nfv.3	Q9NWV8		ENST00000359435.4:c.46G>T	19.37:g.17379661G>T	ENSP00000352408:p.Glu16*		A8MQT0|B4DRY9|B4DVR1|Q6FIA0|Q9P018	Nonsense_Mutation	SNP	NULL	p.E16*	ENST00000359435.4	37	c.46	CCDS46012.1	19	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880875	0.91740	.	.	ENSG00000105393	ENST00000359435;ENST00000447614;ENST00000448635	.	.	.	4.56	3.51	0.40186	.	0.244420	0.29246	N	0.012720	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-11.1345	12.7491	0.57298	0.0:0.1665:0.8335:0.0	.	.	.	.	X	16	.	ENSP00000352408:E16X	E	+	1	0	BABAM1	17240661	1.000000	0.71417	0.846000	0.33378	0.565000	0.35776	5.089000	0.64492	1.265000	0.44215	0.655000	0.94253	GAA	BABAM1	-	NULL	ENSG00000105393		0.657	BABAM1-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	BABAM1	HGNC	protein_coding	OTTHUMT00000463471.1	-	0.00	90	0	G	NM_014173		17379661	+1	tier1	-	no_errors	ENST00000359435	ensembl	human	known	74_37	nonsense	10.38	95	11	SNP	1.000	T
BAI1	575	genome.wustl.edu	37	8	143618431	143618431	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:143618431C>T	ENST00000517894.1	+	26	4548	c.3654C>T	c.(3652-3654)caC>caT	p.H1218H	BAI1_ENST00000323289.5_Silent_p.H1218H			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1218					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGAACGGCCACGCCCAGCTCA	0.687																																																	0													25.0	33.0	31.0					8																	143618431		2083	4202	6285	SO:0001819	synonymous_variant	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3654C>T	8.37:g.143618431C>T				Silent	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.H1218	ENST00000517894.1	37	c.3654		8																																																																																			BAI1	-	NULL	ENSG00000181790		0.687	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	-	0.00	142	0	C	NM_001702		143618431	+1	tier1	-	no_errors	ENST00000323289	ensembl	human	known	74_37	silent	5.29	197	11	SNP	0.704	T
BAIAP2	10458	genome.wustl.edu	37	17	79079945	79079945	+	Splice_Site	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:79079945A>T	ENST00000321300.6	+	11	1429	c.1336A>T	c.(1336-1338)Agc>Tgc	p.S446C	BAIAP2_ENST00000321280.7_Splice_Site_p.S446C|BAIAP2_ENST00000575245.1_Splice_Site_p.S479C|BAIAP2_ENST00000392411.3_Splice_Site_p.S368C|BAIAP2_ENST00000416299.2_Splice_Site_p.S309C|BAIAP2_ENST00000428708.2_Splice_Site_p.S446C|BAIAP2_ENST00000435091.3_Splice_Site_p.S446C|BAIAP2_ENST00000575712.1_Splice_Site_p.S446C	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	446					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GCTGCACATGAGGTGAGCTCT	0.637																																																	0													57.0	49.0	51.0					17																	79079945		2187	4289	6476	SO:0001630	splice_region_variant	0			AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1337+1A>T	17.37:g.79079945A>T			O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.S446C	ENST00000321300.6	37	c.1336	CCDS11775.1	17	.	.	.	.	.	.	.	.	.	.	A	17.56	3.419356	0.62622	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411;ENST00000416299	T;T;T;T;T;T	0.36520	1.63;1.7;1.26;1.26;1.69;1.25	4.97	4.97	0.65823	.	0.114408	0.64402	U	0.000017	T	0.48150	0.1484	L	0.52905	1.665	0.54753	D	0.999987	D;D;D;D;P;D;D;P;P	0.71674	0.99;0.99;0.998;0.966;0.956;0.989;0.98;0.956;0.956	P;P;P;P;P;P;P;P;P	0.55785	0.619;0.708;0.784;0.695;0.774;0.774;0.774;0.774;0.774	T	0.51896	-0.8647	10	0.87932	D	0	.	13.6132	0.62092	1.0:0.0:0.0:0.0	.	309;368;447;446;446;446;446;447;446	B4DWA1;F8W878;B3KPV9;Q9UQB8;Q9UQB8-2;Q9UQB8-3;Q9UQB8-5;Q9UQB8-6;Q9UQB8-4	.;.;.;BAIP2_HUMAN;.;.;.;.;.	C	446;446;446;446;368;309	ENSP00000316338:S446C;ENSP00000401022:S446C;ENSP00000413069:S446C;ENSP00000315685:S446C;ENSP00000376211:S368C;ENSP00000391837:S309C	ENSP00000315685:S446C	S	+	1	0	BAIAP2	76694540	1.000000	0.71417	1.000000	0.80357	0.194000	0.23727	2.848000	0.48278	1.884000	0.54569	0.260000	0.18958	AGC	BAIAP2	-	NULL	ENSG00000175866		0.637	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	BAIAP2	HGNC	protein_coding	OTTHUMT00000438553.1	-	0.00	45	0	A		Missense_Mutation	79079945	+1	tier1	-	no_errors	ENST00000321300	ensembl	human	known	74_37	missense	7.94	58	5	SNP	1.000	T
BANP	54971	genome.wustl.edu	37	16	88052217	88052217	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:88052217G>T	ENST00000393207.1	+	7	1036	c.815G>T	c.(814-816)gGg>gTg	p.G272V	BANP_ENST00000538234.1_Missense_Mutation_p.G280V|BANP_ENST00000355163.5_Missense_Mutation_p.G247V|BANP_ENST00000355022.4_Missense_Mutation_p.G241V|BANP_ENST00000479780.2_Missense_Mutation_p.G241V|BANP_ENST00000393208.2_Missense_Mutation_p.G241V|BANP_ENST00000286122.7_Missense_Mutation_p.G272V	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	272	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.|Interaction with CUX1 and HDAC1. {ECO:0000250}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		AACCTCTCGGGGCAGGGCAAG	0.662																																																	0													35.0	23.0	27.0					16																	88052217		2192	4299	6491	SO:0001583	missense	0			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.815G>T	16.37:g.88052217G>T	ENSP00000376902:p.Gly272Val		A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	pfam_BEN_domain	p.G272V	ENST00000393207.1	37	c.815	CCDS54054.1	16	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016851	0.93404	.	.	ENSG00000172530	ENST00000286122;ENST00000355163;ENST00000289484;ENST00000479780;ENST00000393208;ENST00000540932;ENST00000355022;ENST00000538234;ENST00000393207	T;T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32;0.32	5.2	5.2	0.72013	BEN domain (2);	0.000000	0.85682	D	0.000000	T	0.66197	0.2765	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;0.998;1.0	T	0.64118	-0.6482	9	.	.	.	.	17.7152	0.88335	0.0:0.0:1.0:0.0	.	280;247;241;272;241;241	B4DE54;B4DNJ9;B2RCF7;Q8N9N5;Q8N9N5-2;Q8N9N5-4	.;.;.;BANP_HUMAN;.;.	V	272;247;237;241;241;241;241;280;272	ENSP00000286122:G272V;ENSP00000347290:G247V;ENSP00000432508:G241V;ENSP00000376903:G241V;ENSP00000347125:G241V;ENSP00000444352:G280V;ENSP00000376902:G272V	.	G	+	2	0	BANP	86609718	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	9.200000	0.95010	2.405000	0.81733	0.561000	0.74099	GGG	BANP	-	pfam_BEN_domain	ENSG00000172530		0.662	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	HGNC	protein_coding	OTTHUMT00000269166.1	-	0.00	73	0	G	NM_017869		88052217	+1	tier1	-	no_errors	ENST00000286122	ensembl	human	known	74_37	missense	7.69	60	5	SNP	1.000	T
BBS7	55212	genome.wustl.edu	37	4	122774232	122774232	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:122774232C>A	ENST00000264499.4	-	8	911	c.728G>T	c.(727-729)tGt>tTt	p.C243F	BBS7_ENST00000506636.1_Missense_Mutation_p.C243F	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	243					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						GCTGTCAATACACAAAATACC	0.333									Bardet-Biedl syndrome																																								0													106.0	93.0	97.0					4																	122774232		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.728G>T	4.37:g.122774232C>A	ENSP00000264499:p.Cys243Phe		Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_7_prot	p.C243F	ENST00000264499.4	37	c.728	CCDS3724.1	4	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397573	0.83120	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	D;D	0.91996	-2.95;-2.95	5.26	5.26	0.73747	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96288	0.8789	M	0.82517	2.595	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	D	0.96766	0.9565	10	0.87932	D	0	-12.4823	18.8507	0.92227	0.0:1.0:0.0:0.0	.	243	Q8IWZ6	BBS7_HUMAN	F	243	ENSP00000264499:C243F;ENSP00000423626:C243F	ENSP00000264499:C243F	C	-	2	0	BBS7	122993682	1.000000	0.71417	0.985000	0.45067	0.983000	0.72400	7.563000	0.82314	2.460000	0.83146	0.585000	0.79938	TGT	BBS7	-	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_7_prot	ENSG00000138686		0.333	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS7	HGNC	protein_coding	OTTHUMT00000256716.1	-	0.00	77	0	C			122774232	-1	tier1	-	no_errors	ENST00000264499	ensembl	human	known	74_37	missense	11.69	68	9	SNP	1.000	A
BCL3	602	genome.wustl.edu	37	19	45262823	45262823	+	Missense_Mutation	SNP	G	G	A	rs373245726		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:45262823G>A	ENST00000164227.5	+	9	1560	c.1316G>A	c.(1315-1317)cGa>cAa	p.R439Q		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	439	Pro/Ser-rich.				antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				GGGGTCCTCCGAGGCCCTGGC	0.692			T	IGH@	CLL																																			Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	0								G	GLN/ARG	0,4406		0,0,2203	48.0	58.0	54.0		1316	4.0	1.0	19		54	1,8595	1.2+/-3.3	0,1,4297	no	missense	BCL3	NM_005178.4	43	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	439/455	45262823	1,13001	2203	4298	6501	SO:0001583	missense	0			M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.1316G>A	19.37:g.45262823G>A	ENSP00000164227:p.Arg439Gln			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R439Q	ENST00000164227.5	37	c.1316	CCDS12642.2	19	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334366	0.60853	0.0	1.16E-4	ENSG00000069399	ENST00000164227	T	0.39056	1.1	3.97	3.97	0.46021	.	0.415530	0.17875	N	0.159055	T	0.46600	0.1401	L	0.27053	0.805	0.28057	N	0.933112	D	0.69078	0.997	D	0.67725	0.953	T	0.30621	-0.9972	10	0.87932	D	0	-1.8135	8.9013	0.35497	0.0:0.0:0.7774:0.2226	.	439	P20749	BCL3_HUMAN	Q	439	ENSP00000164227:R439Q	ENSP00000164227:R439Q	R	+	2	0	BCL3	49954663	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.237000	0.32695	2.022000	0.59522	0.491000	0.48974	CGA	BCL3	-	NULL	ENSG00000069399		0.692	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL3	HGNC	protein_coding	OTTHUMT00000322976.1	-	0.00	85	0	G	NM_005178		45262823	+1	tier1	-	no_errors	ENST00000164227	ensembl	human	known	74_37	missense	7.14	117	9	SNP	1.000	A
BEGAIN	57596	genome.wustl.edu	37	14	101005081	101005081	+	Missense_Mutation	SNP	C	C	A	rs199676704		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:101005081C>A	ENST00000355173.2	-	7	1078	c.1007G>T	c.(1006-1008)cGc>cTc	p.R336L	BEGAIN_ENST00000443071.2_Missense_Mutation_p.R336L|CTD-2062F14.3_ENST00000553301.1_lincRNA|BEGAIN_ENST00000556751.1_Missense_Mutation_p.R272L	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	336						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				GGGTGGCTTGCGGTCGAAGAG	0.711																																					NSCLC(159;1889 2010 9965 27479 40101)												0													28.0	23.0	24.0					14																	101005081		2155	4251	6406	SO:0001583	missense	0			BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.1007G>T	14.37:g.101005081C>A	ENSP00000347301:p.Arg336Leu		Q9NPU3|Q9P282	Missense_Mutation	SNP	superfamily_Prefoldin	p.R336L	ENST00000355173.2	37	c.1007	CCDS9962.1	14	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471741	0.43942	.	.	ENSG00000183092	ENST00000355173;ENST00000556751;ENST00000443071	.	.	.	4.47	3.57	0.40892	.	0.255751	0.38326	N	0.001728	T	0.74489	0.3723	M	0.64997	1.995	0.49582	D	0.999808	D	0.89917	1.0	D	0.87578	0.998	T	0.75434	-0.3319	9	0.62326	D	0.03	.	11.8914	0.52630	0.0:0.9142:0.0:0.0858	.	336	Q9BUH8	BEGIN_HUMAN	L	336;272;336	.	ENSP00000347301:R336L	R	-	2	0	BEGAIN	100074834	0.978000	0.34361	0.954000	0.39281	0.038000	0.13279	1.773000	0.38563	0.868000	0.35678	0.462000	0.41574	CGC	BEGAIN	-	NULL	ENSG00000183092		0.711	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BEGAIN	HGNC	protein_coding	OTTHUMT00000414329.1	-	0.00	22	0	C	NM_020836		101005081	-1	tier1	-	no_errors	ENST00000355173	ensembl	human	known	74_37	missense	21.74	17	5	SNP	0.824	A
BIRC8	112401	genome.wustl.edu	37	19	53792962	53792962	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:53792962C>A	ENST00000426466.1	-	1	1913	c.666G>T	c.(664-666)atG>atT	p.M222I		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	222					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		CCGCGCTGCACATGGGACATC	0.393																																																	0													172.0	167.0	169.0					19																	53792962		2203	4300	6503	SO:0001583	missense	0			AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.666G>T	19.37:g.53792962C>A	ENSP00000412957:p.Met222Ile		Q6IPY1|Q96RW5	Missense_Mutation	SNP	pfam_BIR,smart_BIR,smart_Znf_RING,pfscan_BIR,pfscan_Znf_RING	p.M222I	ENST00000426466.1	37	c.666	CCDS12863.1	19	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.329991	0.01298	.	.	ENSG00000163098	ENST00000426466	T	0.74947	-0.89	0.502	0.502	0.16932	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	.	.	.	.	T	0.36193	0.0958	N	0.01019	-1.045	0.27591	N	0.949267	B	0.23185	0.081	B	0.26094	0.066	T	0.45877	-0.9231	9	0.02654	T	1	-9.4018	4.3473	0.11139	1.0E-4:0.5653:0.4346:0.0	.	222	Q96P09	BIRC8_HUMAN	I	222	ENSP00000412957:M222I	ENSP00000412957:M222I	M	-	3	0	BIRC8	58484774	1.000000	0.71417	0.703000	0.30354	0.189000	0.23516	1.152000	0.31663	0.578000	0.29487	0.420000	0.28162	ATG	BIRC8	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000163098		0.393	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC8	HGNC	protein_coding	OTTHUMT00000464357.1	-	0.00	44	0	C	NM_033341		53792962	-1	tier1	-	no_errors	ENST00000426466	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	A
BPIFB2	80341	genome.wustl.edu	37	20	31606541	31606541	+	Silent	SNP	C	C	A	rs373815604		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:31606541C>A	ENST00000170150.3	+	9	963	c.768C>A	c.(766-768)acC>acA	p.T256T		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	256						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										CCATGGCCACCGTGGGCCTCT	0.637																																																	0													87.0	86.0	86.0					20																	31606541		2203	4300	6503	SO:0001819	synonymous_variant	0			AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.768C>A	20.37:g.31606541C>A			Q6UWN3|Q6ZME0|Q8NFQ7	Silent	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	p.T256	ENST00000170150.3	37	c.768	CCDS13210.1	20																																																																																			BPIFB2	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	ENSG00000078898		0.637	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB2	HGNC	protein_coding	OTTHUMT00000078652.2	-	0.00	27	0	C	NM_025227		31606541	+1	tier1	-	no_errors	ENST00000170150	ensembl	human	known	74_37	silent	20.00	32	8	SNP	0.017	A
BPIFA2	140683	genome.wustl.edu	37	20	31767424	31767424	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:31767424C>A	ENST00000253362.2	+	7	806	c.660C>A	c.(658-660)atC>atA	p.I220I	BPIFA2_ENST00000354932.5_Silent_p.I220I			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	220						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										GTCCACTGATCCGCATCTTCA	0.517																																																	0													177.0	163.0	168.0					20																	31767424		2203	4300	6503	SO:0001819	synonymous_variant	0			AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.660C>A	20.37:g.31767424C>A			Q9BQQ0	Silent	SNP	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	p.I220	ENST00000253362.2	37	c.660	CCDS13214.1	20																																																																																			BPIFA2	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	ENSG00000131050		0.517	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BPIFA2	HGNC	protein_coding	OTTHUMT00000257117.1	-	0.00	59	0	C	NM_080574		31767424	+1	tier1	-	no_errors	ENST00000253362	ensembl	human	known	74_37	silent	14.29	59	10	SNP	0.001	A
BRCA1	672	genome.wustl.edu	37	17	41247865	41247865	+	Missense_Mutation	SNP	T	T	G	rs80357745|rs397509305|rs397509306		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:41247865T>G	ENST00000357654.3	-	9	786	c.668A>C	c.(667-669)aAg>aCg	p.K223T	BRCA1_ENST00000468300.1_Missense_Mutation_p.K223T|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000352993.3_Missense_Mutation_p.K223T|BRCA1_ENST00000471181.2_Missense_Mutation_p.K223T|BRCA1_ENST00000493795.1_Missense_Mutation_p.K176T|BRCA1_ENST00000491747.2_Missense_Mutation_p.K223T|BRCA1_ENST00000346315.3_Missense_Mutation_p.K223T|BRCA1_ENST00000354071.3_Missense_Mutation_p.K223T	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	223					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GCCATTACCCTTTTTTGCAGA	0.398			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0			GRCh37	CD057384	BRCA1	D	rs80357745						127.0	104.0	112.0					17																	41247865		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.668A>C	17.37:g.41247865T>G	ENSP00000350283:p.Lys223Thr		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,prints_BRCA1,pfscan_BRCT_dom,pfscan_Znf_RING	p.K223T	ENST00000357654.3	37	c.668	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	T	13.26	2.182885	0.38511	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000493919;ENST00000470026;ENST00000477152;ENST00000494123;ENST00000476777	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97209	-2.29;-2.41;-2.27;-2.4;-2.37;-2.85;-2.3;-2.42;-2.43;-2.22;-2.46;-2.86;-4.29;-2.54;-2.2	4.57	4.57	0.56435	.	0.593557	0.15208	N	0.274643	D	0.97695	0.9244	M	0.62723	1.935	0.80722	D	1	D;D;P;P;D;D;P;P;P	0.67145	0.988;0.993;0.94;0.816;0.996;0.981;0.816;0.787;0.884	P;D;P;B;D;D;B;B;P	0.75484	0.728;0.968;0.561;0.382;0.986;0.954;0.311;0.413;0.509	D	0.97244	0.9893	10	0.72032	D	0.01	.	10.5057	0.44832	0.0:0.0:0.0:1.0	.	176;222;223;223;223;223;223;223;223	B4DES0;E7ETR2;E7EMP0;Q5YLB2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2	.;.;.;.;.;.;.;BRCA1_HUMAN;.	T	223;223;223;223;223;223;176;223;176;222;222;176;223;197;223;222	ENSP00000350283:K223T;ENSP00000326002:K223T;ENSP00000312236:K223T;ENSP00000246907:K223T;ENSP00000417148:K223T;ENSP00000377294:K176T;ENSP00000418960:K223T;ENSP00000418775:K176T;ENSP00000420705:K222T;ENSP00000420412:K222T;ENSP00000418819:K176T;ENSP00000419274:K223T;ENSP00000419988:K197T;ENSP00000419103:K223T;ENSP00000417554:K222T	ENSP00000246907:K223T	K	-	2	0	BRCA1	38501391	0.034000	0.19679	0.790000	0.31976	0.977000	0.68977	0.991000	0.29654	2.049000	0.60858	0.379000	0.24179	AAG	BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.398	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	-	0.00	64	0	T	NM_007294		41247865	-1	tier1	-	no_errors	ENST00000471181	ensembl	human	known	74_37	missense	8.33	99	9	SNP	0.941	G
MALRD1	340895	genome.wustl.edu	37	10	19856477	19856477	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:19856477T>G	ENST00000454679.2	+	19	3623	c.3623T>G	c.(3622-3624)gTg>gGg	p.V1208G	C10orf112_ENST00000455457.2_Missense_Mutation_p.V36G			Q5VYJ5	MALR1_HUMAN		1208	MAM 6. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						GTGTGGTCAGTGATTGGAAAT	0.383																																																	0																																										SO:0001583	missense	0																														ENST00000454679.2:c.3623T>G	10.37:g.19856477T>G	ENSP00000412763:p.Val1208Gly		B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt,prints_MAM_dom	p.V1208G	ENST00000454679.2	37	c.3623		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.632|4.632	0.117393|0.117393	0.08881|0.08881	.|.	.|.	ENSG00000204740|ENSG00000204740	ENST00000377265|ENST00000377266;ENST00000454679;ENST00000455457	T|T;T;T	0.02258|0.02236	4.37|4.38;4.38;4.38	5.05|5.05	1.36|1.36	0.22044|0.22044	.|.	.|1.834250	.|0.02497	.|N	.|0.090082	T|T	0.02304|0.02304	0.0071|0.0071	.|.	.|.	.|.	0.32719|0.32719	N|N	0.510512|0.510512	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.38329|0.38329	-0.9666|-0.9666	5|6	.|.	.|.	.|.	.|.	3.7487|3.7487	0.08558|0.08558	0.1704:0.3782:0.0:0.4513|0.1704:0.3782:0.0:0.4513	.|.	.|.	.|.	.|.	R|G	192|1221;1208;36	ENSP00000366476:S192R|ENSP00000366477:V1221G;ENSP00000412763:V1208G;ENSP00000391253:V36G	.|.	S|V	+|+	3|2	2|0	C10orf112|C10orf112	19896483|19896483	0.116000|0.116000	0.22171|0.22171	0.625000|0.625000	0.29200|0.29200	0.361000|0.361000	0.29550|0.29550	0.506000|0.506000	0.22658|0.22658	0.070000|0.070000	0.16634|0.16634	-0.380000|-0.380000	0.06706|0.06706	AGT|GTG	C10orf112	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000204740		0.383	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		-	0.00	113	0	T			19856477	+1	tier1	-	no_errors	ENST00000454679	ensembl	human	known	74_37	missense	14.42	89	15	SNP	0.796	G
CCDC7	79741	genome.wustl.edu	37	10	32912689	32912689	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:32912689G>T	ENST00000375028.3	+	2	99	c.29G>T	c.(28-30)gGc>gTc	p.G10V	C10orf68_ENST00000375025.4_Intron|C10orf68_ENST00000375030.2_Intron			Q9H943	CJ068_HUMAN		0										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						tctggcgagggcctcagggag	0.502																																																	0																																										SO:0001583	missense	0																														ENST00000375028.3:c.29G>T	10.37:g.32912689G>T	ENSP00000364168:p.Gly10Val		B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	NULL	p.G10V	ENST00000375028.3	37	c.29		10	.	.	.	.	.	.	.	.	.	.	.	2.863	-0.235802	0.05944	.	.	ENSG00000150076	ENST00000375028	T	0.29917	1.55	0.225	0.225	0.15325	.	.	.	.	.	T	0.47600	0.1454	.	.	.	0.20703	N	0.999863	D	0.76494	0.999	D	0.76575	0.988	T	0.25363	-1.0134	7	0.52906	T	0.07	.	.	.	.	.	10	A2A3B4	.	V	10	ENSP00000364168:G10V	ENSP00000364168:G10V	G	+	2	0	C10orf68	32952695	0.154000	0.22792	0.292000	0.24919	0.305000	0.27757	0.364000	0.20325	0.300000	0.22699	0.305000	0.20034	GGC	C10orf68	-	NULL	ENSG00000150076		0.502	C10orf68-002	PUTATIVE	basic|appris_candidate	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000314000.2	-	0.00	31	0	G			32912689	+1	tier1	-	no_errors	ENST00000375028	ensembl	human	putative	74_37	missense	10.81	33	4	SNP	0.378	T
C12orf66	144577	genome.wustl.edu	37	12	64609507	64609507	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:64609507C>T	ENST00000398055.3	-	2	525	c.472G>A	c.(472-474)Gaa>Aaa	p.E158K	C12orf66_ENST00000311915.8_Missense_Mutation_p.E158K|C12orf66_ENST00000544871.1_Missense_Mutation_p.E105K	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	158										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						ACGAGCTCTTCAGCATTGATG	0.507																																																	0													76.0	73.0	74.0					12																	64609507		1989	4183	6172	SO:0001583	missense	0				CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.472G>A	12.37:g.64609507C>T	ENSP00000381132:p.Glu158Lys		C9JX54|Q8IYA0	Missense_Mutation	SNP	pfam_DUF2003	p.E158K	ENST00000398055.3	37	c.472	CCDS41803.1	12	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557164	0.65425	.	.	ENSG00000174206	ENST00000311915;ENST00000544871;ENST00000398055	T;T;T	0.39406	1.08;1.08;1.08	5.95	5.95	0.96441	.	0.044256	0.85682	D	0.000000	T	0.59459	0.2195	L	0.60455	1.87	0.80722	D	1	D;D	0.59767	0.982;0.986	P;P	0.58970	0.831;0.849	T	0.52675	-0.8544	9	.	.	.	-5.7342	20.3719	0.98893	0.0:1.0:0.0:0.0	.	105;158	F5H2Q3;Q96MD2	.;CL066_HUMAN	K	158;105;158	ENSP00000311486:E158K;ENSP00000445481:E105K;ENSP00000381132:E158K	.	E	-	1	0	C12orf66	62895774	1.000000	0.71417	0.865000	0.33974	0.732000	0.41865	7.518000	0.81795	2.826000	0.97356	0.491000	0.48974	GAA	C12orf66	-	pfam_DUF2003	ENSG00000174206		0.507	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf66	HGNC	protein_coding	OTTHUMT00000400921.1	-	0.00	70	0	C	NM_152440		64609507	-1	tier1	-	no_errors	ENST00000398055	ensembl	human	known	74_37	missense	5.81	81	5	SNP	1.000	T
C12orf74	338809	genome.wustl.edu	37	12	93100603	93100605	+	Missense_Mutation	TNP	TGG	TGG	ATT			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T|G|G	T|G|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:93100603_93100605TGG>ATT	ENST00000397833.3	+	2	647_649	c.196_198TGG>ATT	c.(196-198)TGG>ATT	p.W66I	C12orf74_ENST00000544406.2_Missense_Mutation_p.W66I	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	Q32Q52	CL074_HUMAN	chromosome 12 open reading frame 74	66										kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	10						GCAGGATGCCTGGCAGGTGACCA	0.596																																																	0																																										SO:0001583	missense	0			BC043363	CCDS41819.1, CCDS53818.1	12q22	2012-08-16			ENSG00000214215	ENSG00000214215			27887	protein-coding gene	gene with protein product						12477932	Standard	NM_001037671		Approved		uc001tch.2	Q32Q52	OTTHUMG00000170105	ENST00000397833.3:c.196_198TGG>ATT	12.37:g.93100603TGG>ATT	ENSP00000380933:p.Trp66Ile		F5H4P0	Missense_Mutation	SNP	NULL	p.W66R|p.W66L|p.W66C	ENST00000397833.3	37	c.196|c.197|c.198	CCDS41819.1	12																																																																																			C12orf74	-	NULL	ENSG00000214215		0.596	C12orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C12orf74	HGNC	protein_coding	OTTHUMT00000407285.1	-	0.00	42|41|41	0	T|G|G	NM_001037671		93100603|93100604|93100605	+1	tier1	-	no_errors	ENST00000397833	ensembl	human	known	74_37	missense	11.76|11.90|12.05	75|74|73	10	SNP	0.020|0.008|0.002	A|T|T
C12orf42	374470	genome.wustl.edu	37	12	103872154	103872154	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:103872154G>C	ENST00000378113.2	-	2	276	c.51C>G	c.(49-51)acC>acG	p.T17T	C12orf42_ENST00000315192.8_Silent_p.T17T|C12orf42_ENST00000548048.1_5'UTR|C12orf42_ENST00000548789.1_5'UTR|C12orf42_ENST00000548883.1_Silent_p.T17T	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	17										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						AAGGTCTGATGGTTAGCAAGA	0.338																																																	0													164.0	147.0	153.0					12																	103872154		1865	4086	5951	SO:0001819	synonymous_variant	0			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.51C>G	12.37:g.103872154G>C			Q49A64|Q4G0S2	Silent	SNP	NULL	p.T17	ENST00000378113.2	37	c.51	CCDS44963.1	12																																																																																			C12orf42	-	NULL	ENSG00000179088		0.338	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	HGNC	protein_coding	OTTHUMT00000406754.1		0.00	24	0	G	NM_198521		103872154	-1			no_errors	ENST00000378113	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.049	C
C14orf23	387978	genome.wustl.edu	37	14	29261363	29261363	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:29261363G>T	ENST00000399387.4	+	3	504	c.400G>T	c.(400-402)Ggg>Tgg	p.G134W	C14orf23_ENST00000550266.1_Intron|C14orf23_ENST00000548213.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						GTATCTTCCAGGGTCTAAACT	0.388																																																	0																																										SO:0001583	missense	0					14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	ENST00000399387.4:c.400G>T	14.37:g.29261363G>T	ENSP00000382318:p.Gly134Trp			Missense_Mutation	SNP	NULL	p.G134W	ENST00000399387.4	37	c.400		14	.	.	.	.	.	.	.	.	.	.	G	7.860	0.725894	0.15439	.	.	ENSG00000186960	ENST00000399387	.	.	.	3.94	-0.669	0.11388	.	1.366670	0.05608	U	0.577588	T	0.24314	0.0589	.	.	.	0.09310	N	1	D	0.57257	0.979	B	0.43301	0.415	T	0.20405	-1.0276	8	0.87932	D	0	.	2.8612	0.05588	0.2417:0.0:0.3906:0.3677	.	134	Q86U37	CN023_HUMAN	W	134	.	ENSP00000382318:G134W	G	+	1	0	C14orf23	28331114	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.216000	0.17585	-0.235000	0.09767	-0.373000	0.07131	GGG	C14orf23	-	NULL	ENSG00000186960		0.388	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	C14orf23	HGNC	protein_coding	OTTHUMT00000134019.2	-	0.00	53	0	G	NR_026731		29261363	+1	tier1	-	no_errors	ENST00000399387	ensembl	human	known	74_37	missense	9.88	73	8	SNP	0.000	T
C14orf28	122525	genome.wustl.edu	37	14	45370114	45370114	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:45370114G>A	ENST00000325192.3	+	2	751	c.476G>A	c.(475-477)cGa>cAa	p.R159Q	C14orf28_ENST00000553841.1_3'UTR|C14orf28_ENST00000557112.1_Missense_Mutation_p.R159Q|RP11-857B24.5_ENST00000555157.1_RNA	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	159								p.R159L(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						TCCAACTGGCGATGCCCAACT	0.343																																																	1	Substitution - Missense(1)	lung(1)											70.0	72.0	72.0					14																	45370114		2203	4300	6503	SO:0001583	missense	0			AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.476G>A	14.37:g.45370114G>A	ENSP00000326846:p.Arg159Gln			Missense_Mutation	SNP	NULL	p.R159Q	ENST00000325192.3	37	c.476	CCDS32069.1	14	.	.	.	.	.	.	.	.	.	.	G	13.22	2.173338	0.38413	.	.	ENSG00000179476	ENST00000325192;ENST00000557112	T;T	0.30714	1.52;1.52	5.86	4.96	0.65561	.	0.227351	0.44285	D	0.000467	T	0.12433	0.0302	N	0.08118	0	0.27714	N	0.945356	P	0.37176	0.586	B	0.21360	0.034	T	0.09907	-1.0653	10	0.40728	T	0.16	.	9.7082	0.40229	0.1595:0.0:0.8405:0.0	.	159	Q4W4Y0	CN028_HUMAN	Q	159	ENSP00000326846:R159Q;ENSP00000451791:R159Q	ENSP00000326846:R159Q	R	+	2	0	C14orf28	44439864	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.525000	0.53502	1.592000	0.50018	0.650000	0.86243	CGA	C14orf28	-	NULL	ENSG00000179476		0.343	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	C14orf28	HGNC	protein_coding	OTTHUMT00000410086.1	-	0.00	70	0	G	NM_001017923		45370114	+1	tier1	-	no_errors	ENST00000325192	ensembl	human	known	74_37	missense	10.99	81	10	SNP	1.000	A
C16orf58	64755	genome.wustl.edu	37	16	31512031	31512031	+	Missense_Mutation	SNP	C	C	A	rs550615888		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:31512031C>A	ENST00000327237.2	-	3	476	c.437G>T	c.(436-438)cGc>cTc	p.R146L	C16orf58_ENST00000430477.2_Missense_Mutation_p.R4L|C16orf58_ENST00000567994.1_Missense_Mutation_p.R101L|C16orf58_ENST00000570164.1_Missense_Mutation_p.R146L			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	146						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						AAAGACGATGCGGCCCAGCAT	0.542																																																	0													91.0	87.0	88.0					16																	31512031		2197	4300	6497	SO:0001583	missense	0			AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.437G>T	16.37:g.31512031C>A	ENSP00000317579:p.Arg146Leu		Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Missense_Mutation	SNP	pfam_RUS2/WXR1	p.R146L	ENST00000327237.2	37	c.437	CCDS10715.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.521902	0.96416	.	.	ENSG00000140688	ENST00000327237;ENST00000452223;ENST00000541442;ENST00000430477	T;T	0.46451	0.87;0.87	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.65954	0.2741	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	1.0;0.977	D;P	0.83275	0.996;0.896	T	0.64757	-0.6332	10	0.38643	T	0.18	-17.7932	17.0016	0.86382	0.0:1.0:0.0:0.0	.	4;146	B4DJP2;Q96GQ5	.;CP058_HUMAN	L	146;100;146;4	ENSP00000317579:R146L;ENSP00000398074:R4L	ENSP00000317579:R146L	R	-	2	0	C16orf58	31419532	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	5.238000	0.65366	2.591000	0.87537	0.557000	0.71058	CGC	C16orf58	-	pfam_RUS2/WXR1	ENSG00000140688		0.542	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf58	HGNC	protein_coding	OTTHUMT00000255629.2	-	0.00	60	0	C	NM_022744		31512031	-1	tier1	-	no_errors	ENST00000327237	ensembl	human	known	74_37	missense	6.67	70	5	SNP	1.000	A
C17orf99	100141515	genome.wustl.edu	37	17	76160282	76160282	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:76160282C>T	ENST00000340363.5	+	4	532	c.477C>T	c.(475-477)aaC>aaT	p.N159N	C17orf99_ENST00000451352.3_3'UTR	NM_001163075.1	NP_001156547.1	Q6UX52	CQ099_HUMAN	chromosome 17 open reading frame 99	159						extracellular region (GO:0005576)											CTATCACCAACAGCCTGATCG	0.632																																																	0													53.0	56.0	55.0					17																	76160282		692	1591	2283	SO:0001819	synonymous_variant	0			AY358510	CCDS54171.1	17q25.3	2012-10-23			ENSG00000187997	ENSG00000187997			34490	protein-coding gene	gene with protein product							Standard	NM_001163075		Approved	GLPG464, UNQ464	uc002jus.4	Q6UX52	OTTHUMG00000153871	ENST00000340363.5:c.477C>T	17.37:g.76160282C>T				Silent	SNP	NULL	p.N159	ENST00000340363.5	37	c.477	CCDS54171.1	17																																																																																			C17orf99	-	NULL	ENSG00000187997		0.632	C17orf99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf99	HGNC	protein_coding	OTTHUMT00000332775.1		0.00	58	0	C	NM_001163075		76160282	+1			no_errors	ENST00000340363	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.500	T
PROSER3	148137	genome.wustl.edu	37	19	36257856	36257856	+	Splice_Site	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:36257856G>C	ENST00000544099.1	+	8	1020	c.957G>C	c.(955-957)ttG>ttC	p.L319F	C19orf55_ENST00000396908.4_Splice_Site_p.L319F|AC002398.13_ENST00000589397.1_RNA			Q2NL68	PRSR3_HUMAN		319										cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCCGCACGTTGGTGAGCCGAG	0.657																																																	0													9.0	13.0	12.0					19																	36257856		1896	4043	5939	SO:0001630	splice_region_variant	0																														ENST00000544099.1:c.957+1G>C	19.37:g.36257856G>C			Q8NDI3|Q8WWC8|Q96NL4	Missense_Mutation	SNP	NULL	p.L319F	ENST00000544099.1	37	c.957		19	.	.	.	.	.	.	.	.	.	.	G	11.81	1.750653	0.31046	.	.	ENSG00000167595	ENST00000396908	T	0.31247	1.5	4.0	1.71	0.24356	.	1.369980	0.05389	N	0.538615	T	0.17109	0.0411	N	0.22421	0.69	0.19775	N	0.999952	P	0.49447	0.924	B	0.34931	0.192	T	0.18053	-1.0349	10	0.49607	T	0.09	0.4762	4.0509	0.09795	0.1329:0.0:0.614:0.2531	.	319	E5RFB9	.	F	319	ENSP00000380116:L319F	ENSP00000380116:L319F	L	+	3	2	C19orf55	40949696	0.338000	0.24775	0.358000	0.25811	0.008000	0.06430	0.350000	0.20079	0.346000	0.23899	0.305000	0.20034	TTG	C19orf55	-	NULL	ENSG00000167595		0.657	C19orf55-001	KNOWN	basic	protein_coding	C19orf55	HGNC	protein_coding	OTTHUMT00000398160.2	-	0.00	70	0	G		Missense_Mutation	36257856	+1	tier1	-	no_errors	ENST00000396908	ensembl	human	known	74_37	missense	6.85	68	5	SNP	0.399	C
C1orf195	727684	genome.wustl.edu	37	1	15497754	15497754	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:15497754G>T	ENST00000376005.3	-	1	59	c.21C>A	c.(19-21)acC>acA	p.T7T	TMEM51_ENST00000434578.2_Intron|TMEM51_ENST00000400796.3_Intron|TMEM51_ENST00000428417.1_Intron|TMEM51_ENST00000376008.2_Intron|C1orf195_ENST00000424792.1_Silent_p.T7T|TMEM51_ENST00000376014.3_Intron	NM_001278501.1	NP_001265430.1	Q5TG92	CA195_HUMAN	chromosome 1 open reading frame 195	7																	AAGGTTTGCAGGTCAGAGTGG	0.473																																																	0																																										SO:0001819	synonymous_variant	0				CCDS59992.1, CCDS59993.1	1p36.21	2012-07-30			ENSG00000204464	ENSG00000204464			32332	protein-coding gene	gene with protein product							Standard	NM_001278501		Approved			Q5TG92	OTTHUMG00000037852	ENST00000376005.3:c.21C>A	1.37:g.15497754G>T				Silent	SNP	NULL	p.T7	ENST00000376005.3	37	c.21		1																																																																																			C1orf195	-	NULL	ENSG00000204464		0.473	C1orf195-001	KNOWN	basic|appris_candidate_longest	protein_coding	C1orf195	HGNC	protein_coding	OTTHUMT00000092383.1	-	0.00	88	0	G			15497754	-1	tier1	-	no_errors	ENST00000376005	ensembl	human	known	74_37	silent	5.49	86	5	SNP	0.006	T
C1orf168	199920	genome.wustl.edu	37	1	57185023	57185023	+	3'UTR	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:57185023C>A	ENST00000343433.6	-	0	2588					NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168											NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						TGACTAGGTGCCATAAGGCAT	0.338																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.*321G>T	1.37:g.57185023C>A			Q63HM3|Q6ZUY6	RNA	SNP	-	NULL	ENST00000343433.6	37	NULL	CCDS30729.1	1																																																																																			C1orf168	-	-	ENSG00000187889		0.338	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf168	HGNC	protein_coding	OTTHUMT00000022751.2	-	0.00	53	0	C	NM_001004303		57185023	-1	tier1	-	no_errors	ENST00000493000	ensembl	human	known	74_37	rna	6.90	54	4	SNP	0.923	A
C20orf166	128826	genome.wustl.edu	37	20	61167653	61167653	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:61167653C>A	ENST00000370527.3	+	4	902	c.123C>A	c.(121-123)gtC>gtA	p.V41V	C20orf166_ENST00000370524.2_Silent_p.V23V|C20orf166_ENST00000370523.1_Silent_p.V23V	NM_178463.3	NP_848558.1			chromosome 20 open reading frame 166											endometrium(1)|kidney(1)|lung(2)	4	Breast(26;1.04e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)			TCCTGTAGGTCAGCCCTGAAA	0.493																																																	0													30.0	30.0	30.0					20																	61167653		1860	4100	5960	SO:0001819	synonymous_variant	0			AL449263	CCDS46627.1	20q13.33	2014-01-21			ENSG00000174407	ENSG00000174407			16159	protein-coding gene	gene with protein product	"""MIR133A2 host gene"""						Standard	NM_178463		Approved	dJ353C17.1, MIR1-1HG, MIR133A2HG	uc011aaj.2	Q9H1L0	OTTHUMG00000048000	ENST00000370527.3:c.123C>A	20.37:g.61167653C>A				Silent	SNP	NULL	p.V41	ENST00000370527.3	37	c.123	CCDS46627.1	20																																																																																			C20orf166	-	NULL	ENSG00000174407		0.493	C20orf166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf166	HGNC	protein_coding	OTTHUMT00000109262.1	-	0.00	61	0	C	NM_178463		61167653	+1	tier1	-	no_errors	ENST00000370527	ensembl	human	known	74_37	silent	8.86	72	7	SNP	0.000	A
B3GALT5	10317	genome.wustl.edu	37	21	40971376	40971376	+	Intron	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr21:40971376C>A	ENST00000380620.4	+	2	69				C21orf88_ENST00000489821.1_5'UTR|C21orf88_ENST00000380612.4_Intron			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5						protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				GGGGGCCAGGCGGGCTCAGCT	0.547																																																	0																																										SO:0001627	intron_variant	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.-523-5645C>A	21.37:g.40971376C>A			A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	RNA	SNP	-	NULL	ENST00000380620.4	37	NULL	CCDS13667.1	21																																																																																			C21orf88	-	-	ENSG00000184809		0.547	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf88	HGNC	protein_coding	OTTHUMT00000195008.2	-	0.00	86	0	C	NM_033170		40971376	-1	tier1	-	no_errors	ENST00000489821	ensembl	human	known	74_37	rna	5.56	84	5	SNP	0.000	A
C22orf34	348645	genome.wustl.edu	37	22	50016932	50016932	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr22:50016932G>T	ENST00000444628.1	-	5	2033	c.962C>A	c.(961-963)cCc>cAc	p.P321H	C22orf34_ENST00000400023.1_Intron|C22orf34_ENST00000405854.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	0										pancreas(1)	1						GGTGCAGAGGGGCCTGGTCCT	0.602																																																	0																																										SO:0001583	missense	0			BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.962C>A	22.37:g.50016932G>T	ENSP00000395549:p.Pro321His		Q147Y0|Q5R3D1|Q6ZTN8	Missense_Mutation	SNP	NULL	p.P321H	ENST00000444628.1	37	c.962		22	.	.	.	.	.	.	.	.	.	.	G	0.938	-0.710605	0.03230	.	.	ENSG00000188511	ENST00000444628	.	.	.	0.815	-1.63	0.08345	.	.	.	.	.	T	0.19685	0.0473	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22382	-1.0218	4	.	.	.	.	1.56	0.02593	0.348:0.0:0.3388:0.3132	.	.	.	.	H	321	.	.	P	-	2	0	C22orf34	48402936	0.061000	0.20836	0.000000	0.03702	0.021000	0.10359	0.878000	0.28126	-1.038000	0.03279	0.397000	0.26171	CCC	C22orf34	-	NULL	ENSG00000188511		0.602	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	C22orf34	HGNC	protein_coding		-	0.00	119	0	G	NR_026997		50016932	-1	tier1	-	no_errors	ENST00000444628	ensembl	human	known	74_37	missense	10.19	141	16	SNP	0.000	T
C2orf80	389073	genome.wustl.edu	37	2	209049741	209049741	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:209049741G>T	ENST00000341287.4	-	3	252	c.57C>A	c.(55-57)ggC>ggA	p.G19G	C2orf80_ENST00000453017.1_Silent_p.G19G|C2orf80_ENST00000451346.1_Intron	NM_001099334.2	NP_001092804	Q0P641	CB080_HUMAN	chromosome 2 open reading frame 80	19										endometrium(2)|large_intestine(3)|lung(6)|skin(2)	13						GAAGTCTGATGCCAATATAAT	0.438																																																	0													111.0	102.0	105.0					2																	209049741		1881	4112	5993	SO:0001819	synonymous_variant	0			AC016697, AW136505, BC035737	CCDS42809.1	2q33.3	2013-10-31			ENSG00000188674	ENSG00000188674			34352	protein-coding gene	gene with protein product	"""gonad development associated 1"""	615536				22080834, 24055526	Standard	NM_001099334		Approved	LOC389073, GONDA1	uc002vcr.3	Q0P641	OTTHUMG00000154751	ENST00000341287.4:c.57C>A	2.37:g.209049741G>T			A6NKZ3	Silent	SNP	NULL	p.G19	ENST00000341287.4	37	c.57	CCDS42809.1	2																																																																																			C2orf80	-	NULL	ENSG00000188674		0.438	C2orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf80	HGNC	protein_coding	OTTHUMT00000336931.1	-	0.00	56	0	G	NM_001099334		209049741	-1	tier1	-	no_errors	ENST00000341287	ensembl	human	known	74_37	silent	6.35	59	4	SNP	1.000	T
C4BPA	722	genome.wustl.edu	37	1	207307755	207307755	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:207307755G>T	ENST00000367070.3	+	9	1285	c.1091G>T	c.(1090-1092)tGt>tTt	p.C364F		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	364	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						TCAGCGTTATGTTGCCCTGAA	0.388																																																	0													153.0	143.0	146.0					1																	207307755		2203	4300	6503	SO:0001583	missense	0			M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.1091G>T	1.37:g.207307755G>T	ENSP00000356037:p.Cys364Phe		Q5VVQ8	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.C364F	ENST00000367070.3	37	c.1091	CCDS1477.1	1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409349	0.62399	.	.	ENSG00000123838	ENST00000367070	T	0.34072	1.38	4.97	4.97	0.65823	Complement control module (3);Sushi/SCR/CCP (1);	0.000000	0.64402	D	0.000017	T	0.61375	0.2342	M	0.81802	2.56	0.39623	D	0.970065	D	0.89917	1.0	D	0.83275	0.996	T	0.66192	-0.5985	10	0.52906	T	0.07	.	14.1092	0.65111	0.0:0.0:1.0:0.0	.	364	P04003	C4BPA_HUMAN	F	364	ENSP00000356037:C364F	ENSP00000356037:C364F	C	+	2	0	C4BPA	205374378	1.000000	0.71417	0.558000	0.28319	0.148000	0.21650	3.901000	0.56303	2.471000	0.83476	0.591000	0.81541	TGT	C4BPA	-	superfamily_Sushi_SCR_CCP	ENSG00000123838		0.388	C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4BPA	HGNC	protein_coding	OTTHUMT00000088089.3	-	0.00	64	0	G			207307755	+1	tier1	-	no_errors	ENST00000367070	ensembl	human	known	74_37	missense	5.15	92	5	SNP	0.939	T
C4orf47	441054	genome.wustl.edu	37	4	186361817	186361817	+	Missense_Mutation	SNP	G	G	C	rs541151554	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:186361817G>C	ENST00000378850.4	+	5	680	c.658G>C	c.(658-660)Gaa>Caa	p.E220Q		NM_001114357.1	NP_001107829.1	A7E2U8	CD047_HUMAN	chromosome 4 open reading frame 47	220										breast(2)|endometrium(1)	3						AATTAAAAAAGAAGAGAAGAA	0.289																																																	0													42.0	36.0	38.0					4																	186361817		692	1588	2280	SO:0001583	missense	0			AY947525, BC127739, BC141967	CCDS47169.1	4q35.1	2008-07-18			ENSG00000205129	ENSG00000205129			34346	protein-coding gene	gene with protein product						12477932	Standard	NM_001114357		Approved	LOC441054	uc003ixt.2	A7E2U8	OTTHUMG00000160458	ENST00000378850.4:c.658G>C	4.37:g.186361817G>C	ENSP00000368127:p.Glu220Gln		Q5BLP7	Missense_Mutation	SNP	NULL	p.E220Q	ENST00000378850.4	37	c.658	CCDS47169.1	4	.	.	.	.	.	.	.	.	.	.	G	1.910	-0.450843	0.04572	.	.	ENSG00000205129	ENST00000378850	.	.	.	5.49	1.73	0.24493	.	.	.	.	.	T	0.25082	0.0609	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.23084	-1.0198	7	.	.	.	1.4677	6.0582	0.19822	0.2809:0.3096:0.4095:0.0	.	220	A7E2U8	CD047_HUMAN	Q	220	.	.	E	+	1	0	C4orf47	186598811	0.001000	0.12720	0.004000	0.12327	0.491000	0.33493	0.312000	0.19397	0.296000	0.22592	0.563000	0.77884	GAA	C4orf47	-	NULL	ENSG00000205129		0.289	C4orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf47	HGNC	protein_coding	OTTHUMT00000360667.1	-	0.00	58	0	G	NM_001114357		186361817	+1	tier1	-	no_errors	ENST00000378850	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.017	C
C6orf136	221545	genome.wustl.edu	37	6	30615067	30615067	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:30615067A>T	ENST00000376473.5	+	1	218	c.59A>T	c.(58-60)cAg>cTg	p.Q20L	C6orf136_ENST00000493705.1_3'UTR|C6orf136_ENST00000293604.6_Missense_Mutation_p.Q20L|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000528347.2_5'Flank|C6orf136_ENST00000376471.4_Missense_Mutation_p.Q20L	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	20						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						CGCGCCTACCAGGCTCGACCC	0.711																																																	0													17.0	20.0	19.0					6																	30615067		1768	3922	5690	SO:0001583	missense	0			BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.59A>T	6.37:g.30615067A>T	ENSP00000365656:p.Gln20Leu		A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	pfam_DUF2358	p.Q20L	ENST00000376473.5	37	c.59	CCDS43443.1	6	.	.	.	.	.	.	.	.	.	.	A	10.61	1.397856	0.25205	.	.	ENSG00000204564	ENST00000293604;ENST00000376473;ENST00000376471	.	.	.	4.97	4.97	0.65823	.	1.321840	0.04935	N	0.457658	T	0.47021	0.1423	L	0.29908	0.895	0.80722	D	1	B;D;B	0.54207	0.297;0.965;0.295	B;P;B	0.55785	0.202;0.784;0.081	T	0.29427	-1.0012	9	0.87932	D	0	.	11.0232	0.47730	1.0:0.0:0.0:0.0	.	20;20;20	A9R9P9;F8VX15;Q5SQH8	.;.;CF136_HUMAN	L	20	.	ENSP00000293604:Q20L	Q	+	2	0	C6orf136	30723046	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	3.841000	0.55850	2.099000	0.63709	0.378000	0.23410	CAG	C6orf136	-	NULL	ENSG00000204564		0.711	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf136	HGNC	protein_coding	OTTHUMT00000076457.4	-	0.00	60	0	A	NM_145029		30615067	+1	tier1	-	no_errors	ENST00000293604	ensembl	human	known	74_37	missense	10.10	89	10	SNP	1.000	T
CFAP69	79846	genome.wustl.edu	37	7	89900935	89900935	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:89900935C>T	ENST00000389297.4	+	7	879	c.628C>T	c.(628-630)Caa>Taa	p.Q210*	AC002064.4_ENST00000420245.1_RNA|C7orf63_ENST00000316089.8_Nonsense_Mutation_p.Q210*|C7orf63_ENST00000463311.1_3'UTR|C7orf63_ENST00000497910.1_Nonsense_Mutation_p.Q192*	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		210										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						GCTTGAAAATCAACTTGTTGA	0.363																																																	0													108.0	102.0	104.0					7																	89900935		1848	4093	5941	SO:0001587	stop_gained	0																														ENST00000389297.4:c.628C>T	7.37:g.89900935C>T	ENSP00000373948:p.Gln210*		A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.Q210*	ENST00000389297.4	37	c.628	CCDS43613.2	7	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502348	0.85176	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000457170	.	.	.	6.17	5.26	0.73747	.	0.063724	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-5.0125	19.2563	0.93947	0.0:0.8778:0.1222:0.0	.	.	.	.	X	210;210;192;150	.	ENSP00000321753:Q210X	Q	+	1	0	C7orf63	89738871	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	2.795000	0.47861	2.941000	0.99782	0.655000	0.94253	CAA	C7orf63	-	superfamily_ARM-type_fold	ENSG00000105792		0.363	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4	-	0.00	58	0	C			89900935	+1	tier1	-	no_errors	ENST00000389297	ensembl	human	known	74_37	nonsense	5.75	82	5	SNP	1.000	T
CA5A	763	genome.wustl.edu	37	16	87970095	87970095	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:87970095G>C	ENST00000309893.2	-	0	27				CA5A_ENST00000568801.1_5'UTR	NM_001739.1	NP_001730.1	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial						bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(80;0.0513)	Brinzolamide(DB01194)|Zonisamide(DB00909)	TGAAGAGGGTGATGTTCCCTG	0.517																																																	0													70.0	64.0	66.0					16																	87970095		2198	4300	6498			0			L19297	CCDS10965.1	16q24.2	2012-08-21			ENSG00000174990	ENSG00000174990	4.2.1.1	"""Carbonic anhydrases"""	1377	protein-coding gene	gene with protein product		114761		CA5		8356065, 7490083	Standard	NM_001739		Approved	CAV, CAVA	uc002fkn.1	P35218	OTTHUMG00000137677	ENST00000309893.2:c.-39C>G	16.37:g.87970095G>C			B2RPF2	RNA	SNP	-	NULL	ENST00000309893.2	37	NULL	CCDS10965.1	16																																																																																			CA5A	-	-	ENSG00000174990		0.517	CA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA5A	HGNC	protein_coding	OTTHUMT00000269164.1	-	0.00	66	0	G	NM_001739		87970095	-1	tier1	-	no_errors	ENST00000568801	ensembl	human	known	74_37	rna	7.37	86	7	SNP	0.000	C
CACNA1A	773	genome.wustl.edu	37	19	13410024	13410024	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:13410024G>T	ENST00000360228.5	-	19	2422	c.2423C>A	c.(2422-2424)aCg>aAg	p.T808K	CACNA1A_ENST00000573710.2_Missense_Mutation_p.T809K	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	809					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.T809M(3)|p.T808M(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CAGGTGCCGCGTGTAGGCAGC	0.642																																																	4	Substitution - Missense(4)	prostate(4)											47.0	54.0	52.0					19																	13410024		2037	4162	6199	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2423C>A	19.37:g.13410024G>T	ENSP00000353362:p.Thr808Lys		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.T808K	ENST00000360228.5	37	c.2423	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	1.893	-0.455058	0.04540	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.95622	-3.76	3.99	1.56	0.23342	.	1.904990	0.03030	N	0.151895	D	0.91616	0.7351	N	0.24115	0.695	0.09310	N	1	B;B;B	0.26512	0.005;0.151;0.094	B;B;B	0.22601	0.005;0.04;0.018	T	0.83080	-0.0138	10	0.54805	T	0.06	.	10.4736	0.44652	0.0:0.5243:0.4756:0.0	.	809;812;808	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	K	808;812;809;809	ENSP00000353362:T808K	ENSP00000317661:T809K	T	-	2	0	CACNA1A	13271024	0.167000	0.22975	0.052000	0.19188	0.010000	0.07245	1.666000	0.37460	0.847000	0.35167	0.555000	0.69702	ACG	CACNA1A	-	NULL	ENSG00000141837		0.642	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	-	0.00	127	0	G	NM_000068		13410024	-1	tier1	-	no_errors	ENST00000360228	ensembl	human	known	74_37	missense	8.19	157	14	SNP	0.252	T
CABP5	56344	genome.wustl.edu	37	19	48537601	48537601	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:48537601C>G	ENST00000293255.2	-	5	497	c.367G>C	c.(367-369)Ggg>Cgg	p.G123R		NM_019855.4	NP_062829.1	Q9NP86	CABP5_HUMAN	calcium binding protein 5	123	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	11		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		GTGATCTCCCCATCTCCATTC	0.517																																																	0													57.0	54.0	55.0					19																	48537601		2203	4300	6503	SO:0001583	missense	0			AF169159	CCDS12709.1	19q13.33	2014-08-12			ENSG00000105507	ENSG00000105507		"""EF-hand domain containing"""	13714	protein-coding gene	gene with protein product		607315	"""calcium binding protein 3"""	CABP3		10625670	Standard	NM_019855		Approved	CaBP3	uc002phu.2	Q9NP86	OTTHUMG00000183139	ENST00000293255.2:c.367G>C	19.37:g.48537601C>G	ENSP00000293255:p.Gly123Arg		A0AUY4	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.G123R	ENST00000293255.2	37	c.367	CCDS12709.1	19	.	.	.	.	.	.	.	.	.	.	C	19.38	3.816314	0.70912	.	.	ENSG00000105507	ENST00000293255	T	0.27402	1.67	5.01	5.01	0.66863	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.68641	0.3023	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79834	-0.1636	10	0.87932	D	0	-27.1476	16.1949	0.82021	0.0:1.0:0.0:0.0	.	123	Q9NP86	CABP5_HUMAN	R	123	ENSP00000293255:G123R	ENSP00000293255:G123R	G	-	1	0	CABP5	53229413	1.000000	0.71417	0.970000	0.41538	0.481000	0.33189	7.063000	0.76714	2.509000	0.84616	0.561000	0.74099	GGG	CABP5	-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000105507		0.517	CABP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABP5	HGNC	protein_coding	OTTHUMT00000465212.1	-	0.00	70	0	C	NM_019855		48537601	-1	tier1	-	no_errors	ENST00000293255	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	G
CACNA1C	775	genome.wustl.edu	37	12	2760889	2760889	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:2760889G>T	ENST00000347598.4	+	34	4173	c.4173G>T	c.(4171-4173)ggG>ggT	p.G1391G	CACNA1C_ENST00000399655.1_Silent_p.G1343G|CACNA1C_ENST00000399637.1_Silent_p.G1343G|CACNA1C_ENST00000344100.3_Silent_p.G1365G|CACNA1C_ENST00000399601.1_Silent_p.G1343G|CACNA1C_ENST00000399621.1_Silent_p.G1343G|CACNA1C_ENST00000399606.1_Silent_p.G1363G|CACNA1C_ENST00000327702.7_Silent_p.G1343G|CACNA1C_ENST00000399634.1_Silent_p.G1343G|CACNA1C_ENST00000399638.1_Silent_p.G1371G|CACNA1C_ENST00000399629.1_Silent_p.G1360G|CACNA1C_ENST00000399649.1_Silent_p.G1330G|CACNA1C_ENST00000399617.1_Silent_p.G1343G|CACNA1C_ENST00000399595.1_Silent_p.G1332G|CACNA1C_ENST00000406454.3_Silent_p.G1343G|CACNA1C_ENST00000399644.1_Silent_p.G1343G|CACNA1C_ENST00000399591.1_Silent_p.G1332G|CACNA1C_ENST00000402845.3_Silent_p.G1343G|CACNA1C_ENST00000399641.1_Silent_p.G1343G|CACNA1C_ENST00000335762.5_Silent_p.G1368G|CACNA1C_ENST00000399597.1_Silent_p.G1343G|CACNA1C_ENST00000399603.1_Silent_p.G1343G	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1391					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGAGCCGTGGGGAGGGCATCC	0.647																																																	0													55.0	65.0	62.0					12																	2760889		2201	4296	6497	SO:0001819	synonymous_variant	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4173G>T	12.37:g.2760889G>T			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.G1343	ENST00000347598.4	37	c.4029	CCDS44788.1	12																																																																																			CACNA1C	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000151067		0.647	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	-	0.00	54	0	G	NM_000719		2760889	+1	tier1	-	no_errors	ENST00000399634	ensembl	human	known	74_37	silent	15.15	56	10	SNP	1.000	T
CACNA1D	776	genome.wustl.edu	37	3	53766862	53766862	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:53766862G>T	ENST00000350061.5	+	19	3005	c.2494G>T	c.(2494-2496)Gag>Tag	p.E832*	CACNA1D_ENST00000422281.2_Nonsense_Mutation_p.E832*|CACNA1D_ENST00000288139.4_Nonsense_Mutation_p.E852*	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	832	Poly-Glu.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ggaagaggaagaggaggagga	0.433																																																	0													58.0	64.0	62.0					3																	53766862		2203	4300	6503	SO:0001587	stop_gained	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.2494G>T	3.37:g.53766862G>T	ENSP00000288133:p.Glu832*		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.E852*	ENST00000350061.5	37	c.2554	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	G	42	9.245214	0.99111	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	.	.	.	5.35	5.35	0.76521	.	1.827820	0.02366	N	0.077320	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	19.4362	0.94796	0.0:0.0:1.0:0.0	.	.	.	.	X	832;852;832;525	.	ENSP00000288139:E852X	E	+	1	0	CACNA1D	53741902	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.774000	0.85478	2.663000	0.90544	0.655000	0.94253	GAG	CACNA1D	-	NULL	ENSG00000157388		0.433	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	-	0.00	65	0	G	NM_000720		53766862	+1	tier1	-	no_errors	ENST00000288139	ensembl	human	known	74_37	nonsense	6.94	67	5	SNP	1.000	T
CACNA1E	777	genome.wustl.edu	37	1	181767767	181767767	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:181767767G>T	ENST00000367573.2	+	48	6739	c.6739G>T	c.(6739-6741)Gag>Tag	p.E2247*	CACNA1E_ENST00000360108.3_Nonsense_Mutation_p.E2228*|CACNA1E_ENST00000358338.5_Nonsense_Mutation_p.E2136*|CACNA1E_ENST00000526775.1_Nonsense_Mutation_p.E2185*|CACNA1E_ENST00000367567.4_Nonsense_Mutation_p.E1811*|CACNA1E_ENST00000357570.5_Nonsense_Mutation_p.E2198*|CACNA1E_ENST00000367570.1_Nonsense_Mutation_p.E2204*	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2247					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTGTGGTGAGGAGGAGACGCT	0.637																																																	0													29.0	34.0	32.0					1																	181767767		2119	4237	6356	SO:0001587	stop_gained	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6739G>T	1.37:g.181767767G>T	ENSP00000356545:p.Glu2247*		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.E2247*	ENST00000367573.2	37	c.6739	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	48	14.200635	0.99784	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	.	.	.	5.55	5.55	0.83447	.	0.115163	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.1878	0.93651	0.0:0.0:1.0:0.0	.	.	.	.	X	2204;2185;2198;2136;1811;2228;2247	.	ENSP00000350183:E2198X	E	+	1	0	CACNA1E	180034390	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.623000	0.54224	2.618000	0.88619	0.558000	0.71614	GAG	CACNA1E	-	NULL	ENSG00000198216		0.637	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2		0.00	51	0	G	NM_000721		181767767	+1			no_errors	ENST00000367573	ensembl	human	known	74_37	nonsense	6.78	55	4	SNP	1.000	T
CACNA1I	8911	genome.wustl.edu	37	22	39996623	39996623	+	Silent	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr22:39996623A>T	ENST00000402142.3	+	3	447	c.447A>T	c.(445-447)acA>acT	p.T149T	CACNA1I_ENST00000401624.1_Silent_p.T149T|CACNA1I_ENST00000407673.1_Silent_p.T149T|CACNA1I_ENST00000404898.1_Silent_p.T149T|CACNA1I_ENST00000336649.4_Silent_p.T149T|CACNA1I_ENST00000400164.3_Silent_p.T149T	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	149					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	TCGGGGACACATGGAACCGCC	0.527																																																	0													78.0	77.0	77.0					22																	39996623		1939	4144	6083	SO:0001819	synonymous_variant	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.447A>T	22.37:g.39996623A>T			B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.T149	ENST00000402142.3	37	c.447	CCDS46710.1	22																																																																																			CACNA1I	-	pfam_Ion_trans_dom	ENSG00000100346		0.527	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1		0.00	62	0	A	NM_001003406		39996623	+1			no_errors	ENST00000336649	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.058	T
CAGE1	285782	genome.wustl.edu	37	6	7373495	7373496	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:7373495_7373496insA	ENST00000512086.1	-	5	1758_1759	c.1556_1557insT	c.(1555-1557)ttgfs	p.L519fs	CAGE1_ENST00000296742.7_Frame_Shift_Ins_p.L383fs|CAGE1_ENST00000338150.4_Frame_Shift_Ins_p.L519fs|CAGE1_ENST00000509324.1_5'Flank|CAGE1_ENST00000379918.4_Frame_Shift_Ins_p.L519fs|CAGE1_ENST00000502583.1_Frame_Shift_Ins_p.L519fs			Q8TC20	CAGE1_HUMAN	cancer antigen 1	519										breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					ACATAAATTGCAAATTTCTAAC	0.332																																																	0																																										SO:0001589	frameshift_variant	0			BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.1557dupT	6.37:g.7373498_7373498dupA	ENSP00000427583:p.Leu519fs		D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Frame_Shift_Ins	INS	NULL	p.L519fs	ENST00000512086.1	37	c.1557_1556		6																																																																																			CAGE1	-	NULL	ENSG00000164304		0.332	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	CAGE1	HGNC	protein_coding	OTTHUMT00000367136.1		0.00	51	0	-	NM_175745		7373496	-1	tier1		no_errors	ENST00000338150	ensembl	human	known	74_37	frame_shift_ins	17.24	48	10	INS	0.978:0.976	A
CALML5	51806	genome.wustl.edu	37	10	5541125	5541125	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:5541125C>A	ENST00000380332.3	-	1	408	c.277G>T	c.(277-279)Gat>Tat	p.D93Y		NM_017422.4	NP_059118.2	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	93	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				epidermis development (GO:0008544)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			biliary_tract(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|stomach(1)	8						CCGTCGCCATCCTGGTCGAAG	0.711																																					GBM(149;1055 3356 43077)												0													26.0	27.0	27.0					10																	5541125		2203	4299	6502	SO:0001583	missense	0			AF172852	CCDS7068.1	10p15.1	2013-01-10			ENSG00000178372	ENSG00000178372		"""EF-hand domain containing"""	18180	protein-coding gene	gene with protein product	"""calmodulin-like skin protein"""	605183				10777582	Standard	NM_017422		Approved	CLSP	uc001iic.2	Q9NZT1	OTTHUMG00000017598	ENST00000380332.3:c.277G>T	10.37:g.5541125C>A	ENSP00000369689:p.Asp93Tyr		Q5SQI3|Q8IXU8	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.D93Y	ENST00000380332.3	37	c.277	CCDS7068.1	10	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677481	0.29783	.	.	ENSG00000178372	ENST00000380332	T	0.55760	0.5	4.68	-3.08	0.05347	EF-hand-like domain (1);	0.546439	0.17388	N	0.176053	T	0.77239	0.4101	H	0.97732	4.065	0.09310	N	1	D	0.76494	0.999	D	0.72075	0.976	T	0.69533	-0.5120	10	0.87932	D	0	-36.4178	10.4138	0.44309	0.0:0.6123:0.0:0.3877	.	93	Q9NZT1	CALL5_HUMAN	Y	93	ENSP00000369689:D93Y	ENSP00000369689:D93Y	D	-	1	0	CALML5	5531125	0.021000	0.18746	0.000000	0.03702	0.000000	0.00434	1.229000	0.32600	-0.644000	0.05465	-0.768000	0.03414	GAT	CALML5	-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000178372		0.711	CALML5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALML5	HGNC	protein_coding	OTTHUMT00000046556.1		0.00	11	0	C	NM_017422		5541125	-1			no_errors	ENST00000380332	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.009	A
CAPN8	388743	genome.wustl.edu	37	1	223718144	223718144	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:223718144G>T	ENST00000366872.5	-	17	1835	c.1836C>A	c.(1834-1836)ctC>ctA	p.L612L				A6NHC0	CAN8_HUMAN	calpain 8	634	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						CTGCCTTCCTGAGGGCTGTCC	0.453																																																	0													109.0	96.0	100.0					1																	223718144		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366872.5:c.1836C>A	1.37:g.223718144G>T			B2RXL2	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L612	ENST00000366872.5	37	c.1836		1																																																																																			CAPN8	-	NULL	ENSG00000203697		0.453	CAPN8-201	KNOWN	basic|appris_principal	protein_coding	CAPN8	HGNC	protein_coding		-	0.00	51	0	G	NM_001143962		223718144	-1	tier1	-	no_errors	ENST00000366872	ensembl	human	known	74_37	silent	14.29	60	10	SNP	0.995	T
CAPRIN1	4076	genome.wustl.edu	37	11	34074014	34074014	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:34074014G>T	ENST00000341394.4	+	2	236	c.47G>T	c.(46-48)gGa>gTa	p.G16V	CAPRIN1_ENST00000529307.1_5'Flank|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.G16V|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.G16V|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.G16V	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	16					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				AAGTCGTCCGGACCGCCACCG	0.716																																																	0													10.0	14.0	12.0					11																	34074014		1914	3899	5813	SO:0001583	missense	0			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.47G>T	11.37:g.34074014G>T	ENSP00000340329:p.Gly16Val		A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	pfam_Caprin-1_C	p.G16V	ENST00000341394.4	37	c.47	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845414	0.32606	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000534825;ENST00000532820;ENST00000530820	T;T;T;T;T	0.53640	2.29;2.29;0.61;2.29;2.29	4.18	3.22	0.36961	.	5.003840	0.01366	U	0.012384	T	0.35393	0.0930	N	0.14661	0.345	0.80722	D	1	B;B	0.26775	0.099;0.159	B;B	0.23150	0.012;0.044	T	0.02053	-1.1222	10	0.22706	T	0.39	-5.8994	11.7948	0.52093	0.0:0.1784:0.8216:0.0	.	16;16	Q14444;Q14444-2	CAPR1_HUMAN;.	V	16	ENSP00000340329:G16V;ENSP00000374296:G16V;ENSP00000431373:G16V;ENSP00000434150:G16V;ENSP00000434204:G16V	ENSP00000340329:G16V	G	+	2	0	CAPRIN1	34030590	.	.	0.994000	0.49952	0.092000	0.18411	.	.	0.815000	0.34398	0.551000	0.68910	GGA	CAPRIN1	-	NULL	ENSG00000135387		0.716	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2		0.00	62	0	G	NM_005898		34074014	+1			no_errors	ENST00000341394	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.995	T
CFAP36	112942	genome.wustl.edu	37	2	55762900	55762900	+	Splice_Site	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:55762900G>A	ENST00000349456.4	+	6	685		c.e6+1		CCDC104_ENST00000406691.3_Splice_Site|CCDC104_ENST00000407816.3_Splice_Site|CCDC104_ENST00000403007.3_Missense_Mutation_p.V180M|CCDC104_ENST00000339012.3_Splice_Site|CCDC104_ENST00000490934.1_Splice_Site			Q96G28	CFA36_HUMAN												breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GAAAAAACAGGTGCCTACAGA	0.279																																																	0													88.0	102.0	97.0					2																	55762900		2201	4300	6501	SO:0001630	splice_region_variant	0																														ENST00000349456.4:c.537+1G>A	2.37:g.55762900G>A			Q53SF0|Q53ST9|Q6UY34	Splice_Site	SNP	-	e7+1	ENST00000349456.4	37	c.612+1	CCDS1854.2	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.26|16.26	3.073500|3.073500	0.55646|0.55646	.|.	.|.	ENSG00000163001|ENSG00000163001	ENST00000339012;ENST00000406691;ENST00000349456;ENST00000407816|ENST00000403007	.|T	.|0.36878	.|1.23	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|.	.|.	.|.	.|.	.|T	.|0.45216	.|0.1331	.|.	.|.	.|.	0.20074|0.20074	N|N	0.999939|0.999939	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.33497	.|-0.9866	.|5	.|.	.|.	.|.	.|.	17.5215|17.5215	0.87789|0.87789	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|M	-1|180	.|ENSP00000385972:V180M	.|.	.|V	+|+	.|1	.|0	CCDC104|CCDC104	55616404|55616404	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.555000|0.555000	0.35460|0.35460	5.570000|5.570000	0.67398|0.67398	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	.|GTG	CCDC104	-	-	ENSG00000163001		0.279	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC104	HGNC	protein_coding	OTTHUMT00000319610.2	-	0.00	46	0	G		Intron	55762900	+1	tier1	-	no_errors	ENST00000339012	ensembl	human	known	74_37	splice_site	5.97	63	4	SNP	1.000	A
CCDC144A	9720	genome.wustl.edu	37	17	16612402	16612402	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:16612402G>T	ENST00000360524.8	+	5	1107	c.1031G>T	c.(1030-1032)tGt>tTt	p.C344F	CCDC144A_ENST00000340621.5_Missense_Mutation_p.C343F|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.C344F|RN7SL620P_ENST00000580704.1_RNA|CCDC144A_ENST00000399273.1_Missense_Mutation_p.C344F|CCDC144A_ENST00000456009.1_Intron|CCDC144A_ENST00000443444.2_Missense_Mutation_p.C344F	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	344																	ATACCTGGTTGTGAGGAAGAA	0.383																																																	0													31.0	30.0	31.0					17																	16612402		1799	4036	5835	SO:0001583	missense	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.1031G>T	17.37:g.16612402G>T	ENSP00000353717:p.Cys344Phe		O60311|Q6ZU57	Missense_Mutation	SNP	pfam_DUF3496	p.C344F	ENST00000360524.8	37	c.1031	CCDS45621.1	17	.	.	.	.	.	.	.	.	.	.	.	8.294	0.818375	0.16607	.	.	ENSG00000170160	ENST00000340621;ENST00000399273;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000360495	T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1	1.26	-0.977	0.10282	.	.	.	.	.	T	0.10551	0.0258	N	0.22421	0.69	0.09310	N	1	P	0.50156	0.932	B	0.40782	0.34	T	0.16958	-1.0385	8	.	.	.	.	2.5055	0.04644	0.4059:0.2768:0.3173:0.0	.	344	A2RUR9	C144A_HUMAN	F	343;344;344;344;344;344	ENSP00000344740:C343F;ENSP00000382215:C344F;ENSP00000439262:C344F;ENSP00000440655:C344F;ENSP00000353717:C344F;ENSP00000353685:C344F	.	C	+	2	0	CCDC144A	16553127	0.001000	0.12720	0.345000	0.25642	0.104000	0.19210	-0.838000	0.04372	-0.135000	0.11495	0.175000	0.17021	TGT	CCDC144A	-	NULL	ENSG00000170160		0.383	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	HGNC	protein_coding	OTTHUMT00000444093.1	-	0.00	242	0	G			16612402	+1	tier1	-	no_errors	ENST00000360524	ensembl	human	known	74_37	missense	6.90	297	22	SNP	0.001	T
CCDC15	80071	genome.wustl.edu	37	11	124845083	124845083	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:124845083G>A	ENST00000344762.5	+	5	867	c.608G>A	c.(607-609)aGg>aAg	p.R203K	CCDC15_ENST00000529051.1_Missense_Mutation_p.R203K	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	203						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		GATGATGGAAGGAAAAGCTTT	0.343																																																	0													38.0	35.0	36.0					11																	124845083		1823	4067	5890	SO:0001583	missense	0			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.608G>A	11.37:g.124845083G>A	ENSP00000341684:p.Arg203Lys		Q9H8U7	Missense_Mutation	SNP	NULL	p.R203K	ENST00000344762.5	37	c.608	CCDS44756.1	11	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110318	0.56398	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.37411	1.2;1.2	5.08	-1.06	0.10002	.	0.309807	0.28176	N	0.016301	T	0.11196	0.0273	N	0.11201	0.11	0.09310	N	1	B	0.13145	0.007	B	0.14578	0.011	T	0.22730	-1.0208	10	0.02654	T	1	-8.3538	1.725	0.02920	0.3049:0.1358:0.4217:0.1375	.	203	Q0P6D6	CCD15_HUMAN	K	203	ENSP00000435403:R203K;ENSP00000341684:R203K	ENSP00000341684:R203K	R	+	2	0	CCDC15	124350293	0.000000	0.05858	0.018000	0.16275	0.697000	0.40408	-0.561000	0.05957	0.101000	0.17610	0.563000	0.77884	AGG	CCDC15	-	NULL	ENSG00000149548		0.343	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC15	HGNC	protein_coding	OTTHUMT00000387131.1		0.00	41	0	G	NM_025004		124845083	+1			no_errors	ENST00000344762	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	A
CCDC7	79741	genome.wustl.edu	37	10	32856778	32856778	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:32856778G>A	ENST00000362006.5	+	16	1921	c.1378G>A	c.(1378-1380)Ggt>Agt	p.G460S	C10orf68_ENST00000375028.3_De_novo_Start_OutOfFrame|C10orf68_ENST00000572165.1_3'UTR|C10orf68_ENST00000375030.2_De_novo_Start_InFrame|CCDC7_ENST00000277657.6_Missense_Mutation_p.G460S	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	460								p.G460S(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				TTCAGATTCAGGTGGACAAAG	0.328																																																	1	Substitution - Missense(1)	prostate(1)											77.0	77.0	77.0					10																	32856778		2203	4299	6502	SO:0001583	missense	0			BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.1378G>A	10.37:g.32856778G>A	ENSP00000355078:p.Gly460Ser		Q5VW55|Q8IVQ0|Q8NEQ0	Missense_Mutation	SNP	NULL	p.G460S	ENST00000362006.5	37	c.1378	CCDS7173.1	10	.	.	.	.	.	.	.	.	.	.	G	13.58	2.279800	0.40294	.	.	ENSG00000216937	ENST00000277657;ENST00000362006;ENST00000435402	T;T;T	0.59906	1.14;1.14;0.23	4.3	-0.844	0.10741	.	.	.	.	.	T	0.35008	0.0917	N	0.24115	0.695	0.09310	N	1	P	0.46784	0.884	B	0.40940	0.344	T	0.18840	-1.0324	9	0.26408	T	0.33	-4.4983	3.2962	0.06966	0.4132:0.0:0.4031:0.1837	.	460	Q96M83	CCDC7_HUMAN	S	460;460;129	ENSP00000277657:G460S;ENSP00000355078:G460S;ENSP00000401923:G129S	ENSP00000277657:G460S	G	+	1	0	CCDC7	32896784	0.000000	0.05858	0.000000	0.03702	0.256000	0.26092	-0.733000	0.04898	-0.057000	0.13199	0.650000	0.86243	GGT	CCDC7	-	NULL	ENSG00000216937		0.328	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CCDC7	HGNC	protein_coding	OTTHUMT00000047490.1	-	0.00	16	0	G	NM_145023		32856778	+1	tier1	-	no_errors	ENST00000277657	ensembl	human	known	74_37	missense	26.32	14	5	SNP	0.001	A
CCER1	196477	genome.wustl.edu	37	12	91348442	91348442	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:91348442C>G	ENST00000358859.2	-	1	511	c.78G>C	c.(76-78)tgG>tgC	p.W26C	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	26																	CCGAGTGTGCCCAgccacagc	0.652																																																	0													9.0	8.0	8.0					12																	91348442		2147	4220	6367	SO:0001583	missense	0			BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.78G>C	12.37:g.91348442C>G	ENSP00000351727:p.Trp26Cys		Q8TC47	Missense_Mutation	SNP	NULL	p.W26C	ENST00000358859.2	37	c.78	CCDS9036.1	12	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035695	0.54896	.	.	ENSG00000197651	ENST00000358859	T	0.35048	1.33	5.08	4.2	0.49525	.	0.000000	0.32328	N	0.006251	T	0.42653	0.1212	N	0.24115	0.695	0.52501	D	0.99995	D	0.89917	1.0	D	0.80764	0.994	T	0.40961	-0.9535	10	0.87932	D	0	-6.4946	9.5742	0.39447	0.0:0.9051:0.0:0.0949	.	26	Q8TC90	CL012_HUMAN	C	26	ENSP00000351727:W26C	ENSP00000351727:W26C	W	-	3	0	C12orf12	89872573	0.880000	0.30214	0.790000	0.31976	0.054000	0.15201	1.208000	0.32345	1.381000	0.46364	-0.448000	0.05591	TGG	CCER1	-	NULL	ENSG00000197651		0.652	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCER1	HGNC	protein_coding	OTTHUMT00000407142.2	-	0.00	38	0	C	NM_152638		91348442	-1	tier1	-	no_errors	ENST00000358859	ensembl	human	known	74_37	missense	12.50	42	6	SNP	0.889	G
CCL18	6362	genome.wustl.edu	37	17	34398331	34398331	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:34398331G>T	ENST00000004921.3	+	3	263	c.200G>T	c.(199-201)cGg>cTg	p.R67L	AC069363.1_ENST00000588864.1_RNA|AC069363.1_ENST00000590992.1_RNA	NM_002988.2	NP_002979.1	P55774	CCL18_HUMAN	chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)	67					cell chemotaxis (GO:0060326)|cell communication (GO:0007154)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|response to biotic stimulus (GO:0009607)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)			endometrium(1)|large_intestine(2)|lung(1)	4		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AAGAGAGGCCGGCAGATCTGT	0.557																																																	0													80.0	80.0	80.0					17																	34398331		2203	4300	6503	SO:0001583	missense	0			Y13710	CCDS11306.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000006074	ENSG00000275385		"""Chemokine ligands"""	10616	protein-coding gene	gene with protein product		603757	"""small inducible cytokine subfamily A (Cys-Cys), member 18, pulmonary and activation-regulated"""	SCYA18		9233607, 10049593	Standard	NM_002988		Approved	DC-CK1, PARC, AMAC-1, DCCK1, MIP-4, CKb7	uc002hku.3	P55774	OTTHUMG00000188410	ENST00000004921.3:c.200G>T	17.37:g.34398331G>T	ENSP00000004921:p.Arg67Leu		B5BUM2|Q53X71	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.R67L	ENST00000004921.3	37	c.200	CCDS11306.1	17	.	.	.	.	.	.	.	.	.	.	.	11.19	1.564931	0.27915	.	.	ENSG00000006074	ENST00000004921	T	0.06768	3.26	4.44	1.16	0.20824	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.204155	0.31747	N	0.007132	T	0.19366	0.0465	.	.	.	0.09310	N	1	D	0.71674	0.998	D	0.72625	0.978	T	0.03514	-1.1029	9	0.62326	D	0.03	.	4.8691	0.13624	0.1968:0.1737:0.6295:0.0	.	67	P55774	CCL18_HUMAN	L	67	ENSP00000004921:R67L	ENSP00000004921:R67L	R	+	2	0	CCL18	31422444	0.003000	0.15002	0.005000	0.12908	0.018000	0.09664	0.697000	0.25556	0.180000	0.19960	0.591000	0.81541	CGG	CCL18	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000006074		0.557	CCL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL18	HGNC	protein_coding	OTTHUMT00000256583.1	-	0.00	276	0	G	NM_002988		34398331	+1	tier1	-	no_errors	ENST00000004921	ensembl	human	known	74_37	missense	10.14	256	29	SNP	0.029	T
CCNB1IP1	57820	genome.wustl.edu	37	14	20779823	20779823	+	Silent	SNP	C	C	A	rs372100580	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:20779823C>A	ENST00000398169.3	-	7	1336	c.720G>T	c.(718-720)gcG>gcT	p.A240A	CCNB1IP1_ENST00000358932.4_Silent_p.A240A|CCNB1IP1_ENST00000353689.4_Silent_p.A240A|CCNB1IP1_ENST00000437553.2_Silent_p.A240A|CCNB1IP1_ENST00000398163.2_Silent_p.A240A|CCNB1IP1_ENST00000398160.2_Silent_p.A240A			Q9NPC3	CIP1_HUMAN	cyclin B1 interacting protein 1, E3 ubiquitin protein ligase	240					blastocyst formation (GO:0001825)|chiasma assembly (GO:0051026)|protein ubiquitination (GO:0016567)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		HMGA2/CCNB1IP1(2)	breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;8.86e-07)|all cancers(55;4.98e-06)	GBM - Glioblastoma multiforme(265;0.0164)		TGGGAGAACCCGCAAAAAATG	0.458			T	HMGA2	leiomyoma																																			Dom	yes		14	14q11.2	57820	"""cyclin B1 interacting protein 1, E3 ubiquitin protein ligase"""		M	0													114.0	119.0	117.0					14																	20779823		2203	4300	6503	SO:0001819	synonymous_variant	0			AF216381	CCDS9547.1	14q11.2	2014-02-04	2011-01-31	2004-01-14	ENSG00000100814	ENSG00000100814			19437	protein-coding gene	gene with protein product	"""human enhancer of invasion 10"""	608249	"""chromosome 14 open reading frame 18"", ""cyclin B1 interacting protein 1"""	C14orf18		12612082, 21779533	Standard	NM_021178		Approved	HEI10	uc001vwy.4	Q9NPC3	OTTHUMG00000029509	ENST00000398169.3:c.720G>T	14.37:g.20779823C>A				Silent	SNP	NULL	p.A240	ENST00000398169.3	37	c.720	CCDS9547.1	14																																																																																			CCNB1IP1	-	NULL	ENSG00000100814		0.458	CCNB1IP1-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	CCNB1IP1	HGNC	protein_coding	OTTHUMT00000073538.3	-	0.00	60	0	C	NM_021178, NM_182849, NM_182851, NM_182852		20779823	-1	tier1	-	no_errors	ENST00000353689	ensembl	human	known	74_37	silent	8.86	72	7	SNP	1.000	A
CCNT2	905	genome.wustl.edu	37	2	135705377	135705377	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:135705377G>T	ENST00000264157.5	+	7	641	c.611G>T	c.(610-612)tGc>tTc	p.C204F	CCNT2_ENST00000537343.1_Missense_Mutation_p.C29F|CCNT2_ENST00000295238.6_Missense_Mutation_p.C204F	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	204					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		CATTTGGCTTGCAAATGGTCC	0.408																																																	0													164.0	149.0	154.0					2																	135705377		2203	4300	6503	SO:0001583	missense	0			AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.611G>T	2.37:g.135705377G>T	ENSP00000264157:p.Cys204Phe		A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.C204F	ENST00000264157.5	37	c.611	CCDS2174.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.607032|4.607032	0.87157|0.87157	.|.	.|.	ENSG00000082258|ENSG00000082258	ENST00000446247;ENST00000537343;ENST00000295238;ENST00000264157|ENST00000452521	T;T;T;T|.	0.42513|.	0.97;0.97;0.97;0.97|.	5.33|5.33	5.33|5.33	0.75918|0.75918	Cyclin-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84492|0.84492	0.5484|0.5484	M|M	0.88570|0.88570	2.965|2.965	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;0.999;1.0|.	D;D;D|.	0.87578|.	0.998;0.975;0.998|.	D|D	0.86770|0.86770	0.1972|0.1972	10|5	0.66056|.	D|.	0.02|.	.|.	19.015|19.015	0.92890|0.92890	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	29;204;204|.	B4DH21;O60583;O60583-2|.	.;CCNT2_HUMAN;.|.	F|F	45;29;204;204|26	ENSP00000399497:C45F;ENSP00000439506:C29F;ENSP00000295238:C204F;ENSP00000264157:C204F|.	ENSP00000264157:C204F|.	C|L	+|+	2|3	0|2	CCNT2|CCNT2	135421847|135421847	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.869000|9.869000	0.99810|0.99810	2.495000|2.495000	0.84180|0.84180	0.591000|0.591000	0.81541|0.81541	TGC|TTG	CCNT2	-	superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000082258		0.408	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNT2	HGNC	protein_coding	OTTHUMT00000254629.1	-	0.00	67	0	G	NM_058241		135705377	+1	tier1	-	no_errors	ENST00000264157	ensembl	human	known	74_37	missense	10.64	84	10	SNP	1.000	T
CCNY	219771	genome.wustl.edu	37	10	35819102	35819102	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:35819102G>T	ENST00000374704.4	+	7	690	c.510G>T	c.(508-510)caG>caT	p.Q170H	CCNY_ENST00000339497.5_Missense_Mutation_p.Q145H|CCNY_ENST00000265375.9_Missense_Mutation_p.Q116H|CCNY_ENST00000492478.1_3'UTR|CCNY_ENST00000374706.1_Missense_Mutation_p.Q116H	NM_145012.4	NP_659449.3	Q8ND76	CCNY_HUMAN	cyclin Y	170	Cyclin N-terminal.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	8						AGCAGAAGCAGATTTACCGGT	0.512																																																	0													129.0	93.0	105.0					10																	35819102		2203	4300	6503	SO:0001583	missense	0			AF413522, AY504868	CCDS7189.1, CCDS7190.1, CCDS60513.1	10p11.22	2011-01-25	2007-02-09	2007-02-09	ENSG00000108100	ENSG00000108100			23354	protein-coding gene	gene with protein product		612786	"""chromosome 10 open reading frame 9"""	C10orf9		20441050	Standard	XM_005252388		Approved	CFP1, CBCP1	uc001iyw.4	Q8ND76	OTTHUMG00000017955	ENST00000374704.4:c.510G>T	10.37:g.35819102G>T	ENSP00000363836:p.Gln170His		B7ZKX9|D3DRY9|Q2M3V4|Q2TU96|Q6NT86|Q7Z4U7|Q8TEX2|Q8TEX3|Q96M99|Q96P45	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_PHO80-like,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_Y	p.Q170H	ENST00000374704.4	37	c.510	CCDS7189.1	10	.	.	.	.	.	.	.	.	.	.	G	9.726	1.160893	0.21538	.	.	ENSG00000108100	ENST00000374706;ENST00000537547;ENST00000374704;ENST00000339497;ENST00000265375;ENST00000456784	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	5.91	4.05	0.47172	Cyclin, N-terminal (1);Cyclin-like (2);	0.049357	0.85682	D	0.000000	T	0.05502	0.0145	N	0.11927	0.2	0.50467	D	0.999873	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.002	T	0.36237	-0.9756	10	0.14656	T	0.56	-1.5679	8.6576	0.34073	0.1311:0.1239:0.745:0.0	.	37;145;170	B7Z8E4;Q8ND76-2;Q8ND76	.;.;CCNY_HUMAN	H	116;170;170;145;116;37	ENSP00000363838:Q116H;ENSP00000363836:Q170H;ENSP00000344275:Q145H;ENSP00000265375:Q116H	ENSP00000265375:Q116H	Q	+	3	2	CCNY	35859108	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.204000	0.42761	0.819000	0.34492	0.655000	0.94253	CAG	CCNY	-	pfam_Cyclin_N,pfam_Cyclin_PHO80-like,superfamily_Cyclin-like,pirsf_Cyclin_Y	ENSG00000108100		0.512	CCNY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNY	HGNC	protein_coding	OTTHUMT00000047568.2	-	0.00	45	0	G	NM_181698		35819102	+1	tier1	-	no_errors	ENST00000374704	ensembl	human	known	74_37	missense	21.21	51	14	SNP	1.000	T
CCT3	7203	genome.wustl.edu	37	1	156279014	156279014	+	Silent	SNP	C	C	A	rs143692903		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:156279014C>A	ENST00000295688.3	-	14	1894	c.1614G>T	c.(1612-1614)ggG>ggT	p.G538G	CCT3_ENST00000368259.2_Silent_p.G500G|CCT3_ENST00000472765.2_Silent_p.G493G|CCT3_ENST00000368261.3_Silent_p.G493G	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	538					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CATCAGGAGCCCCGCCTTGCC	0.537																																																	0													109.0	117.0	114.0					1																	156279014		2203	4300	6503	SO:0001819	synonymous_variant	0			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.1614G>T	1.37:g.156279014C>A			A6NE14|Q5SZY1|Q9BR64	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_gamma	p.G538	ENST00000295688.3	37	c.1614	CCDS1140.2	1																																																																																			CCT3	-	NULL	ENSG00000163468		0.537	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	-	0.00	68	0	C	NM_005998		156279014	-1	tier1	-	no_errors	ENST00000295688	ensembl	human	known	74_37	silent	8.64	74	7	SNP	0.993	A
CD200R1L	344807	genome.wustl.edu	37	3	112545840	112545840	+	Splice_Site	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:112545840C>G	ENST00000398214.1	-	4	904	c.679G>C	c.(679-681)Ggt>Cgt	p.G227R	CD200R1L_ENST00000488794.1_Splice_Site_p.G206R|CD200R1L_ENST00000448932.1_Splice_Site_p.G206R	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	227						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						AGGCGCTTACCTGAATTCAAC	0.433																																																	0													64.0	67.0	66.0					3																	112545840		2172	4295	6467	SO:0001630	splice_region_variant	0			AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.679+1G>C	3.37:g.112545840C>G			Q6WHB7	Missense_Mutation	SNP	pfam_CD80_C2-set,pfscan_Ig-like_dom	p.G227R	ENST00000398214.1	37	c.679	CCDS43131.1	3	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135518	0.37728	.	.	ENSG00000206531	ENST00000398214;ENST00000488794;ENST00000448932	T;T;T	0.19669	2.13;2.16;2.16	3.6	1.62	0.23740	.	1.862370	0.02632	N	0.104408	T	0.26122	0.0637	L	0.55990	1.75	0.09310	N	1	P	0.45902	0.868	P	0.45506	0.483	T	0.09862	-1.0655	9	.	.	.	.	4.0427	0.09758	0.2227:0.6414:0.0:0.1359	.	227	Q6Q8B3	MO2R2_HUMAN	R	227;206;206	ENSP00000381272:G227R;ENSP00000418413:G206R;ENSP00000415132:G206R	.	G	-	1	0	CD200R1L	114028530	0.434000	0.25570	0.005000	0.12908	0.059000	0.15707	0.624000	0.24462	0.239000	0.21243	0.655000	0.94253	GGT	CD200R1L	-	NULL	ENSG00000206531		0.433	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD200R1L	HGNC	protein_coding	OTTHUMT00000354365.1	-	0.00	56	0	C	NM_001008784	Missense_Mutation	112545840	-1	tier1	-	no_errors	ENST00000398214	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.014	G
CDCA8	55143	genome.wustl.edu	37	1	38166128	38166128	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:38166128G>T	ENST00000373055.1	+	5	631	c.358G>T	c.(358-360)Gat>Tat	p.D120Y	CDCA8_ENST00000327331.2_Missense_Mutation_p.D120Y	NM_001256875.1|NM_018101.3	NP_001243804.1|NP_060571.1	Q53HL2	BOREA_HUMAN	cell division cycle associated 8	120	Required for interaction with SENP3.				chromosome organization (GO:0051276)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(1)|stomach(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AATACAGGTAGATGAAATGAT	0.368																																																	0													121.0	118.0	119.0					1																	38166128		2203	4300	6503	SO:0001583	missense	0			BG354581	CCDS424.1	1p34.3	2013-01-17			ENSG00000134690	ENSG00000134690			14629	protein-coding gene	gene with protein product	"""borealin"""	609977				12188893, 15260989	Standard	NM_001256875		Approved	FLJ12042, MESRGP, BOR, DasraB	uc001cbs.4	Q53HL2	OTTHUMG00000004320	ENST00000373055.1:c.358G>T	1.37:g.38166128G>T	ENSP00000362146:p.Asp120Tyr		D3DPT4|Q53HN1|Q96AM3|Q9NVW5	Missense_Mutation	SNP	pfam_Cell_div_borealin,pfam_Borealin-like_N	p.D120Y	ENST00000373055.1	37	c.358	CCDS424.1	1	.	.	.	.	.	.	.	.	.	.	G	10.01	1.234298	0.22626	.	.	ENSG00000134690	ENST00000373055;ENST00000327331	T;T	0.48522	0.81;0.81	4.25	3.33	0.38152	.	0.641517	0.15236	N	0.273162	T	0.36276	0.0961	L	0.44542	1.39	0.28748	N	0.901609	B	0.33379	0.41	B	0.28784	0.094	T	0.33854	-0.9852	10	0.59425	D	0.04	-0.2724	8.2834	0.31913	0.1098:0.0:0.8902:0.0	.	120	Q53HL2	BOREA_HUMAN	Y	120	ENSP00000362146:D120Y;ENSP00000316121:D120Y	ENSP00000316121:D120Y	D	+	1	0	CDCA8	37938715	1.000000	0.71417	0.994000	0.49952	0.406000	0.30931	2.647000	0.46639	1.133000	0.42147	-0.157000	0.13467	GAT	CDCA8	-	NULL	ENSG00000134690		0.368	CDCA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA8	HGNC	protein_coding	OTTHUMT00000012473.1	-	0.00	66	0	G	NM_018101		38166128	+1	tier1	-	no_errors	ENST00000327331	ensembl	human	known	74_37	missense	17.07	66	14	SNP	0.998	T
CDH22	64405	genome.wustl.edu	37	20	44856180	44856180	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:44856180C>A	ENST00000372262.3	-	3	1037	c.637G>T	c.(637-639)Ggc>Tgc	p.G213C	CDH22_ENST00000537909.1_Missense_Mutation_p.G213C	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	213	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				TGGTGCTCGCCGTCCAGCACG	0.736																																																	0													27.0	23.0	24.0					20																	44856180		2203	4299	6502	SO:0001583	missense	0			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.637G>T	20.37:g.44856180C>A	ENSP00000361336:p.Gly213Cys		B9EGK7|O43205	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G213C	ENST00000372262.3	37	c.637	CCDS13395.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.222380	0.95139	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.57752	0.38;0.38	5.14	5.14	0.70334	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.81805	0.4900	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87565	0.2474	10	0.87932	D	0	.	17.7901	0.88550	0.0:1.0:0.0:0.0	.	213	Q9UJ99	CAD22_HUMAN	C	213	ENSP00000361336:G213C;ENSP00000437790:G213C	ENSP00000361336:G213C	G	-	1	0	CDH22	44289587	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.651000	0.83577	2.667000	0.90743	0.563000	0.77884	GGC	CDH22	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000149654		0.736	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1	-	0.00	88	0	C	NM_021248		44856180	-1	tier1	-	no_errors	ENST00000372262	ensembl	human	known	74_37	missense	9.92	109	12	SNP	1.000	A
CDH23	64072	genome.wustl.edu	37	10	73571509	73571509	+	Splice_Site	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:73571509T>A	ENST00000224721.6	+	64	9338	c.9333T>A	c.(9331-9333)gcT>gcA	p.A3111A	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Splice_Site_p.A866A	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	3106					calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CTGGCTCAGCTGGTAAGTGAG	0.637																																																	0													17.0	20.0	19.0					10																	73571509		1979	4143	6122	SO:0001630	splice_region_variant	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.9334+1T>A	10.37:g.73571509T>A			C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A866	ENST00000224721.6	37	c.2598		10																																																																																			CDH23	-	NULL	ENSG00000107736		0.637	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	-	0.00	59	0	T	NM_052836	Silent	73571509	+1	tier1	-	no_errors	ENST00000398788	ensembl	human	known	74_37	silent	10.53	49	6	SNP	0.953	A
CDH4	1002	genome.wustl.edu	37	20	60499458	60499458	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:60499458G>T	ENST00000360469.5	+	11	1783	c.1695G>T	c.(1693-1695)acG>acT	p.T565T	CDH4_ENST00000543233.1_Silent_p.T491T	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	565	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGATCACCACGGCGGCAGTGC	0.612																																																	0													115.0	89.0	98.0					20																	60499458		2203	4300	6503	SO:0001819	synonymous_variant	0			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1695G>T	20.37:g.60499458G>T			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.T565	ENST00000360469.5	37	c.1695	CCDS13488.1	20																																																																																			CDH4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000179242		0.612	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	-	0.00	53	0	G	NM_001794		60499458	+1	tier1	-	no_errors	ENST00000360469	ensembl	human	known	74_37	silent	6.98	80	6	SNP	0.047	T
CDH7	1005	genome.wustl.edu	37	18	63489458	63489458	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr18:63489458A>T	ENST00000397968.2	+	5	1193	c.767A>T	c.(766-768)aAc>aTc	p.N256I	CDH7_ENST00000323011.3_Missense_Mutation_p.N256I|CDH7_ENST00000536984.2_Missense_Mutation_p.N256I	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	256	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				ACTGATGTCAACGATAATCCA	0.388																																																	0													167.0	119.0	135.0					18																	63489458		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.767A>T	18.37:g.63489458A>T	ENSP00000381058:p.Asn256Ile		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N256I	ENST00000397968.2	37	c.767	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	A	22.3	4.275781	0.80580	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.77750	-1.12;-1.12;-1.12	5.0	5.0	0.66597	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.104300	0.64402	D	0.000012	D	0.91064	0.7188	H	0.94925	3.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.93569	0.6902	10	0.87932	D	0	.	15.0123	0.71557	1.0:0.0:0.0:0.0	.	256;256	F5H5X9;Q9ULB5	.;CADH7_HUMAN	I	256	ENSP00000319166:N256I;ENSP00000443030:N256I;ENSP00000381058:N256I	ENSP00000319166:N256I	N	+	2	0	CDH7	61640438	1.000000	0.71417	0.977000	0.42913	0.890000	0.51754	8.755000	0.91646	1.999000	0.58509	0.477000	0.44152	AAC	CDH7	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000081138		0.388	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	-	0.00	47	0	A	NM_033646		63489458	+1	tier1	-	no_errors	ENST00000323011	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
CEACAM18	729767	genome.wustl.edu	37	19	51986279	51986279	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:51986279G>C	ENST00000396477.4	+	4	703	c.682G>C	c.(682-684)Gac>Cac	p.D228H	CEACAM18_ENST00000451626.1_Missense_Mutation_p.D289H	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	228	Ig-like C2-type.							p.D289H(2)|p.D228H(2)		breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		AGATGGGCCCGACTATGTGCT	0.552																																																	4	Substitution - Missense(4)	lung(4)											160.0	153.0	155.0					19																	51986279		1965	4158	6123	SO:0001583	missense	0					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.682G>C	19.37:g.51986279G>C	ENSP00000379738:p.Asp228His		C9JN24	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D289H	ENST00000396477.4	37	c.865		19	.	.	.	.	.	.	.	.	.	.	.	11.69	1.712590	0.30322	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.07327	3.2	2.76	0.386	0.16254	Immunoglobulin-like (1);	.	.	.	.	T	0.18800	0.0451	M	0.63428	1.95	0.09310	N	1	D	0.60160	0.987	P	0.61201	0.885	T	0.07693	-1.0759	9	0.72032	D	0.01	-13.5954	7.2542	0.26166	0.0:0.0:0.4815:0.5185	.	289	A8MTB9	CEA18_HUMAN	H	289;228;228	ENSP00000402203:D289H	ENSP00000379738:D228H	D	+	1	0	CEACAM18	56678091	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	0.400000	0.20932	0.193000	0.20303	0.456000	0.33151	GAC	CEACAM18	-	pfscan_Ig-like_dom	ENSG00000213822		0.552	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	HGNC	protein_coding	OTTHUMT00000323114.2		0.00	52	0	G			51986279	+1			no_errors	ENST00000451626	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.001	C
CELF3	11189	genome.wustl.edu	37	1	151679697	151679697	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:151679697G>C	ENST00000290583.4	-	8	1639	c.846C>G	c.(844-846)taC>taG	p.Y282*	CELF3_ENST00000392706.3_Nonsense_Mutation_p.Y99*|CELF3_ENST00000470688.1_5'UTR|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000290585.4_Intron	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	282					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.Y282*(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						GCACCGGGCTGTAGCCGTTGA	0.672																																																	1	Substitution - Nonsense(1)	kidney(1)											24.0	23.0	24.0					1																	151679697		2178	4276	6454	SO:0001587	stop_gained	0			U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.846C>G	1.37:g.151679697G>C	ENSP00000290583:p.Tyr282*		B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Y282*	ENST00000290583.4	37	c.846	CCDS1002.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	43|43	9.921316|9.921316	0.99295|0.99295	.|.	.|.	ENSG00000159409|ENSG00000159409	ENST00000420342|ENST00000290583;ENST00000392706	.|.	.|.	.|.	3.86|3.86	3.86|3.86	0.44501|0.44501	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|.	0.14399|.	0.0348|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.06789|.	-1.0807|.	3|.	.|0.09338	.|T	.|0.73	-4.7475|-4.7475	8.5218|8.5218	0.33279|0.33279	0.1086:0.0:0.8914:0.0|0.1086:0.0:0.8914:0.0	.|.	.|.	.|.	.|.	R|X	283|282;99	.|.	.|ENSP00000290583:Y282X	T|Y	-|-	2|3	0|2	CELF3|CELF3	149946321|149946321	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	6.195000|6.195000	0.72088|0.72088	2.008000|2.008000	0.58898|0.58898	0.555000|0.555000	0.69702|0.69702	ACA|TAC	CELF3	-	NULL	ENSG00000159409		0.672	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF3	HGNC	protein_coding	OTTHUMT00000036663.2	-	0.00	36	0	G	NM_007185		151679697	-1	tier1	-	no_errors	ENST00000290583	ensembl	human	known	74_37	nonsense	14.52	53	9	SNP	1.000	C
CENPA	1058	genome.wustl.edu	37	2	27015647	27015647	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:27015647C>T	ENST00000335756.4	+	3	434	c.234C>T	c.(232-234)ttC>ttT	p.F78F	CENPA_ENST00000475662.1_Intron|CENPA_ENST00000233505.8_Intron	NM_001809.3	NP_001800.1	P49450	CENPA_HUMAN	centromere protein A	78	CATD.|H3-like.				CENP-A containing nucleosome assembly (GO:0034080)|establishment of mitotic spindle orientation (GO:0000132)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|protein localization to chromosome, centromeric region (GO:0071459)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|condensed chromosome inner kinetochore (GO:0000939)|condensed nuclear chromosome kinetochore (GO:0000778)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(3)|lung(3)|urinary_tract(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGTTAAATTCACTCGTGGTG	0.507																																					Pancreas(28;769 878 30250 30578 41330)												0													90.0	91.0	90.0					2																	27015647		2203	4300	6503	SO:0001819	synonymous_variant	0			U14518	CCDS1729.1, CCDS42662.1	2p23.3	2013-11-05	2006-06-16		ENSG00000115163	ENSG00000115163			1851	protein-coding gene	gene with protein product	"""centromere-specific histone"", ""histone H3-like centromeric protein A"""	117139	"""centromere protein A (17kD)"", ""centromere protein A, 17kDa"""				Standard	NM_001042426		Approved	CENP-A, CenH3	uc002rhr.3	P49450	OTTHUMG00000097073	ENST00000335756.4:c.234C>T	2.37:g.27015647C>T			D6W544|Q53T74|Q9BVW2	Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.F78	ENST00000335756.4	37	c.234	CCDS1729.1	2																																																																																			CENPA	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3	ENSG00000115163		0.507	CENPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPA	HGNC	protein_coding	OTTHUMT00000214190.2	-	0.00	43	0	C	NM_001809		27015647	+1	tier1	-	no_errors	ENST00000335756	ensembl	human	known	74_37	silent	10.77	58	7	SNP	0.998	T
CENPB	1059	genome.wustl.edu	37	20	3767129	3767129	+	Start_Codon_SNP	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:3767129A>G	ENST00000379751.4	-	1	208	c.2T>C	c.(1-3)aTg>aCg	p.M1T	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	1					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						CTTGGGGCCCATcccggcgcg	0.801																																																	0													17.0	18.0	18.0					20																	3767129		2198	4288	6486	SO:0001582	initiator_codon_variant	0			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.2T>C	20.37:g.3767129A>G	ENSP00000369075:p.Met1Thr		Q96EI4	Missense_Mutation	SNP	pfam_Centromere_CenpB_dimerisation,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.M1T	ENST00000379751.4	37	c.2	CCDS13064.1	20	.	.	.	.	.	.	.	.	.	.	a	15.00	2.703062	0.48412	.	.	ENSG00000125817	ENST00000379751	T	0.42513	0.97	2.68	2.68	0.31781	Homeodomain-like (1);Helix-turn-helix, Psq-like (1);	0.000000	0.41500	U	0.000876	T	0.38878	0.1057	.	.	.	0.80722	D	1	P	0.42993	0.797	B	0.42959	0.403	T	0.32981	-0.9886	9	0.72032	D	0.01	.	8.8465	0.35172	1.0:0.0:0.0:0.0	.	1	P07199	CENPB_HUMAN	T	1	ENSP00000369075:M1T	ENSP00000369075:M1T	M	-	2	0	CENPB	3715129	0.032000	0.19561	1.000000	0.80357	0.791000	0.44710	1.019000	0.30014	1.014000	0.39417	0.149000	0.16113	ATG	CENPB	-	superfamily_Homeodomain-like,pfscan_HTH_Psq	ENSG00000125817		0.801	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPB	HGNC	protein_coding	OTTHUMT00000077772.2		0.00	35	0	A	NM_001810	Missense_Mutation	3767129	-1			no_errors	ENST00000379751	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	G
CENPF	1063	genome.wustl.edu	37	1	214814241	214814241	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:214814241G>T	ENST00000366955.3	+	12	2728	c.2560G>T	c.(2560-2562)Gaa>Taa	p.E854*		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AAAGCAGTGTGAAGAGTTGGT	0.368																																					Colon(80;575 1284 11000 14801 43496)												0													37.0	38.0	37.0					1																	214814241		2203	4300	6503	SO:0001587	stop_gained	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.2560G>T	1.37:g.214814241G>T	ENSP00000355922:p.Glu854*		Q13171|Q13246|Q5VVM7	Nonsense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_CenpF/LEK1_Rb-prot-bd	p.E854*	ENST00000366955.3	37	c.2560	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	G	41	8.754719	0.98941	.	.	ENSG00000117724	ENST00000366955	.	.	.	5.48	3.54	0.40534	.	0.193909	0.25402	N	0.030937	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	7.0314	0.24969	0.1552:0.1405:0.7043:0.0	.	.	.	.	X	854	.	ENSP00000355922:E854X	E	+	1	0	CENPF	212880864	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	2.549000	0.45803	0.620000	0.30215	0.609000	0.83330	GAA	CENPF	-	NULL	ENSG00000117724		0.368	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1		0.00	22	0	G	NM_016343		214814241	+1			no_errors	ENST00000366955	ensembl	human	known	74_37	nonsense	7.32	38	3	SNP	1.000	T
CEP250	11190	genome.wustl.edu	37	20	34055253	34055253	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:34055253G>T	ENST00000397527.1	+	9	1444	c.724G>T	c.(724-726)Gag>Tag	p.E242*	CEP250_ENST00000397524.1_Nonsense_Mutation_p.E242*|CEP250_ENST00000342580.4_Nonsense_Mutation_p.E242*	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	242					centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GGATGGGCGGGAGCCGGCCCA	0.572																																																	0													72.0	78.0	76.0					20																	34055253		2203	4300	6503	SO:0001587	stop_gained	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.724G>T	20.37:g.34055253G>T	ENSP00000380661:p.Glu242*		E1P5Q3|O14812|O60588|Q9H450	Nonsense_Mutation	SNP	superfamily_Prefoldin	p.E242*	ENST00000397527.1	37	c.724	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	G	15.08	2.728288	0.48833	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000397524;ENST00000425934	.	.	.	5.56	5.56	0.83823	.	2.167190	0.01848	N	0.035716	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	16.3704	0.83355	0.0:0.0:1.0:0.0	.	.	.	.	X	242	.	ENSP00000341541:E242X	E	+	1	0	CEP250	33518667	1.000000	0.71417	0.768000	0.31515	0.157000	0.22087	5.390000	0.66261	2.890000	0.99128	0.655000	0.94253	GAG	CEP250	-	NULL	ENSG00000126001		0.572	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	-	0.00	42	0	G	NM_007186		34055253	+1	tier1	-	no_errors	ENST00000397527	ensembl	human	known	74_37	nonsense	14.00	43	7	SNP	0.863	T
CFTR	1080	genome.wustl.edu	37	7	117235030	117235030	+	Missense_Mutation	SNP	G	G	T	rs397508393		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:117235030G>T	ENST00000003084.6	+	15	2669	c.2537G>T	c.(2536-2538)tGg>tTg	p.W846L	CFTR_ENST00000454343.1_Missense_Mutation_p.W785L	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	846					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GTGACTACATGGAACACATAC	0.358									Cystic Fibrosis																																								0			GRCh37	CM930121	CFTR	M							172.0	159.0	163.0					7																	117235030		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.2537G>T	7.37:g.117235030G>T	ENSP00000003084:p.Trp846Leu		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.W846L	ENST00000003084.6	37	c.2537	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749630	0.89753	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.98105	-4.72;-4.72;-4.72	5.34	5.34	0.76211	ABC transporter, transmembrane domain, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.98601	0.9532	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98372	1.0554	10	0.21014	T	0.42	-9.081	19.3921	0.94587	0.0:0.0:1.0:0.0	.	846	P13569	CFTR_HUMAN	L	846;785;816	ENSP00000003084:W846L;ENSP00000403677:W785L;ENSP00000389119:W816L	ENSP00000003084:W846L	W	+	2	0	CFTR	117022266	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.129000	0.77225	2.652000	0.90054	0.591000	0.81541	TGG	CFTR	-	superfamily_ABC1_TM_dom,tigrfam_cAMP_cl_channel	ENSG00000001626		0.358	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	-	0.00	60	0	G	NM_000492		117235030	+1	tier1	-	no_errors	ENST00000003084	ensembl	human	known	74_37	missense	11.39	70	9	SNP	1.000	T
CHKA	1119	genome.wustl.edu	37	11	67837676	67837676	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:67837676G>C	ENST00000265689.4	-	6	875	c.849C>G	c.(847-849)ccC>ccG	p.P283P	CHKA_ENST00000356135.5_Silent_p.P265P	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha	283					CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	CCAGTTCCAAGGGCAGATTGT	0.343																																																	0													84.0	90.0	88.0					11																	67837676		2200	4294	6494	SO:0001819	synonymous_variant	0			D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.849C>G	11.37:g.67837676G>C			Q8NE29	Silent	SNP	pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	p.P283	ENST00000265689.4	37	c.849	CCDS8178.1	11																																																																																			CHKA	-	pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	ENSG00000110721		0.343	CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHKA	HGNC	protein_coding	OTTHUMT00000394570.1	-	0.00	91	0	G	NM_001277		67837676	-1	tier1	-	no_errors	ENST00000265689	ensembl	human	known	74_37	silent	9.24	108	11	SNP	0.854	C
CHST2	9435	genome.wustl.edu	37	3	142840873	142840873	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:142840873G>T	ENST00000309575.3	+	2	2599	c.1215G>T	c.(1213-1215)acG>acT	p.T405T		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	405					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						TGGCTAAGACGCTGCAGACAG	0.647																																																	0													42.0	50.0	48.0					3																	142840873		2202	4299	6501	SO:0001819	synonymous_variant	0			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1215G>T	3.37:g.142840873G>T			D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.T405	ENST00000309575.3	37	c.1215	CCDS3129.1	3																																																																																			CHST2	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000175040		0.647	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST2	HGNC	protein_coding	OTTHUMT00000354850.1	-	0.00	43	0	G	NM_004267		142840873	+1	tier1	-	no_errors	ENST00000309575	ensembl	human	known	74_37	silent	15.38	44	8	SNP	0.991	T
CHUK	1147	genome.wustl.edu	37	10	101954272	101954272	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:101954272G>T	ENST00000370397.7	-	17	1822	c.1736C>A	c.(1735-1737)tCc>tAc	p.S579Y	CHUK_ENST00000590930.1_5'UTR	NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	579					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	GTCACTGTAGGAGTGATCTAT	0.408																																					Ovarian(159;52 1904 10536 35305 37148)												0													86.0	71.0	76.0					10																	101954272		2203	4300	6503	SO:0001583	missense	0			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.1736C>A	10.37:g.101954272G>T	ENSP00000359424:p.Ser579Tyr		O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S579Y	ENST00000370397.7	37	c.1736	CCDS7488.1	10	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125363	0.56721	.	.	ENSG00000213341	ENST00000370397	T	0.22945	1.93	5.8	2.92	0.33932	.	0.399275	0.27759	N	0.017971	T	0.23410	0.0566	L	0.40543	1.245	0.24078	N	0.995959	P	0.52842	0.956	P	0.44732	0.459	T	0.06881	-1.0802	10	0.66056	D	0.02	0.0485	10.3737	0.44068	0.2171:0.0:0.7829:0.0	.	579	O15111	IKKA_HUMAN	Y	579	ENSP00000359424:S579Y	ENSP00000359424:S579Y	S	-	2	0	CHUK	101944262	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	2.126000	0.42026	0.358000	0.24211	0.655000	0.94253	TCC	CHUK	-	NULL	ENSG00000213341		0.408	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHUK	HGNC	protein_coding	OTTHUMT00000049836.1		0.00	20	0	G	NM_001278		101954272	-1			no_errors	ENST00000370397	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.987	T
CINP	51550	genome.wustl.edu	37	14	102815064	102815064	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:102815064T>A	ENST00000216756.6	-	5	509	c.469A>T	c.(469-471)Agg>Tgg	p.R157W	CINP_ENST00000560326.1_5'Flank|CINP_ENST00000536961.2_Missense_Mutation_p.R172W|CINP_ENST00000541568.2_Silent_p.T113T	NM_032630.2	NP_116019.1	Q9BW66	CINP_HUMAN	cyclin-dependent kinase 2 interacting protein	157				R -> K (in Ref. 1; AAF44747/AAF44748). {ECO:0000305}.	cell cycle (GO:0007049)|cell division (GO:0051301)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	nucleus (GO:0005634)				large_intestine(2)|lung(2)	4						AGCTCCTTCCTGTACATCTCC	0.537																																																	0													69.0	48.0	55.0					14																	102815064		2203	4300	6503	SO:0001583	missense	0			AK056112, AF228148, AF228149	CCDS9972.1	14q32.33	2010-02-17			ENSG00000100865	ENSG00000100865			23789	protein-coding gene	gene with protein product		613362				16082200	Standard	NM_032630		Approved	MGC849	uc021sea.1	Q9BW66		ENST00000216756.6:c.469A>T	14.37:g.102815064T>A	ENSP00000216756:p.Arg157Trp		F5H7P3|F5H8A7|Q9NPF9	Missense_Mutation	SNP	prints_Cyclin-dep_Kinase_2_interact	p.R172W	ENST00000216756.6	37	c.514	CCDS9972.1	14	.	.	.	.	.	.	.	.	.	.	T	11.79	1.742516	0.30865	.	.	ENSG00000100865	ENST00000216756;ENST00000536961	T;T	0.46819	0.88;0.86	6.07	-12.1	0.00011	.	1.100120	0.06780	N	0.785142	T	0.20495	0.0493	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.53620	-0.8413	10	0.59425	D	0.04	.	6.4875	0.22097	0.1252:0.1587:0.4969:0.2192	.	157	Q9BW66	CINP_HUMAN	W	157;172	ENSP00000216756:R157W;ENSP00000442057:R172W	ENSP00000216756:R157W	R	-	1	2	CINP	101884817	0.000000	0.05858	0.000000	0.03702	0.555000	0.35460	-0.909000	0.04058	-4.847000	0.00029	-1.106000	0.02097	AGG	CINP	-	prints_Cyclin-dep_Kinase_2_interact	ENSG00000100865		0.537	CINP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CINP	HGNC	protein_coding	OTTHUMT00000415055.1	-	0.00	30	0	T	NM_032630		102815064	-1	tier1	-	no_errors	ENST00000536961	ensembl	human	known	74_37	missense	17.24	24	5	SNP	0.000	A
CLCN4	1183	genome.wustl.edu	37	X	10180566	10180566	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:10180566G>T	ENST00000380833.4	+	10	1840	c.1449G>T	c.(1447-1449)gtG>gtT	p.V483V	CLCN4_ENST00000421085.2_Silent_p.V389V|CLCN4_ENST00000380829.1_Silent_p.V452V	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	483					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GCAGGATGGTGGGAATTGGCG	0.582																																					Melanoma(74;1050 1296 1576 30544 38374)												0													96.0	79.0	84.0					X																	10180566		2203	4300	6503	SO:0001819	synonymous_variant	0			X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.1449G>T	X.37:g.10180566G>T			A1L3U1|B7Z5Z4|Q9UBU1	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,smart_CBS_dom,prints_Cl-channel_volt-gated,prints_Cl_channel-4	p.V483	ENST00000380833.4	37	c.1449	CCDS14137.1	X																																																																																			CLCN4	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated	ENSG00000073464		0.582	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN4	HGNC	protein_coding	OTTHUMT00000055730.1		0.00	69	0	G			10180566	+1			no_errors	ENST00000380833	ensembl	human	known	74_37	silent	7.25	64	5	SNP	1.000	T
CLCNKA	1187	genome.wustl.edu	37	1	16357020	16357020	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:16357020G>T	ENST00000331433.4	+	15	1492	c.1473G>T	c.(1471-1473)ctG>ctT	p.L491L	CLCNKA_ENST00000439316.2_Silent_p.L448L|CLCNKA_ENST00000375692.1_Silent_p.L491L|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000420078.1_Silent_p.L491L			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	491					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CCTTTGAGCTGACCGGCCAGA	0.647																																																	0													57.0	51.0	53.0					1																	16357020		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.1473G>T	1.37:g.16357020G>T			B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,smart_CBS_dom,prints_Cl-channel_volt-gated,prints_Cl_channel-K	p.L491	ENST00000331433.4	37	c.1473	CCDS167.1	1																																																																																			CLCNKA	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated	ENSG00000186510		0.647	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	HGNC	protein_coding	OTTHUMT00000026326.1	-	0.00	99	0	G			16357020	+1	tier1	-	no_errors	ENST00000331433	ensembl	human	known	74_37	silent	5.68	83	5	SNP	1.000	T
CLIP2	7461	genome.wustl.edu	37	7	73731997	73731997	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:73731997G>T	ENST00000395060.1	+	1	121	c.121G>T	c.(121-123)Ggc>Tgc	p.G41C	CLIP2_ENST00000361545.5_Splice_Site_p.G41C|CLIP2_ENST00000223398.6_Splice_Site_p.G41C			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	41						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CTCCAAGGAAGGTACGTGGCA	0.642																																																	0													68.0	72.0	70.0					7																	73731997		2203	4299	6502	SO:0001630	splice_region_variant	0			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.121+1G>T	7.37:g.73731997G>T			O14527|O43611	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.G41C	ENST00000395060.1	37	c.121	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	G	13.74	2.326491	0.41197	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.60920	0.15;0.17;0.15	4.52	4.52	0.55395	.	0.072597	0.53938	D	0.000048	T	0.52821	0.1758	L	0.27053	0.805	0.58432	D	0.999997	P;P	0.48503	0.911;0.856	P;B	0.49752	0.621;0.417	T	0.57831	-0.7743	10	0.66056	D	0.02	-30.7081	12.629	0.56646	0.0:0.0:1.0:0.0	.	41;41	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	C	41	ENSP00000223398:G41C;ENSP00000355151:G41C;ENSP00000378500:G41C	ENSP00000223398:G41C	G	+	1	0	CLIP2	73369933	1.000000	0.71417	1.000000	0.80357	0.177000	0.22998	4.635000	0.61332	2.340000	0.79590	0.561000	0.74099	GGC	CLIP2	-	NULL	ENSG00000106665		0.642	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	HGNC	protein_coding	OTTHUMT00000252556.1	-	0.00	152	0	G	NM_003388	Missense_Mutation	73731997	+1	tier1	-	no_errors	ENST00000223398	ensembl	human	known	74_37	missense	7.88	151	13	SNP	1.000	T
CLPSL2	389383	genome.wustl.edu	37	6	35747261	35747261	+	3'UTR	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:35747261G>T	ENST00000403376.3	+	0	337				CLPSL1_ENST00000542261.1_5'Flank|CLPSL2_ENST00000481904.1_3'UTR|CLPSL1_ENST00000373861.5_5'Flank|CLPSL2_ENST00000360454.2_Missense_Mutation_p.G139V	NM_207409.2	NP_997292.2	Q6UWE3	COLL2_HUMAN	colipase-like 2						digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										CTCCCTTGGGGCCATAGGCCC	0.547																																																	0													71.0	54.0	60.0					6																	35747261		2189	4277	6466	SO:0001624	3_prime_UTR_variant	0				CCDS4810.2, CCDS69095.1	6p21.31	2014-01-28	2012-02-06	2012-02-06	ENSG00000196748	ENSG00000196748			21250	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 126"""	C6orf126			Standard	NM_001286550		Approved	dJ510O8.5, UNQ3045	uc010jvz.1	Q6UWE3	OTTHUMG00000014581	ENST00000403376.3:c.*34G>T	6.37:g.35747261G>T			B0QZ45|Q5T9G3	Missense_Mutation	SNP	NULL	p.G139V	ENST00000403376.3	37	c.416	CCDS4810.2	6	.	.	.	.	.	.	.	.	.	.	G	9.050	0.991885	0.18966	.	.	ENSG00000196748	ENST00000360454	.	.	.	3.38	-2.09	0.07232	.	.	.	.	.	T	0.08980	0.0222	.	.	.	0.18873	N	0.999987	P	0.35844	0.524	B	0.35353	0.201	T	0.25117	-1.0141	7	0.87932	D	0	-3.9105	1.1096	0.01701	0.2149:0.3304:0.2864:0.1683	.	139	Q6UWE3-2	.	V	139	.	ENSP00000353639:G139V	G	+	2	0	C6orf126	35855239	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.152000	0.16302	-0.483000	0.06772	-0.500000	0.04577	GGC	CLPSL2	-	NULL	ENSG00000196748		0.547	CLPSL2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPSL2	HGNC	protein_coding	OTTHUMT00000280618.2		0.00	47	0	G	NM_207409		35747261	+1			no_errors	ENST00000360454	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.001	T
CNGA2	1260	genome.wustl.edu	37	X	150909341	150909341	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:150909341C>A	ENST00000329903.4	+	4	483	c.450C>A	c.(448-450)ccC>ccA	p.P150P		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	150					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					TTGCCATGCCCGTCCTTTACA	0.557																																																	0													178.0	153.0	161.0					X																	150909341		2203	4300	6503	SO:0001819	synonymous_variant	0			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.450C>A	X.37:g.150909341C>A			A0AVD0	Silent	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.P150	ENST00000329903.4	37	c.450	CCDS14701.1	X																																																																																			CNGA2	-	NULL	ENSG00000183862		0.557	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA2	HGNC	protein_coding	OTTHUMT00000060888.1		0.00	42	0	C	NM_005140		150909341	+1			no_errors	ENST00000329903	ensembl	human	known	74_37	silent	6.82	41	3	SNP	0.942	A
COL19A1	1310	genome.wustl.edu	37	6	70646735	70646735	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:70646735G>T	ENST00000322773.4	+	8	908	c.806G>T	c.(805-807)aGt>aTt	p.S269I		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	269					cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GCTCATGCCAGTAAAATGTCT	0.428																																																	0													169.0	159.0	162.0					6																	70646735		2203	4300	6503	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.806G>T	6.37:g.70646735G>T	ENSP00000316030:p.Ser269Ile		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.S269I	ENST00000322773.4	37	c.806	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	5.949	0.359052	0.11239	.	.	ENSG00000082293	ENST00000322773	D	0.91894	-2.93	5.37	5.37	0.77165	.	0.553942	0.19523	N	0.112231	D	0.88074	0.6339	L	0.47716	1.5	0.80722	D	1	P	0.43169	0.8	B	0.43575	0.424	D	0.87004	0.2118	10	0.33141	T	0.24	.	17.6565	0.88179	0.0:0.0:1.0:0.0	.	269	Q14993	COJA1_HUMAN	I	269	ENSP00000316030:S269I	ENSP00000316030:S269I	S	+	2	0	COL19A1	70703456	0.989000	0.36119	0.025000	0.17156	0.087000	0.18053	4.395000	0.59678	2.677000	0.91161	0.655000	0.94253	AGT	COL19A1	-	NULL	ENSG00000082293		0.428	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	-	0.00	66	0	G			70646735	+1	tier1	-	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.057	T
COL12A1	1303	genome.wustl.edu	37	6	75843646	75843646	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:75843646C>T	ENST00000322507.8	-	33	5901	c.5592G>A	c.(5590-5592)tgG>tgA	p.W1864*	COL12A1_ENST00000345356.6_Nonsense_Mutation_p.W700*|COL12A1_ENST00000416123.2_Nonsense_Mutation_p.W1864*|COL12A1_ENST00000483888.2_Nonsense_Mutation_p.W1864*	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1864	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTGCATGGTCCCAGCGGACAT	0.448																																																	0													111.0	105.0	107.0					6																	75843646		1937	4145	6082	SO:0001587	stop_gained	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5592G>A	6.37:g.75843646C>T	ENSP00000325146:p.Trp1864*		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.W1864*	ENST00000322507.8	37	c.5592	CCDS43482.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	46|46	12.557217|12.557217	0.99678|0.99678	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|.	.|.	.|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|.	0.34658|.	0.0905|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34304|.	-0.9834|.	3|.	.|0.02654	.|T	.|1	.|.	20.3932|20.3932	0.98965|0.98965	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	R|X	599|1864;1864;700;1864;1864	.|.	.|ENSP00000325146:W1864X	G|W	-|-	1|3	0|0	COL12A1|COL12A1	75900366|75900366	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.487000|7.487000	0.81328|0.81328	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GGA|TGG	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.448	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	57	0	C	NM_004370		75843646	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	nonsense	7.95	81	7	SNP	1.000	T
COL10A1	1300	genome.wustl.edu	37	6	116441947	116441947	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:116441947G>T	ENST00000327673.4	-	2	1739	c.1332C>A	c.(1330-1332)gcC>gcA	p.A444A	NT5DC1_ENST00000319550.4_Intron|AL121963.1_ENST00000430695.1_5'Flank|COL10A1_ENST00000243222.4_Silent_p.A444A			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	444	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		GTATTCCAGGGGCACCTCTTG	0.622																																																	0													30.0	31.0	31.0					6																	116441947		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.1332C>A	6.37:g.116441947G>T			A1L4P2	Silent	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.A444	ENST00000327673.4	37	c.1332	CCDS5105.1	6																																																																																			COL10A1	-	NULL	ENSG00000123500		0.622	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL10A1	HGNC	protein_coding	OTTHUMT00000041926.1	-	0.00	65	0	G			116441947	-1	tier1	-	no_errors	ENST00000243222	ensembl	human	known	74_37	silent	6.33	74	5	SNP	0.000	T
COL22A1	169044	genome.wustl.edu	37	8	139815144	139815144	+	Missense_Mutation	SNP	G	G	C	rs376678600		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:139815144G>C	ENST00000303045.6	-	11	1974	c.1528C>G	c.(1528-1530)Cct>Gct	p.P510A	COL22A1_ENST00000435777.1_Missense_Mutation_p.P510A	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	510	Collagen-like 1.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TTAGGTCCAGGAGCGCCAACC	0.597										HNSCC(7;0.00092)																																							0													147.0	123.0	131.0					8																	139815144		2203	4300	6503	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1528C>G	8.37:g.139815144G>C	ENSP00000303153:p.Pro510Ala		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.P510A	ENST00000303045.6	37	c.1528	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	G	15.60	2.880233	0.51801	.	.	ENSG00000169436	ENST00000303045;ENST00000435777	D;D	0.96554	-4.05;-4.05	4.88	3.92	0.45320	.	0.352176	0.20389	U	0.093287	D	0.95620	0.8576	M	0.68952	2.095	0.40292	D	0.978519	P	0.51057	0.941	P	0.49332	0.607	D	0.94105	0.7365	10	0.38643	T	0.18	.	10.4025	0.44237	0.0:0.1984:0.8016:0.0	.	510	Q8NFW1	COMA1_HUMAN	A	510	ENSP00000303153:P510A;ENSP00000387655:P510A	ENSP00000303153:P510A	P	-	1	0	COL22A1	139884326	0.999000	0.42202	0.969000	0.41365	0.847000	0.48162	2.572000	0.45999	2.643000	0.89663	0.655000	0.94253	CCT	COL22A1	-	NULL	ENSG00000169436		0.597	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	-	0.00	59	0	G	XM_291257		139815144	-1	tier1	-	no_errors	ENST00000303045	ensembl	human	known	74_37	missense	14.94	74	13	SNP	0.952	C
COL3A1	1281	genome.wustl.edu	37	2	189867045	189867045	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:189867045C>A	ENST00000304636.3	+	35	2583	c.2413C>A	c.(2413-2415)Cct>Act	p.P805T	COL3A1_ENST00000317840.5_Missense_Mutation_p.P805T	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	805	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGAAACTGGCCCTCCAGGACC	0.438																																																	0													128.0	121.0	124.0					2																	189867045		2203	4300	6503	SO:0001583	missense	0			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2413C>A	2.37:g.189867045C>A	ENSP00000304408:p.Pro805Thr		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.P805T	ENST00000304636.3	37	c.2413	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	C	16.87	3.240974	0.58995	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.94330	-3.4;-3.4	5.77	5.77	0.91146	.	0.000000	0.49916	D	0.000132	D	0.92619	0.7655	M	0.63843	1.955	0.40682	D	0.982314	B	0.33637	0.42	B	0.35312	0.2	D	0.90771	0.4672	10	0.29301	T	0.29	.	19.9926	0.97371	0.0:1.0:0.0:0.0	.	805	P02461	CO3A1_HUMAN	T	805	ENSP00000304408:P805T;ENSP00000315243:P805T	ENSP00000304408:P805T	P	+	1	0	COL3A1	189575290	0.992000	0.36948	0.902000	0.35471	0.985000	0.73830	3.063000	0.49978	2.729000	0.93468	0.467000	0.42956	CCT	COL3A1	-	NULL	ENSG00000168542		0.438	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	HGNC	protein_coding	OTTHUMT00000255899.3		0.00	105	0	C	NM_000090		189867045	+1			no_errors	ENST00000304636	ensembl	human	known	74_37	missense	5.75	82	5	SNP	0.997	A
CPAMD8	27151	genome.wustl.edu	37	19	17088273	17088273	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:17088273G>T	ENST00000443236.1	-	15	1835	c.1804C>A	c.(1804-1806)Ccc>Acc	p.P602T	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	555						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CGACCAAGGGGGACCATGCTG	0.582																																																	0													48.0	52.0	51.0					19																	17088273		1955	4143	6098	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1804C>A	19.37:g.17088273G>T	ENSP00000402505:p.Pro602Thr		Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.P602T	ENST00000443236.1	37	c.1804	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	g	17.04	3.286826	0.59867	.	.	ENSG00000160111	ENST00000291440	.	.	.	2.62	2.62	0.31277	Alpha-2-macroglobulin, N-terminal 2 (1);	0.000000	0.64402	U	0.000008	D	0.83903	0.5355	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87720	0.2572	9	0.87932	D	0	.	13.4642	0.61243	0.0:0.0:1.0:0.0	.	555	Q8IZJ3	CPMD8_HUMAN	T	602	.	ENSP00000291440:P602T	P	-	1	0	CPAMD8	16949273	1.000000	0.71417	0.609000	0.28983	0.606000	0.37113	6.206000	0.72154	1.181000	0.42912	0.461000	0.40582	CCC	CPAMD8	-	pfam_A2M_N_2	ENSG00000160111		0.582	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	-	0.00	52	0	G	NM_015692		17088273	-1	tier1	-	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	13.21	46	7	SNP	1.000	T
CPED1	79974	genome.wustl.edu	37	7	120907296	120907296	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:120907296C>A	ENST00000310396.5	+	21	3128	c.2661C>A	c.(2659-2661)atC>atA	p.I887I		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	887						endoplasmic reticulum (GO:0005783)											TCCTAGTGATCATCAAAACTT	0.323																																																	0													69.0	66.0	67.0					7																	120907296		2198	4295	6493	SO:0001819	synonymous_variant	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2661C>A	7.37:g.120907296C>A			A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	NULL	p.I887	ENST00000310396.5	37	c.2661	CCDS34739.1	7																																																																																			CPED1	-	NULL	ENSG00000106034		0.323	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1		0.00	54	0	C	NM_024913		120907296	+1			no_errors	ENST00000310396	ensembl	human	known	74_37	silent	5.88	48	3	SNP	1.000	A
CRB1	23418	genome.wustl.edu	37	1	197316469	197316469	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:197316469G>T	ENST00000367400.3	+	4	983		c.e4-1		CRB1_ENST00000535699.1_Splice_Site|CRB1_ENST00000543483.1_Splice_Site|CRB1_ENST00000538660.1_Splice_Site|CRB1_ENST00000367399.2_Intron	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated						cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTACTTTCCAGATATAGCTGT	0.393																																																	0													170.0	160.0	163.0					1																	197316469		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.849-1G>T	1.37:g.197316469G>T			A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Splice_Site	SNP	-	e4-1	ENST00000367400.3	37	c.849-1	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418520	0.83559	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7682	0.91881	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CRB1	195583092	1.000000	0.71417	0.917000	0.36280	0.996000	0.88848	9.180000	0.94867	2.524000	0.85096	0.585000	0.79938	.	CRB1	-	-	ENSG00000134376		0.393	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	-	0.00	47	0	G	NM_201253	Intron	197316469	+1	tier1	-	no_errors	ENST00000367400	ensembl	human	known	74_37	splice_site	12.00	66	9	SNP	0.998	T
CREBBP	1387	genome.wustl.edu	37	16	3778029	3778029	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:3778029C>T	ENST00000262367.5	-	31	7828	c.7019G>A	c.(7018-7020)aGt>aAt	p.S2340N	CREBBP_ENST00000382070.3_Missense_Mutation_p.S2302N	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2340					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CACCTGGTTACTAAGGGACGT	0.657			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													89.0	87.0	87.0					16																	3778029		2197	4300	6497	SO:0001583	missense	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.7019G>A	16.37:g.3778029C>T	ENSP00000262367:p.Ser2340Asn		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.S2340N	ENST00000262367.5	37	c.7019	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	c	13.14	2.148368	0.37923	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.83992	-1.79;-1.72	5.35	5.35	0.76521	.	0.109437	0.64402	D	0.000005	T	0.74122	0.3675	N	0.19112	0.55	0.58432	D	0.999997	B;B	0.27498	0.18;0.18	B;B	0.21546	0.035;0.035	T	0.71695	-0.4515	10	0.49607	T	0.09	-6.477	18.4233	0.90598	0.0:1.0:0.0:0.0	.	2370;2340	Q4LE28;Q92793	.;CBP_HUMAN	N	2340;2370;2302;875	ENSP00000262367:S2340N;ENSP00000371502:S2302N	ENSP00000262367:S2340N	S	-	2	0	CREBBP	3718030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.691000	0.68249	2.668000	0.90789	0.655000	0.94253	AGT	CREBBP	-	NULL	ENSG00000005339		0.657	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	-	0.00	111	0	C	NM_004380		3778029	-1	tier1	-	no_errors	ENST00000262367	ensembl	human	known	74_37	missense	6.25	120	8	SNP	1.000	T
CRTC3	64784	genome.wustl.edu	37	15	91136924	91136924	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:91136924G>C	ENST00000268184.6	+	3	292	c.288G>C	c.(286-288)gaG>gaC	p.E96D	CRTC3_ENST00000560098.1_Intron|CTD-3065B20.2_ENST00000558389.1_RNA|CRTC3_ENST00000558619.1_3'UTR|CRTC3_ENST00000420329.2_Missense_Mutation_p.E96D			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	96	Required for interaction with HTLV-1 TAX.				energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			GGCTGGTGGAGAGGCCATCCA	0.537			T	MAML2	salivary gland mucoepidermoid																																			Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	0													75.0	79.0	78.0					15																	91136924		2198	4298	6496	SO:0001583	missense	0				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.288G>C	15.37:g.91136924G>C	ENSP00000268184:p.Glu96Asp		Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	NULL	p.E96D	ENST00000268184.6	37	c.288	CCDS32331.1	15	.	.	.	.	.	.	.	.	.	.	G	15.24	2.774703	0.49786	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.12879	2.67;2.64	5.67	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.13798	0.0334	N	0.24115	0.695	0.51482	D	0.999929	B;B	0.32128	0.244;0.357	B;P	0.45794	0.298;0.493	T	0.06881	-1.0802	10	0.07813	T	0.8	-23.5152	13.2036	0.59782	0.0816:0.0:0.9184:0.0	.	96;96	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	D	60;96;96	ENSP00000268184:E96D;ENSP00000416573:E96D	ENSP00000268184:E96D	E	+	3	2	CRTC3	88937928	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.207000	0.42788	2.836000	0.97738	0.655000	0.94253	GAG	CRTC3	-	NULL	ENSG00000140577		0.537	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CRTC3	HGNC	protein_coding	OTTHUMT00000417716.2	-	0.00	86	0	G	NM_022769		91136924	+1	tier1	-	no_errors	ENST00000268184	ensembl	human	known	74_37	missense	5.21	91	5	SNP	1.000	C
CSMD3	114788	genome.wustl.edu	37	8	114326869	114326869	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:114326869G>C	ENST00000297405.5	-	2	576	c.332C>G	c.(331-333)gCt>gGt	p.A111G	CSMD3_ENST00000455883.2_Missense_Mutation_p.A111G|CSMD3_ENST00000352409.3_Missense_Mutation_p.A111G|CSMD3_ENST00000343508.3_Missense_Mutation_p.A71G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	111	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A71D(1)|p.A111D(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTCTTCTAGAGCAAATGACTG	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							2	Substitution - Missense(2)	lung(2)											156.0	148.0	151.0					8																	114326869		2203	4299	6502	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.332C>G	8.37:g.114326869G>C	ENSP00000297405:p.Ala111Gly		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.A111G	ENST00000297405.5	37	c.332	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	19.20	3.780692	0.70222	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.72	5.72	0.89469	CUB (5);	0.000000	0.64402	D	0.000011	T	0.37376	0.1001	L	0.48218	1.51	0.47659	D	0.999487	D;D;D;D;P	0.89917	0.996;0.999;1.0;0.992;0.538	D;D;D;D;B	0.85130	0.99;0.994;0.997;0.989;0.298	T	0.00931	-1.1510	10	0.39692	T	0.17	.	18.8756	0.92334	0.0:0.0:1.0:0.0	.	111;111;111;111;71	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407;Q7Z407-2	.;.;.;CSMD3_HUMAN;.	G	71;111;111;111	ENSP00000345799:A71G;ENSP00000297405:A111G;ENSP00000412263:A111G;ENSP00000343124:A111G	ENSP00000297405:A111G	A	-	2	0	CSMD3	114396045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.860000	0.99555	2.697000	0.92050	0.557000	0.71058	GCT	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.368	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	52	0	G	NM_052900		114326869	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	13.51	64	10	SNP	1.000	C
CTAGE1	64693	genome.wustl.edu	37	18	19997426	19997426	+	5'Flank	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr18:19997426A>T	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.C117S			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					TTTTCTAGACAGAGTATTTCA	0.393																																																	0													101.0	112.0	108.0					18																	19997426		2179	4292	6471	SO:0001631	upstream_gene_variant	0			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19997426A>T	Exception_encountered		B0YIZ3	Missense_Mutation	SNP	NULL	p.C117S	ENST00000525417.1	37	c.349		18	.	.	.	.	.	.	.	.	.	.	A	3.863	-0.029458	0.07589	.	.	ENSG00000212710	ENST00000391403	T	0.74632	-0.86	0.949	0.949	0.19566	.	.	.	.	.	T	0.55289	0.1911	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.36163	-0.9759	8	.	.	.	.	4.1182	0.10092	1.0:0.0:0.0:0.0	.	117	Q96RT6	CTGE2_HUMAN	S	117	ENSP00000375220:C117S	.	C	-	1	0	CTAGE1	18251424	0.000000	0.05858	0.081000	0.20488	0.322000	0.28314	-0.149000	0.10204	0.652000	0.30806	0.374000	0.22700	TGT	CTAGE1	-	NULL	ENSG00000212710		0.393	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	CTAGE1	HGNC	protein_coding	OTTHUMT00000386767.1	-	0.00	149	0	A	NM_022663, NM_172241		19997426	-1	tier1	-	no_errors	ENST00000391403	ensembl	human	known	74_37	missense	6.86	163	12	SNP	0.163	T
CTSG	1511	genome.wustl.edu	37	14	25043995	25043995	+	Silent	SNP	G	G	C	rs143803246		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:25043995G>C	ENST00000216336.2	-	3	261	c.225C>G	c.(223-225)ggC>ggG	p.G75G		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	75	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.G75G(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		TATTGTGGGCGCCCAGGGTGA	0.557																																																	1	Substitution - coding silent(1)	large_intestine(1)											139.0	122.0	128.0					14																	25043995		2203	4300	6503	SO:0001819	synonymous_variant	0			M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.225C>G	14.37:g.25043995G>C			Q6IBJ6|Q9UCA5|Q9UCU6	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G75	ENST00000216336.2	37	c.225	CCDS9631.1	14																																																																																			CTSG	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000100448		0.557	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSG	HGNC	protein_coding	OTTHUMT00000276536.2	-	0.00	64	0	G	NM_001911		25043995	-1	tier1	-	no_errors	ENST00000216336	ensembl	human	known	74_37	silent	12.99	67	10	SNP	0.992	C
CTSL	1514	genome.wustl.edu	37	9	90343008	90343008	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:90343008G>C	ENST00000343150.5	+	3	1083	c.193G>C	c.(193-195)Gaa>Caa	p.E65Q	CTSL_ENST00000340342.6_Missense_Mutation_p.E65Q|CTSL_ENST00000495822.1_Intron|CTSL_ENST00000342020.5_Missense_Mutation_p.E65Q			P07711	CATL1_HUMAN	cathepsin L	65					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										GCACAATCAGGAATACAGGGA	0.473																																																	0													209.0	179.0	189.0					9																	90343008		2203	4300	6503	SO:0001583	missense	0			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.193G>C	9.37:g.90343008G>C	ENSP00000345344:p.Glu65Gln		Q6IAV1|Q96QJ0	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.E65Q	ENST00000343150.5	37	c.193	CCDS6675.1	9	.	.	.	.	.	.	.	.	.	.	G	19.82	3.897706	0.72639	.	.	ENSG00000135047	ENST00000343150;ENST00000340342;ENST00000342020	T;T;T	0.22336	1.96;1.96;1.96	4.09	4.09	0.47781	Proteinase inhibitor I29, cathepsin propeptide (2);	0.095859	0.64402	D	0.000001	T	0.32224	0.0822	M	0.62266	1.93	0.58432	D	0.999999	P	0.46457	0.878	P	0.48270	0.572	T	0.18053	-1.0349	10	0.52906	T	0.07	.	16.469	0.84095	0.0:0.0:1.0:0.0	.	65	P07711	CATL1_HUMAN	Q	65	ENSP00000345344:E65Q;ENSP00000365061:E65Q;ENSP00000340470:E65Q	ENSP00000365061:E65Q	E	+	1	0	CTSL1	89532828	1.000000	0.71417	0.009000	0.14445	0.640000	0.38277	8.324000	0.90005	2.100000	0.63781	0.491000	0.48974	GAA	CTSL	-	pfam_Prot_inhib_I29,smart_Prot_inhib_I29	ENSG00000135047		0.473	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSL	HGNC	protein_coding	OTTHUMT00000052936.1	-	0.00	257	0	G	NM_001912		90343008	+1	tier1	-	no_errors	ENST00000340342	ensembl	human	known	74_37	missense	11.65	235	31	SNP	1.000	C
CUBN	8029	genome.wustl.edu	37	10	16992031	16992031	+	Missense_Mutation	SNP	C	C	A	rs141941868	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:16992031C>A	ENST00000377833.4	-	34	5114	c.5049G>T	c.(5047-5049)ttG>ttT	p.L1683F		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1683	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGCCGCCATCCAAAATTTCTA	0.443																																																	0													77.0	70.0	72.0					10																	16992031		2203	4300	6503	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5049G>T	10.37:g.16992031C>A	ENSP00000367064:p.Leu1683Phe		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.L1683F	ENST00000377833.4	37	c.5049	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427414	0.43122	.	.	ENSG00000107611	ENST00000377833	T	0.34072	1.38	6.08	4.25	0.50352	CUB (5);	0.468058	0.15922	N	0.238080	T	0.35970	0.0950	N	0.11724	0.165	0.80722	D	1	D	0.69078	0.997	D	0.68621	0.959	T	0.03296	-1.1051	10	0.10377	T	0.69	.	11.8679	0.52503	0.0:0.8604:0.0:0.1396	.	1683	O60494	CUBN_HUMAN	F	1683	ENSP00000367064:L1683F	ENSP00000367064:L1683F	L	-	3	2	CUBN	17032037	1.000000	0.71417	0.997000	0.53966	0.264000	0.26372	2.493000	0.45320	0.909000	0.36697	0.655000	0.94253	TTG	CUBN	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000107611		0.443	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	-	0.00	51	0	C	NM_001081		16992031	-1	tier1	-	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	6.67	70	5	SNP	1.000	A
DACH2	117154	genome.wustl.edu	37	X	85994826	85994826	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:85994826A>T	ENST00000373125.4	+	7	1181	c.1181A>T	c.(1180-1182)cAc>cTc	p.H394L	DACH2_ENST00000508860.1_Missense_Mutation_p.H227L|DACH2_ENST00000510272.1_Missense_Mutation_p.H175L|DACH2_ENST00000373131.1_Missense_Mutation_p.H381L	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	394					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						ACCTCTTCCCACACCAGCAGC	0.473																																																	0													80.0	63.0	69.0					X																	85994826		2203	4299	6502	SO:0001583	missense	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1181A>T	X.37:g.85994826A>T	ENSP00000362217:p.His394Leu		B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.H394L	ENST00000373125.4	37	c.1181	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	A	19.45	3.829685	0.71258	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.83837	-1.77;-1.75	4.98	4.98	0.66077	.	0.000000	0.64402	D	0.000001	D	0.83464	0.5260	L	0.53249	1.67	0.58432	D	0.999993	D;D;P;P	0.54047	0.964;0.964;0.949;0.956	P;P;P;B	0.51415	0.532;0.554;0.669;0.366	T	0.80797	-0.1222	10	0.20519	T	0.43	.	13.8686	0.63603	1.0:0.0:0.0:0.0	.	260;394;381;394	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	L	394;381;394;227;175;227;49	ENSP00000362223:H381L;ENSP00000362217:H394L	ENSP00000345134:H394L	H	+	2	0	DACH2	85881482	1.000000	0.71417	0.904000	0.35570	0.552000	0.35366	6.337000	0.72958	1.650000	0.50662	0.412000	0.27726	CAC	DACH2	-	NULL	ENSG00000126733		0.473	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	-	0.00	64	0	A	NM_053281		85994826	+1	tier1	-	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	10.47	77	9	SNP	0.998	T
DCAF8L1	139425	genome.wustl.edu	37	X	27998866	27998866	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:27998866C>A	ENST00000441525.1	-	1	700	c.586G>T	c.(586-588)Gcc>Tcc	p.A196S		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	196										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						ACAGAACCGGCATGGCTTCCA	0.562													C|||	2	0.000529801	0.0	0.0	3775	,	,		14720	0.0		0.0	False		,,,				2504	0.002																0													33.0	27.0	29.0					X																	27998866		2202	4299	6501	SO:0001583	missense	0				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.586G>T	X.37:g.27998866C>A	ENSP00000405222:p.Ala196Ser		B3KXX1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A196S	ENST00000441525.1	37	c.586	CCDS35222.1	X	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.980094	0.00448	.	.	ENSG00000226372	ENST00000441525	T	0.58060	0.36	0.842	-1.68	0.08212	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.481914	0.21650	N	0.071187	T	0.18467	0.0443	N	0.04245	-0.25	0.19945	N	0.999944	B	0.06786	0.001	B	0.15052	0.012	T	0.19160	-1.0314	10	0.06625	T	0.88	3.3379	2.2312	0.03997	0.3047:0.2387:0.0:0.4566	.	196	A6NGE4	DC8L1_HUMAN	S	196	ENSP00000405222:A196S	ENSP00000405222:A196S	A	-	1	0	DCAF8L1	27908787	0.598000	0.26882	0.000000	0.03702	0.002000	0.02628	0.155000	0.16362	-1.513000	0.01789	-0.739000	0.03532	GCC	DCAF8L1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000226372		0.562	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	HGNC	protein_coding	OTTHUMT00000056150.2	-	0.00	117	0	C	XM_066690		27998866	-1	tier1	-	no_errors	ENST00000441525	ensembl	human	known	74_37	missense	5.13	111	6	SNP	0.813	A
DACH2	117154	genome.wustl.edu	37	X	86071037	86071037	+	Splice_Site	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:86071037A>G	ENST00000373125.4	+	11	1685	c.1685A>G	c.(1684-1686)gAt>gGt	p.D562G	DACH2_ENST00000508860.1_Splice_Site_p.D395G|DACH2_ENST00000510272.1_Splice_Site_p.D343G|DACH2_ENST00000373131.1_Splice_Site_p.D549G	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	562					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TTTATTTCAGATACTGGAATT	0.358																																																	0													60.0	57.0	58.0					X																	86071037		2203	4300	6503	SO:0001630	splice_region_variant	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1685-1A>G	X.37:g.86071037A>G			B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.D562G	ENST00000373125.4	37	c.1685	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	A	11.73	1.726712	0.30593	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.86297	-2.08;-2.1	4.67	4.67	0.58626	.	0.000000	0.64402	D	0.000006	T	0.81522	0.4840	N	0.20986	0.625	0.50039	D	0.99984	P;B;P;P	0.50443	0.736;0.199;0.933;0.935	B;B;P;B	0.46452	0.272;0.098;0.517;0.411	T	0.80086	-0.1529	9	.	.	.	.	13.3817	0.60770	1.0:0.0:0.0:0.0	.	428;562;549;562	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	G	562;549;562;395;343;395;227	ENSP00000362223:D549G;ENSP00000362217:D562G	.	D	+	2	0	DACH2	85957693	1.000000	0.71417	0.999000	0.59377	0.300000	0.27592	6.485000	0.73625	1.531000	0.49152	0.417000	0.27973	GAT	DACH2	-	NULL	ENSG00000126733		0.358	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	-	0.00	134	0	A	NM_053281	Missense_Mutation	86071037	+1	tier1	-	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	6.47	130	9	SNP	1.000	G
DCHS2	54798	genome.wustl.edu	37	4	155287589	155287589	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:155287589C>A	ENST00000357232.4	-	5	466	c.467G>T	c.(466-468)gGg>gTg	p.G156V	DCHS2_ENST00000339452.1_Missense_Mutation_p.G750V	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	156	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GGCACTTAGCCCACCCTGGTG	0.443																																																	0													69.0	58.0	62.0					4																	155287589		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.467G>T	4.37:g.155287589C>A	ENSP00000349768:p.Gly156Val		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G156V	ENST00000357232.4	37	c.467	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666840	0.88251	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.61742	0.08;0.58	5.83	5.83	0.93111	Cadherin (3);Cadherin-like (1);	0.000000	0.64402	D	0.000019	T	0.76285	0.3966	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.76334	-0.2997	10	0.62326	D	0.03	.	19.7266	0.96166	0.0:1.0:0.0:0.0	.	750;156	E9PC11;Q6V1P9	.;PCD23_HUMAN	V	156;750;750	ENSP00000349768:G156V;ENSP00000345062:G750V	ENSP00000345062:G750V	G	-	2	0	DCHS2	155507039	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	6.962000	0.76048	2.756000	0.94617	0.655000	0.94253	GGG	DCHS2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.443	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2		0.00	51	0	C	NM_001142552		155287589	-1			no_errors	ENST00000357232	ensembl	human	known	74_37	missense	7.94	58	5	SNP	1.000	A
DEPDC5	9681	genome.wustl.edu	37	22	32293528	32293528	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr22:32293528G>T	ENST00000382112.3	+	39	4307	c.4237G>T	c.(4237-4239)Ggg>Tgg	p.G1413W	DEPDC5_ENST00000400248.2_Missense_Mutation_p.G1391W|DEPDC5_ENST00000382111.2_Missense_Mutation_p.G1422W|DEPDC5_ENST00000266091.3_Missense_Mutation_p.G1400W|DEPDC5_ENST00000400246.1_Missense_Mutation_p.G1422W|DEPDC5_ENST00000400249.2_Missense_Mutation_p.G1391W|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000539165.1_Missense_Mutation_p.G239W|DEPDC5_ENST00000535622.1_Missense_Mutation_p.G1322W	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1422					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGTTTTGGAGGGGCCTTTTGC	0.537																																																	0													120.0	118.0	119.0					22																	32293528		1935	4126	6061	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4237G>T	22.37:g.32293528G>T	ENSP00000371546:p.Gly1413Trp		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_IML1,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.G1400W	ENST00000382112.3	37	c.4198	CCDS46692.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	21.1|21.1	4.103851|4.103851	0.76983|0.76983	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000433147|ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165	.|T;T;T;T;T;T;T	.|0.31510	.|1.49;1.91;1.91;1.9;1.91;1.9;1.91	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.196730|0.196730	0.45361|0.45361	D|D	0.000376|0.000376	T|T	0.42539|0.42539	0.1207|0.1207	N|N	0.22421|0.22421	0.69|0.69	0.54753|0.54753	D|D	0.999983|0.999983	.|D;D;D;D;D;D	.|0.76494	.|0.995;0.999;0.999;0.996;0.993;0.993	.|P;P;D;P;P;P	.|0.64595	.|0.781;0.885;0.927;0.855;0.72;0.72	T|T	0.38243|0.38243	-0.9670|-0.9670	6|10	.|0.72032	.|D	.|0.01	.|.	18.6148|18.6148	0.91299|0.91299	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1422;1322;808;1400;1413;1391	.|B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.|.;.;.;.;.;DEPD5_HUMAN	V|W	797|1322;1400;1391;1322;1422;1413;1422;1391;239	.|ENSP00000440210:G1322W;ENSP00000266091:G1400W;ENSP00000383108:G1391W;ENSP00000383105:G1422W;ENSP00000371546:G1413W;ENSP00000371545:G1422W;ENSP00000383107:G1391W	.|ENSP00000266091:G1400W	G|G	+|+	2|1	0|0	DEPDC5|DEPDC5	30623528|30623528	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.884000|0.884000	0.51177|0.51177	6.198000|6.198000	0.72106|0.72106	2.648000|2.648000	0.89879|0.89879	0.556000|0.556000	0.70494|0.70494	GGG|GGG	DEPDC5	-	NULL	ENSG00000100150		0.537	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	-	0.00	53	0	G	NM_014662		32293528	+1	tier1	-	no_errors	ENST00000266091	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
DGAT2L6	347516	genome.wustl.edu	37	X	69421794	69421794	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:69421794C>A	ENST00000333026.3	+	5	627	c.527C>A	c.(526-528)tCa>tAa	p.S176*		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	176					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						CAGAAAGGCTCAGGCAATGCC	0.517																																																	0													107.0	90.0	96.0					X																	69421794		2203	4300	6503	SO:0001587	stop_gained	0			AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.527C>A	X.37:g.69421794C>A	ENSP00000328036:p.Ser176*		Q6IEE2	Nonsense_Mutation	SNP	pfam_DAGAT	p.S176*	ENST00000333026.3	37	c.527	CCDS14397.1	X	.	.	.	.	.	.	.	.	.	.	C	34	5.317712	0.95682	.	.	ENSG00000184210	ENST00000333026	.	.	.	4.51	4.51	0.55191	.	0.350198	0.24278	N	0.039922	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-19.4915	9.797	0.40742	0.0:0.7955:0.2045:0.0	.	.	.	.	X	176	.	ENSP00000328036:S176X	S	+	2	0	DGAT2L6	69338519	0.978000	0.34361	0.996000	0.52242	0.942000	0.58702	2.453000	0.44970	2.234000	0.73211	0.594000	0.82650	TCA	DGAT2L6	-	pfam_DAGAT	ENSG00000184210		0.517	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT2L6	HGNC	protein_coding	OTTHUMT00000057067.1	-	0.00	69	0	C	NM_198512		69421794	+1	tier1	-	no_errors	ENST00000333026	ensembl	human	known	74_37	nonsense	10.39	69	8	SNP	1.000	A
LRRC16B	90668	genome.wustl.edu	37	14	24520164	24520164	+	5'Flank	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:24520164C>A	ENST00000342740.5	+	0	0				LRRC16B_ENST00000334420.7_5'Flank|RP11-468E2.9_ENST00000558293.1_RNA	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B							cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		GGAGGAACCCCGTCCCGCCTC	0.597																																																	0													56.0	58.0	57.0					14																	24520164		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23			14.37:g.24520164C>A	Exception_encountered		Q8TEF7|Q96HS9	RNA	SNP	-	NULL	ENST00000342740.5	37	NULL	CCDS32054.1	14	.	.	.	.	.	.	.	.	.	.	C	8.742	0.919177	0.17982	.	.	ENSG00000225766	ENST00000397065	.	.	.	4.7	0.636	0.17729	.	.	.	.	.	T	0.25901	0.0631	L	0.45137	1.4	.	.	.	B	0.29531	0.247	B	0.28305	0.088	T	0.29912	-0.9996	7	0.08837	T	0.75	.	3.6978	0.08371	0.2646:0.4741:0.0:0.2613	.	278	P0CG22	DR4L1_HUMAN	Q	278	.	ENSP00000380255:P278Q	P	+	2	0	AL136295.1	23590004	0.000000	0.05858	0.009000	0.14445	0.713000	0.41058	0.143000	0.16115	0.220000	0.20860	-0.463000	0.05309	CCG	RP11-468E2.9	-	-	ENSG00000225766		0.597	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DHRS4L1	Clone_based_vega_gene	protein_coding	OTTHUMT00000416527.1	-	0.00	98	0	C	NM_138360		24520164	+1	tier1	-	no_errors	ENST00000558293	ensembl	human	known	74_37	rna	7.09	131	10	SNP	0.002	A
DHX8	1659	genome.wustl.edu	37	17	41561514	41561514	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:41561514G>A	ENST00000262415.3	+	1	181	c.109G>A	c.(109-111)Gag>Aag	p.E37K	DHX8_ENST00000540306.1_Missense_Mutation_p.E37K	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	37					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		GGTTTGCACTGAGCTGGACAA	0.582											OREG0024434	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(56;1548 1661 49258 49987)												0													118.0	109.0	112.0					17																	41561514		2203	4300	6503	SO:0001583	missense	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.109G>A	17.37:g.41561514G>A	ENSP00000262415:p.Glu37Lys	902		Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E37K	ENST00000262415.3	37	c.109	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.265143	0.95399	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.04970	3.52;3.58	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.30448	0.0765	M	0.84156	2.68	0.80722	D	1	D;P	0.67145	0.996;0.956	D;D	0.76071	0.987;0.931	T	0.01010	-1.1482	10	0.66056	D	0.02	.	19.1891	0.93656	0.0:0.0:1.0:0.0	.	37;37	F5H658;Q14562	.;DHX8_HUMAN	K	37	ENSP00000437886:E37K;ENSP00000262415:E37K	ENSP00000262415:E37K	E	+	1	0	DHX8	38917040	1.000000	0.71417	0.980000	0.43619	0.951000	0.60555	9.100000	0.94213	2.783000	0.95769	0.655000	0.94253	GAG	DHX8	-	NULL	ENSG00000067596		0.582	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	-	0.00	112	0	G			41561514	+1	tier1	-	no_errors	ENST00000262415	ensembl	human	known	74_37	missense	6.54	100	7	SNP	1.000	A
DHX8	1659	genome.wustl.edu	37	17	41571102	41571102	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:41571102C>T	ENST00000262415.3	+	8	1132	c.1060C>T	c.(1060-1062)Ctt>Ttt	p.L354F	DHX8_ENST00000540306.1_Missense_Mutation_p.L354F	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	354					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		ACGGCGAAATCTTGTCGGGGA	0.493																																					NSCLC(56;1548 1661 49258 49987)												0													202.0	204.0	203.0					17																	41571102		2203	4300	6503	SO:0001583	missense	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1060C>T	17.37:g.41571102C>T	ENSP00000262415:p.Leu354Phe			Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L354F	ENST00000262415.3	37	c.1060	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	C	16.48	3.135228	0.56828	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.03330	3.97;3.97	5.89	4.87	0.63330	Nucleic acid-binding, OB-fold-like (1);	0.062767	0.64402	D	0.000009	T	0.03477	0.0100	N	0.22421	0.69	0.40718	D	0.982639	P;P	0.42785	0.79;0.566	B;B	0.40565	0.333;0.321	T	0.49934	-0.8886	10	0.59425	D	0.04	.	10.2174	0.43177	0.1373:0.7904:0.0:0.0724	.	354;354	F5H658;Q14562	.;DHX8_HUMAN	F	354	ENSP00000437886:L354F;ENSP00000262415:L354F	ENSP00000262415:L354F	L	+	1	0	DHX8	38926628	0.987000	0.35691	0.999000	0.59377	0.996000	0.88848	1.252000	0.32874	2.793000	0.96121	0.561000	0.74099	CTT	DHX8	-	superfamily_NA-bd_OB-fold	ENSG00000067596		0.493	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	-	0.00	124	0	C			41571102	+1	tier1	-	no_errors	ENST00000262415	ensembl	human	known	74_37	missense	20.45	105	27	SNP	0.759	T
DLC1	10395	genome.wustl.edu	37	8	13072192	13072192	+	Intron	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:13072192A>T	ENST00000276297.4	-	5	1758				DLC1_ENST00000512044.2_Intron|DLC1_ENST00000316609.5_Silent_p.P480P	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GAAAGGTGTAAGGAGACAAAC	0.478																																																	0													162.0	148.0	153.0					8																	13072192		2203	4300	6503	SO:0001627	intron_variant	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1348+90585T>A	8.37:g.13072192A>T			B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	NULL	p.P480	ENST00000276297.4	37	c.1440	CCDS5989.1	8																																																																																			DLC1	-	NULL	ENSG00000164741		0.478	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	-	0.00	113	0	A	NM_182643, NM_006094		13072192	-1	tier1	-	no_errors	ENST00000316609	ensembl	human	known	74_37	silent	12.63	83	12	SNP	1.000	T
DLG4	1742	genome.wustl.edu	37	17	7096810	7096810	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:7096810C>A	ENST00000399506.2	-	16	1876	c.1685G>T	c.(1684-1686)tGt>tTt	p.C562F	DLG4_ENST00000399510.2_Missense_Mutation_p.C605F|DLG4_ENST00000302955.6_Missense_Mutation_p.C559F			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	562	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	ACGGGGAACACAGGATCCAAA	0.627																																																	0													68.0	68.0	68.0					17																	7096810		1992	4158	6150	SO:0001583	missense	0			U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.1685G>T	17.37:g.7096810C>A	ENSP00000382425:p.Cys562Phe		B7Z1S1|G5E939|Q92941|Q9UKK8	Missense_Mutation	SNP	pirsf_M-assoc_guanylate_kinase,pfam_GK/Ca_channel_bsu,pfam_PDZ,pfam_PDZ_assoc,pfam_MAGUK_PEST_N,pfam_SH3_domain,pfam_SH3_2,pfam_L27_1,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.C605F	ENST00000399506.2	37	c.1814		17	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487088	0.84854	.	.	ENSG00000132535	ENST00000399506;ENST00000302955;ENST00000399510;ENST00000293813;ENST00000380912;ENST00000539674	T;T;T	0.43688	0.94;0.94;0.94	5.08	5.08	0.68730	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	.	.	.	.	T	0.72503	0.3468	M	0.93016	3.37	0.80722	D	1	D;P;D;D	0.89917	1.0;0.932;0.999;0.997	D;P;D;D	0.91635	0.994;0.9;0.999;0.997	T	0.79720	-0.1685	9	0.87932	D	0	.	16.0154	0.80434	0.0:1.0:0.0:0.0	.	602;562;559;605	B9EGL1;P78352;G5E939;P78352-2	.;DLG4_HUMAN;.;.	F	562;559;605;605;502;605	ENSP00000382425:C562F;ENSP00000307471:C559F;ENSP00000382428:C605F	ENSP00000293813:C605F	C	-	2	0	DLG4	7037534	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.630000	0.83225	2.652000	0.90054	0.655000	0.94253	TGT	DLG4	-	pirsf_M-assoc_guanylate_kinase,pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like	ENSG00000132535		0.627	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	DLG4	HGNC	protein_coding	OTTHUMT00000259419.2		0.00	83	0	C	NM_001365		7096810	-1			no_errors	ENST00000399510	ensembl	human	known	74_37	missense	6.98	80	6	SNP	1.000	A
DMBX1	127343	genome.wustl.edu	37	1	46978148	46978148	+	Silent	SNP	C	C	A	rs142368793		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:46978148C>A	ENST00000360032.3	+	4	1130	c.1116C>A	c.(1114-1116)ctC>ctA	p.L372L	DMBX1_ENST00000371956.4_Silent_p.L377L	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					CCCTGGGACTCGATACGCTGC	0.612																																																	0													45.0	48.0	47.0					1																	46978148		2203	4299	6502	SO:0001819	synonymous_variant	0			AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.1116C>A	1.37:g.46978148C>A				Silent	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.L377	ENST00000360032.3	37	c.1131	CCDS536.1	1																																																																																			DMBX1	-	NULL	ENSG00000197587		0.612	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DMBX1	HGNC	protein_coding	OTTHUMT00000021895.1	-	0.00	54	0	C			46978148	+1	tier1	-	no_errors	ENST00000371956	ensembl	human	known	74_37	silent	11.84	67	9	SNP	0.610	A
DMD	1756	genome.wustl.edu	37	X	32481653	32481653	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:32481653C>A	ENST00000357033.4	-	25	3541	c.3335G>T	c.(3334-3336)gGg>gTg	p.G1112V	DMD_ENST00000378677.2_Missense_Mutation_p.G1108V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1112					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TATCTTCTGCCCACCTTCATT	0.388																																																	0													178.0	122.0	141.0					X																	32481653		2202	4299	6501	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3335G>T	X.37:g.32481653C>A	ENSP00000354923:p.Gly1112Val		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.G1112V	ENST00000357033.4	37	c.3335	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	17.83	3.486575	0.63962	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.39787	1.06;1.06	5.43	4.57	0.56435	.	0.000000	0.37669	U	0.001994	T	0.62258	0.2413	M	0.73598	2.24	0.80722	D	1	D;P;D	0.89917	0.999;0.752;1.0	D;P;D	0.70716	0.95;0.518;0.97	T	0.60994	-0.7152	10	0.26408	T	0.33	.	15.2254	0.73348	0.0:0.8546:0.1454:0.0	.	1104;1112;1108	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	V	1104;1108;1112;1112;989	ENSP00000367948:G1108V;ENSP00000354923:G1112V	ENSP00000354923:G1112V	G	-	2	0	DMD	32391574	1.000000	0.71417	0.942000	0.38095	0.955000	0.61496	4.850000	0.62889	1.059000	0.40554	0.436000	0.28706	GGG	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.388	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	71	0	C	NM_004006		32481653	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	5.68	83	5	SNP	0.998	A
DNAH14	127602	genome.wustl.edu	37	1	225519255	225519255	+	Intron	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:225519255A>T	ENST00000445597.2	+	45	7485				DNAH14_ENST00000439375.2_Missense_Mutation_p.L3187F|DNAH14_ENST00000430092.1_Missense_Mutation_p.L3187F			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CGTCAGTCTTACTAACTGTCC	0.428																																																	0													79.0	73.0	75.0					1																	225519255		692	1591	2283	SO:0001627	intron_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7486-5713A>T	1.37:g.225519255A>T			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.L3187F	ENST00000445597.2	37	c.9561		1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.661514	0.47572	.	.	ENSG00000185842	ENST00000430092;ENST00000439375	D;D	0.81499	-1.5;-1.5	5.04	-2.74	0.05932	.	0.364034	0.15722	U	0.247867	D	0.89322	0.6682	M	0.94101	3.495	0.24858	N	0.992364	D	0.89917	1.0	D	0.87578	0.998	T	0.81123	-0.1076	10	0.87932	D	0	.	6.9667	0.24627	0.4461:0.1307:0.4231:0.0	.	3187	Q0VDD8-4	.	F	3187	ENSP00000414402:L3187F;ENSP00000392061:L3187F	ENSP00000414402:L3187F	L	+	3	2	DNAH14	223585878	0.683000	0.27633	0.103000	0.21229	0.476000	0.33039	0.206000	0.17375	-0.703000	0.05049	0.438000	0.28831	TTA	DNAH14	-	NULL	ENSG00000185842		0.428	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	39	0	A	XM_059166		225519255	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	9.52	57	6	SNP	0.141	T
DNAJA3	9093	genome.wustl.edu	37	16	4492341	4492341	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:4492341A>T	ENST00000262375.6	+	5	780	c.703A>T	c.(703-705)Acg>Tcg	p.T235S	DNAJA3_ENST00000355296.4_Missense_Mutation_p.T235S|DNAJA3_ENST00000431375.2_Missense_Mutation_p.T82S	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	235					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						CATCATGGACACGTGTGAGCG	0.552																																																	0													113.0	100.0	105.0					16																	4492341		2197	4300	6497	SO:0001583	missense	0			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.703A>T	16.37:g.4492341A>T	ENSP00000262375:p.Thr235Ser		B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_DnaJ_C,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_domain,pfscan_DnaJ_domain,pfscan_HSP_DnaJ_Cys-rich_dom,prints_DnaJ_domain	p.T235S	ENST00000262375.6	37	c.703	CCDS10515.1	16	.	.	.	.	.	.	.	.	.	.	A	9.896	1.205553	0.22205	.	.	ENSG00000103423	ENST00000262375;ENST00000355296;ENST00000431375	T;T;T	0.63744	-0.06;-0.06;0.94	5.78	3.29	0.37713	HSP40/DnaJ peptide-binding (1);Heat shock protein DnaJ, cysteine-rich domain (3);	0.227351	0.46145	D	0.000316	T	0.47135	0.1429	L	0.43923	1.385	0.09310	N	0.999997	B;B;B	0.22746	0.028;0.016;0.074	B;B;B	0.23018	0.015;0.022;0.043	T	0.23833	-1.0177	10	0.15066	T	0.55	-23.5652	6.7207	0.23328	0.6197:0.0:0.0727:0.3076	.	82;235;235	E7ES32;Q96EY1-2;Q96EY1	.;.;DNJA3_HUMAN	S	235;235;82	ENSP00000262375:T235S;ENSP00000347445:T235S;ENSP00000393970:T82S	ENSP00000262375:T235S	T	+	1	0	DNAJA3	4432342	0.082000	0.21442	0.015000	0.15790	0.471000	0.32888	0.501000	0.22578	0.991000	0.38814	0.383000	0.25322	ACG	DNAJA3	-	pfam_HSP_DnaJ_Cys-rich_dom,superfamily_HSP_DnaJ_Cys-rich_dom,superfamily_HSP40/DnaJ_pept-bd,pfscan_HSP_DnaJ_Cys-rich_dom	ENSG00000103423		0.552	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNAJA3	HGNC	protein_coding	OTTHUMT00000251633.1		0.00	62	0	A			4492341	+1			no_errors	ENST00000262375	ensembl	human	known	74_37	missense	5.08	55	3	SNP	0.015	T
DNAJA3	9093	genome.wustl.edu	37	16	4496970	4496970	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:4496970G>T	ENST00000262375.6	+	8	1157	c.1080G>T	c.(1078-1080)ggG>ggT	p.G360G	DNAJA3_ENST00000355296.4_Silent_p.G360G|DNAJA3_ENST00000431375.2_Silent_p.G207G	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	360					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						CTCTTCTTGGGGGTACAGCCA	0.527																																																	0													69.0	71.0	71.0					16																	4496970		2197	4300	6497	SO:0001819	synonymous_variant	0			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.1080G>T	16.37:g.4496970G>T			B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Silent	SNP	pfam_DnaJ_domain,pfam_DnaJ_C,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_domain,pfscan_DnaJ_domain,pfscan_HSP_DnaJ_Cys-rich_dom,prints_DnaJ_domain	p.G360	ENST00000262375.6	37	c.1080	CCDS10515.1	16																																																																																			DNAJA3	-	pfam_DnaJ_C,superfamily_HSP40/DnaJ_pept-bd	ENSG00000103423		0.527	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNAJA3	HGNC	protein_coding	OTTHUMT00000251633.1		0.00	48	0	G			4496970	+1			no_errors	ENST00000262375	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.709	T
DPF3	8110	genome.wustl.edu	37	14	73190435	73190435	+	Splice_Site	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:73190435C>G	ENST00000556509.1	-	5	430	c.431G>C	c.(430-432)aGg>aCg	p.R144T	DPF3_ENST00000541685.1_Splice_Site_p.R144T|DPF3_ENST00000557704.1_5'UTR|DPF3_ENST00000546183.1_Splice_Site_p.R154T	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	144					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TTCCAAAACCCTCTGAAATGA	0.353																																																	0													139.0	138.0	138.0					14																	73190435		1813	4074	5887	SO:0001630	splice_region_variant	0			U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.430-1G>C	14.37:g.73190435C>G			A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R199T	ENST00000556509.1	37	c.596		14	.	.	.	.	.	.	.	.	.	.	C	20.2	3.958234	0.73902	.	.	ENSG00000205683	ENST00000540281;ENST00000556509;ENST00000398816;ENST00000541685;ENST00000546183	D;T;T	0.90844	-2.74;-0.19;-0.21	5.07	5.07	0.68467	.	.	.	.	.	D	0.94578	0.8253	M	0.73962	2.25	0.80722	D	1	D;P;D	0.55172	0.97;0.916;0.967	P;P;P	0.60789	0.857;0.631;0.879	D	0.95196	0.8312	9	0.87932	D	0	.	18.4822	0.90817	0.0:1.0:0.0:0.0	.	154;144;144	F5H575;Q92784-2;Q92784	.;.;DPF3_HUMAN	T	144;144;143;144;154	ENSP00000450518:R144T;ENSP00000441640:R144T;ENSP00000444662:R154T	ENSP00000381791:R199T	R	-	2	0	DPF3	72260188	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.652000	0.67959	2.364000	0.80123	0.561000	0.74099	AGG	DPF3	-	NULL	ENSG00000205683		0.353	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	DPF3	HGNC	protein_coding	OTTHUMT00000413152.2	-	0.00	118	0	C		Missense_Mutation	73190435	-1	tier1	-	no_errors	ENST00000366353	ensembl	human	known	74_37	missense	8.86	144	14	SNP	1.000	G
DRAXIN	374946	genome.wustl.edu	37	1	11766385	11766386	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C|T	C|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:11766385_11766386CT>AA	ENST00000294485.5	+	2	205_206	c.70_71CT>AA	c.(70-72)CTg>AAg	p.L24K		NM_198545.3	NP_940947.3			dorsal inhibitory axon guidance protein																		GGAGCTGAGCCTGGCAGGCGCC	0.658																																																	0																																										SO:0001583	missense	0			AY358750	CCDS135.1	1p36.22	2012-08-20	2012-08-14	2012-08-14	ENSG00000162490	ENSG00000162490			25054	protein-coding gene	gene with protein product	"""dorsal repulsive axon guidance protein"", ""neural tissue-specific cysteine-rich protein"""	612682	"""chromosome 1 open reading frame 187"""	C1orf187		19150847	Standard	NM_198545		Approved	FLJ34999, Draxin, Neucrin	uc001asr.1	Q8NBI3	OTTHUMG00000002227	Exception_encountered	1.37:g.11766385_11766386delinsAA	ENSP00000294485:p.Leu24Lys			Missense_Mutation	SNP	NULL	p.L24M|p.L24Q	ENST00000294485.5	37	c.70|c.71	CCDS135.1	1																																																																																			DRAXIN	-	NULL	ENSG00000162490		0.658	DRAXIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAXIN	HGNC	protein_coding	OTTHUMT00000006325.1	-	0.00	72|71	0	C|T	NM_198545		11766385|11766386	+1	tier1	-	no_errors	ENST00000294485	ensembl	human	known	74_37	missense	9.09	90	9	SNP	0.003|0.000	A
DRAM2	128338	genome.wustl.edu	37	1	111674115	111674115	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:111674115G>A	ENST00000286692.4	-	3	679	c.62C>T	c.(61-63)gCt>gTt	p.A21V	DRAM2_ENST00000484310.1_5'UTR|DRAM2_ENST00000539140.1_Missense_Mutation_p.A21V			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	21					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)				endometrium(1)|large_intestine(5)|lung(3)	9						TATGAAAGCAGCAGATGTCCA	0.378																																																	0													135.0	136.0	136.0					1																	111674115		2203	4300	6503	SO:0001583	missense	0			AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.62C>T	1.37:g.111674115G>A	ENSP00000286692:p.Ala21Val		B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.A21V	ENST00000286692.4	37	c.62	CCDS30801.1	1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.938283	0.92526	.	.	ENSG00000156171	ENST00000286692;ENST00000539140	T;T	0.42513	0.97;0.97	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.47857	0.1468	L	0.44542	1.39	0.53005	D	0.999967	D	0.67145	0.996	D	0.65443	0.935	T	0.45804	-0.9236	10	0.72032	D	0.01	-2.1023	15.5529	0.76167	0.0:0.0:1.0:0.0	.	21	Q6UX65	DRAM2_HUMAN	V	21	ENSP00000286692:A21V;ENSP00000437718:A21V	ENSP00000286692:A21V	A	-	2	0	DRAM2	111475638	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	7.422000	0.80217	2.816000	0.96949	0.561000	0.74099	GCT	DRAM2	-	pfam_Frag1/DRAM/Sfk1	ENSG00000156171		0.378	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM2	HGNC	protein_coding	OTTHUMT00000032930.3	-	0.00	60	0	G	NM_178454		111674115	-1	tier1	-	no_errors	ENST00000286692	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	A
DSCAML1	57453	genome.wustl.edu	37	11	117395568	117395568	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:117395568T>A	ENST00000321322.6	-	5	1070	c.1069A>T	c.(1069-1071)Acc>Tcc	p.T357S	DSCAML1_ENST00000527706.1_Missense_Mutation_p.T87S	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	297	Ig-like C2-type 4.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AAGGTGTTGGTGACCTCACAA	0.637																																																	0													51.0	40.0	44.0					11																	117395568		2200	4296	6496	SO:0001583	missense	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1069A>T	11.37:g.117395568T>A	ENSP00000315465:p.Thr357Ser		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T357S	ENST00000321322.6	37	c.1069	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	T	7.171	0.587590	0.13812	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.68479	-0.33;-0.33	4.94	3.8	0.43715	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.41834	0.1176	N	0.12471	0.22	0.38822	D	0.955658	B;B	0.10296	0.002;0.003	B;B	0.21360	0.013;0.034	T	0.30650	-0.9971	9	0.02654	T	1	.	9.2753	0.37696	0.288:0.0:0.0:0.712	.	87;297	G3V1B5;Q8TD84	.;DSCL1_HUMAN	S	87;357;64	ENSP00000434335:T87S;ENSP00000315465:T357S	ENSP00000315465:T357S	T	-	1	0	DSCAML1	116900778	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.944000	0.70219	0.895000	0.36342	0.454000	0.30748	ACC	DSCAML1	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000177103		0.637	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	-	0.00	82	0	T	NM_020693		117395568	-1	tier1	-	no_errors	ENST00000321322	ensembl	human	known	74_37	missense	12.79	75	11	SNP	1.000	A
DUXA	503835	genome.wustl.edu	37	19	57670600	57670600	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:57670600G>T	ENST00000554048.2	-	3	226	c.227C>A	c.(226-228)cCa>cAa	p.P76Q		NM_001012729.1	NP_001012747.1	A6NLW8	DUXA_HUMAN	double homeobox A	76					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		CTCAGCTTCTGGTCTTTTCTG	0.428																																																	0													109.0	100.0	103.0					19																	57670600		2203	4300	6503	SO:0001583	missense	0				CCDS33126.1	19q13.43	2012-10-04			ENSG00000258873	ENSG00000258873		"""Homeoboxes / PRD class"""	32179	protein-coding gene	gene with protein product		611168					Standard	NM_001012729		Approved		uc002qoa.1	A6NLW8	OTTHUMG00000170714	ENST00000554048.2:c.227C>A	19.37:g.57670600G>T	ENSP00000452398:p.Pro76Gln			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.P76Q	ENST00000554048.2	37	c.227	CCDS33126.1	19	.	.	.	.	.	.	.	.	.	.	G	3.584	-0.085014	0.07097	.	.	ENSG00000258873	ENST00000554048	D	0.92199	-2.99	2.19	1.12	0.20585	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	2.097570	0.03027	N	0.151546	D	0.88392	0.6424	N	0.08118	0	0.09310	N	1	D	0.62365	0.991	P	0.60949	0.881	T	0.80913	-0.1170	10	0.15066	T	0.55	-0.427	4.7299	0.12959	0.1867:0.0:0.8133:0.0	.	76	A6NLW8	DUXA_HUMAN	Q	76	ENSP00000452398:P76Q	ENSP00000365415:P76Q	P	-	2	0	DUXA	62362412	0.000000	0.05858	0.008000	0.14137	0.011000	0.07611	0.422000	0.21296	0.481000	0.27557	0.561000	0.74099	CCA	DUXA	-	superfamily_Homeodomain-like,smart_Homeobox_dom	ENSG00000258873		0.428	DUXA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	DUXA	HGNC	protein_coding	OTTHUMT00000410075.3	-	0.00	67	0	G	NM_001012729		57670600	-1	tier1	-	no_errors	ENST00000554048	ensembl	human	known	74_37	missense	13.24	59	9	SNP	0.008	T
DYRK1A	1859	genome.wustl.edu	37	21	38878463	38878463	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr21:38878463G>A	ENST00000398960.2	+	10	1683	c.1608G>A	c.(1606-1608)cgG>cgA	p.R536R	DYRK1A_ENST00000338785.3_Silent_p.R536R|DYRK1A_ENST00000339659.4_Silent_p.R527R|DYRK1A_ENST00000398956.2_Intron|DYRK1A_ENST00000321219.8_Intron|DYRK1A_ENST00000455387.2_Silent_p.R308R|DYRK1A_ENST00000451934.1_Silent_p.R536R	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	536					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACCAGCATCGGCACAGTGGTG	0.562																																					Melanoma(114;464 1602 31203 43785 45765)												0													80.0	68.0	72.0					21																	38878463		2203	4300	6503	SO:0001819	synonymous_variant	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1608G>A	21.37:g.38878463G>A			O60769|Q92582|Q92810|Q9UNM5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R536	ENST00000398960.2	37	c.1608	CCDS42925.1	21																																																																																			DYRK1A	-	NULL	ENSG00000157540		0.562	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	-	0.00	31	0	G	NM_001396		38878463	+1	tier1	-	no_errors	ENST00000398960	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	A
E2F6	1876	genome.wustl.edu	37	2	11591836	11591836	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:11591836C>A	ENST00000381525.3	-	4	746	c.477G>T	c.(475-477)gaG>gaT	p.E159D	E2F6_ENST00000546212.1_Missense_Mutation_p.E84D|E2F6_ENST00000362009.4_Intron|E2F6_ENST00000542100.1_Missense_Mutation_p.E84D|E2F6_ENST00000307236.4_Missense_Mutation_p.E127D	NM_198256.2	NP_937987.2	O75461	E2F6_HUMAN	E2F transcription factor 6	159	Dimerization. {ECO:0000255}.|Leucine-zipper.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|kidney(1)|lung(3)|prostate(1)|skin(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.114)|OV - Ovarian serous cystadenocarcinoma(76;0.168)		CCTTAATTAACTCATCCAAAG	0.363																																																	0													38.0	32.0	34.0					2																	11591836		1804	4057	5861	SO:0001583	missense	0			AF041381	CCDS1680.2, CCDS62858.1, CCDS62859.1	2p25.1	2008-02-05			ENSG00000169016	ENSG00000169016			3120	protein-coding gene	gene with protein product		602944				9501179	Standard	NM_198256		Approved	E2F-6	uc002rbh.4	O75461	OTTHUMG00000090565	ENST00000381525.3:c.477G>T	2.37:g.11591836C>A	ENSP00000370936:p.Glu159Asp		A8K2Z8|G5E936|O60544|Q53QY9|Q6Q9Z6|Q7Z2H6	Missense_Mutation	SNP	pfam_E2F_TDP	p.E159D	ENST00000381525.3	37	c.477	CCDS1680.2	2	.	.	.	.	.	.	.	.	.	.	C	13.31	2.197704	0.38806	.	.	ENSG00000169016	ENST00000381525;ENST00000307236;ENST00000542100;ENST00000546212	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	5.94	2.95	0.34219	.	0.428495	0.29165	N	0.012960	T	0.80670	0.4667	L	0.46157	1.445	0.80722	D	1	B;B	0.31879	0.344;0.086	B;B	0.29077	0.076;0.098	T	0.71941	-0.4440	10	0.45353	T	0.12	0.0389	1.3788	0.02226	0.1546:0.3337:0.3026:0.2091	.	159;127	O75461;G5E936	E2F6_HUMAN;.	D	159;127;84;84	ENSP00000370936:E159D;ENSP00000302159:E127D;ENSP00000446315:E84D;ENSP00000438864:E84D	ENSP00000302159:E127D	E	-	3	2	E2F6	11509287	0.640000	0.27243	0.963000	0.40424	0.993000	0.82548	-0.199000	0.09491	0.300000	0.22699	0.650000	0.86243	GAG	E2F6	-	NULL	ENSG00000169016		0.363	E2F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F6	HGNC	protein_coding	OTTHUMT00000207101.2	-	0.00	51	0	C	NM_001952		11591836	-1	tier1	-	no_errors	ENST00000381525	ensembl	human	known	74_37	missense	12.50	70	10	SNP	0.996	A
EIF4A3	9775	genome.wustl.edu	37	17	78117984	78117984	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:78117984C>G	ENST00000269349.3	-	2	450	c.229G>C	c.(229-231)Gat>Cat	p.D77H		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	77	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			GCGATGACATCTCTCCCTTTG	0.473																																																	0													188.0	133.0	151.0					17																	78117984		2203	4300	6503	SO:0001583	missense	0			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.229G>C	17.37:g.78117984C>G	ENSP00000269349:p.Asp77His		Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D77H	ENST00000269349.3	37	c.229	CCDS11767.1	17	.	.	.	.	.	.	.	.	.	.	c	17.71	3.456904	0.63401	.	.	ENSG00000141543	ENST00000269349	T	0.24350	1.86	5.59	4.62	0.57501	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.045624	0.85682	D	0.000000	T	0.58963	0.2159	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68853	-0.5299	10	0.87932	D	0	11.3701	12.2676	0.54686	0.0:0.9169:0.0:0.0831	.	77	P38919	IF4A3_HUMAN	H	77	ENSP00000269349:D77H	ENSP00000269349:D77H	D	-	1	0	EIF4A3	75732579	1.000000	0.71417	0.359000	0.25824	0.545000	0.35147	7.167000	0.77562	1.354000	0.45846	0.650000	0.86243	GAT	EIF4A3	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000141543		0.473	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A3	HGNC	protein_coding	OTTHUMT00000437446.1	-	0.00	86	0	C	NM_014740		78117984	-1	tier1	-	no_errors	ENST00000269349	ensembl	human	known	74_37	missense	21.82	86	24	SNP	0.999	G
ELAVL4	1996	genome.wustl.edu	37	1	50661318	50661318	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:50661318C>T	ENST00000371823.4	+	5	818	c.594C>T	c.(592-594)ccC>ccT	p.P198P	ELAVL4_ENST00000448907.2_Silent_p.P201P|ELAVL4_ENST00000371819.1_Silent_p.P203P|ELAVL4_ENST00000371824.1_Silent_p.P198P|ELAVL4_ENST00000357083.4_Silent_p.P215P|ELAVL4_ENST00000371821.1_Silent_p.P203P|ELAVL4_ENST00000371827.1_Silent_p.P198P	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	198	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						GCCAGAAGCCCAGCGGTGCTA	0.567																																																	0													111.0	113.0	112.0					1																	50661318		2203	4300	6503	SO:0001819	synonymous_variant	0			AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.594C>T	1.37:g.50661318C>T			B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.P203	ENST00000371823.4	37	c.609	CCDS553.1	1																																																																																			ELAVL4	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	ENSG00000162374		0.567	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	ELAVL4	HGNC	protein_coding	OTTHUMT00000021712.1	-	0.00	88	0	C	NM_021952		50661318	+1	tier1	-	no_errors	ENST00000371821	ensembl	human	known	74_37	silent	9.02	111	11	SNP	0.993	T
ELN	2006	genome.wustl.edu	37	7	73474214	73474214	+	Splice_Site	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:73474214A>T	ENST00000252034.7	+	23	1813		c.e23-1		ELN_ENST00000357036.5_Splice_Site|ELN_ENST00000320492.7_Splice_Site|ELN_ENST00000380576.5_Splice_Site|ELN_ENST00000458204.1_Splice_Site|ELN_ENST00000380553.4_Splice_Site|ELN_ENST00000380584.4_Splice_Site|ELN_ENST00000380575.4_Splice_Site|ELN_ENST00000380562.4_Silent_p.A477A|ELN_ENST00000429192.1_Splice_Site|ELN_ENST00000320399.6_Splice_Site|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000414324.1_Splice_Site|ELN_ENST00000445912.1_Splice_Site|ELN_ENST00000358929.4_Silent_p.A506A	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin						blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				TCAATCTTGCAGGGTTAGTTC	0.567			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																	Dom	yes		7	7q11.23	2006	elastin	yes	L	0													233.0	227.0	229.0					7																	73474214		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1415-1A>T	7.37:g.73474214A>T			B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Splice_Site	SNP	-	e23-2	ENST00000252034.7	37	c.1415-2	CCDS5562.2	7	.	.	.	.	.	.	.	.	.	.	.	10.85	1.466647	0.26335	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000320492;ENST00000414324;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	.	.	.	3.71	3.71	0.42584	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0233	0.36213	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ELN	73112150	0.831000	0.29352	0.159000	0.22649	0.014000	0.08584	1.321000	0.33678	1.691000	0.51100	0.529000	0.55759	.	ELN	-	-	ENSG00000049540		0.567	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	HGNC	protein_coding	OTTHUMT00000316913.1	-	0.00	105	0	A	NM_000501	Intron	73474214	+1	tier1	-	no_errors	ENST00000320399	ensembl	human	known	74_37	splice_site	7.14	117	9	SNP	0.703	T
ELOVL5	60481	genome.wustl.edu	37	6	53140028	53140028	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:53140028G>C	ENST00000542638.1	-	5	803	c.356C>G	c.(355-357)tCc>tGc	p.S119C	MIR5685_ENST00000579080.1_RNA|ELOVL5_ENST00000486973.1_5'Flank|ELOVL5_ENST00000304434.6_Missense_Mutation_p.S119C|ELOVL5_ENST00000370918.4_Missense_Mutation_p.S109C|ELOVL5_ENST00000541407.1_Missense_Mutation_p.S146C			Q9NYP7	ELOV5_HUMAN	ELOVL fatty acid elongase 5	119					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7	Lung NSC(77;0.116)					TATGAGTTTGGAGAAGTAGTA	0.463																																																	0													164.0	143.0	150.0					6																	53140028		2203	4300	6503	SO:0001583	missense	0			AF052129	CCDS4951.1, CCDS56433.1, CCDS56434.1, CCDS75470.1	6p21.1-p12.1	2014-07-30	2011-05-25		ENSG00000012660	ENSG00000012660			21308	protein-coding gene	gene with protein product		611805	"""ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"", ""spinocerebellar ataxia 38"""	SCA38		10970790, 25065913	Standard	NM_021814		Approved	HELO1, dJ483K16.1	uc011dwx.2	Q9NYP7	OTTHUMG00000016249	ENST00000542638.1:c.356C>G	6.37:g.53140028G>C	ENSP00000440728:p.Ser119Cys		B4DZJ2|F6SH78|Q59EL3|Q5TGH5|Q6NXE7|Q7L2S5|Q8NCG4|Q9UI22	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.S146C	ENST00000542638.1	37	c.437	CCDS4951.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.265081	0.95399	.	.	ENSG00000012660	ENST00000370918;ENST00000304434;ENST00000542638;ENST00000541407	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	T	0.61565	0.2357	M	0.90650	3.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66085	-0.6011	10	0.62326	D	0.03	-15.9899	20.7342	0.99715	0.0:0.0:1.0:0.0	.	146;119;119	F6SH78;B3KWH9;Q9NYP7	.;.;ELOV5_HUMAN	C	109;119;119;146	ENSP00000359956:S109C;ENSP00000306640:S119C;ENSP00000440728:S119C;ENSP00000438095:S146C	ENSP00000306640:S119C	S	-	2	0	ELOVL5	53247987	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.807000	0.99171	2.906000	0.99361	0.655000	0.94253	TCC	ELOVL5	-	pfam_GNS1_SUR4	ENSG00000012660		0.463	ELOVL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL5	HGNC	protein_coding	OTTHUMT00000043566.1	-	0.00	72	0	G	NM_021814		53140028	-1	tier1	-	no_errors	ENST00000541407	ensembl	human	known	74_37	missense	8.85	103	10	SNP	1.000	C
EMC1	23065	genome.wustl.edu	37	1	19565849	19565849	+	Intron	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:19565849G>A	ENST00000477853.1	-	9	997				EMC1_ENST00000375208.3_Intron|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375199.3_Intron	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1							ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											CTAGCCAGCTGCCTTACAGAG	0.557																																																	0													44.0	44.0	44.0					1																	19565849		692	1591	2283	SO:0001627	intron_variant	0				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.955-53C>T	1.37:g.19565849G>A			A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	RNA	SNP	-	NULL	ENST00000477853.1	37	NULL	CCDS190.1	1																																																																																			EMC1	-	-	ENSG00000127463		0.557	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	-	0.00	33	0	G	NM_015047		19565849	-1	tier1	-	no_errors	ENST00000467423	ensembl	human	known	74_37	rna	7.69	48	4	SNP	0.062	A
EMR4P	326342	genome.wustl.edu	37	19	6971215	6971215	+	RNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:6971215G>T	ENST00000600751.1	-	0	1205					NR_024075.1		Q86SQ3	EMR4_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)										GTCAGGAACAGGAGGTGGGCC	0.547																																																	0																																												0			AY181245		19p13.2	2014-08-08	2008-06-06	2008-06-06	ENSG00000268758	ENSG00000268758		"""-"", ""GPCR / Class B : Orphans"""	19240	pseudogene	pseudogene		612305	"""G protein-coupled receptor 127"", ""egf-like module containing, mucin-like, hormone receptor-like 4"""	GPR127, EMR4		12565841	Standard	NR_024075		Approved	PGR16	uc010xjk.2	Q86SQ3	OTTHUMG00000177251		19.37:g.6971215G>T			Q86SP1	RNA	SNP	-	NULL	ENST00000600751.1	37	NULL		19																																																																																			EMR4P	-	-	ENSG00000268758		0.547	EMR4P-002	KNOWN	basic	processed_transcript	EMR4P	HGNC	pseudogene	OTTHUMT00000436007.1	-	0.00	67	0	G	NR_024075		6971215	-1	tier1	-	no_errors	ENST00000600751	ensembl	human	known	74_37	rna	12.16	65	9	SNP	0.981	T
EMR4P	326342	genome.wustl.edu	37	19	6972268	6972268	+	RNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:6972268C>A	ENST00000600751.1	-	0	1028					NR_024075.1		Q86SQ3	EMR4_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)										GCAAGAGCCACGAGGACGGCA	0.498																																																	0																																												0			AY181245		19p13.2	2014-08-08	2008-06-06	2008-06-06	ENSG00000268758	ENSG00000268758		"""-"", ""GPCR / Class B : Orphans"""	19240	pseudogene	pseudogene		612305	"""G protein-coupled receptor 127"", ""egf-like module containing, mucin-like, hormone receptor-like 4"""	GPR127, EMR4		12565841	Standard	NR_024075		Approved	PGR16	uc010xjk.2	Q86SQ3	OTTHUMG00000177251		19.37:g.6972268C>A			Q86SP1	RNA	SNP	-	NULL	ENST00000600751.1	37	NULL		19																																																																																			EMR4P	-	-	ENSG00000268758		0.498	EMR4P-002	KNOWN	basic	processed_transcript	EMR4P	HGNC	pseudogene	OTTHUMT00000436007.1	-	0.00	83	0	C	NR_024075		6972268	-1	tier1	-	no_errors	ENST00000600751	ensembl	human	known	74_37	rna	9.52	76	8	SNP	0.023	A
ENAM	10117	genome.wustl.edu	37	4	71508513	71508513	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:71508513C>T	ENST00000396073.3	+	9	1651	c.1370C>T	c.(1369-1371)cCc>cTc	p.P457L	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	457					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			CCAACCAGCCCCTGGAGAAAC	0.393																																																	0													34.0	36.0	36.0					4																	71508513		2185	4295	6480	SO:0001583	missense	0			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1370C>T	4.37:g.71508513C>T	ENSP00000379383:p.Pro457Leu		Q17RI5|Q9H3D1	Missense_Mutation	SNP	NULL	p.P457L	ENST00000396073.3	37	c.1370	CCDS3544.2	4	.	.	.	.	.	.	.	.	.	.	C	9.017	0.984048	0.18889	.	.	ENSG00000132464	ENST00000396073	T	0.31247	1.5	5.93	3.31	0.37934	.	0.580762	0.16818	N	0.198268	T	0.33818	0.0876	M	0.74647	2.275	0.40929	D	0.984376	B	0.23735	0.09	B	0.26969	0.075	T	0.12656	-1.0539	10	0.59425	D	0.04	0.2994	8.1016	0.30861	0.0:0.7528:0.0:0.2472	.	457	Q9NRM1	ENAM_HUMAN	L	457	ENSP00000379383:P457L	ENSP00000379383:P457L	P	+	2	0	ENAM	71727377	0.264000	0.24093	0.741000	0.31004	0.139000	0.21198	0.765000	0.26546	0.430000	0.26230	0.655000	0.94253	CCC	ENAM	-	NULL	ENSG00000132464		0.393	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	HGNC	protein_coding	OTTHUMT00000252166.3	-	0.00	57	0	C	NM_031889		71508513	+1	tier1	-	no_errors	ENST00000396073	ensembl	human	known	74_37	missense	15.85	69	13	SNP	0.867	T
ENGASE	64772	genome.wustl.edu	37	17	77082110	77082110	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:77082110G>A	ENST00000579016.1	+	14	1911	c.1911G>A	c.(1909-1911)gaG>gaA	p.E637E		NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	637						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						CTGAGCGGGAGGGGCCCCCTG	0.667																																																	0													35.0	42.0	39.0					17																	77082110		2132	4242	6374	SO:0001819	synonymous_variant	0			AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.1911G>A	17.37:g.77082110G>A			Q659F0|Q8TB86|Q9H6U4	Silent	SNP	pfam_Glyco_hydro_85,pfscan_BRCT_dom	p.E637	ENST00000579016.1	37	c.1911	CCDS42394.1	17																																																																																			ENGASE	-	NULL	ENSG00000167280		0.667	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENGASE	HGNC	protein_coding	OTTHUMT00000395807.1	-	0.00	80	0	G	NM_022759		77082110	+1	tier1	-	no_errors	ENST00000579016	ensembl	human	known	74_37	silent	5.66	100	6	SNP	0.006	A
ENPEP	2028	genome.wustl.edu	37	4	111436598	111436598	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:111436598G>T	ENST00000265162.5	+	8	1851	c.1509G>T	c.(1507-1509)caG>caT	p.Q503H	RP11-380D23.1_ENST00000503998.1_RNA	NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	503					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		AAGGATGTCAGGTATGATTTA	0.289																																																	0													79.0	85.0	83.0					4																	111436598		2202	4296	6498	SO:0001630	splice_region_variant	0			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1509+1G>T	4.37:g.111436598G>T			Q504U2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.Q503H	ENST00000265162.5	37	c.1509	CCDS3691.1	4	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341200	0.60963	.	.	ENSG00000138792	ENST00000265162	T	0.04917	3.53	5.59	3.53	0.40419	.	0.112881	0.64402	D	0.000006	T	0.16300	0.0392	M	0.63428	1.95	0.80722	D	1	D	0.69078	0.997	P	0.57679	0.825	T	0.01326	-1.1384	10	0.45353	T	0.12	.	13.0903	0.59164	0.1533:0.0:0.8467:0.0	.	503	Q07075	AMPE_HUMAN	H	503	ENSP00000265162:Q503H	ENSP00000265162:Q503H	Q	+	3	2	ENPEP	111656047	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	2.839000	0.48207	1.361000	0.45981	0.650000	0.86243	CAG	ENPEP	-	NULL	ENSG00000138792		0.289	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	HGNC	protein_coding	OTTHUMT00000255747.2	-	0.00	47	0	G		Missense_Mutation	111436598	+1	tier1	-	no_errors	ENST00000265162	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
AAK1	22848	genome.wustl.edu	37	2	69691701	69691701	+	Intron	SNP	A	A	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:69691701A>C	ENST00000409068.1	-	15	2300				RP11-427H3.3_ENST00000606389.2_lincRNA			Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1						endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						CAAACACCAAAAAACGAGTGA	0.428																																																	0																																										SO:0001627	intron_variant	0			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409068.1:c.1987-2864T>G	2.37:g.69691701A>C			Q4ZFZ3|Q53RX6|Q9UPV4	RNA	SNP	-	NULL	ENST00000409068.1	37	NULL		2																																																																																			RP11-427H3.3	-	-	ENSG00000188971		0.428	AAK1-011	PUTATIVE	basic	protein_coding	ENSG00000188971	Clone_based_vega_gene	protein_coding	OTTHUMT00000333994.1	-	0.00	49	0	A	NM_014911		69691701	-1	tier1	-	no_errors	ENST00000606389	ensembl	human	known	74_37	rna	11.11	48	6	SNP	0.003	C
LOC101927209	101927209	genome.wustl.edu	37	1	142711340	142711340	+	lincRNA	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:142711340T>A	ENST00000610091.1	-	0	2766																											TGCCTTCCAGTGGAGACTCTA	0.343																																																	0																																												0																															1.37:g.142711340T>A				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.343	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	188	0	T			142711340	-1	tier1	-	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	13.82	212	34	SNP	0.695	A
RP13-379L11.2	0	genome.wustl.edu	37	20	56534062	56534062	+	lincRNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:56534062G>T	ENST00000371169.1	-	0	654																											TCCCAGGAAGGGTGAGGTTCT	0.478																																																	0																																												0																															20.37:g.56534062G>T				RNA	SNP	-	NULL	ENST00000371169.1	37	NULL		20																																																																																			RP13-379L11.2	-	-	ENSG00000203971		0.478	RP13-379L11.2-001	KNOWN	basic	lincRNA	ENSG00000203971	Clone_based_vega_gene	lincRNA	OTTHUMT00000267816.1	-	0.00	58	0	G			56534062	-1	tier1	-	no_errors	ENST00000371169	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.001	T
RAPGEF2	9693	genome.wustl.edu	37	4	160216908	160216908	+	Intron	SNP	C	C	T	rs66478721|rs373967945|rs4690935|rs113715111|rs60091174		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:160216908C>T	ENST00000264431.4	+	2	479				AC105316.1_ENST00000401270.1_RNA|RAPGEF2_ENST00000504604.1_Intron	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2						adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		tgtgtgtgtgcgcgcgcgcgc	0.423																																																	0																																										SO:0001627	intron_variant	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.61-8586C>T	4.37:g.160216908C>T			D3DP27	RNA	SNP	-	NULL	ENST00000264431.4	37	NULL	CCDS43277.1	4																																																																																			AC105316.1	-	-	ENSG00000216089		0.423	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216089	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000364980.2	-	0.00	37	0	C	NM_014247		160216908	+1	tier1	rs4690935	no_errors	ENST00000401270	ensembl	human	novel	74_37	rna	23.33	23	7	SNP	0.000	T
TSSK1B	83942	genome.wustl.edu	37	5	112769133	112769133	+	3'UTR	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:112769133C>T	ENST00000390666.3	-	0	1595				CTD-2201G3.1_ENST00000510381.2_RNA|MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000383058.4_RNA|CTD-2201G3.1_ENST00000416046.2_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B						multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		GTCACTGAGCCGTTGCGGCCA	0.627																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.*300G>A	5.37:g.112769133C>T			B2R8D9	RNA	SNP	-	NULL	ENST00000390666.3	37	NULL	CCDS4112.1	5																																																																																			CTD-2201G3.1	-	-	ENSG00000232633		0.627	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232633	Clone_based_vega_gene	protein_coding	OTTHUMT00000250774.2	-	0.00	61	0	C	NM_032028		112769133	+1	tier1	-	no_errors	ENST00000416046	ensembl	human	known	74_37	rna	10.00	54	6	SNP	0.974	T
LOC730338	730338	genome.wustl.edu	37	7	46728896	46728896	+	3'UTR	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:46728896G>T	ENST00000451905.1	-	0	527				AC011294.3_ENST00000469937.1_5'UTR																							TTCTTTCTCTGGGATGCCCCT	0.438																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000451905.1:c.*102C>A	7.37:g.46728896G>T				RNA	SNP	-	NULL	ENST00000451905.1	37	NULL		7																																																																																			AC011294.3	-	-	ENSG00000233539		0.438	AC011294.3-003	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000233539	Clone_based_vega_gene	protein_coding	OTTHUMT00000340262.1	-	0.00	45	0	G			46728896	-1	tier1	-	no_errors	ENST00000469937	ensembl	human	known	74_37	rna	8.62	53	5	SNP	0.008	T
RP11-423O2.5	0	genome.wustl.edu	37	1	142803954	142803954	+	lincRNA	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:142803954A>G	ENST00000423385.1	-	0	1011																											GAGAGTTTAAATACCTTGAAC	0.303																																																	0																																												0																															1.37:g.142803954A>G				RNA	SNP	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			RP11-423O2.5	-	-	ENSG00000234978		0.303	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	Clone_based_vega_gene	lincRNA	OTTHUMT00000193203.1	-	0.00	32	0	A			142803954	-1	tier1	-	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	13.89	31	5	SNP	0.002	G
GOLGA8S	653061	genome.wustl.edu	37	15	23609607	23609607	+	Intron	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:23609607G>T	ENST00000562295.1	+	16	1448				RN7SL536P_ENST00000491146.2_RNA|AC100756.1_ENST00000459602.1_RNA					golgin A8 family, member S																		GGGAGGCCAGGGCACAGCAGG	0.587																																																	0																																										SO:0001627	intron_variant	0					15q11.2	2013-01-17			ENSG00000261739	ENSG00000261739			44409	other	unknown							Standard	NR_038843		Approved		uc021sfv.2		OTTHUMG00000176415	ENST00000562295.1:c.1448+17G>T	15.37:g.23609607G>T				RNA	SNP	-	NULL	ENST00000562295.1	37	NULL		15																																																																																			AC100756.1	-	-	ENSG00000238737		0.587	GOLGA8S-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000238737	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000431934.1	-	0.00	298	0	G	NR_038843		23609607	+1	tier1	-	no_errors	ENST00000459602	ensembl	human	novel	74_37	rna	20.55	259	67	SNP	0.001	T
LOC101927648	101927648	genome.wustl.edu	37	1	143361994	143361994	+	lincRNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:143361994G>T	ENST00000423249.1	-	0	147				RP11-435B5.3_ENST00000430699.1_lincRNA																							CCAAGAAAGTGTCAGAGCCTT	0.328																																																	0																																												0																															1.37:g.143361994G>T				RNA	SNP	-	NULL	ENST00000423249.1	37	NULL		1																																																																																			RP11-435B5.3	-	-	ENSG00000242569		0.328	RP11-435B5.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	ENSG00000242569	Clone_based_vega_gene	lincRNA	OTTHUMT00000037552.1	-	0.00	245	0	G			143361994	+1	tier1	-	no_errors	ENST00000411775	ensembl	human	known	74_37	rna	7.93	267	23	SNP	0.016	T
RP11-146E13.4	0	genome.wustl.edu	37	14	19855465	19855465	+	lincRNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:19855465G>T	ENST00000548109.1	+	0	72																											GGCCTTGCCTGGCCCTGGGCG	0.602																																																	0																																												0																															14.37:g.19855465G>T				RNA	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			CTD-2314B22.3	-	-	ENSG00000244306		0.602	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	Clone_based_vega_gene	lincRNA	OTTHUMT00000409408.1	-	0.00	29	0	G			19855465	-1	tier1	-	no_errors	ENST00000551334	ensembl	human	known	74_37	rna	24.00	19	6	SNP	1.000	T
PCDHB17	54661	genome.wustl.edu	37	5	140537208	140537208	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:140537208C>G	ENST00000539533.1	+	1	1632	c.1632C>G	c.(1630-1632)agC>agG	p.S544R						protocadherin beta 17 pseudogene																		CTTTGAGCAGCGAGGCGCTGG	0.677																																																	0																																										SO:0001583	missense	0			AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.1632C>G	5.37:g.140537208C>G	ENSP00000438685:p.Ser544Arg			Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S544R	ENST00000539533.1	37	c.1632		5	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746521	0.69418	.	.	ENSG00000255622	ENST00000539533	T	0.54866	0.55	4.99	4.99	0.66335	.	.	.	.	.	T	0.69043	0.3067	.	.	.	.	.	.	D	0.62365	0.991	D	0.63703	0.917	T	0.78001	-0.2375	7	0.72032	D	0.01	.	12.7738	0.57436	0.0:0.9193:0.0:0.0807	.	544	Q96T98	.	R	544	ENSP00000438685:S544R	ENSP00000438685:S544R	S	+	3	2	AC005754.1	140517392	0.153000	0.22777	1.000000	0.80357	0.937000	0.57800	0.456000	0.21859	2.486000	0.83907	0.556000	0.70494	AGC	PCDHB17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000255622		0.677	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000255622	Uniprot_gn	protein_coding		-	0.00	275	0	C			140537208	+1	tier1	-	no_errors	ENST00000539533	ensembl	human	known	74_37	missense	5.11	297	16	SNP	1.000	G
MGAM2	93432	genome.wustl.edu	37	7	141833840	141833840	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:141833840G>T	ENST00000477922.3	+	7	689	c.635G>T	c.(634-636)cGa>cTa	p.R212L	RP11-1220K2.2_ENST00000550469.2_Missense_Mutation_p.R212L																endometrium(1)|lung(5)	6						CTGTCTTTCCGACTGCCCAGT	0.567																																																	0																																										SO:0001583	missense	0																														ENST00000477922.3:c.635G>T	7.37:g.141833840G>T	ENSP00000420449:p.Arg212Leu			Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,superfamily_P_trefoil,smart_P_trefoil	p.R212L	ENST00000477922.3	37	c.635		7	.	.	.	.	.	.	.	.	.	.	.	16.79	3.220961	0.58560	.	.	ENSG00000257743	ENST00000550469;ENST00000477922	D	0.85702	-2.02	4.76	1.83	0.25207	Glycoside hydrolase-type carbohydrate-binding (1);	.	.	.	.	T	0.71392	0.3334	.	.	.	.	.	.	B	0.15719	0.014	B	0.06405	0.002	T	0.61337	-0.7083	7	0.26408	T	0.33	.	3.9316	0.09288	0.1777:0.0:0.4888:0.3335	.	212	Q2M2H8	MGAL2_HUMAN	L	212	ENSP00000447431:R212L	ENSP00000380641:R212L	R	+	2	0	RP11-1220K2.2	141480309	0.063000	0.20901	0.993000	0.49108	0.995000	0.86356	0.509000	0.22707	0.264000	0.21851	0.561000	0.74099	CGA	RP11-1220K2.2	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000257743		0.567	RP11-1220K2.2-003	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000257743	Clone_based_vega_gene	protein_coding	OTTHUMT00000351325.3	-	0.00	89	0	G			141833840	+1	tier1	-	no_errors	ENST00000477922	ensembl	human	putative	74_37	missense	7.32	76	6	SNP	0.893	T
ITFG2	55846	genome.wustl.edu	37	12	2921868	2921868	+	5'UTR	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:2921868G>A	ENST00000228799.2	+	0	81				RP4-816N1.6_ENST00000547794.1_RNA|ITFG2_ENST00000419778.2_5'UTR|RP4-816N1.6_ENST00000547834.1_RNA|ITFG2_ENST00000542548.1_5'UTR|RP4-816N1.6_ENST00000552469.1_RNA	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2						germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CGGCTGTCGCGACGGGGGTTC	0.587																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.-59G>A	12.37:g.2921868G>A			A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	RNA	SNP	-	NULL	ENST00000228799.2	37	NULL	CCDS8513.1	12																																																																																			RP4-816N1.6	-	-	ENSG00000258325		0.587	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258325	Clone_based_vega_gene	protein_coding	OTTHUMT00000253091.1	-	0.00	21	0	G	NM_018463		2921868	-1	tier1	-	no_errors	ENST00000547794	ensembl	human	known	74_37	rna	21.43	22	6	SNP	0.000	A
GUCY1A2	2977	genome.wustl.edu	37	11	106672169	106672169	+	Intron	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:106672169C>G	ENST00000526355.2	-	5	2161				GUCY1A2_ENST00000347596.2_Intron|GUCY1A2_ENST00000282249.2_Intron|AP001282.1_ENST00000578526.1_RNA	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	agggcaaaacccacaattact	0.328																																																	0																																										SO:0001627	intron_variant	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1692+8549G>C	11.37:g.106672169C>G			A1L4C4|B7ZLT5	RNA	SNP	-	NULL	ENST00000526355.2	37	NULL	CCDS8335.1	11																																																																																			AP001282.1	-	-	ENSG00000264542		0.328	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	ENSG00000264542	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000389003.2	-	0.00	35	0	C			106672169	-1	tier1	-	no_errors	ENST00000578526	ensembl	human	novel	74_37	rna	7.27	51	4	SNP	0.000	G
POU4F1	5457	genome.wustl.edu	37	13	79173478	79173478	+	3'UTR	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:79173478G>A	ENST00000377208.5	-	0	3543				RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000606124.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000607205.1_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1						axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		AGATCAATCCGTGAGACATTT	0.358																																					Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)												0																																										SO:0001624	3_prime_UTR_variant	0			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.*2072C>T	13.37:g.79173478G>A			Q14986|Q15318|Q5T227	RNA	SNP	-	NULL	ENST00000377208.5	37	NULL	CCDS31996.1	13																																																																																			RP11-52L5.6	-	-	ENSG00000271776		0.358	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271776	Clone_based_vega_gene	protein_coding	OTTHUMT00000045360.3	-	0.00	59	0	G			79173478	+1	tier1	-	no_errors	ENST00000607269	ensembl	human	known	74_37	rna	8.45	65	6	SNP	0.991	A
SLC5A9	200010	genome.wustl.edu	37	1	48694895	48694895	+	Intron	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:48694895C>T	ENST00000438567.2	+	4	391				RP5-1024N4.4_ENST00000606809.1_RNA|SLC5A9_ENST00000533824.1_Intron|SLC5A9_ENST00000420136.2_Intron|SLC5A9_ENST00000236495.5_Intron	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9						sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						acagcactGCCTCTGGGTGGG	0.612																																																	0													71.0	78.0	76.0					1																	48694895		2203	4300	6503	SO:0001627	intron_variant	0			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.340-72C>T	1.37:g.48694895C>T			B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	RNA	SNP	-	NULL	ENST00000438567.2	37	NULL	CCDS30709.2	1																																																																																			RP5-1024N4.4	-	-	ENSG00000272491		0.612	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272491	Clone_based_vega_gene	protein_coding	OTTHUMT00000022061.3	-	0.00	46	0	C	XM_117174		48694895	-1	tier1	-	no_errors	ENST00000606809	ensembl	human	known	74_37	rna	11.11	48	6	SNP	0.000	T
ENTHD2	146705	genome.wustl.edu	37	17	79205458	79205458	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:79205458C>G	ENST00000300714.3	-	9	792	c.735G>C	c.(733-735)caG>caC	p.Q245H	ENTHD2_ENST00000374769.2_Missense_Mutation_p.Q161H|AC027601.1_ENST00000575922.1_RNA|AC027601.1_ENST00000569559.1_RNA	NM_144679.2	NP_653280.1	Q96N21	AP4AT_HUMAN	ENTH domain containing 2	245						cytoplasmic vesicle (GO:0031410)											AGCTCAACTCCTGCTGACAGT	0.662																																																	0													36.0	32.0	34.0					17																	79205458		2203	4300	6503	SO:0001583	missense	0			AK056090	CCDS11779.1	17q25.3	2012-07-18	2012-07-18	2012-07-18	ENSG00000167302	ENSG00000167302			26458	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 56"""	C17orf56			Standard	NM_144679		Approved	FLJ31528	uc002jzu.2	Q96N21	OTTHUMG00000177866	ENST00000300714.3:c.735G>C	17.37:g.79205458C>G	ENSP00000300714:p.Gln245His		Q6ZQU0|Q6ZSQ9	Missense_Mutation	SNP	pfam_Epsin_dom_N,superfamily_ENTH_VHS	p.Q245H	ENST00000300714.3	37	c.735	CCDS11779.1	17	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470896	0.43942	.	.	ENSG00000167302	ENST00000300714;ENST00000374769	T;T	0.23754	1.89;1.89	4.79	1.6	0.23607	.	0.124501	0.56097	D	0.000039	T	0.42832	0.1220	M	0.62016	1.91	0.45852	D	0.998717	D;D	0.89917	0.998;1.0	D;D	0.87578	0.942;0.998	T	0.28839	-1.0031	10	0.87932	D	0	-27.7105	8.7491	0.34605	0.0:0.6833:0.0:0.3167	.	245;161	Q96N21;Q96N21-2	CQ056_HUMAN;.	H	245;161	ENSP00000300714:Q245H;ENSP00000363901:Q161H	ENSP00000300714:Q245H	Q	-	3	2	C17orf56	76820053	0.997000	0.39634	1.000000	0.80357	0.123000	0.20343	0.480000	0.22244	0.533000	0.28675	0.561000	0.74099	CAG	ENTHD2	-	NULL	ENSG00000167302		0.662	ENTHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD2	HGNC	protein_coding	OTTHUMT00000439315.1	-	0.00	47	0	C	NM_144679		79205458	-1	tier1	-	no_errors	ENST00000300714	ensembl	human	known	74_37	missense	22.00	39	11	SNP	1.000	G
EPHB1	2047	genome.wustl.edu	37	3	134696814	134696814	+	Intron	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:134696814G>C	ENST00000398015.3	+	3	1175				EPHB1_ENST00000488154.1_Intron	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						ACAGTGTCCAGGCCTTTTTGG	0.542																																																	0																																										SO:0001627	intron_variant	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.805+25920G>C	3.37:g.134696814G>C			A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	p.R271T	ENST00000398015.3	37	c.812	CCDS46921.1	3																																																																																			EPHB1	-	NULL	ENSG00000154928		0.542	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	-	0.00	75	0	G	NM_004441		134696814	+1	tier1	-	no_errors	ENST00000482618	ensembl	human	known	74_37	missense	12.87	88	13	SNP	0.002	C
ERICH1	157697	genome.wustl.edu	37	8	665954	665954	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:665954C>G	ENST00000262109.7	-	2	153	c.76G>C	c.(76-78)Gga>Cga	p.G26R	ERICH1_ENST00000518277.1_5'UTR|ERICH1_ENST00000522706.1_Intron	NM_207332.1	NP_997215.1	Q86X53	ERIC1_HUMAN	glutamate-rich 1	26										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)	20		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		TCCCTCTTTCCTTGGCCACTT	0.468																																																	0													135.0	136.0	135.0					8																	665954		2203	4300	6503	SO:0001583	missense	0				CCDS5955.1	8p23.3	2005-09-01			ENSG00000104714	ENSG00000104714			27234	protein-coding gene	gene with protein product							Standard	NM_207332		Approved		uc003wph.3	Q86X53	OTTHUMG00000129163	ENST00000262109.7:c.76G>C	8.37:g.665954C>G	ENSP00000262109:p.Gly26Arg		A8K2J9|Q9P063	Missense_Mutation	SNP	NULL	p.G26R	ENST00000262109.7	37	c.76	CCDS5955.1	8	.	.	.	.	.	.	.	.	.	.	C	9.171	1.021266	0.19433	.	.	ENSG00000104714	ENST00000543819;ENST00000262109	T	0.33865	1.39	4.07	3.2	0.36748	.	0.775342	0.11552	N	0.552719	T	0.17916	0.0430	N	0.03608	-0.345	0.22842	N	0.998665	B;B	0.34241	0.444;0.444	B;B	0.35278	0.199;0.199	T	0.11867	-1.0570	10	0.54805	T	0.06	-12.1964	7.8342	0.29360	0.0:0.8879:0.0:0.1121	.	26;26	B4DMI5;Q86X53	.;ERIC1_HUMAN	R	26	ENSP00000262109:G26R	ENSP00000262109:G26R	G	-	1	0	ERICH1	655954	0.304000	0.24472	0.608000	0.28969	0.011000	0.07611	1.274000	0.33132	1.307000	0.44944	-0.136000	0.14681	GGA	ERICH1	-	NULL	ENSG00000104714		0.468	ERICH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ERICH1	HGNC	protein_coding	OTTHUMT00000251228.3	-	0.00	133	0	C	NM_207332		665954	-1	tier1	-	no_errors	ENST00000262109	ensembl	human	known	74_37	missense	11.63	114	15	SNP	0.700	G
ERN1	2081	genome.wustl.edu	37	17	62133221	62133223	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:62133221_62133223delGCT	ENST00000433197.3	-	13	1579_1581	c.1484_1486delAGC	c.(1483-1488)cagctg>ctg	p.Q495del		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						TGGAAGGGCAgctgctgctgctg	0.631																																																	0										53,58,3253		10,0,33,12,34,1593						4.2	1.0			6	0,118,6892		0,0,0,19,80,3406	no	codingComplex	ERN1	NM_001433.3		10,0,33,31,114,4999	A1A1,A1A2,A1R,A2A2,A2R,RR		1.6833,3.2996,2.2074				53,176,10145				SO:0001651	inframe_deletion	0			AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.1484_1486delAGC	17.37:g.62133230_62133232delGCT	ENSP00000401445:p.Gln495del			In_Frame_Del	DEL	pfam_Prot_kinase_dom,pfam_KEN_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_dom	p.Q495in_frame_del	ENST00000433197.3	37	c.1486_1484	CCDS45762.1	17																																																																																			ERN1	-	NULL	ENSG00000178607		0.631	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN1	HGNC	protein_coding	OTTHUMT00000443734.2		0.00	39	0	GCT	NM_001433		62133223	-1	tier1		no_errors	ENST00000433197	ensembl	human	known	74_37	in_frame_del	9.30	39	4	DEL	0.999:0.998:0.998	-
EYS	346007	genome.wustl.edu	37	6	66205078	66205078	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:66205078G>T	ENST00000370621.3	-	4	752	c.226C>A	c.(226-228)Cag>Aag	p.Q76K	EYS_ENST00000342421.5_Missense_Mutation_p.Q76K|EYS_ENST00000370616.2_Missense_Mutation_p.Q76K|EYS_ENST00000393380.2_Missense_Mutation_p.Q76K|EYS_ENST00000370618.3_Missense_Mutation_p.Q76K|EYS_ENST00000503581.1_Missense_Mutation_p.Q76K			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	76					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GGGCAAATCTGGGGAACAGCT	0.358																																																	0													89.0	89.0	89.0					6																	66205078		2203	4300	6503	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.226C>A	6.37:g.66205078G>T	ENSP00000359655:p.Gln76Lys		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.Q76K	ENST00000370621.3	37	c.226		6	.	.	.	.	.	.	.	.	.	.	G	18.33	3.601380	0.66445	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.92595	-2.48;-2.46;-2.46;-3.07;-3.0;-3.0	4.92	3.13	0.36017	.	.	.	.	.	D	0.84597	0.5507	N	0.24115	0.695	0.20764	N	0.999858	D;D;D	0.76494	0.967;0.999;0.999	P;D;P	0.65443	0.756;0.935;0.903	T	0.76293	-0.3012	9	0.12766	T	0.61	.	9.0572	0.36412	0.1756:0.0:0.8244:0.0	.	76;76;76	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	K	76	ENSP00000424243:Q76K;ENSP00000359655:Q76K;ENSP00000359650:Q76K;ENSP00000377042:Q76K;ENSP00000341818:Q76K;ENSP00000359652:Q76K	ENSP00000341818:Q76K	Q	-	1	0	EYS	66261799	1.000000	0.71417	0.021000	0.16686	0.947000	0.59692	4.043000	0.57354	0.581000	0.29539	0.591000	0.81541	CAG	EYS	-	NULL	ENSG00000188107		0.358	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	38	0	G	XM_294050		66205078	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	12.12	58	8	SNP	1.000	T
FADS1	3992	genome.wustl.edu	37	11	61570536	61570536	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:61570536G>T	ENST00000350997.7	-	10	1528	c.1296C>A	c.(1294-1296)ttC>ttA	p.F432L	FADS1_ENST00000460649.1_Missense_Mutation_p.F77L|FADS1_ENST00000433932.1_Missense_Mutation_p.F291L|FADS1_ENST00000542506.1_Missense_Mutation_p.F291L|FADS2_ENST00000574708.1_Intron|FADS1_ENST00000536991.1_Missense_Mutation_p.F123L	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	375					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GGTGTCCACTGAACCAGTCAT	0.552																																																	0													114.0	115.0	114.0					11																	61570536		2201	4299	6500	SO:0001583	missense	0				CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.1296C>A	11.37:g.61570536G>T	ENSP00000322229:p.Phe432Leu		A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Cyt_B5-like_heme/steroid-bd	p.F432L	ENST00000350997.7	37	c.1296	CCDS8011.2	11	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791231	0.90367	.	.	ENSG00000149485	ENST00000543488;ENST00000350997;ENST00000412725;ENST00000536991;ENST00000433932;ENST00000460649;ENST00000542506	T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53	4.88	3.97	0.46021	Fatty acid desaturase, type 1 (1);	0.255682	0.25890	U	0.027627	T	0.14270	0.0345	L	0.38649	1.16	0.58432	D	0.999997	P	0.35923	0.528	B	0.39217	0.294	T	0.04229	-1.0967	10	0.66056	D	0.02	-11.0753	13.2304	0.59941	0.0785:0.0:0.9215:0.0	.	375	O60427	FADS1_HUMAN	L	307;432;291;123;291;77;291	ENSP00000322229:F432L;ENSP00000439097:F123L;ENSP00000405087:F291L;ENSP00000445253:F77L;ENSP00000441403:F291L	ENSP00000322229:F432L	F	-	3	2	FADS1	61327112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.870000	0.39529	1.196000	0.43129	0.655000	0.94253	TTC	FADS1	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase	ENSG00000149485		0.552	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS1	HGNC	protein_coding	OTTHUMT00000347648.2	-	0.00	33	0	G	NM_013402		61570536	-1	tier1	-	no_errors	ENST00000350997	ensembl	human	known	74_37	missense	11.11	40	5	SNP	1.000	T
FADS3	3995	genome.wustl.edu	37	11	61645986	61645986	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:61645986C>G	ENST00000278829.2	-	5	897	c.745G>C	c.(745-747)Gag>Cag	p.E249Q	FADS3_ENST00000540820.1_Missense_Mutation_p.E249Q|FADS3_ENST00000527697.1_Missense_Mutation_p.E125Q|FADS3_ENST00000525588.1_Missense_Mutation_p.E221Q	NM_021727.3	NP_068373.1	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	249					unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CCACCCACCTCGACGGATGAC	0.642																																																	0													91.0	89.0	90.0					11																	61645986		2202	4299	6501	SO:0001583	missense	0				CCDS8013.1	11q12-q13.1	2013-01-25			ENSG00000221968	ENSG00000221968	1.14.19.3	"""Fatty acid desaturases"""	3576	protein-coding gene	gene with protein product	"""delta-9-desaturase"""	606150		LLCDL3			Standard	NM_021727		Approved	CYB5RP	uc001nsm.3	Q9Y5Q0	OTTHUMG00000167500	ENST00000278829.2:c.745G>C	11.37:g.61645986C>G	ENSP00000278829:p.Glu249Gln		O60426	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd	p.E249Q	ENST00000278829.2	37	c.745	CCDS8013.1	11	.	.	.	.	.	.	.	.	.	.	.	26.7	4.764697	0.90020	.	.	ENSG00000221968	ENST00000527697;ENST00000278829;ENST00000540820;ENST00000525588;ENST00000531956;ENST00000534223	T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	4.51	4.51	0.55191	Fatty acid desaturase, type 1 (1);	.	.	.	.	D	0.82508	0.5052	M	0.88450	2.955	0.58432	D	0.999999	D;D	0.61697	0.973;0.99	P;D	0.65874	0.906;0.939	T	0.82870	-0.0243	9	0.27082	T	0.32	-11.7093	16.1502	0.81611	0.0:1.0:0.0:0.0	.	125;249	E9PKP8;Q9Y5Q0	.;FADS3_HUMAN	Q	125;249;249;221;125;125	ENSP00000431533:E125Q;ENSP00000278829:E249Q;ENSP00000439308:E249Q;ENSP00000432206:E221Q;ENSP00000436890:E125Q;ENSP00000434551:E125Q	ENSP00000278829:E249Q	E	-	1	0	FADS3	61402562	1.000000	0.71417	0.919000	0.36401	0.260000	0.26232	6.662000	0.74426	2.214000	0.71695	0.561000	0.74099	GAG	FADS3	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase	ENSG00000221968		0.642	FADS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS3	HGNC	protein_coding	OTTHUMT00000394836.1	-	0.00	71	0	C			61645986	-1	tier1	-	no_errors	ENST00000278829	ensembl	human	known	74_37	missense	8.14	79	7	SNP	0.999	G
FAM186A	121006	genome.wustl.edu	37	12	50744904	50744904	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:50744904G>C	ENST00000327337.5	-	4	5710	c.5711C>G	c.(5710-5712)tCt>tGt	p.S1904C	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.S1904C	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1904	Pro-rich.																CCCAGGGGTAGAAGGAGCCTG	0.577																																					NSCLC(138;1796 1887 12511 19463 37884)												0													54.0	63.0	60.0					12																	50744904		692	1591	2283	SO:0001583	missense	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.5711C>G	12.37:g.50744904G>C	ENSP00000329995:p.Ser1904Cys			Missense_Mutation	SNP	NULL	p.S1904C	ENST00000327337.5	37	c.5711	CCDS44878.1	12	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300587	0.40694	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.19394	2.15;2.15	4.36	1.47	0.22746	.	.	.	.	.	T	0.20495	0.0493	N	0.08118	0	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.66847	0.947;0.947	T	0.12016	-1.0564	9	0.56958	D	0.05	.	5.8415	0.18637	0.1772:0.0:0.6682:0.1546	.	1904;1904	F5GYN0;A6NE01	.;F186A_HUMAN	C	1904	ENSP00000441337:S1904C;ENSP00000329995:S1904C	ENSP00000329995:S1904C	S	-	2	0	FAM186A	49031171	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.416000	0.21198	0.211000	0.20683	0.549000	0.68633	TCT	FAM186A	-	NULL	ENSG00000185958		0.577	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	-	0.00	67	0	G	XM_001718353		50744904	-1	tier1	-	no_errors	ENST00000327337	ensembl	human	known	74_37	missense	10.11	80	9	SNP	0.000	C
FAM86C2P	645332	genome.wustl.edu	37	11	67572775	67572775	+	IGR	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:67572775C>A								FAM86C2P (7635 upstream) : RP11-119D9.1 (81191 downstream)																							GCGTTCTCCTCGGGCGCCATG	0.751																																																	0																																										SO:0001628	intergenic_variant	0																															11.37:g.67572775C>A				RNA	SNP	-	NULL		37	NULL		11																																																																																			FAM86C2P	-	-	ENSG00000160172	0	0.751					FAM86C2P	HGNC			-	0.00	185	0	C			67572775	-1	tier1	-	no_errors	ENST00000525180	ensembl	human	known	74_37	rna	5.93	222	14	SNP	0.292	A
FAM90A27P	646508	genome.wustl.edu	37	19	53786080	53786080	+	RNA	SNP	C	C	A	rs188231618		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:53786080C>A	ENST00000599085.1	+	0	56					NR_046365.1		A6NNH2	F90AR_HUMAN	family with sequence similarity 90, member A27, pseudogene								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										AGCAGCAGAGCGAAGCTCCGA	0.557																																																	0																																												0					19q13.42	2014-03-18			ENSG00000189348	ENSG00000189348			43617	pseudogene	pseudogene							Standard	NR_046365		Approved		uc031rmv.1	A6NNH2	OTTHUMG00000182909		19.37:g.53786080C>A				RNA	SNP	-	NULL	ENST00000599085.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.419288	0.00188	.	.	ENSG00000189348	ENST00000338885	.	.	.	2.16	-4.32	0.03688	.	0.773616	0.10994	N	0.611335	T	0.10208	0.0250	.	.	.	0.25773	N	0.984813	.	.	.	.	.	.	T	0.32929	-0.9888	5	0.02654	T	1	.	4.5734	0.12221	0.244:0.3984:0.3577:0.0	.	.	.	.	R	115	.	ENSP00000341223:S115R	S	+	3	2	AC092070.1	58477892	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.154000	0.10130	-1.238000	0.02535	-1.028000	0.02416	AGC	FAM90A27P	-	-	ENSG00000189348		0.557	FAM90A27P-002	KNOWN	basic	processed_transcript	FAM90A27P	HGNC	pseudogene	OTTHUMT00000464290.1	-	0.00	77	0	C	NR_046365		53786080	+1	tier1	-	no_errors	ENST00000599085	ensembl	human	known	74_37	rna	11.19	118	15	SNP	0.000	A
FASN	2194	genome.wustl.edu	37	17	80043514	80043514	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:80043514G>A	ENST00000306749.2	-	23	4184	c.3966C>T	c.(3964-3966)ctC>ctT	p.L1322L	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1322					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CCGGGTCCCCGAGGGCAGCCA	0.697																																					Colon(59;314 1043 11189 28578 32273)												0													13.0	15.0	14.0					17																	80043514		2175	4280	6455	SO:0001819	synonymous_variant	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.3966C>T	17.37:g.80043514G>A			Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.L1322	ENST00000306749.2	37	c.3966	CCDS11801.1	17																																																																																			FASN	-	pfam_Methyltransf_12,pfam_Methyltransf_11	ENSG00000169710		0.697	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	-	0.00	112	0	G	NM_004104		80043514	-1	tier1	-	no_errors	ENST00000306749	ensembl	human	known	74_37	silent	8.57	95	9	SNP	0.001	A
FASTKD3	79072	genome.wustl.edu	37	5	7867439	7867439	+	Missense_Mutation	SNP	G	G	T	rs201558864		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:7867439G>T	ENST00000264669.5	-	2	894	c.758C>A	c.(757-759)cCg>cAg	p.P253Q	FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000264668.2_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	253					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AATATCCTCCGGGGTAAATGT	0.363																																																	0													75.0	82.0	79.0					5																	7867439		2202	4300	6502	SO:0001583	missense	0			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.758C>A	5.37:g.7867439G>T	ENSP00000264669:p.Pro253Gln		Q9BVD3	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.P253Q	ENST00000264669.5	37	c.758	CCDS3873.1	5	.	.	.	.	.	.	.	.	.	.	G	15.18	2.758016	0.49468	.	.	ENSG00000124279	ENST00000264669	T	0.29655	1.56	4.85	4.85	0.62838	.	0.233302	0.45361	D	0.000364	T	0.47581	0.1453	M	0.73598	2.24	0.09310	N	0.999998	D	0.61080	0.989	P	0.55871	0.786	T	0.43491	-0.9388	10	0.51188	T	0.08	-9.5051	12.574	0.56354	0.0796:0.0:0.9204:0.0	.	253	Q14CZ7	FAKD3_HUMAN	Q	253	ENSP00000264669:P253Q	ENSP00000264669:P253Q	P	-	2	0	FASTKD3	7920439	0.810000	0.29049	0.016000	0.15963	0.702000	0.40608	4.488000	0.60300	2.501000	0.84356	0.650000	0.86243	CCG	FASTKD3	-	NULL	ENSG00000124279		0.363	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD3	HGNC	protein_coding	OTTHUMT00000253673.1		0.00	40	0	G	NM_024091		7867439	-1			no_errors	ENST00000264669	ensembl	human	known	74_37	missense	5.97	62	4	SNP	0.050	T
FBN3	84467	genome.wustl.edu	37	19	8174147	8174147	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:8174147C>G	ENST00000600128.1	-	36	4996	c.4582G>C	c.(4582-4584)Ggc>Cgc	p.G1528R	FBN3_ENST00000601739.1_Missense_Mutation_p.G1528R|FBN3_ENST00000270509.2_Missense_Mutation_p.G1528R			Q75N90	FBN3_HUMAN	fibrillin 3	1528	TB 6.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CAGGGATTGCCCCAAGCCCGG	0.642																																																	0													64.0	58.0	60.0					19																	8174147		2203	4300	6503	SO:0001583	missense	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.4582G>C	19.37:g.8174147C>G	ENSP00000470498:p.Gly1528Arg		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.G1528R	ENST00000600128.1	37	c.4582	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	C	17.33	3.362431	0.61403	.	.	ENSG00000142449	ENST00000270509	D	0.97791	-4.54	4.23	4.23	0.50019	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.85682	U	0.000000	D	0.99036	0.9670	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99250	1.0887	10	0.51188	T	0.08	.	16.5549	0.84482	0.0:1.0:0.0:0.0	.	1528	Q75N90	FBN3_HUMAN	R	1528	ENSP00000270509:G1528R	ENSP00000270509:G1528R	G	-	1	0	FBN3	8080147	1.000000	0.71417	1.000000	0.80357	0.137000	0.21094	7.351000	0.79395	2.068000	0.61886	0.313000	0.20887	GGC	FBN3	-	pfam_TB_dom,superfamily_TB_dom,pirsf_FBN	ENSG00000142449		0.642	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	-	0.00	72	0	C	NM_032447		8174147	-1	tier1	-	no_errors	ENST00000270509	ensembl	human	known	74_37	missense	16.67	60	12	SNP	1.000	G
FCGBP	8857	genome.wustl.edu	37	19	40357626	40357626	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:40357626C>A	ENST00000221347.6	-	34	15694	c.15687G>T	c.(15685-15687)tgG>tgT	p.W5229C		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5229						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CACGGGTGGCCCAGCAGTTCC	0.617																																																	0													90.0	70.0	77.0					19																	40357626		2203	4300	6503	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15687G>T	19.37:g.40357626C>A	ENSP00000221347:p.Trp5229Cys		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.W5229C	ENST00000221347.6	37	c.15687	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	9.402	1.078151	0.20227	.	.	ENSG00000090920	ENST00000221347	T	0.18502	2.21	4.45	3.39	0.38822	Follistatin-like, N-terminal (1);von Willebrand factor, type D domain (1);	1.468840	0.04340	U	0.353881	T	0.38453	0.1041	L	0.57536	1.79	0.25222	N	0.989893	D	0.65815	0.995	D	0.69142	0.962	T	0.08330	-1.0727	10	0.38643	T	0.18	.	9.4132	0.38505	0.2123:0.7877:0.0:0.0	.	5229	Q9Y6R7	FCGBP_HUMAN	C	5229	ENSP00000221347:W5229C	ENSP00000221347:W5229C	W	-	3	0	FCGBP	45049466	0.000000	0.05858	0.305000	0.25099	0.045000	0.14185	0.336000	0.19823	1.052000	0.40392	0.655000	0.94253	TGG	FCGBP	-	smart_VWC_out,smart_Fol_N,smart_VWF_type-D	ENSG00000090920		0.617	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	-	0.00	41	0	C	NM_003890		40357626	-1	tier1	-	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.254	A
FIP1L1	81608	genome.wustl.edu	37	4	54319248	54319249	+	Frame_Shift_Del	DEL	AG	AG	-	rs143671659		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:54319248_54319249delAG	ENST00000337488.6	+	16	1641_1642	c.1447_1448delAG	c.(1447-1449)agafs	p.R483fs	FIP1L1_ENST00000358575.5_Frame_Shift_Del_p.R477fs|FIP1L1_ENST00000306932.6_Frame_Shift_Del_p.R409fs|FIP1L1_ENST00000507166.1_Intron	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	483	Arg-rich.|Glu-rich.|Sufficient for interaction with CPSF1 and CSTF3.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R487fs*3(2)		large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			agaACGCACCAGAGAGAGAGAG	0.47			T	PDGFRA	idiopathic hypereosinophilic syndrome																																			Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	2	Deletion - Frameshift(2)	large_intestine(1)|kidney(1)																																								SO:0001589	frameshift_variant	0			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.1447_1448delAG	4.37:g.54319258_54319259delAG	ENSP00000336752:p.Arg483fs		B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Frame_Shift_Del	DEL	pfam_Fip1	p.E486fs	ENST00000337488.6	37	c.1447_1448	CCDS3491.1	4																																																																																			FIP1L1	-	NULL	ENSG00000145216		0.470	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	FIP1L1	HGNC	protein_coding	OTTHUMT00000250602.1		0.00	26	0	AG	NM_030917		54319249	+1			no_errors	ENST00000337488	ensembl	human	known	74_37	frame_shift_del	10.29	61	7	DEL	0.975:0.991	0
PRR36	80164	genome.wustl.edu	37	19	7934933	7934933	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:7934933G>T	ENST00000539422.1	-	5	3359	c.3197C>A	c.(3196-3198)cCc>cAc	p.P1066H	CTD-3193O13.11_ENST00000597156.1_lincRNA|CTD-3193O13.9_ENST00000593356.1_Intron	NM_001190467.1	NP_001177396.1																					AGGGGGAGAGGGAGGGACCTG	0.711																																																	0																																										SO:0001583	missense	0																														ENST00000539422.1:c.3197C>A	19.37:g.7934933G>T	ENSP00000438970:p.Pro1066His			Missense_Mutation	SNP	NULL	p.P1066H	ENST00000539422.1	37	c.3197		19	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676678	0.47886	.	.	ENSG00000183248	ENST00000539422;ENST00000327607	.	.	.	3.83	2.76	0.32466	.	.	.	.	.	T	0.68622	0.3021	M	0.72894	2.215	0.34312	D	0.685555	D	0.69078	0.997	P	0.60345	0.873	T	0.75852	-0.3171	8	0.48119	T	0.1	-0.9423	10.9758	0.47465	0.0:0.1918:0.8081:0.0	.	1066	F5H1R7	.	H	1066;336	.	ENSP00000330326:P336H	P	-	2	0	AC010336.1	7840933	0.000000	0.05858	0.851000	0.33527	0.254000	0.26022	-0.216000	0.09266	0.585000	0.29608	0.305000	0.20034	CCC	CTD-3193O13.9	-	NULL	ENSG00000183248		0.711	CTD-3193O13.9-201	KNOWN	basic|appris_principal	protein_coding	FLJ22184	Clone_based_vega_gene	protein_coding			0.00	49	0	G			7934933	-1			no_errors	ENST00000539422	ensembl	human	known	74_37	missense	18.75	26	6	SNP	0.992	T
FN1	2335	genome.wustl.edu	37	2	216249641	216249641	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:216249641G>A	ENST00000359671.1	-	28	4663	c.4398C>T	c.(4396-4398)atC>atT	p.I1466I	FN1_ENST00000443816.1_Silent_p.I1466I|FN1_ENST00000357867.4_Silent_p.I1466I|FN1_ENST00000446046.1_Silent_p.I1466I|FN1_ENST00000356005.4_Silent_p.I1466I|FN1_ENST00000354785.4_Silent_p.I1557I|FN1_ENST00000490833.1_5'Flank|FN1_ENST00000323926.6_Silent_p.I1557I|FN1_ENST00000336916.4_Silent_p.I1466I|FN1_ENST00000346544.3_Silent_p.I1466I|FN1_ENST00000432072.2_Silent_p.I1557I|FN1_ENST00000357009.2_Silent_p.I1466I|FN1_ENST00000421182.1_Silent_p.I1466I|FN1_ENST00000345488.5_Silent_p.I1466I			P02751	FINC_HUMAN	fibronectin 1	1466	Cell-attachment.|Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CATCCCAGCTGATCAGTAGGC	0.433																																																	0													64.0	63.0	63.0					2																	216249641		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4398C>T	2.37:g.216249641G>A			B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.I1557	ENST00000359671.1	37	c.4671		2																																																																																			FN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000115414		0.433	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding			0.00	71	0	G	NM_212476		216249641	-1			no_errors	ENST00000354785	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.998	A
FN1	2335	genome.wustl.edu	37	2	216289984	216289984	+	Missense_Mutation	SNP	C	C	T	rs150990682		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:216289984C>T	ENST00000359671.1	-	7	1134	c.869G>A	c.(868-870)cGt>cAt	p.R290H	FN1_ENST00000443816.1_Missense_Mutation_p.R290H|FN1_ENST00000357867.4_Missense_Mutation_p.R290H|FN1_ENST00000446046.1_Missense_Mutation_p.R290H|FN1_ENST00000356005.4_Missense_Mutation_p.R290H|FN1_ENST00000354785.4_Missense_Mutation_p.R290H|FN1_ENST00000323926.6_Missense_Mutation_p.R290H|FN1_ENST00000426059.1_Missense_Mutation_p.R290H|FN1_ENST00000336916.4_Missense_Mutation_p.R290H|FN1_ENST00000346544.3_Missense_Mutation_p.R290H|FN1_ENST00000432072.2_Missense_Mutation_p.R290H|FN1_ENST00000357009.2_Missense_Mutation_p.R290H|FN1_ENST00000421182.1_Missense_Mutation_p.R290H|FN1_ENST00000345488.5_Missense_Mutation_p.R290H			P02751	FINC_HUMAN	fibronectin 1	290					acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	AACAGCTGCACGAACATCGGT	0.532																																																	0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	112.0	107.0	108.0		869,869,869,869,869,869	1.0	0.1	2	dbSNP_134	108	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	FN1	NM_002026.2,NM_054034.2,NM_212474.1,NM_212476.1,NM_212478.1,NM_212482.1	29,29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign	290/2356,290/658,290/2177,290/2297,290/2331,290/2478	216289984	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.869G>A	2.37:g.216289984C>T	ENSP00000352696:p.Arg290His		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.R290H	ENST00000359671.1	37	c.869		2	.	.	.	.	.	.	.	.	.	.	C	11.56	1.673677	0.29693	0.0	1.16E-4	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50277	0.75;2.12;2.29;0.83;2.35;1.99;2.33;1.99;2.29;2.02;1.52;0.83;1.42;1.4	5.83	0.996	0.19844	.	0.226724	0.30455	N	0.009586	T	0.26231	0.0640	N	0.12182	0.205	0.25729	N	0.985287	B;B;B;B;B;B;B;B;B;B;B	0.17268	0.001;0.003;0.001;0.018;0.003;0.002;0.001;0.001;0.003;0.003;0.021	B;B;B;B;B;B;B;B;B;B;B	0.21360	0.002;0.002;0.003;0.034;0.003;0.001;0.003;0.002;0.003;0.003;0.008	T	0.17930	-1.0353	10	0.30854	T	0.27	.	9.6396	0.39831	0.0:0.5237:0.0:0.4763	.	290;290;290;290;290;290;290;290;290;290;290	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	H	290	ENSP00000394423:R290H;ENSP00000323534:R290H;ENSP00000338200:R290H;ENSP00000350534:R290H;ENSP00000346839:R290H;ENSP00000352696:R290H;ENSP00000265312:R290H;ENSP00000273049:R290H;ENSP00000349509:R290H;ENSP00000410422:R290H;ENSP00000415018:R290H;ENSP00000399538:R290H;ENSP00000348285:R290H;ENSP00000398907:R290H	ENSP00000265313:R290H	R	-	2	0	FN1	215998229	0.473000	0.25878	0.061000	0.19648	0.007000	0.05969	0.799000	0.27028	0.392000	0.25172	-0.244000	0.11960	CGT	FN1	-	NULL	ENSG00000115414		0.532	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding			0.00	60	0	C	NM_212476		216289984	-1			no_errors	ENST00000354785	ensembl	human	known	74_37	missense	5.66	49	3	SNP	0.159	T
FOXN3	1112	genome.wustl.edu	37	14	89629022	89629022	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:89629022C>T	ENST00000345097.4	-	7	1325	c.1209G>A	c.(1207-1209)aaG>aaA	p.K403K	FOXN3_ENST00000555353.1_Silent_p.K381K|FOXN3_ENST00000557258.1_Silent_p.K381K|FOXN3_ENST00000261302.5_Silent_p.K403K	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	403					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCTTGGGCTCCTTCTGGCTGT	0.667																																																	0													91.0	79.0	83.0					14																	89629022		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.1209G>A	14.37:g.89629022C>T			Q96II7|Q9UIE7	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.K403	ENST00000345097.4	37	c.1209	CCDS41977.1	14																																																																																			FOXN3	-	NULL	ENSG00000053254		0.667	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN3	HGNC	protein_coding	OTTHUMT00000410902.2	-	0.00	59	0	C	NM_005197		89629022	-1	tier1	-	no_errors	ENST00000261302	ensembl	human	known	74_37	silent	7.14	78	6	SNP	0.998	T
FREM2	341640	genome.wustl.edu	37	13	39424336	39424336	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:39424336C>A	ENST00000280481.7	+	9	6757	c.6541C>A	c.(6541-6543)Cca>Aca	p.P2181T	FREM2_ENST00000482551.1_3'UTR	NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2181	Calx-beta 4.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGAAGAACGCCCAAACACTGA	0.433																																																	0													95.0	86.0	89.0					13																	39424336		2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6541C>A	13.37:g.39424336C>A	ENSP00000280481:p.Pro2181Thr		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.P2181T	ENST00000280481.7	37	c.6541	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	29.5	5.012413	0.93346	.	.	ENSG00000150893	ENST00000280481	T	0.20069	2.1	5.79	5.79	0.91817	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.60777	-0.7196	10	0.54805	T	0.06	.	20.0373	0.97568	0.0:1.0:0.0:0.0	.	2181;2181	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	T	2181	ENSP00000280481:P2181T	ENSP00000280481:P2181T	P	+	1	0	FREM2	38322336	1.000000	0.71417	0.974000	0.42286	0.968000	0.65278	7.724000	0.84798	2.734000	0.93682	0.655000	0.94253	CCA	FREM2	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000150893		0.433	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	35	0	C	NM_207361		39424336	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
FRG1	2483	genome.wustl.edu	37	4	190883076	190883076	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:190883076G>C	ENST00000226798.4	+	8	951	c.729G>C	c.(727-729)acG>acC	p.T243T		NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	243					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.T243T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGCATGAGACGCTTCTGGACA	0.328																																																	1	Substitution - coding silent(1)	lung(1)											74.0	91.0	86.0					4																	190883076		2149	4182	6331	SO:0001819	synonymous_variant	0			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.729G>C	4.37:g.190883076G>C			A8K775	Silent	SNP	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	p.T243	ENST00000226798.4	37	c.729	CCDS34121.1	4																																																																																			FRG1	-	pfam_FRG1	ENSG00000109536		0.328	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	HGNC	protein_coding	OTTHUMT00000359622.4		0.00	40	0	G	NM_004477		190883076	+1			no_errors	ENST00000226798	ensembl	human	known	74_37	silent	6.25	45	3	SNP	0.258	C
FRMD3	257019	genome.wustl.edu	37	9	85958132	85958132	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:85958132C>A	ENST00000304195.3	-	5	651	c.445G>T	c.(445-447)Gcc>Tcc	p.A149S	FRMD3_ENST00000376438.1_Missense_Mutation_p.A149S	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	149	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						CCCAGGTAGGCAGCATCAGAA	0.488																																																	0													110.0	117.0	114.0					9																	85958132		2069	4224	6293	SO:0001583	missense	0			AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.445G>T	9.37:g.85958132C>A	ENSP00000303508:p.Ala149Ser		A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.A149S	ENST00000304195.3	37	c.445	CCDS43840.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.631196	0.96682	.	.	ENSG00000172159	ENST00000376438;ENST00000304195;ENST00000376422	T;T	0.78707	-1.2;-1.2	6.17	6.17	0.99709	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.89598	0.6761	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89305	0.3629	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	149;149	A2A2Y4;A2A2Y4-2	FRMD3_HUMAN;.	S	149;149;45	ENSP00000365621:A149S;ENSP00000303508:A149S	ENSP00000303508:A149S	A	-	1	0	FRMD3	85147952	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.631000	0.83237	2.941000	0.99782	0.655000	0.94253	GCC	FRMD3	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	ENSG00000172159		0.488	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD3	HGNC	protein_coding	OTTHUMT00000157355.1	-	0.00	72	0	C	NM_174938		85958132	-1	tier1	-	no_errors	ENST00000304195	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	A
FRY	10129	genome.wustl.edu	37	13	32812001	32812001	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:32812001G>T	ENST00000380250.3	+	44	6792	c.6296G>T	c.(6295-6297)gGg>gTg	p.G2099V		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2099						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GACTTCTCCGGGCTGCAGCAG	0.537																																																	0													62.0	67.0	65.0					13																	32812001		2009	4171	6180	SO:0001583	missense	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.6296G>T	13.37:g.32812001G>T	ENSP00000369600:p.Gly2099Val		Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G2099V	ENST00000380250.3	37	c.6296	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778414	0.90195	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.48836	0.8	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.73133	0.3548	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73949	-0.3821	10	0.66056	D	0.02	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	2099	Q5TBA9	FRY_HUMAN	V	2099;936	ENSP00000369600:G2099V	ENSP00000369600:G2099V	G	+	2	0	FRY	31710001	1.000000	0.71417	0.999000	0.59377	0.886000	0.51366	9.837000	0.99465	2.861000	0.98227	0.655000	0.94253	GGG	FRY	-	superfamily_ARM-type_fold	ENSG00000073910		0.537	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	-	0.00	29	0	G	NM_023037		32812001	+1	tier1	-	no_errors	ENST00000380250	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
FRYL	285527	genome.wustl.edu	37	4	48622744	48622744	+	Missense_Mutation	SNP	G	G	A	rs371083439		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:48622744G>A	ENST00000503238.1	-	3	225	c.226C>T	c.(226-228)Cgc>Tgc	p.R76C	FRYL_ENST00000507711.1_Missense_Mutation_p.R76C|FRYL_ENST00000537810.1_Missense_Mutation_p.R76C|FRYL_ENST00000358350.4_Missense_Mutation_p.R76C|FRYL_ENST00000264319.7_5'UTR			O94915	FRYL_HUMAN	FRY-like	76					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AACAAGGTGCGAAGTAAGGAA	0.408																																																	0													149.0	139.0	142.0					4																	48622744		1891	4113	6004	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.226C>T	4.37:g.48622744G>A	ENSP00000426064:p.Arg76Cys		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R76C	ENST00000503238.1	37	c.226	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829175	0.90955	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000505759	T;T;T;T	0.67865	-0.29;-0.29;-0.29;0.83	5.91	5.91	0.95273	.	0.000000	0.64402	U	0.000002	T	0.81814	0.4902	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;0.994;0.999	D;P;P	0.80764	0.994;0.454;0.856	T	0.81508	-0.0901	10	0.62326	D	0.03	.	20.2956	0.98549	0.0:0.0:1.0:0.0	.	127;76;76	Q6ZNE6;F2Z2S2;O94915	.;.;FRYL_HUMAN	C	76;76;76;76;168	ENSP00000426064:R76C;ENSP00000351113:R76C;ENSP00000441114:R76C;ENSP00000421584:R76C	ENSP00000351113:R76C	R	-	1	0	FRYL	48317501	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	6.695000	0.74593	2.805000	0.96524	0.460000	0.39030	CGC	FRYL	-	NULL	ENSG00000075539		0.408	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	-	0.00	77	0	G			48622744	-1	tier1	-	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	9.09	90	9	SNP	1.000	A
FSIP2	401024	genome.wustl.edu	37	2	186656428	186656428	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:186656428C>A	ENST00000424728.1	+	16	4565	c.4565C>A	c.(4564-4566)tCa>tAa	p.S1522*	AC008174.3_ENST00000436557.1_RNA|FSIP2_ENST00000343098.5_Nonsense_Mutation_p.S1611*|AC008174.3_ENST00000429929.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	1522										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GACAACCCATCATTTGCTTCA	0.373																																																	0																																										SO:0001587	stop_gained	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.4565C>A	2.37:g.186656428C>A	ENSP00000401306:p.Ser1522*		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Nonsense_Mutation	SNP	NULL	p.S1611*	ENST00000424728.1	37	c.4832		2	.	.	.	.	.	.	.	.	.	.	C	40	8.241894	0.98722	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	.	.	.	5.2	2.33	0.28932	.	0.000000	0.43416	D	0.000573	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.5058	0.07689	0.1721:0.5692:0.1665:0.0921	.	.	.	.	X	1611;1522;1522	.	ENSP00000321903:S1522X	S	+	2	0	FSIP2	186364673	0.613000	0.27009	0.748000	0.31131	0.396000	0.30629	0.698000	0.25571	1.428000	0.47296	0.650000	0.86243	TCA	FSIP2	-	NULL	ENSG00000188738		0.373	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	63	0	C	NM_173651		186656428	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	nonsense	5.32	89	5	SNP	0.448	A
FYB	2533	genome.wustl.edu	37	5	39202128	39202128	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:39202128C>A	ENST00000351578.6	-	2	1125	c.935G>T	c.(934-936)aGg>aTg	p.R312M	FYB_ENST00000515010.1_Missense_Mutation_p.R312M|FYB_ENST00000505428.1_Missense_Mutation_p.R312M|FYB_ENST00000540520.1_Missense_Mutation_p.R322M|FYB_ENST00000512982.1_Missense_Mutation_p.R312M	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	312					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTTAGGGAACCTGGCAGGAGG	0.502																																																	0													86.0	87.0	87.0					5																	39202128		1844	4091	5935	SO:0001583	missense	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.935G>T	5.37:g.39202128C>A	ENSP00000316460:p.Arg312Met		A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.R322M	ENST00000351578.6	37	c.965	CCDS47200.1	5	.	.	.	.	.	.	.	.	.	.	C	12.78	2.040663	0.35989	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	6.17	1.28	0.21552	.	0.716490	0.14235	N	0.332422	T	0.16811	0.0404	L	0.29908	0.895	0.26019	N	0.981896	P;P	0.34780	0.468;0.468	B;B	0.35971	0.177;0.215	T	0.15723	-1.0427	10	0.59425	D	0.04	-3.7677	4.9588	0.14056	0.1255:0.2122:0.0:0.6623	.	322;312	B4DLN2;O15117	.;FYB_HUMAN	M	312;312;312;312;322;312	ENSP00000316460:R312M;ENSP00000426346:R312M;ENSP00000425845:R312M;ENSP00000427114:R312M;ENSP00000442840:R322M	ENSP00000316460:R312M	R	-	2	0	FYB	39237885	0.645000	0.27286	0.522000	0.27862	0.782000	0.44232	0.281000	0.18810	0.199000	0.20427	-0.302000	0.09304	AGG	FYB	-	NULL	ENSG00000082074		0.502	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	-	0.00	102	0	C	NM_001465		39202128	-1	tier1	-	no_errors	ENST00000540520	ensembl	human	known	74_37	missense	7.26	115	9	SNP	0.993	A
GAGE10	643832	genome.wustl.edu	37	X	49161383	49161383	+	Silent	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:49161383C>G	ENST00000407599.3	+	2	138	c.45C>G	c.(43-45)ctC>ctG	p.L15L		NM_001098413.2	NP_001091883.2	A6NGK3	GAG10_HUMAN	G antigen 10	15										breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	Ovarian(276;0.236)					GACCAAGACTCTATGTAGAGC	0.438																																																	0													212.0	219.0	217.0					X																	49161383		2203	4300	6503	SO:0001819	synonymous_variant	0					Xp11.23	2010-06-03			ENSG00000215274	ENSG00000215274			30968	protein-coding gene	gene with protein product							Standard	XM_006710256		Approved	OTTHUMG00000024136	uc010nir.1	A6NGK3	OTTHUMG00000024136	ENST00000407599.3:c.45C>G	X.37:g.49161383C>G				Silent	SNP	pfam_GAGE	p.L15	ENST00000407599.3	37	c.45	CCDS43938.1	X																																																																																			GAGE10	-	pfam_GAGE	ENSG00000215274		0.438	GAGE10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	GAGE10	HGNC	protein_coding	OTTHUMT00000060816.1	-	0.00	571	0	C	NM_001098413		49161383	+1	tier1	-	no_errors	ENST00000407599	ensembl	human	known	74_37	silent	8.45	626	58	SNP	0.000	G
GAS2L2	246176	genome.wustl.edu	37	17	34071950	34071950	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:34071950G>T	ENST00000254466.6	-	6	2593	c.2566C>A	c.(2566-2568)Ccc>Acc	p.P856T	GAS2L2_ENST00000587565.1_Missense_Mutation_p.P840T	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	856					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGAGGTTGGGGGCTGCTCTCC	0.602																																																	0													85.0	66.0	73.0					17																	34071950		2203	4300	6503	SO:0001583	missense	0			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.2566C>A	17.37:g.34071950G>T	ENSP00000254466:p.Pro856Thr		Q8NHY4	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.P856T	ENST00000254466.6	37	c.2566	CCDS11298.1	17	.	.	.	.	.	.	.	.	.	.	G	9.577	1.122521	0.20877	.	.	ENSG00000132139	ENST00000254466;ENST00000359507	T	0.17528	2.27	4.92	0.0716	0.14383	.	1.057410	0.07377	N	0.886803	T	0.09468	0.0233	N	0.24115	0.695	0.09310	N	1	B	0.18461	0.028	B	0.14023	0.01	T	0.40646	-0.9552	10	0.18276	T	0.48	0.1639	3.3423	0.07123	0.2146:0.0:0.3927:0.3926	.	856	Q8NHY3	GA2L2_HUMAN	T	856;270	ENSP00000254466:P856T	ENSP00000254466:P856T	P	-	1	0	GAS2L2	31096063	0.001000	0.12720	0.006000	0.13384	0.058000	0.15608	0.122000	0.15687	0.212000	0.20703	0.462000	0.41574	CCC	GAS2L2	-	NULL	ENSG00000132139		0.602	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L2	HGNC	protein_coding	OTTHUMT00000256497.1	-	0.00	73	0	G	NM_139285		34071950	-1	tier1	-	no_errors	ENST00000254466	ensembl	human	known	74_37	missense	6.86	95	7	SNP	0.002	T
GLP1R	2740	genome.wustl.edu	37	6	39047379	39047379	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:39047379G>T	ENST00000373256.4	+	11	1126	c.1083G>T	c.(1081-1083)ggG>ggT	p.G361G		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	361					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	CCCTGCTGGGGACTCATGAGG	0.577																																																	0													90.0	85.0	87.0					6																	39047379		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.1083G>T	6.37:g.39047379G>T			Q2M229|Q99669	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GLP1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.G361	ENST00000373256.4	37	c.1083	CCDS4839.1	6																																																																																			GLP1R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000112164		0.577	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP1R	HGNC	protein_coding	OTTHUMT00000040443.1	-	0.00	60	0	G			39047379	+1	tier1	-	no_errors	ENST00000373256	ensembl	human	known	74_37	silent	6.52	86	6	SNP	0.990	T
GNA15	2769	genome.wustl.edu	37	19	3157847	3157847	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:3157847C>T	ENST00000262958.3	+	6	1124	c.866C>T	c.(865-867)tCc>tTc	p.S289F	AC005264.2_ENST00000587587.1_RNA	NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	289					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		ATCCCCACCTCCCACCTGGCT	0.473																																																	0													185.0	173.0	177.0					19																	3157847		2203	4300	6503	SO:0001583	missense	0				CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.866C>T	19.37:g.3157847C>T	ENSP00000262958:p.Ser289Phe		E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q	p.S289F	ENST00000262958.3	37	c.866	CCDS12104.1	19	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999907	0.74818	.	.	ENSG00000060558	ENST00000262958	D	0.88896	-2.44	4.62	4.62	0.57501	.	0.000000	0.64402	D	0.000002	D	0.94798	0.8320	M	0.86343	2.81	0.53688	D	0.999979	D	0.89917	1.0	D	0.80764	0.994	D	0.95675	0.8727	10	0.87932	D	0	.	15.0612	0.71955	0.0:1.0:0.0:0.0	.	289	P30679	GNA15_HUMAN	F	289	ENSP00000262958:S289F	ENSP00000262958:S289F	S	+	2	0	GNA15	3108847	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	4.650000	0.61440	2.156000	0.67533	0.544000	0.68410	TCC	GNA15	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su	ENSG00000060558		0.473	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA15	HGNC	protein_coding	OTTHUMT00000452320.2	-	0.00	127	0	C	NM_002068		3157847	+1	tier1	-	no_errors	ENST00000262958	ensembl	human	known	74_37	missense	5.41	175	10	SNP	0.997	T
GNLY	10578	genome.wustl.edu	37	2	85922542	85922542	+	Missense_Mutation	SNP	C	C	A	rs141055775		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:85922542C>A	ENST00000263863.4	+	2	280	c.152C>A	c.(151-153)cCc>cAc	p.P51H	GNLY_ENST00000409696.3_Missense_Mutation_p.P36H|GNLY_ENST00000524600.1_Missense_Mutation_p.P78H|GNLY_ENST00000533041.1_3'UTR	NM_006433.3	NP_006424.2	P22749	GNLY_HUMAN	granulysin	51					cellular defense response (GO:0006968)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular space (GO:0005615)				endometrium(4)|kidney(10)|large_intestine(1)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	19						CAGGAGGGCCCCCAGGTACGT	0.622																																																	0													62.0	53.0	56.0					2																	85922542		2203	4300	6503	SO:0001583	missense	0			X54101	CCDS1984.1, CCDS46354.1	2p12-q11	2008-02-05			ENSG00000115523	ENSG00000115523			4414	protein-coding gene	gene with protein product	"""T-lymphocyte activation gene 519"""	188855		LAG2		2212946, 2434598	Standard	NM_012483		Approved	NKG5, LAG-2, D2S69E, TLA519	uc002sql.4	P22749	OTTHUMG00000130179	ENST00000263863.4:c.152C>A	2.37:g.85922542C>A	ENSP00000263863:p.Pro51His		P09325|Q6GU08	Missense_Mutation	SNP	pfam_SapB_2,superfamily_Saposin-like,smart_SaposinB,pfscan_SaposinB	p.P51H	ENST00000263863.4	37	c.152	CCDS1984.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.62|12.62	1.991488|1.991488	0.35131|0.35131	.|.	.|.	ENSG00000115523|ENSG00000115523	ENST00000263863;ENST00000524600;ENST00000409696|ENST00000526018	T;T;T|T	0.57107|0.66460	0.42;0.45;0.44|-0.21	1.64|1.64	-3.1|-3.1	0.05315|0.05315	.|.	1.229440|1.229440	0.06348|0.06348	N|U	0.709403|0.709403	T|T	0.49932|0.49932	0.1586|0.1586	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B|.	0.28933|.	0.228;0.092|.	B;B|.	0.16289|.	0.015;0.015|.	T|T	0.36939|0.36939	-0.9727|-0.9727	10|8	0.49607|0.39692	T|T	0.09|0.17	.|.	2.7255|2.7255	0.05212|0.05212	0.2176:0.3036:0.0:0.4788|0.2176:0.3036:0.0:0.4788	.|.	78;51|.	B4E3H9;P22749|.	.;GNLY_HUMAN|.	H|T	51;78;36|18	ENSP00000263863:P51H;ENSP00000436423:P78H;ENSP00000387116:P36H|ENSP00000434467:P18T	ENSP00000263863:P51H|ENSP00000434467:P18T	P|P	+|+	2|1	0|0	GNLY|GNLY	85776053|85776053	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.375000|0.375000	0.29983|0.29983	-1.329000|-1.329000	0.02677|0.02677	-1.014000|-1.014000	0.03379|0.03379	0.306000|0.306000	0.20318|0.20318	CCC|CCC	GNLY	-	NULL	ENSG00000115523		0.622	GNLY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNLY	HGNC	protein_coding	OTTHUMT00000252497.1	-	0.00	62	0	C	NM_006433		85922542	+1	tier1	-	no_errors	ENST00000263863	ensembl	human	known	74_37	missense	8.64	74	7	SNP	0.000	A
GP6	51206	genome.wustl.edu	37	19	55526303	55526303	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:55526303C>A	ENST00000417454.1	-	8	1033	c.1006G>T	c.(1006-1008)Ggg>Tgg	p.G336W	GP6_ENST00000333884.2_Missense_Mutation_p.G318W|GP6_ENST00000310373.3_Missense_Mutation_p.R337L|CTC-550B14.7_ENST00000586845.1_RNA|CTC-550B14.7_ENST00000593060.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)	336					blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.R337L(1)		NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		GAACATAACCCGCGGCTGTGA	0.637																																																	1	Substitution - Missense(1)	lung(1)											44.0	49.0	47.0					19																	55526303		2143	4232	6375	SO:0001583	missense	0			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.1006G>T	19.37:g.55526303C>A	ENSP00000394922:p.Gly336Trp		Q9HCN7|Q9UIF2	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2	p.R337L	ENST00000417454.1	37	c.1010	CCDS46184.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.59|12.59	1.983427|1.983427	0.35036|0.35036	.|.	.|.	ENSG00000088053|ENSG00000088053	ENST00000417454;ENST00000333884|ENST00000310373	T;T|T	0.00532|0.00561	6.83;6.75|6.59	2.65|2.65	0.335|0.335	0.15953|0.15953	.|.	.|.	.|.	.|.	.|.	T|T	0.00384|0.00384	0.0012|0.0012	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D;D|P	0.89917|0.36048	1.0;1.0|0.534	D;D|B	0.74023|0.28139	0.98;0.982|0.086	T|T	0.48080|0.48080	-0.9066|-0.9066	8|8	0.87932|0.87932	D|D	0|0	.|.	3.6946|3.6946	0.08360|0.08360	0.0:0.5851:0.2599:0.1549|0.0:0.5851:0.2599:0.1549	.|.	318;336|337	Q9HCN6-2;Q9HCN6|Q9HCN6-3	.;GPVI_HUMAN|.	W|L	336;318|337	ENSP00000394922:G336W;ENSP00000334552:G318W|ENSP00000308782:R337L	ENSP00000334552:G318W|ENSP00000308782:R337L	G|R	-|-	1|2	0|0	GP6|GP6	60218115|60218115	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-0.079000|-0.079000	0.11357|0.11357	0.155000|0.155000	0.19261|0.19261	0.561000|0.561000	0.74099|0.74099	GGG|CGG	GP6	-	NULL	ENSG00000088053		0.637	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	HGNC	protein_coding	OTTHUMT00000357006.1	-	0.00	62	0	C			55526303	-1	tier1	-	no_errors	ENST00000310373	ensembl	human	known	74_37	missense	8.64	74	7	SNP	0.000	A
GPR78	27201	genome.wustl.edu	37	4	8583004	8583004	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:8583004G>T	ENST00000382487.4	+	1	712	c.295G>T	c.(295-297)Gcg>Tcg	p.A99S	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	99					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						GAGCGTGGCGGCGCTGAGCGC	0.721																																																	0													8.0	9.0	9.0					4																	8583004		2170	4250	6420	SO:0001583	missense	0			AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.295G>T	4.37:g.8583004G>T	ENSP00000371927:p.Ala99Ser		Q8NGV3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A99S	ENST00000382487.4	37	c.295	CCDS3403.1	4	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825299	0.71143	.	.	ENSG00000155269	ENST00000382487	T	0.43688	0.94	2.41	0.521	0.17046	GPCR, rhodopsin-like superfamily (1);	0.076200	0.51477	U	0.000091	T	0.53498	0.1800	L	0.57536	1.79	0.37539	D	0.918236	D	0.89917	1.0	D	0.85130	0.997	T	0.52094	-0.8621	10	0.59425	D	0.04	.	7.3276	0.26563	0.2198:0.0:0.7802:0.0	.	99	Q96P69	GPR78_HUMAN	S	99	ENSP00000371927:A99S	ENSP00000371927:A99S	A	+	1	0	GPR78	8633904	0.997000	0.39634	0.004000	0.12327	0.834000	0.47266	5.119000	0.64679	-0.516000	0.06470	0.313000	0.20887	GCG	GPR78	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000155269		0.721	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR78	HGNC	protein_coding	OTTHUMT00000359201.1		0.00	14	0	G			8583004	+1			no_errors	ENST00000382487	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.998	T
GPRC5B	51704	genome.wustl.edu	37	16	19873269	19873269	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:19873269C>A	ENST00000300571.2	-	3	1248	c.1057G>T	c.(1057-1059)Ggc>Tgc	p.G353C	GPRC5B_ENST00000537135.1_Missense_Mutation_p.G379C|GPRC5B_ENST00000569479.1_Missense_Mutation_p.G353C|GPRC5B_ENST00000569847.1_Missense_Mutation_p.G353C|GPRC5B_ENST00000535671.1_Missense_Mutation_p.G353C	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	353					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)	p.G353S(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						CCCAAGCTGCCGTTGGGAAAT	0.512																																																	2	Substitution - Missense(2)	lung(1)|prostate(1)											61.0	55.0	57.0					16																	19873269		2197	4300	6497	SO:0001583	missense	0			AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.1057G>T	16.37:g.19873269C>A	ENSP00000300571:p.Gly353Cys		D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.G379C	ENST00000300571.2	37	c.1135	CCDS10581.1	16	.	.	.	.	.	.	.	.	.	.	C	21.1	4.090238	0.76756	.	.	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000538074;ENST00000537135	T;T;T	0.33865	1.42;1.44;1.39	5.38	4.43	0.53597	.	0.217634	0.38605	N	0.001640	T	0.50120	0.1597	L	0.43152	1.355	0.42338	D	0.992324	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.45086	-0.9285	9	.	.	.	.	13.1289	0.59369	0.0:0.9234:0.0:0.0766	.	379;353	B7Z831;Q9NZH0	.;GPC5B_HUMAN	C	353;353;202;379	ENSP00000300571:G353C;ENSP00000442858:G353C;ENSP00000441775:G379C	.	G	-	1	0	GPRC5B	19780770	0.997000	0.39634	0.994000	0.49952	0.946000	0.59487	3.604000	0.54081	1.276000	0.44395	-0.136000	0.14681	GGC	GPRC5B	-	NULL	ENSG00000167191		0.512	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5B	HGNC	protein_coding	OTTHUMT00000254285.1	-	0.00	55	0	C			19873269	-1	tier1	-	no_errors	ENST00000537135	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	A
GPR97	222487	genome.wustl.edu	37	16	57717928	57717928	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:57717928C>A	ENST00000333493.4	+	9	1127	c.966C>A	c.(964-966)gcC>gcA	p.A322A	GPR97_ENST00000327655.6_Silent_p.A112A|GPR97_ENST00000450388.3_Silent_p.A202A|RP11-405F3.4_ENST00000563062.1_RNA	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	322					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGAATCTGGCCTTCTTGGTCA	0.587																																																	0													91.0	92.0	91.0					16																	57717928		2198	4300	6498	SO:0001819	synonymous_variant	0			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.966C>A	16.37:g.57717928C>A			Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.A322	ENST00000333493.4	37	c.966	CCDS10786.1	16																																																																																			GPR97	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000182885		0.587	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR97	HGNC	protein_coding	OTTHUMT00000257333.2	-	0.00	81	0	C	NM_170776		57717928	+1	tier1	-	no_errors	ENST00000333493	ensembl	human	known	74_37	silent	6.38	86	6	SNP	0.006	A
GRAMD1C	54762	genome.wustl.edu	37	3	113627935	113627935	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:113627935A>G	ENST00000358160.4	+	9	1412	c.920A>G	c.(919-921)gAc>gGc	p.D307G	GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000440446.2_Missense_Mutation_p.D102G|GRAMD1C_ENST00000472026.1_Missense_Mutation_p.D140G|GRAMD1C_ENST00000452134.2_Missense_Mutation_p.T7A	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	307						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						CTTTCTCTGGACAAAAGCAGC	0.299																																																	0													66.0	71.0	69.0					3																	113627935		2203	4300	6503	SO:0001583	missense	0				CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.920A>G	3.37:g.113627935A>G	ENSP00000350881:p.Asp307Gly		A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.D307G	ENST00000358160.4	37	c.920	CCDS33826.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.30|15.30	2.791908|2.791908	0.50102|0.50102	.|.	.|.	ENSG00000178075|ENSG00000178075	ENST00000358160;ENST00000472026;ENST00000462838;ENST00000440446|ENST00000452134;ENST00000488680	T;T;T|T	0.58506|0.44482	0.88;0.47;0.33|0.92	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	0.424586|.	0.27231|.	N|.	0.020303|.	T|T	0.57110|0.57110	0.2031|0.2031	M|M	0.72353|0.72353	2.195|2.195	0.24320|0.24320	N|N	0.995045|0.995045	B;B|.	0.21753|.	0.06;0.012|.	B;B|.	0.22601|.	0.04;0.006|.	T|T	0.54794|0.54794	-0.8240|-0.8240	10|7	0.48119|0.87932	T|D	0.1|0	.|.	14.6551|14.6551	0.68828|0.68828	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	140;307|.	E9PHT3;Q8IYS0|.	.;GRM1C_HUMAN|.	G|A	307;140;102;102|7	ENSP00000350881:D307G;ENSP00000419132:D140G;ENSP00000408135:D102G|ENSP00000399844:T7A	ENSP00000350881:D307G|ENSP00000399844:T7A	D|T	+|+	2|1	0|0	GRAMD1C|GRAMD1C	115110625|115110625	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.951000|0.951000	0.60555|0.60555	5.563000|5.563000	0.67352|0.67352	2.159000|2.159000	0.67721|0.67721	0.455000|0.455000	0.32223|0.32223	GAC|ACA	GRAMD1C	-	NULL	ENSG00000178075		0.299	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD1C	HGNC	protein_coding	OTTHUMT00000354733.1	-	0.00	58	0	A	NM_017577		113627935	+1	tier1	-	no_errors	ENST00000358160	ensembl	human	known	74_37	missense	5.56	102	6	SNP	0.987	G
GRIFIN	402635	genome.wustl.edu	37	7	2515604	2515604	+	RNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:2515604G>T	ENST00000417742.1	-	0	199							A4D1Z8	GRIFN_HUMAN	galectin-related inter-fiber protein								carbohydrate binding (GO:0030246)						Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;3.23e-14)		TCCAGCCGGGGGCCAGGCCGC	0.706																																																	0													23.0	29.0	27.0					7																	2515604		1938	4118	6056			0					7p22.2	2013-01-30			ENSG00000236734	ENSG00000275572			4577	protein-coding gene	gene with protein product						9786891, 18087242	Standard	NM_001291784		Approved			A4D1Z8	OTTHUMG00000152042		7.37:g.2515604G>T				RNA	SNP	-	NULL	ENST00000417742.1	37	NULL		7																																																																																			GRIFIN	-	-	ENSG00000236734		0.706	GRIFIN-002	KNOWN	basic	processed_transcript	GRIFIN	HGNC	processed_transcript	OTTHUMT00000325020.1	-	0.00	49	0	G			2515604	-1	tier1	-	no_errors	ENST00000417742	ensembl	human	known	74_37	rna	9.33	68	7	SNP	1.000	T
GRINA	2907	genome.wustl.edu	37	8	145066491	145066491	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:145066491G>T	ENST00000313269.5	+	5	1050	c.772G>T	c.(772-774)Gtg>Ttg	p.V258L	GRINA_ENST00000395068.4_Missense_Mutation_p.V258L	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	258						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CATCATGGCCGTGGGCATCAC	0.627																																																	0													99.0	79.0	86.0					8																	145066491		2203	4300	6503	SO:0001583	missense	0			NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.772G>T	8.37:g.145066491G>T	ENSP00000314380:p.Val258Leu		B3KXM7|O43836|Q8IVW7	Missense_Mutation	SNP	pfam_Bax_inhibitor_1-related	p.V258L	ENST00000313269.5	37	c.772	CCDS34961.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.76|15.76	2.929507|2.929507	0.52759|0.52759	.|.	.|.	ENSG00000178719|ENSG00000178719	ENST00000533044;ENST00000527194|ENST00000313269;ENST00000529301;ENST00000395068;ENST00000537637	.|T;T;T	.|0.39229	.|1.09;1.09;1.09	5.28|5.28	4.4|4.4	0.53042|0.53042	.|.	.|0.157577	.|0.43110	.|D	.|0.000607	T|T	0.25082|0.25082	0.0609|0.0609	N|N	0.17872|0.17872	0.535|0.535	0.47441|0.47441	D|D	0.999423|0.999423	.|P	.|0.36438	.|0.553	.|B	.|0.39617	.|0.305	T|T	0.09662|0.09662	-1.0664|-1.0664	5|10	.|0.02654	.|T	.|1	-15.7342|-15.7342	9.8058|9.8058	0.40792|0.40792	0.0957:0.0:0.9043:0.0|0.0957:0.0:0.9043:0.0	.|.	.|258	.|Q7Z429	.|GRINA_HUMAN	L|L	80;70|258;258;258;239	.|ENSP00000314380:V258L;ENSP00000432706:V258L;ENSP00000378507:V258L	.|ENSP00000314380:V258L	R|V	+|+	2|1	0|0	GRINA|GRINA	145138479|145138479	1.000000|1.000000	0.71417|0.71417	0.854000|0.854000	0.33618|0.33618	0.573000|0.573000	0.36030|0.36030	3.683000|3.683000	0.54663|0.54663	1.224000|1.224000	0.43551|0.43551	0.650000|0.650000	0.86243|0.86243	CGT|GTG	GRINA	-	pfam_Bax_inhibitor_1-related	ENSG00000178719		0.627	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GRINA	HGNC	protein_coding	OTTHUMT00000384048.1	-	0.00	40	0	G	NM_001009184		145066491	+1	tier1	-	no_errors	ENST00000313269	ensembl	human	known	74_37	missense	15.09	45	8	SNP	0.996	T
GRM4	2914	genome.wustl.edu	37	6	34122888	34122888	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:34122888G>T	ENST00000374177.3	-	1	511	c.280C>A	c.(280-282)Cgc>Agc	p.R94S		NM_001256809.1	NP_001243738.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	0					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CAGCGGGGGCGGCGGGGGTCT	0.692											OREG0017361	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001583	missense	0			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000374177.3:c.280C>A	6.37:g.34122888G>T	ENSP00000363292:p.Arg94Ser	845	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_GABA_rcpt_B	p.R94S	ENST00000374177.3	37	c.280	CCDS59012.1	6	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384682	0.42308	.	.	ENSG00000124493	ENST00000374177	D	0.87491	-2.26	4.88	3.05	0.35203	.	.	.	.	.	T	0.64204	0.2577	.	.	.	0.21020	N	0.999801	.	.	.	.	.	.	T	0.54476	-0.8288	6	0.22109	T	0.4	.	6.2043	0.20593	0.0967:0.0:0.7198:0.1834	.	.	.	.	S	94	ENSP00000363292:R94S	ENSP00000363292:R94S	R	-	1	0	GRM4	34230866	0.931000	0.31567	0.066000	0.19879	0.965000	0.64279	2.543000	0.45752	0.555000	0.29079	0.462000	0.41574	CGC	GRM4	-	NULL	ENSG00000124493		0.692	GRM4-002	KNOWN	basic|CCDS	protein_coding	GRM4	HGNC	protein_coding	OTTHUMT00000471761.1	-	0.00	121	0	G			34122888	-1	tier1	-	no_errors	ENST00000374177	ensembl	human	known	74_37	missense	6.88	149	11	SNP	0.121	T
GTF2IRD1	9569	genome.wustl.edu	37	7	73932624	73932624	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:73932624A>T	ENST00000265755.3	+	5	970	c.577A>T	c.(577-579)Agc>Tgc	p.S193C	GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.S225C|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.S193C|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.S193C|GTF2IRD1_ENST00000489094.1_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	193					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCTGGAACACAGCCACCGCAT	0.716																																																	0													32.0	32.0	32.0					7																	73932624		2202	4300	6502	SO:0001583	missense	0			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.577A>T	7.37:g.73932624A>T	ENSP00000265755:p.Ser193Cys		O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.S193C	ENST00000265755.3	37	c.577	CCDS5571.1	7	.	.	.	.	.	.	.	.	.	.	A	24.8	4.568686	0.86439	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.66416	0.2787	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.989;0.974	T	0.70178	-0.4943	10	0.72032	D	0.01	-28.2129	14.1976	0.65682	1.0:0.0:0.0:0.0	.	225;193;193;193	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	C	193;225;193;193	ENSP00000265755:S193C;ENSP00000397566:S225C;ENSP00000408477:S193C;ENSP00000418383:S193C	ENSP00000265755:S193C	S	+	1	0	GTF2IRD1	73570560	1.000000	0.71417	0.992000	0.48379	0.630000	0.37929	8.683000	0.91236	2.003000	0.58678	0.528000	0.53228	AGC	GTF2IRD1	-	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	ENSG00000006704		0.716	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2IRD1	HGNC	protein_coding	OTTHUMT00000252654.2		0.00	21	0	A	NM_016328		73932624	+1			no_errors	ENST00000265755	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
GUCA1A	2978	genome.wustl.edu	37	6	42141452	42141452	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:42141452T>C	ENST00000394237.1	+	3	1077	c.101T>C	c.(100-102)cTc>cCc	p.L34P	GUCA1A_ENST00000053469.4_Missense_Mutation_p.L34P|GUCA1A_ENST00000372958.1_Missense_Mutation_p.L34P|GUCA1A_ENST00000541991.1_Missense_Mutation_p.L34P			P43080	GUC1A_HUMAN	guanylate cyclase activator 1A (retina)	34	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;5.54e-05)|Epithelial(12;0.000167)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TCTGGCCAACTCACCCTCTAT	0.547																																																	0													142.0	124.0	130.0					6																	42141452		2203	4300	6503	SO:0001583	missense	0				CCDS4864.1	6p21.1	2013-06-06			ENSG00000048545	ENSG00000048545		"""EF-hand domain containing"""	4678	protein-coding gene	gene with protein product	"""cone dystrophy 3"""	600364	"""chromosome 6 open reading frame 131"""	GUCA, GUCA1, C6orf131		9425234	Standard	NM_000409		Approved	GCAP, GCAP1, COD3, dJ139D8.6, CORD14	uc003orx.3	P43080	OTTHUMG00000014696	ENST00000394237.1:c.101T>C	6.37:g.42141452T>C	ENSP00000377784:p.Leu34Pro		B3KWT4|Q7Z6T1|Q9NU14	Missense_Mutation	SNP	pfam_EF_hand_dom,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.L34P	ENST00000394237.1	37	c.101	CCDS4864.1	6	.	.	.	.	.	.	.	.	.	.	T	24.1	4.491738	0.84962	.	.	ENSG00000048545	ENST00000418175;ENST00000541991;ENST00000372965;ENST00000053469;ENST00000394237;ENST00000372958	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	5.75	5.75	0.90469	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.90150	0.6922	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92353	0.5891	10	0.87932	D	0	.	14.0228	0.64568	0.0:0.0:0.0:1.0	.	34	P43080	GUC1A_HUMAN	P	34;34;30;34;34;34	ENSP00000388438:L34P;ENSP00000437476:L34P;ENSP00000053469:L34P;ENSP00000377784:L34P;ENSP00000362049:L34P	ENSP00000053469:L34P	L	+	2	0	GUCA1A	42249430	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.194000	0.70268	0.533000	0.62120	CTC	GUCA1A	-	NULL	ENSG00000048545		0.547	GUCA1A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GUCA1A	HGNC	protein_coding	OTTHUMT00000316582.1		0.00	62	0	T			42141452	+1			no_errors	ENST00000053469	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	C
H2AFV	94239	genome.wustl.edu	37	7	44882898	44882898	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:44882898C>A	ENST00000308153.4	-	2	150	c.59G>T	c.(58-60)cGc>cTc	p.R20L	H2AFV_ENST00000349299.3_Missense_Mutation_p.R20L|H2AFV_ENST00000437072.1_Missense_Mutation_p.R20L|H2AFV_ENST00000350771.3_Intron|H2AFV_ENST00000222690.6_Missense_Mutation_p.R20L|H2AFV_ENST00000381124.5_Missense_Mutation_p.R20L|H2AFV_ENST00000521529.1_Intron|H2AFV_ENST00000446531.1_Missense_Mutation_p.R20L	NM_012412.4	NP_036544.1	Q71UI9	H2AV_HUMAN	H2A histone family, member V	20						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	9						TCTCTGTGAGCGAGATACTGC	0.363																																																	0													101.0	96.0	97.0					7																	44882898		2203	4300	6503	SO:0001583	missense	0			AF081192	CCDS5495.1, CCDS5496.1, CCDS5497.1, CCDS5498.1, CCDS47581.1	7p13	2011-01-27		2004-03-26	ENSG00000105968	ENSG00000105968		"""Histones / Replication-independent"""	20664	protein-coding gene	gene with protein product				H2AV			Standard	NM_012412		Approved	MGC10170, MGC10831, MGC1947	uc003tma.2	Q71UI9	OTTHUMG00000129217	ENST00000308153.4:c.59G>T	7.37:g.44882898C>A	ENSP00000308405:p.Arg20Leu		A6NFA8|A6NKY0|A6NN01|A8MQC5|Q59GV8|Q6PK98	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.R20L	ENST00000308153.4	37	c.59	CCDS5496.1	7	.	.	.	.	.	.	.	.	.	.	c	33	5.222310	0.95139	.	.	ENSG00000105968	ENST00000222690;ENST00000437072;ENST00000349299;ENST00000308153;ENST00000381124;ENST00000446531	T;D;D;T;T;T	0.86865	-0.53;-2.18;-2.18;-0.53;-0.53;-0.53	5.42	5.42	0.78866	Histone-fold (2);Histone core (1);Histone H2A (2);	.	.	.	.	D	0.93585	0.7952	H	0.95004	3.61	0.80722	D	1	P;B;P	0.51791	0.686;0.399;0.948	B;B;P	0.51833	0.25;0.049;0.681	D	0.95191	0.8308	9	0.87932	D	0	-14.9909	16.7291	0.85431	0.0:1.0:0.0:0.0	.	20;20;20	A6NFA8;Q71UI9;A6NN01	.;H2AV_HUMAN;.	L	20	ENSP00000222690:R20L;ENSP00000397115:R20L;ENSP00000342714:R20L;ENSP00000308405:R20L;ENSP00000370516:R20L;ENSP00000406901:R20L	ENSP00000222690:R20L	R	-	2	0	H2AFV	44849423	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.257000	0.78362	2.551000	0.86045	0.450000	0.29827	CGC	H2AFV	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000105968		0.363	H2AFV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	H2AFV	HGNC	protein_coding	OTTHUMT00000251305.1	-	0.00	73	0	C	NM_012412		44882898	-1	tier1	-	no_errors	ENST00000308153	ensembl	human	known	74_37	missense	9.09	80	8	SNP	1.000	A
HAP1	9001	genome.wustl.edu	37	17	39883692	39883692	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:39883692C>A	ENST00000310778.5	-	9	1298	c.1289G>T	c.(1288-1290)gGt>gTt	p.G430V	RN7SL399P_ENST00000471648.2_RNA|JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Intron|HAP1_ENST00000347901.4_Intron|HAP1_ENST00000393939.2_Intron			P54257	HAP1_HUMAN	huntingtin-associated protein 1	430	Glu-rich.|HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CAGCTGGGAACCCACCCACAC	0.622																																																	0													64.0	60.0	61.0					17																	39883692		2203	4300	6503	SO:0001583	missense	0			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1289G>T	17.37:g.39883692C>A	ENSP00000309392:p.Gly430Val		A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	pfam_HAP1_N	p.G430V	ENST00000310778.5	37	c.1289		17	.	.	.	.	.	.	.	.	.	.	C	10.04	1.240473	0.22711	.	.	ENSG00000173805	ENST00000310778	T	0.05996	3.36	3.15	0.984	0.19773	.	.	.	.	.	T	0.03959	0.0111	.	.	.	0.32206	N	0.577201	P	0.38827	0.649	B	0.33042	0.157	T	0.35847	-0.9772	8	0.39692	T	0.17	.	4.6633	0.12653	0.0:0.6139:0.2486:0.1375	.	430	P54257	HAP1_HUMAN	V	430	ENSP00000309392:G430V	ENSP00000309392:G430V	G	-	2	0	HAP1	37137218	0.360000	0.24964	0.356000	0.25785	0.809000	0.45718	0.041000	0.13927	0.552000	0.29026	0.549000	0.68633	GGT	HAP1	-	pfam_HAP1_N	ENSG00000173805		0.622	HAP1-006	KNOWN	basic|appris_principal	protein_coding	HAP1	HGNC	protein_coding	OTTHUMT00000389619.1	-	0.00	105	0	C	NM_003949		39883692	-1	tier1	-	no_errors	ENST00000310778	ensembl	human	known	74_37	missense	7.26	115	9	SNP	0.566	A
HDAC4	9759	genome.wustl.edu	37	2	240002840	240002840	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:240002840C>A	ENST00000345617.3	-	22	3477	c.2686G>T	c.(2686-2688)Ggc>Tgc	p.G896C	HDAC4_ENST00000543185.1_Missense_Mutation_p.G480C	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	896	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TCCAGGCCGCCGGTGAAAGCC	0.622																																																	0													34.0	39.0	37.0					2																	240002840		2203	4300	6503	SO:0001583	missense	0			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2686G>T	2.37:g.240002840C>A	ENSP00000264606:p.Gly896Cys		Q9UND6	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.G896C	ENST00000345617.3	37	c.2686	CCDS2529.1	2	.	.	.	.	.	.	.	.	.	.	c	20.5	3.999452	0.74818	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185	T;T	0.70631	-0.5;-0.5	3.78	3.78	0.43462	Histone deacetylase domain (2);	0.112249	0.64402	D	0.000011	D	0.83732	0.5318	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86838	0.2015	10	0.72032	D	0.01	.	16.0323	0.80588	0.0:1.0:0.0:0.0	.	864;896	Q53SM2;P56524	.;HDAC4_HUMAN	C	896;784;480	ENSP00000264606:G896C;ENSP00000440481:G480C	ENSP00000264606:G896C	G	-	1	0	HDAC4	239667777	1.000000	0.71417	0.672000	0.29872	0.656000	0.38851	7.390000	0.79816	1.856000	0.53863	0.450000	0.29827	GGC	HDAC4	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000068024		0.622	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC4	HGNC	protein_coding	OTTHUMT00000257174.2	-	0.00	100	0	C	NM_006037		240002840	-1	tier1	-	no_errors	ENST00000345617	ensembl	human	known	74_37	missense	10.32	113	13	SNP	1.000	A
HDLBP	3069	genome.wustl.edu	37	2	242195807	242195807	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:242195807C>T	ENST00000391975.1	-	7	892	c.665G>A	c.(664-666)cGt>cAt	p.R222H	HDLBP_ENST00000310931.4_Missense_Mutation_p.R222H|HDLBP_ENST00000427183.2_Missense_Mutation_p.R258H|HDLBP_ENST00000391976.2_Missense_Mutation_p.R222H	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	222	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CTCCACAGCACGTTTGTCCTG	0.522																																																	0													98.0	84.0	89.0					2																	242195807		2203	4300	6503	SO:0001583	missense	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.665G>A	2.37:g.242195807C>T	ENSP00000375836:p.Arg222His		B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.R222H	ENST00000391975.1	37	c.665	CCDS2547.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.8|20.8	4.048339|4.048339	0.75846|0.75846	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000422933|ENST00000453141	T;T;T;T;T|.	0.42900|.	0.96;0.96;0.96;0.96;1.21|.	5.87|5.87	5.87|5.87	0.94306|0.94306	K Homology (1);K Homology, type 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69324|0.69324	0.3098|0.3098	L|L	0.43152|0.43152	1.355|1.355	0.49051|0.49051	D|D	0.999746|0.999746	D;D|.	0.76494|.	0.999;0.999|.	P;D|.	0.69142|.	0.835;0.962|.	T|T	0.62062|0.62062	-0.6933|-0.6933	10|5	0.49607|.	T|.	0.09|.	-9.0376|-9.0376	20.5827|20.5827	0.99408|0.99408	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	258;222|.	E7EM71;Q00341|.	.;VIGLN_HUMAN|.	H|M	222;222;222;258;222|123	ENSP00000375836:R222H;ENSP00000375837:R222H;ENSP00000312042:R222H;ENSP00000399139:R258H;ENSP00000403807:R222H|.	ENSP00000312042:R222H|.	R|V	-|-	2|1	0|0	HDLBP|HDLBP	241844480|241844480	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.056000|0.056000	0.15407|0.15407	5.686000|5.686000	0.68211|0.68211	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CGT|GTG	HDLBP	-	smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000115677		0.522	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5	-	0.00	48	0	C	NM_203346		242195807	-1	tier1	-	no_errors	ENST00000310931	ensembl	human	known	74_37	missense	11.76	60	8	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112673449	112673449	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:112673449C>T	ENST00000430131.2	-	35	5463	c.4318G>A	c.(4318-4320)Gta>Ata	p.V1440I	HECTD4_ENST00000550722.1_Missense_Mutation_p.V1716I|HECTD4_ENST00000377560.5_Missense_Mutation_p.V1690I			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1440					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CAGTCTTCTACGCTCATCAGG	0.582																																																	0													48.0	50.0	49.0					12																	112673449		1968	4159	6127	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4318G>A	12.37:g.112673449C>T	ENSP00000404379:p.Val1440Ile		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.V1690I	ENST00000430131.2	37	c.5068		12	.	.	.	.	.	.	.	.	.	.	C	35	5.490833	0.96339	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.52983	0.64;0.65;0.64	6.03	6.03	0.97812	.	.	.	.	.	T	0.54159	0.1841	N	0.19112	0.55	0.80722	D	1	D	0.54772	0.968	P	0.59221	0.854	T	0.56848	-0.7911	9	0.72032	D	0.01	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	1440	Q9Y4D8	K0614_HUMAN	I	1690;1440;1716	ENSP00000366783:V1690I;ENSP00000404379:V1440I;ENSP00000449784:V1716I	ENSP00000366783:V1690I	V	-	1	0	C12orf51	111157832	1.000000	0.71417	0.876000	0.34364	0.865000	0.49528	7.400000	0.79949	2.854000	0.98071	0.655000	0.94253	GTA	HECTD4	-	NULL	ENSG00000173064		0.582	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	61	0	C	NM_173813		112673449	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	missense	6.06	61	4	SNP	1.000	T
HERC2P3	283755	genome.wustl.edu	37	15	20644851	20644851	+	RNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:20644851C>A	ENST00000428453.1	-	0	3096							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						ATGTCCCTCGCCCTTTCGGTC	0.458																																																	0													115.0	62.0	81.0					15																	20644851		1509	2699	4208			0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20644851C>A				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.458	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	326	0	C	NG_008269		20644851	-1	tier1	-	no_errors	ENST00000426501	ensembl	human	known	74_37	rna	11.14	343	43	SNP	1.000	A
HIP1R	9026	genome.wustl.edu	37	12	123344997	123344997	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:123344997G>A	ENST00000253083.4	+	27	2712	c.2587G>A	c.(2587-2589)Gcc>Acc	p.A863T		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	863	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		GGAATTTTACGCCAAGAACTC	0.642											OREG0022225	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													57.0	64.0	62.0					12																	123344997		2203	4300	6503	SO:0001583	missense	0			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.2587G>A	12.37:g.123344997G>A	ENSP00000253083:p.Ala863Thr	1526	A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.A863T	ENST00000253083.4	37	c.2587	CCDS31922.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.027273	0.97216	.	.	ENSG00000130787	ENST00000253083	T	0.44083	0.93	5.33	5.33	0.75918	I/LWEQ (4);	0.000000	0.85682	D	0.000000	T	0.49966	0.1588	L	0.60012	1.86	0.80722	D	1	D	0.53745	0.962	P	0.49140	0.601	T	0.42085	-0.9472	10	0.29301	T	0.29	-26.4801	18.63	0.91357	0.0:0.0:1.0:0.0	.	863	O75146	HIP1R_HUMAN	T	863	ENSP00000253083:A863T	ENSP00000253083:A863T	A	+	1	0	HIP1R	121910950	1.000000	0.71417	0.996000	0.52242	0.930000	0.56654	9.760000	0.98935	2.486000	0.83907	0.655000	0.94253	GCC	HIP1R	-	pfam_ILWEQ_dom,smart_ILWEQ_dom,pfscan_ILWEQ_dom	ENSG00000130787		0.642	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1R	HGNC	protein_coding	OTTHUMT00000400935.1	-	0.00	53	0	G	NM_003959		123344997	+1	tier1	-	no_errors	ENST00000253083	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	A
HIST2H2AC	8338	genome.wustl.edu	37	1	149858798	149858798	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:149858798G>A	ENST00000331380.2	+	1	274	c.274G>A	c.(274-276)Gag>Aag	p.E92K	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	92						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CCGCAACGACGAGGAACTGAA	0.597																																																	0													68.0	69.0	68.0					1																	149858798		2203	4297	6500	SO:0001583	missense	0			AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.274G>A	1.37:g.149858798G>A	ENSP00000332194:p.Glu92Lys		Q6DRA7|Q8IUE5	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E92K	ENST00000331380.2	37	c.274	CCDS937.1	1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878358	0.33162	.	.	ENSG00000184260	ENST00000331380	T	0.47528	0.84	5.34	3.44	0.39384	Histone-fold (2);Histone H2A (1);	0.000000	0.44902	D	0.000420	T	0.68183	0.2973	H	0.96748	3.875	0.38548	D	0.949392	D	0.63880	0.993	D	0.65684	0.937	T	0.76239	-0.3032	10	0.87932	D	0	.	9.7166	0.40278	0.0779:0.1416:0.7806:0.0	.	92	Q16777	H2A2C_HUMAN	K	92	ENSP00000332194:E92K	ENSP00000332194:E92K	E	+	1	0	HIST2H2AC	148125422	1.000000	0.71417	0.984000	0.44739	0.041000	0.13682	7.519000	0.81809	0.619000	0.30197	-0.136000	0.14681	GAG	HIST2H2AC	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000184260		0.597	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AC	HGNC	protein_coding	OTTHUMT00000087128.1	-	0.00	159	0	G	NM_003517		149858798	+1	tier1	-	no_errors	ENST00000331380	ensembl	human	known	74_37	missense	8.04	181	16	SNP	1.000	A
HKDC1	80201	genome.wustl.edu	37	10	71008284	71008284	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:71008284C>A	ENST00000354624.5	+	10	1503	c.1370C>A	c.(1369-1371)aCc>aAc	p.T457N	HKDC1_ENST00000395086.2_Missense_Mutation_p.T457N|HKDC1_ENST00000488706.1_3'UTR	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	457	Hexokinase type-2 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GCCATGGTGACCGCGGTGGCC	0.642																																																	0													39.0	40.0	40.0					10																	71008284		2203	4300	6503	SO:0001583	missense	0				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1370C>A	10.37:g.71008284C>A	ENSP00000346643:p.Thr457Asn		B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.T457N	ENST00000354624.5	37	c.1370	CCDS7288.1	10	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966395	0.92855	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	T;T	0.12465	2.68;2.68	4.97	4.97	0.65823	Hexokinase, C-terminal (1);	0.052599	0.64402	D	0.000001	T	0.47801	0.1465	M	0.91818	3.245	0.58432	D	0.999999	D	0.76494	0.999	D	0.81914	0.995	T	0.59369	-0.7467	10	0.66056	D	0.02	-15.1498	18.3972	0.90502	0.0:1.0:0.0:0.0	.	457	Q2TB90	HKDC1_HUMAN	N	457	ENSP00000346643:T457N;ENSP00000378521:T457N	ENSP00000346643:T457N	T	+	2	0	HKDC1	70678290	1.000000	0.71417	0.954000	0.39281	0.946000	0.59487	7.615000	0.83006	2.583000	0.87209	0.462000	0.41574	ACC	HKDC1	-	pfam_Hexokinase_C	ENSG00000156510		0.642	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	HGNC	protein_coding	OTTHUMT00000048389.1	-	0.00	57	0	C	NM_025130		71008284	+1	tier1	-	no_errors	ENST00000354624	ensembl	human	known	74_37	missense	11.43	62	8	SNP	1.000	A
HLA-DMA	3108	genome.wustl.edu	37	6	32917464	32917464	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:32917464G>A	ENST00000374843.4	-	3	661	c.576C>T	c.(574-576)ttC>ttT	p.F192F	HLA-DMA_ENST00000395305.3_Silent_p.F97F|HLA-DMA_ENST00000395303.3_Silent_p.F158F|HLA-DMA_ENST00000464392.1_5'UTR|XXbac-BPG181M17.5_ENST00000429234.1_Intron	NM_006120.3	NP_006111.2	P28067	DMA_HUMAN	major histocompatibility complex, class II, DM alpha	192	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|chaperone mediated protein folding requiring cofactor (GO:0051085)|immunoglobulin mediated immune response (GO:0016064)|inner ear development (GO:0048839)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of immune response (GO:0050778)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein transport (GO:0015031)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)	MHC class II protein complex binding (GO:0023026)			kidney(1)|large_intestine(2)|lung(8)	11						GTTCTGGTGTGAAGTTTAAGT	0.478																																																	0													77.0	74.0	75.0					6																	32917464		1510	2709	4219	SO:0001819	synonymous_variant	0				CCDS4761.1	6p21.3	2013-01-11			ENSG00000204257	ENSG00000204257		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4934	protein-coding gene	gene with protein product		142855				1922385	Standard	NM_006120		Approved	D6S222E, RING6	uc003ocm.2	P28067	OTTHUMG00000031173	ENST00000374843.4:c.576C>T	6.37:g.32917464G>A			Q29639|Q29640	Silent	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.F192	ENST00000374843.4	37	c.576	CCDS4761.1	6																																																																																			HLA-DMA	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000204257		0.478	HLA-DMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMA	HGNC	protein_coding	OTTHUMT00000076325.2	-	0.00	39	0	G	NM_006120		32917464	-1	tier1	-	no_errors	ENST00000374843	ensembl	human	known	74_37	silent	10.23	79	9	SNP	1.000	A
HSPB7	27129	genome.wustl.edu	37	1	16344400	16344400	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:16344400G>A	ENST00000311890.9	-	1	885	c.59C>T	c.(58-60)tCt>tTt	p.S20F	HSPB7_ENST00000406363.2_Missense_Mutation_p.S20F|HSPB7_ENST00000411503.1_Missense_Mutation_p.S20F|HSPB7_ENST00000375718.4_Intron|HSPB7_ENST00000545268.1_Missense_Mutation_p.S20F|HSPB7_ENST00000487046.1_Missense_Mutation_p.S20F	NM_014424.4	NP_055239.1	Q9UBY9	HSPB7_HUMAN	heat shock 27kDa protein family, member 7 (cardiovascular)	20	Poly-Ser.|Required for localization to SC35 splicing speckles.				regulation of heart contraction (GO:0008016)|response to unfolded protein (GO:0006986)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(1)|liver(1)|lung(6)|skin(1)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		ggaggaggaagaggaagagga	0.652																																																	0													45.0	44.0	44.0					1																	16344400		2203	4300	6503	SO:0001583	missense	0			AF155908	CCDS30611.1	1p36.23-p34.3	2011-09-02	2002-08-29		ENSG00000173641	ENSG00000173641		"""Heat shock proteins / HSPB"""	5249	protein-coding gene	gene with protein product		610692	"""heat shock 27kD protein family, member 7 (cardiovascular)"""			10593960	Standard	NM_014424		Approved	cvHSP	uc001axo.2	Q9UBY9	OTTHUMG00000009531	ENST00000311890.9:c.59C>T	1.37:g.16344400G>A	ENSP00000310111:p.Ser20Phe		B3KQ37|C9K0Y0|Q9NU17	Missense_Mutation	SNP	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.S20F	ENST00000311890.9	37	c.59	CCDS30611.1	1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669498	0.47677	.	.	ENSG00000173641	ENST00000411503;ENST00000311890;ENST00000375714;ENST00000487046;ENST00000406363;ENST00000545268	D;D;D;D	0.95412	-3.02;-3.02;-3.7;-3.05	3.3	3.3	0.37823	.	0.000000	0.36482	N	0.002576	D	0.90225	0.6944	N	0.24115	0.695	0.22819	N	0.998694	P;P;P;B	0.48911	0.917;0.917;0.917;0.172	P;P;P;B	0.46049	0.502;0.502;0.502;0.248	T	0.82317	-0.0517	10	0.09843	T	0.71	-5.5267	11.0613	0.47948	0.0:0.1908:0.8092:0.0	.	46;46;108;20	Q7Z3C1;Q5T5Q1;Q5T5Q2;Q9UBY9	.;.;.;HSPB7_HUMAN	F	20;20;108;20;20;20	ENSP00000391578:S20F;ENSP00000310111:S20F;ENSP00000419477:S20F;ENSP00000385472:S20F	ENSP00000310111:S20F	S	-	2	0	HSPB7	16216987	0.868000	0.29978	0.618000	0.29105	0.713000	0.41058	4.556000	0.60775	2.145000	0.66743	0.407000	0.27541	TCT	HSPB7	-	NULL	ENSG00000173641		0.652	HSPB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HSPB7	HGNC	protein_coding	OTTHUMT00000026334.2	-	0.00	52	0	G	NM_014424		16344400	-1	tier1	-	no_errors	ENST00000487046	ensembl	human	known	74_37	missense	8.33	55	5	SNP	0.317	A
HSD3B2	3284	genome.wustl.edu	37	1	119964835	119964835	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:119964835G>T	ENST00000543831.1	+	4	960	c.711G>T	c.(709-711)agG>agT	p.R237S	HSD3B2_ENST00000369416.3_Missense_Mutation_p.R237S	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	237			Missing (in AH2; activity abolished).		androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	TGGCCTTGAGGGCTCTGCGGG	0.507																																																	0													48.0	52.0	50.0					1																	119964835		2203	4300	6503	SO:0001583	missense	0			BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.711G>T	1.37:g.119964835G>T	ENSP00000445122:p.Arg237Ser		A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	p.R237S	ENST00000543831.1	37	c.711	CCDS902.1	1	.	.	.	.	.	.	.	.	.	.	-	16.06	3.015842	0.54468	.	.	ENSG00000203859	ENST00000543831;ENST00000369416	D;D	0.86030	-2.06;-2.06	3.98	0.451	0.16629	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.106561	0.64402	D	0.000007	D	0.86973	0.6062	M	0.86178	2.8	0.38463	D	0.947263	D	0.60575	0.988	P	0.62560	0.904	D	0.85672	0.1295	9	.	.	.	-16.1968	8.0279	0.30448	0.4125:0.0:0.5875:0.0	.	237	P26439	3BHS2_HUMAN	S	237	ENSP00000445122:R237S;ENSP00000358424:R237S	.	R	+	3	2	HSD3B2	119766358	0.998000	0.40836	0.621000	0.29145	0.826000	0.46750	0.526000	0.22971	0.195000	0.20347	0.298000	0.19748	AGG	HSD3B2	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct	ENSG00000203859		0.507	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B2	HGNC	protein_coding	OTTHUMT00000034994.1	-	0.00	85	0	G	NM_000198		119964835	+1	tier1	-	no_errors	ENST00000369416	ensembl	human	known	74_37	missense	13.21	91	14	SNP	0.894	T
HTR3C	170572	genome.wustl.edu	37	3	183777335	183777335	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:183777335C>A	ENST00000318351.1	+	7	866	c.832C>A	c.(832-834)Cgt>Agt	p.R278S		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	278					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	GAGCGAGAATCGTGCCCCATT	0.547																																																	0													161.0	142.0	148.0					3																	183777335		2203	4300	6503	SO:0001583	missense	0			AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.832C>A	3.37:g.183777335C>A	ENSP00000322617:p.Arg278Ser		A2RRR5	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	p.R278S	ENST00000318351.1	37	c.832	CCDS3250.1	3	.	.	.	.	.	.	.	.	.	.	.	10.27	1.304310	0.23736	.	.	ENSG00000178084	ENST00000318351	D	0.88586	-2.4	4.01	1.19	0.21007	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.133396	0.49305	N	0.000150	D	0.91713	0.7380	M	0.86097	2.795	0.09310	N	1	P	0.52316	0.952	P	0.60286	0.872	D	0.83820	0.0246	10	0.87932	D	0	.	3.1778	0.06575	0.3653:0.4275:0.0:0.2072	.	278	Q8WXA8	5HT3C_HUMAN	S	278	ENSP00000322617:R278S	ENSP00000322617:R278S	R	+	1	0	HTR3C	185260029	0.004000	0.15560	0.000000	0.03702	0.012000	0.07955	0.289000	0.18957	0.045000	0.15804	0.655000	0.94253	CGT	HTR3C	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	ENSG00000178084		0.547	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3C	HGNC	protein_coding	OTTHUMT00000346296.1	-	0.00	80	0	C	NM_130770		183777335	+1	tier1	-	no_errors	ENST00000318351	ensembl	human	known	74_37	missense	6.03	109	7	SNP	0.002	A
HYDIN	54768	genome.wustl.edu	37	16	71101239	71101239	+	Missense_Mutation	SNP	C	C	A	rs369466741		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:71101239C>A	ENST00000393567.2	-	15	2179	c.2029G>T	c.(2029-2031)Gtg>Ttg	p.V677L	HYDIN_ENST00000393550.2_Missense_Mutation_p.V692L|HYDIN_ENST00000288168.10_Missense_Mutation_p.V694L|HYDIN_ENST00000448089.2_Missense_Mutation_p.V677L|HYDIN_ENST00000448691.1_Missense_Mutation_p.V677L|HYDIN_ENST00000541601.1_Missense_Mutation_p.V694L|HYDIN_ENST00000538248.1_Missense_Mutation_p.V704L|HYDIN_ENST00000543639.1_5'Flank|HYDIN_ENST00000321489.5_Missense_Mutation_p.V677L	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	677					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.V677L(3)|p.V692L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ATGCCCTCCACGTCCACCACG	0.522																																																	4	Substitution - Missense(4)	lung(4)											72.0	62.0	66.0					16																	71101239		2198	4300	6498	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2029G>T	16.37:g.71101239C>A	ENSP00000377197:p.Val677Leu		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.V677L	ENST00000393567.2	37	c.2029	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834021	0.91036	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601;ENST00000288168;ENST00000393550	T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	4.99	4.99	0.66335	.	0.000000	0.30085	U	0.010441	T	0.70996	0.3288	M	0.83953	2.67	0.43300	D	0.995297	D;D;D;D;D	0.89917	0.968;0.968;0.983;0.968;1.0	D;D;P;P;D	0.81914	0.925;0.925;0.847;0.903;0.995	T	0.73049	-0.4105	10	0.41790	T	0.15	.	17.1332	0.86732	0.0:1.0:0.0:0.0	.	704;694;694;677;677	B4DRN4;F5H6V3;F8WD03;Q4G0P3-5;F8WD23	.;.;.;.;.	L	677;677;677;677;677;704;694;694;692	ENSP00000377197:V677L;ENSP00000398544:V677L;ENSP00000394826:V677L;ENSP00000314736:V677L;ENSP00000444970:V704L;ENSP00000437341:V694L;ENSP00000288168:V694L;ENSP00000377181:V692L	ENSP00000288168:V694L	V	-	1	0	HYDIN	69658740	0.997000	0.39634	0.964000	0.40570	0.978000	0.69477	3.660000	0.54496	2.332000	0.79248	0.603000	0.83216	GTG	HYDIN	-	NULL	ENSG00000157423		0.522	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	91	0	C			71101239	-1	tier1	-	no_errors	ENST00000448089	ensembl	human	known	74_37	missense	8.26	109	10	SNP	0.998	A
HYKK	123688	genome.wustl.edu	37	15	78805449	78805449	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:78805449C>T	ENST00000569878.1	+	1	19	c.19C>T	c.(19-21)Cag>Tag	p.Q7*	HYKK_ENST00000566332.1_Nonsense_Mutation_p.Q7*|HYKK_ENST00000360519.3_Nonsense_Mutation_p.Q7*|HYKK_ENST00000408962.2_Nonsense_Mutation_p.Q7*|HYKK_ENST00000563233.1_Nonsense_Mutation_p.Q7*|HYKK_ENST00000388988.4_Nonsense_Mutation_p.Q7*			A2RU49	HYKK_HUMAN	hydroxylysine kinase	7						cytoplasm (GO:0005737)	hydroxylysine kinase activity (GO:0047992)										TGGAAACTATCAGCAGTCAGA	0.423																																																	0													58.0	58.0	58.0					15																	78805449		2020	4183	6203	SO:0001587	stop_gained	0			BC132753, BC144383, BM045979	CCDS42063.1, CCDS45318.1	15q25.1	2013-06-11	2013-06-11	2013-06-11	ENSG00000188266	ENSG00000188266	2.7.1.81		34403	protein-coding gene	gene with protein product	"""5-hydroxylysine kinase"""	614681	"""aminoglycoside phosphotransferase domain containing 1"""	AGPHD1		18780872, 22241472	Standard	NM_001013619		Approved	LOC123688	uc010unc.2	A2RU49		ENST00000569878.1:c.19C>T	15.37:g.78805449C>T	ENSP00000455459:p.Gln7*		B7ZMA5|F8W6X5|Q6ZTN0	Nonsense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.Q7*	ENST00000569878.1	37	c.19	CCDS42063.1	15	.	.	.	.	.	.	.	.	.	.	C	23.7	4.441770	0.83993	.	.	ENSG00000188266	ENST00000408962;ENST00000388988;ENST00000360519	.	.	.	5.73	2.74	0.32292	.	1.013360	0.07891	N	0.971151	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-5.3976	6.3318	0.21274	0.1286:0.6619:0.0:0.2095	.	.	.	.	X	7	.	ENSP00000353710:Q7X	Q	+	1	0	AGPHD1	76592504	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.198000	0.09505	0.311000	0.23014	0.655000	0.94253	CAG	HYKK	-	NULL	ENSG00000188266		0.423	HYKK-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HYKK	HGNC	protein_coding	OTTHUMT00000435834.1		0.00	40	0	C	NM_001013619		78805449	+1			no_errors	ENST00000388988	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	0.000	T
IBTK	25998	genome.wustl.edu	37	6	82924380	82924380	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:82924380G>C	ENST00000306270.7	-	12	2317	c.1768C>G	c.(1768-1770)Cag>Gag	p.Q590E	IBTK_ENST00000503631.1_Intron|IBTK_ENST00000510291.1_Missense_Mutation_p.Q590E	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	590	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		AACAATTTCTGAAAAAAATCA	0.363																																																	0													48.0	49.0	49.0					6																	82924380		2203	4300	6503	SO:0001583	missense	0			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.1768C>G	6.37:g.82924380G>C	ENSP00000305721:p.Gln590Glu		Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_RCC1/BLIP-II,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.Q590E	ENST00000306270.7	37	c.1768	CCDS34490.1	6	.	.	.	.	.	.	.	.	.	.	G	11.80	1.747364	0.30955	.	.	ENSG00000005700	ENST00000306270;ENST00000510291	T;T	0.66460	-0.21;-0.21	5.71	4.77	0.60923	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.158814	0.53938	D	0.000058	T	0.20981	0.0505	N	0.12471	0.22	0.26256	N	0.978657	B;B;B	0.27286	0.061;0.174;0.061	B;B;B	0.26416	0.058;0.069;0.058	T	0.14559	-1.0468	10	0.02654	T	1	-8.2742	10.1204	0.42616	0.0:0.1092:0.6911:0.1998	.	590;590;590	E7EPI0;Q9P2D0-2;Q9P2D0	.;.;IBTK_HUMAN	E	590	ENSP00000305721:Q590E;ENSP00000426405:Q590E	ENSP00000305721:Q590E	Q	-	1	0	IBTK	82981099	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.607000	0.46300	2.699000	0.92147	0.655000	0.94253	CAG	IBTK	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000005700		0.363	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBTK	HGNC	protein_coding	OTTHUMT00000041337.2		0.00	37	0	G	NM_015525		82924380	-1			no_errors	ENST00000306270	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	C
IFT52	51098	genome.wustl.edu	37	20	42242550	42242550	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:42242550G>C	ENST00000373030.3	+	7	676	c.546G>C	c.(544-546)gcG>gcC	p.A182A	IFT52_ENST00000373039.4_Silent_p.A182A	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	182					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)	p.A182A(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CAGCAGTGGCGGTTCTGTCTA	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											97.0	92.0	94.0					20																	42242550		2203	4300	6503	SO:0001819	synonymous_variant	0			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.546G>C	20.37:g.42242550G>C			B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Silent	SNP	pfam_ABC_transp_unknown	p.A182	ENST00000373030.3	37	c.546	CCDS33470.1	20																																																																																			IFT52	-	NULL	ENSG00000101052		0.393	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	HGNC	protein_coding	OTTHUMT00000079317.1	-	0.00	124	0	G	NM_016004		42242550	+1	tier1	-	no_errors	ENST00000373030	ensembl	human	known	74_37	silent	5.88	160	10	SNP	0.998	C
IFT81	28981	genome.wustl.edu	37	12	110628806	110628806	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:110628806G>A	ENST00000242591.5	+	13	1926	c.1420G>A	c.(1420-1422)Gaa>Aaa	p.E474K	IFT81_ENST00000552912.1_Missense_Mutation_p.E474K	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	474					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						ACTGAAGAGTGAAGTTGATGA	0.333																																																	0													122.0	117.0	119.0					12																	110628806		1863	4107	5970	SO:0001583	missense	0			AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.1420G>A	12.37:g.110628806G>A	ENSP00000242591:p.Glu474Lys		Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Missense_Mutation	SNP	NULL	p.E474K	ENST00000242591.5	37	c.1420	CCDS41831.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.336489	0.95758	.	.	ENSG00000122970	ENST00000552912;ENST00000242591	T;T	0.15834	2.39;2.39	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	M	0.70595	2.14	0.80722	D	1	D	0.63046	0.992	D	0.63283	0.913	T	0.09618	-1.0666	10	0.37606	T	0.19	-20.9981	18.8013	0.92018	0.0:0.0:1.0:0.0	.	474	Q8WYA0	IFT81_HUMAN	K	474	ENSP00000449718:E474K;ENSP00000242591:E474K	ENSP00000242591:E474K	E	+	1	0	IFT81	109113189	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	9.273000	0.95719	2.509000	0.84616	0.655000	0.94253	GAA	IFT81	-	NULL	ENSG00000122970		0.333	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IFT81	HGNC	protein_coding	OTTHUMT00000403529.1	-	0.00	67	0	G	NM_014055		110628806	+1	tier1	-	no_errors	ENST00000242591	ensembl	human	known	74_37	missense	9.35	97	10	SNP	1.000	A
IL10	3586	genome.wustl.edu	37	1	206945647	206945647	+	Missense_Mutation	SNP	C	C	A	rs550164520		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:206945647C>A	ENST00000423557.1	-	1	192	c.134G>T	c.(133-135)cGa>cTa	p.R45L	IL10_ENST00000471071.1_5'Flank	NM_000572.2	NP_000563.1	P22301	IL10_HUMAN	interleukin 10	45					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|defense response to bacterium (GO:0042742)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|leukocyte chemotaxis (GO:0030595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of chronic inflammatory response to antigenic stimulus (GO:0002875)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interferon-alpha biosynthetic process (GO:0045355)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of myeloid dendritic cell activation (GO:0030886)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor biosynthetic process (GO:0032800)|regulation of gene expression (GO:0010468)|regulation of isotype switching (GO:0045191)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to carbon monoxide (GO:0034465)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to inactivity (GO:0014854)|response to insulin (GO:0032868)|response to molecule of bacterial origin (GO:0002237)|type 2 immune response (GO:0042092)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-10 receptor binding (GO:0005141)			endometrium(1)|large_intestine(6)|lung(4)|prostate(1)	12	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GAAGGCATCTCGGAGATCTCG	0.547																																																	0													122.0	100.0	107.0					1																	206945647		2203	4300	6503	SO:0001583	missense	0			M57627	CCDS1467.1	1q31-q32	2011-07-14			ENSG00000136634	ENSG00000136634		"""Interleukins and interleukin receptors"""	5962	protein-coding gene	gene with protein product	"""cytokine synthesis inhibitory factor"", ""T-cell growth inhibitory factor"""	124092				9162098	Standard	NM_000572		Approved	CSIF, TGIF, IL10A, IL-10	uc001hen.1	P22301	OTTHUMG00000036386	ENST00000423557.1:c.134G>T	1.37:g.206945647C>A	ENSP00000412237:p.Arg45Leu			Missense_Mutation	SNP	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,smart_IL-10/19/20/24/26_fam,prints_IL-10	p.R45L	ENST00000423557.1	37	c.134	CCDS1467.1	1	.	.	.	.	.	.	.	.	.	.	C	19.34	3.809518	0.70797	.	.	ENSG00000136634	ENST00000423557	T	0.71934	-0.61	5.86	5.86	0.93980	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.000000	0.85682	D	0.000000	D	0.87330	0.6150	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89449	0.3729	10	0.87932	D	0	-13.9647	15.6773	0.77338	0.0:1.0:0.0:0.0	.	45	P22301	IL10_HUMAN	L	45	ENSP00000412237:R45L	ENSP00000412237:R45L	R	-	2	0	IL10	205012270	0.992000	0.36948	0.953000	0.39169	0.445000	0.32107	4.110000	0.57831	2.778000	0.95560	0.655000	0.94253	CGA	IL10	-	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,smart_IL-10/19/20/24/26_fam,prints_IL-10	ENSG00000136634		0.547	IL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10	HGNC	protein_coding	OTTHUMT00000088564.3	-	0.00	51	0	C	NM_000572		206945647	-1	tier1	-	no_errors	ENST00000423557	ensembl	human	known	74_37	missense	13.43	58	9	SNP	0.980	A
INPP4B	8821	genome.wustl.edu	37	4	143003189	143003189	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:143003189C>A	ENST00000513000.1	-	26	3070	c.2637G>T	c.(2635-2637)atG>atT	p.M879I	INPP4B_ENST00000509777.1_Missense_Mutation_p.M879I|INPP4B_ENST00000308502.4_Missense_Mutation_p.M879I|INPP4B_ENST00000262992.4_Missense_Mutation_p.M879I|INPP4B_ENST00000508116.1_Missense_Mutation_p.M879I	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	879					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.M879I(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					GATACCTTCTCATGCAATCCA	0.343																																																	1	Substitution - Missense(1)	lung(1)											92.0	83.0	86.0					4																	143003189		2203	4300	6503	SO:0001583	missense	0			U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2637G>T	4.37:g.143003189C>A	ENSP00000425487:p.Met879Ile		Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	superfamily_C2_dom	p.M879I	ENST00000513000.1	37	c.2637	CCDS3757.1	4	.	.	.	.	.	.	.	.	.	.	C	31	5.082299	0.94050	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000508116;ENST00000509777	T;T;T;T;T	0.40756	1.44;1.44;1.44;1.44;1.02	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.69314	0.3097	M	0.79693	2.465	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.69397	-0.5156	10	0.59425	D	0.04	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	879	O15327	INP4B_HUMAN	I	879	ENSP00000425487:M879I;ENSP00000262992:M879I;ENSP00000308441:M879I;ENSP00000423954:M879I;ENSP00000422793:M879I	ENSP00000262992:M879I	M	-	3	0	INPP4B	143222639	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.487000	0.81328	2.880000	0.98712	0.650000	0.86243	ATG	INPP4B	-	NULL	ENSG00000109452		0.343	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP4B	HGNC	protein_coding	OTTHUMT00000364587.1		0.00	35	0	C	NM_003866		143003189	-1			no_errors	ENST00000509777	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
INSRR	3645	genome.wustl.edu	37	1	156815775	156815775	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:156815775G>C	ENST00000368195.3	-	9	2343	c.1947C>G	c.(1945-1947)ggC>ggG	p.G649G	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	649	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGTAGAGGTCGCCGTCCTCTG	0.701																																																	0													55.0	47.0	49.0					1																	156815775		2203	4300	6503	SO:0001819	synonymous_variant	0			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.1947C>G	1.37:g.156815775G>C			O60724|Q5VZS3	Silent	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.G649	ENST00000368195.3	37	c.1947	CCDS1160.1	1																																																																																			INSRR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000027644		0.701	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	-	0.00	60	0	G	NM_014215		156815775	-1	tier1	-	no_errors	ENST00000368195	ensembl	human	known	74_37	silent	13.10	73	11	SNP	0.985	C
IQCJ-SCHIP1	100505385	genome.wustl.edu	37	3	159606731	159606731	+	Splice_Site	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:159606731A>G	ENST00000460298.1	+	6	1438	c.1197A>G	c.(1195-1197)gaA>gaG	p.E399E	SCHIP1_ENST00000482804.1_Splice_Site_p.E212E|IQCJ-SCHIP1_ENST00000527095.1_Splice_Site_p.E207E|IQCJ-SCHIP1_ENST00000412423.2_Splice_Site_p.E426E|IQCJ-SCHIP1_ENST00000476809.1_Splice_Site_p.E488E|IQCJ-SCHIP1_ENST00000485419.1_Splice_Site_p.E515E|SCHIP1_ENST00000445224.2_Splice_Site_p.E196E|IQCJ-SCHIP1_ENST00000337808.6_Splice_Site_p.E439E					IQCJ-SCHIP1 readthrough											central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(7)	12						CCCAGATAGAAAGTAAGTGTA	0.368																																																	0													102.0	94.0	97.0					3																	159606731		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS56289.1, CCDS56291.1	3q25.33	2011-03-24			ENSG00000250588	ENSG00000250588			38842	other	readthrough							Standard	NM_001197113		Approved		uc003fcq.2		OTTHUMG00000162426	ENST00000460298.1:c.1198+1A>G	3.37:g.159606731A>G				Silent	SNP	pfam_SCHIP_1	p.E515	ENST00000460298.1	37	c.1545		3																																																																																			IQCJ-SCHIP1	-	pfam_SCHIP_1	ENSG00000250588		0.368	IQCJ-SCHIP1-011	PUTATIVE	basic|exp_conf	protein_coding	IQCJ-SCHIP1	HGNC	protein_coding	OTTHUMT00000352558.2	-	0.00	82	0	A	NM_001197113	Silent	159606731	+1	tier1	-	no_errors	ENST00000485419	ensembl	human	known	74_37	silent	5.48	69	4	SNP	1.000	G
ITGA10	8515	genome.wustl.edu	37	1	145533913	145533913	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:145533913G>T	ENST00000369304.3	+	13	1734	c.1559G>T	c.(1558-1560)gGa>gTa	p.G520V	ITGA10_ENST00000539363.1_Missense_Mutation_p.G377V|ITGA10_ENST00000538811.1_Missense_Mutation_p.G389V	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	520					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAGGAAACAGGACGTGTTTAT	0.557																																																	0													94.0	86.0	89.0					1																	145533913		2203	4300	6503	SO:0001583	missense	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1559G>T	1.37:g.145533913G>T	ENSP00000358310:p.Gly520Val		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.G520V	ENST00000369304.3	37	c.1559	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810164	0.70797	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.56275	0.47;0.47;0.47	5.27	4.34	0.51931	.	0.149633	0.43579	D	0.000548	T	0.76321	0.3971	H	0.97158	3.95	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.998	D;D;D;D	0.91635	0.967;0.994;0.999;0.927	D	0.84447	0.0586	10	0.87932	D	0	.	12.8633	0.57926	0.0:0.0:0.8355:0.1645	.	486;389;377;520	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	V	520;486;377;389	ENSP00000358310:G520V;ENSP00000439894:G377V;ENSP00000440011:G389V	ENSP00000358310:G520V	G	+	2	0	ITGA10	144245270	1.000000	0.71417	0.991000	0.47740	0.999000	0.98932	9.577000	0.98196	1.193000	0.43086	0.655000	0.94253	GGA	ITGA10	-	smart_Int_alpha_beta-p	ENSG00000143127		0.557	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	-	0.00	84	0	G	NM_003637		145533913	+1	tier1	-	no_errors	ENST00000369304	ensembl	human	known	74_37	missense	9.89	82	9	SNP	0.999	T
ITGA2B	3674	genome.wustl.edu	37	17	42461461	42461461	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:42461461C>T	ENST00000262407.5	-	10	968	c.937G>A	c.(937-939)Gga>Aga	p.G313R	ITGA2B_ENST00000377068.3_5'UTR|ITGA2B_ENST00000353281.4_Missense_Mutation_p.G313R	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	313			G -> A (in dbSNP:rs1126554). {ECO:0000269|PubMed:2345548, ECO:0000269|PubMed:2439501}.		axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	ACCTGCTCTCCGCGCAGCCGA	0.572																																																	0													32.0	31.0	31.0					17																	42461461		2203	4300	6503	SO:0001583	missense	0				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.937G>A	17.37:g.42461461C>T	ENSP00000262407:p.Gly313Arg		B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G313R	ENST00000262407.5	37	c.937	CCDS32665.1	17	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449417	0.63178	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.74842	-0.88;-0.88	5.13	5.13	0.70059	.	1.473130	0.05124	N	0.491297	D	0.90707	0.7084	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	T	0.83310	-0.0023	10	0.87932	D	0	.	14.0692	0.64851	0.0:1.0:0.0:0.0	.	313	P08514	ITA2B_HUMAN	R	313	ENSP00000262407:G313R;ENSP00000340536:G313R	ENSP00000262407:G313R	G	-	1	0	ITGA2B	39816987	0.876000	0.30132	0.937000	0.37676	0.170000	0.22686	2.930000	0.48924	2.375000	0.81037	0.561000	0.74099	GGA	ITGA2B	-	prints_Integrin_alpha	ENSG00000005961		0.572	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2B	HGNC	protein_coding	OTTHUMT00000439823.1	-	0.00	63	0	C			42461461	-1	tier1	-	no_errors	ENST00000262407	ensembl	human	known	74_37	missense	10.39	68	8	SNP	0.992	T
ITGA3	3675	genome.wustl.edu	37	17	48151811	48151811	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:48151811G>T	ENST00000320031.8	+	10	1712		c.e10-1		ITGA3_ENST00000544892.1_Splice_Site|ITGA3_ENST00000007722.7_Splice_Site	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)						blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TGTCTCTGCAGGGCCCGGCCC	0.602																																																	0													72.0	62.0	65.0					17																	48151811		2203	4300	6503	SO:0001630	splice_region_variant	0			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.1383-1G>T	17.37:g.48151811G>T			A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Splice_Site	SNP	-	e10-1	ENST00000320031.8	37	c.1383-1	CCDS11558.1	17	.	.	.	.	.	.	.	.	.	.	G	17.55	3.416385	0.62511	.	.	ENSG00000005884	ENST00000544892;ENST00000007722;ENST00000538917;ENST00000320031	.	.	.	5.6	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5377	0.56150	0.0:0.0:0.8335:0.1665	.	.	.	.	.	-1	.	.	.	+	.	.	ITGA3	45506810	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.093000	0.57714	2.637000	0.89404	0.563000	0.77884	.	ITGA3	-	-	ENSG00000005884		0.602	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA3	HGNC	protein_coding	OTTHUMT00000366298.1	-	0.00	32	0	G	NM_005501	Intron	48151811	+1	tier1	-	no_errors	ENST00000320031	ensembl	human	known	74_37	splice_site	24.14	22	7	SNP	1.000	T
ITGB4	3691	genome.wustl.edu	37	17	73747158	73747158	+	Silent	SNP	C	C	T	rs376494263		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:73747158C>T	ENST00000200181.3	+	30	3946	c.3759C>T	c.(3757-3759)taC>taT	p.Y1253Y	ITGB4_ENST00000450894.3_Silent_p.Y1253Y|ITGB4_ENST00000339591.3_Silent_p.Y1253Y|ITGB4_ENST00000449880.2_Silent_p.Y1253Y|ITGB4_ENST00000579662.1_Silent_p.Y1253Y	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1253	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCACAGCCTACGAGGTCTGCT	0.597																																																	0								C	,,	0,4406		0,0,2203	91.0	82.0	85.0		3759,3759,3759	-9.7	0.5	17		85	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ITGB4	NM_000213.3,NM_001005619.1,NM_001005731.1	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	1253/1823,1253/1806,1253/1753	73747158	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.3759C>T	17.37:g.73747158C>T			A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Silent	SNP	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,prints_Integrin_bsu,pfscan_Fibronectin_type3	p.Y1253	ENST00000200181.3	37	c.3759	CCDS11727.1	17																																																																																			ITGB4	-	pirsf_Integrin_bsu-4,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000132470		0.597	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	-	0.00	38	0	C			73747158	+1	tier1	-	no_errors	ENST00000200181	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.109	T
ITPR2	3709	genome.wustl.edu	37	12	26572079	26572079	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:26572079C>G	ENST00000381340.3	-	50	7429	c.7013G>C	c.(7012-7014)cGa>cCa	p.R2338P	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2338					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GATGACTGCTCGGTACCCACG	0.453																																																	0													96.0	99.0	98.0					12																	26572079		2003	4177	6180	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7013G>C	12.37:g.26572079C>G	ENSP00000370744:p.Arg2338Pro		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.R2338P	ENST00000381340.3	37	c.7013	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	C	16.11	3.031195	0.54790	.	.	ENSG00000123104	ENST00000381340	D	0.98617	-5.03	5.22	5.22	0.72569	Ion transport (1);	0.208958	0.39909	N	0.001223	D	0.97990	0.9338	N	0.24115	0.695	0.80722	D	1	P	0.46987	0.888	P	0.60609	0.877	D	0.97842	1.0269	10	0.33141	T	0.24	.	18.9781	0.92746	0.0:1.0:0.0:0.0	.	2338	Q14571	ITPR2_HUMAN	P	2338	ENSP00000370744:R2338P	ENSP00000370744:R2338P	R	-	2	0	ITPR2	26463346	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	4.453000	0.60061	2.716000	0.92895	0.655000	0.94253	CGA	ITPR2	-	pfam_Ion_trans_dom	ENSG00000123104		0.453	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	-	0.00	55	0	C	NM_002223		26572079	-1	tier1	-	no_errors	ENST00000381340	ensembl	human	known	74_37	missense	7.35	63	5	SNP	1.000	G
JAKMIP2	9832	genome.wustl.edu	37	5	147040585	147040585	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:147040585G>T	ENST00000265272.5	-	3	1020	c.553C>A	c.(553-555)Cgg>Agg	p.R185R	JAKMIP2_ENST00000507386.1_Silent_p.R185R|JAKMIP2_ENST00000333010.6_Silent_p.R143R	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	185						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCACTCCGAAGGTCCCCA	0.522																																																	0													163.0	154.0	157.0					5																	147040585		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.553C>A	5.37:g.147040585G>T			A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Silent	SNP	NULL	p.R185	ENST00000265272.5	37	c.553	CCDS4285.1	5																																																																																			JAKMIP2	-	NULL	ENSG00000176049		0.522	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1	-	0.00	44	0	G	NM_014790		147040585	-1	tier1	-	no_errors	ENST00000265272	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.687	T
KANSL1	284058	genome.wustl.edu	37	17	44144914	44144914	+	Splice_Site	SNP	C	C	A	rs281865470		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:44144914C>A	ENST00000262419.6	-	5	2123		c.e5+1		KANSL1_ENST00000575318.1_Splice_Site|KANSL1_ENST00000432791.1_Splice_Site|KANSL1_ENST00000393476.3_Splice_Site|KANSL1_ENST00000572904.1_Splice_Site|KANSL1_ENST00000574590.1_Splice_Site	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1						chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.?(1)									CTAAAACTTACGTGTTAATAA	0.413																																																	1	Unknown(1)	endometrium(1)											116.0	103.0	107.0					17																	44144914		2203	4300	6503	SO:0001630	splice_region_variant	0			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.1652+1G>T	17.37:g.44144914C>A			A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Splice_Site	SNP	-	e4+1	ENST00000262419.6	37	c.1652+1	CCDS11503.1	17	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521123	0.64747	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5344	0.75990	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA1267	41500736	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	5.286000	0.65639	2.432000	0.82394	0.655000	0.94253	.	KANSL1	-	-	ENSG00000120071		0.413	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KANSL1	HGNC	protein_coding	OTTHUMT00000440274.1	-	0.00	49	0	C	NM_015443	Intron	44144914	-1	tier1	-	no_errors	ENST00000262419	ensembl	human	known	74_37	splice_site	16.09	73	14	SNP	1.000	A
KATNBL1	79768	genome.wustl.edu	37	15	34439631	34439631	+	Splice_Site	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:34439631C>A	ENST00000256544.3	-	6	700	c.558G>T	c.(556-558)agG>agT	p.R186S		NM_024713.2	NP_078989.1	Q9H079	KTBL1_HUMAN	katanin p80 subunit B-like 1	186						nucleolus (GO:0005730)											GATCTTCTATCCTGAGAGTAT	0.318																																																	0													48.0	46.0	47.0					15																	34439631		2201	4298	6499	SO:0001630	splice_region_variant	0			AL136908	CCDS10034.1	15q13.2	2012-09-27	2012-09-27	2012-09-27	ENSG00000134152	ENSG00000134152			26199	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 29"""	C15orf29		11230166	Standard	NM_024713		Approved	FLJ22557	uc001zhp.3	Q9H079	OTTHUMG00000129368	ENST00000256544.3:c.558-1G>T	15.37:g.34439631C>A			A8KAF6|Q2TAC0|Q9H670	Missense_Mutation	SNP	NULL	p.R186S	ENST00000256544.3	37	c.558	CCDS10034.1	15	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822758	0.71028	.	.	ENSG00000134152	ENST00000256544;ENST00000540594	.	.	.	5.68	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.77671	0.4165	M	0.71581	2.175	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.80044	-0.1547	9	0.59425	D	0.04	.	14.7582	0.69583	0.0:0.9306:0.0:0.0694	.	186	Q9H079	CO029_HUMAN	S	186;90	.	ENSP00000256544:R186S	R	-	3	2	C15orf29	32226923	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	2.898000	0.48672	1.550000	0.49438	0.591000	0.81541	AGG	KATNBL1	-	NULL	ENSG00000134152		0.318	KATNBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KATNBL1	HGNC	protein_coding	OTTHUMT00000251520.1	-	0.00	44	0	C	NM_024713	Missense_Mutation	34439631	-1	tier1	-	no_errors	ENST00000256544	ensembl	human	known	74_37	missense	7.14	65	5	SNP	1.000	A
KBTBD6	89890	genome.wustl.edu	37	13	41706476	41706476	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:41706476C>T	ENST00000379485.1	-	1	406	c.172G>A	c.(172-174)Gat>Aat	p.D58N	KBTBD6_ENST00000499385.2_Intron	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	58										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		AGCCGCGCATCGTAGAAGGAC	0.607																																																	0													102.0	102.0	102.0					13																	41706476		2203	4300	6503	SO:0001583	missense	0			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.172G>A	13.37:g.41706476C>T	ENSP00000368799:p.Asp58Asn		Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.D58N	ENST00000379485.1	37	c.172	CCDS9376.1	13	.	.	.	.	.	.	.	.	.	.	c	17.33	3.363198	0.61513	.	.	ENSG00000165572	ENST00000379485	T	0.67171	-0.25	3.65	3.65	0.41850	BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.73009	0.3532	L	0.39467	1.215	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.73506	-0.3961	10	0.45353	T	0.12	.	13.2074	0.59805	0.0:1.0:0.0:0.0	.	58	Q86V97	KBTB6_HUMAN	N	58	ENSP00000368799:D58N	ENSP00000368799:D58N	D	-	1	0	KBTBD6	40604476	1.000000	0.71417	0.984000	0.44739	0.343000	0.28985	3.904000	0.56325	2.061000	0.61500	0.313000	0.20887	GAT	KBTBD6	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold	ENSG00000165572		0.607	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD6	HGNC	protein_coding	OTTHUMT00000044657.1	-	0.00	60	0	C	NM_152903		41706476	-1	tier1	-	no_errors	ENST00000379485	ensembl	human	known	74_37	missense	12.12	87	12	SNP	1.000	T
KDELR2	11014	genome.wustl.edu	37	7	6505755	6505755	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:6505755C>G	ENST00000258739.4	-	4	735	c.551G>C	c.(550-552)gGc>gCc	p.G184A	KDELR2_ENST00000490996.1_Intron|DAGLB_ENST00000436575.1_Intron|KDELR2_ENST00000463747.1_Intron	NM_006854.3	NP_006845.1	P33947	ERD22_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2	184					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	KDEL sequence binding (GO:0005046)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		CTGGACTACGCCGGCCACCAC	0.473																																																	0													95.0	95.0	95.0					7																	6505755		2203	4300	6503	SO:0001583	missense	0			X63745	CCDS5351.1, CCDS43550.1	7p	2008-05-02			ENSG00000136240	ENSG00000136240			6305	protein-coding gene	gene with protein product		609024				1316805, 1325562	Standard	NM_006854		Approved	ELP-1, ERD2.2	uc003sqe.4	P33947	OTTHUMG00000023103	ENST00000258739.4:c.551G>C	7.37:g.6505755C>G	ENSP00000258739:p.Gly184Ala		A4D2P4|Q6IPC5|Q96E30	Missense_Mutation	SNP	pfam_ER_ret_rcpt,prints_ER_ret_rcpt	p.G184A	ENST00000258739.4	37	c.551	CCDS5351.1	7	.	.	.	.	.	.	.	.	.	.	C	29.5	5.009389	0.93346	.	.	ENSG00000136240	ENST00000258739	T	0.79940	-1.32	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.92776	0.7703	H	0.95079	3.62	0.80722	D	1	D	0.71674	0.998	D	0.66602	0.945	D	0.94506	0.7714	10	0.72032	D	0.01	-4.4161	19.3519	0.94392	0.0:1.0:0.0:0.0	.	184	P33947	ERD22_HUMAN	A	184	ENSP00000258739:G184A	ENSP00000258739:G184A	G	-	2	0	KDELR2	6472280	1.000000	0.71417	0.923000	0.36655	0.997000	0.91878	7.686000	0.84128	2.578000	0.87016	0.460000	0.39030	GGC	KDELR2	-	prints_ER_ret_rcpt	ENSG00000136240		0.473	KDELR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR2	HGNC	protein_coding	OTTHUMT00000059424.2		0.00	86	0	C			6505755	-1			no_errors	ENST00000258739	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	G
KDM4C	23081	genome.wustl.edu	37	9	6793022	6793022	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:6793022C>T	ENST00000381309.3	+	2	599	c.34C>T	c.(34-36)Ccc>Tcc	p.P12S	KDM4C_ENST00000381306.3_Missense_Mutation_p.P12S|KDM4C_ENST00000442236.2_5'UTR|KDM4C_ENST00000401787.3_Missense_Mutation_p.P12S|KDM4C_ENST00000535193.1_Missense_Mutation_p.P34S|KDM4C_ENST00000543771.1_Missense_Mutation_p.P12S|KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000489243.1_3'UTR	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	12					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						TCCTCTGAACCCCAGCTGTAA	0.493																																																	0													153.0	161.0	158.0					9																	6793022		2203	4300	6503	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.34C>T	9.37:g.6793022C>T	ENSP00000370710:p.Pro12Ser		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.P12S	ENST00000381309.3	37	c.34	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936666	0.73442	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.18657	2.2;2.2;2.26;2.38;2.27	5.58	5.58	0.84498	.	0.058053	0.64402	D	0.000001	T	0.42063	0.1186	M	0.62088	1.915	0.80722	D	1	D;B;B;B;B;B	0.63046	0.992;0.217;0.0;0.186;0.03;0.091	P;B;B;B;B;B	0.60012	0.867;0.103;0.001;0.114;0.025;0.098	T	0.08806	-1.0704	10	0.45353	T	0.12	-0.7953	18.3414	0.90307	0.0:1.0:0.0:0.0	.	12;12;12;34;12;12	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	S	34;12;12;12;12	ENSP00000442382:P34S;ENSP00000445427:P12S;ENSP00000383990:P12S;ENSP00000370710:P12S;ENSP00000370707:P12S	ENSP00000370707:P12S	P	+	1	0	KDM4C	6783022	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.264000	0.65513	2.597000	0.87782	0.655000	0.94253	CCC	KDM4C	-	NULL	ENSG00000107077		0.493	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	-	0.00	86	0	C	NM_015061		6793022	+1	tier1	-	no_errors	ENST00000381309	ensembl	human	known	74_37	missense	5.43	87	5	SNP	1.000	T
KHDRBS2	202559	genome.wustl.edu	37	6	62390931	62390931	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:62390931C>A	ENST00000281156.4	-	9	1265	c.987G>T	c.(985-987)ttG>ttT	p.L329F	RP1-240B8.3_ENST00000511849.2_RNA	NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	329					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		GTGGTGCCTTCAAGCTAGAGC	0.468																																																	0													174.0	124.0	141.0					6																	62390931		2203	4300	6503	SO:0001583	missense	0			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.987G>T	6.37:g.62390931C>A	ENSP00000281156:p.Leu329Phe		A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.L329F	ENST00000281156.4	37	c.987	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	C	15.68	2.906370	0.52333	.	.	ENSG00000112232	ENST00000281156	T	0.46451	0.87	5.13	2.93	0.34026	.	0.072061	0.56097	D	0.000032	T	0.24314	0.0589	L	0.32530	0.975	0.47778	D	0.999513	D	0.69078	0.997	P	0.60789	0.879	T	0.14448	-1.0472	10	0.13108	T	0.6	.	4.3383	0.11097	0.0:0.5268:0.0:0.4732	.	329	Q5VWX1	KHDR2_HUMAN	F	329	ENSP00000281156:L329F	ENSP00000281156:L329F	L	-	3	2	KHDRBS2	62448890	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.353000	0.44089	1.292000	0.44672	0.650000	0.86243	TTG	KHDRBS2	-	NULL	ENSG00000112232		0.468	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2	-	0.00	53	0	C	NM_152688		62390931	-1	tier1	-	no_errors	ENST00000281156	ensembl	human	known	74_37	missense	6.49	72	5	SNP	1.000	A
KIAA1211L	343990	genome.wustl.edu	37	2	99454683	99454683	+	Silent	SNP	C	C	A	rs147976810	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:99454683C>A	ENST00000397899.2	-	3	469	c.138G>T	c.(136-138)ccG>ccT	p.P46P	RNU7-46P_ENST00000459066.1_RNA|KIAA1211L_ENST00000462314.1_5'UTR	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	46																	CTGTGGACGACGGCGATTCTT	0.408																																																	0													114.0	106.0	109.0					2																	99454683		1971	4151	6122	SO:0001819	synonymous_variant	0			BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.138G>T	2.37:g.99454683C>A				Silent	SNP	NULL	p.P46	ENST00000397899.2	37	c.138	CCDS42720.1	2																																																																																			KIAA1211L	-	NULL	ENSG00000196872		0.408	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211L	HGNC	protein_coding	OTTHUMT00000329933.1	-	0.00	83	0	C	NM_207362		99454683	-1	tier1	-	no_errors	ENST00000397899	ensembl	human	known	74_37	silent	15.65	97	18	SNP	0.000	A
KIAA1467	57613	genome.wustl.edu	37	12	13232915	13232915	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:13232915G>C	ENST00000197268.8	+	12	1955	c.1835G>C	c.(1834-1836)aGg>aCg	p.R612T		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	612						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		TTTCTCTCTAGGATAAAGTTT	0.483																																																	0													36.0	41.0	39.0					12																	13232915		2203	4300	6503	SO:0001583	missense	0			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.1835G>C	12.37:g.13232915G>C	ENSP00000197268:p.Arg612Thr		Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.R612T	ENST00000197268.8	37	c.1835	CCDS31750.1	12	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116411	0.77323	.	.	ENSG00000084444	ENST00000197268	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.77698	0.4169	M	0.64997	1.995	0.51012	D	0.999904	D	0.89917	1.0	D	0.91635	0.999	T	0.79584	-0.1743	9	0.87932	D	0	-13.4983	17.4437	0.87573	0.0:0.0:1.0:0.0	.	612	A2RU67	K1467_HUMAN	T	612	.	ENSP00000197268:R612T	R	+	2	0	KIAA1467	13124182	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	6.063000	0.71162	2.540000	0.85666	0.650000	0.86243	AGG	KIAA1467	-	NULL	ENSG00000084444		0.483	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1467	HGNC	protein_coding	OTTHUMT00000401007.1	-	0.00	82	0	G	NM_020853		13232915	+1	tier1	-	no_errors	ENST00000197268	ensembl	human	known	74_37	missense	6.60	99	7	SNP	1.000	C
KIF1B	23095	genome.wustl.edu	37	1	10292396	10292396	+	Missense_Mutation	SNP	G	G	T	rs371015089		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:10292396G>T	ENST00000377086.1	+	2	212	c.10G>T	c.(10-12)Gcc>Tcc	p.A4S	KIF1B_ENST00000377081.1_Missense_Mutation_p.A4S|KIF1B_ENST00000263934.6_Missense_Mutation_p.A4S|KIF1B_ENST00000377093.4_Missense_Mutation_p.A4S|KIF1B_ENST00000377083.1_Missense_Mutation_p.A4S			O60333	KIF1B_HUMAN	kinesin family member 1B	4					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AATGTCGGGAGCCTCAGTGAA	0.418																																																	0													67.0	64.0	65.0					1																	10292396		2203	4300	6503	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.10G>T	1.37:g.10292396G>T	ENSP00000366290:p.Ala4Ser		A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A4S	ENST00000377086.1	37	c.10		1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.023884	0.35701	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	T;T;T;T;T	0.72725	-0.48;-0.68;-0.61;-0.68;-0.62	5.42	5.42	0.78866	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	T	0.51890	0.1701	N	0.01640	-0.785	0.80722	D	1	P;P;P;B;B;P;B	0.40515	0.719;0.55;0.719;0.376;0.057;0.518;0.198	B;B;P;B;B;B;B	0.48304	0.241;0.241;0.573;0.223;0.074;0.226;0.085	T	0.56715	-0.7933	10	0.02654	T	1	.	19.5793	0.95459	0.0:0.0:1.0:0.0	.	4;4;4;4;4;4;4	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	S	4	ENSP00000263934:A4S;ENSP00000366297:A4S;ENSP00000366290:A4S;ENSP00000366287:A4S;ENSP00000366284:A4S	ENSP00000263934:A4S	A	+	1	0	KIF1B	10214983	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	8.882000	0.92420	2.709000	0.92574	0.591000	0.81541	GCC	KIF1B	-	superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000054523		0.418	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	-	0.00	35	0	G			10292396	+1	tier1	-	no_errors	ENST00000263934	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KIT	3815	genome.wustl.edu	37	4	55604640	55604640	+	Missense_Mutation	SNP	G	G	T	rs146374006		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:55604640G>T	ENST00000288135.5	+	21	2945	c.2848G>T	c.(2848-2850)Gtg>Ttg	p.V950L		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	950					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACAGAAGCCCGTGGTAGACCA	0.517		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													134.0	130.0	131.0					4																	55604640		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2848G>T	4.37:g.55604640G>T	ENSP00000288135:p.Val950Leu		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V950L	ENST00000288135.5	37	c.2848	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	G	5.281	0.237212	0.10023	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	T;T	0.76578	-1.03;-1.03	3.49	1.66	0.24008	.	1.166780	0.06477	N	0.732241	T	0.70002	0.3174	L	0.36672	1.1	0.09310	N	1	B;B	0.20887	0.034;0.049	B;B	0.24541	0.054;0.044	T	0.59359	-0.7469	10	0.62326	D	0.03	.	8.2872	0.31935	0.0:0.0:0.5728:0.4272	.	946;950	P10721-2;P10721	.;KIT_HUMAN	L	950;946	ENSP00000288135:V950L;ENSP00000390987:V946L	ENSP00000288135:V950L	V	+	1	0	KIT	55299397	0.021000	0.18746	0.001000	0.08648	0.029000	0.11900	1.067000	0.30616	0.450000	0.26774	0.561000	0.74099	GTG	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000157404		0.517	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	-	0.00	67	0	G			55604640	+1	tier1	-	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	10.00	81	9	SNP	0.001	T
KLHL2	11275	genome.wustl.edu	37	4	166149971	166149971	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:166149971G>T	ENST00000226725.6	+	3	424	c.165G>T	c.(163-165)ctG>ctT	p.L55L	KLHL2_ENST00000421009.2_5'UTR|KLHL2_ENST00000514860.1_Silent_p.L59L|KLHL2_ENST00000538127.1_Intron	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2	55					protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		AAAATTTGCTGTGCGATGTCA	0.373																																																	0													83.0	76.0	78.0					4																	166149971		2203	4300	6503	SO:0001819	synonymous_variant	0			AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.165G>T	4.37:g.166149971G>T			A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L55	ENST00000226725.6	37	c.165	CCDS34094.1	4																																																																																			KLHL2	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,pirsf_Kelch-like_gigaxonin	ENSG00000109466		0.373	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLHL2	HGNC	protein_coding	OTTHUMT00000364439.1	-	0.00	225	0	G			166149971	+1	tier1	-	no_errors	ENST00000226725	ensembl	human	known	74_37	silent	7.84	246	21	SNP	0.999	T
KMT2C	58508	genome.wustl.edu	37	7	151878492	151878492	+	Silent	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:151878492T>A	ENST00000262189.6	-	36	6671	c.6453A>T	c.(6451-6453)acA>acT	p.T2151T	KMT2C_ENST00000355193.2_Silent_p.T2151T	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2151	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGGACCTAGCTGTTCCTGAAG	0.512																																																	0													119.0	126.0	123.0					7																	151878492		2203	4300	6503	SO:0001819	synonymous_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.6453A>T	7.37:g.151878492T>A			Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.T2151	ENST00000262189.6	37	c.6453	CCDS5931.1	7																																																																																			KMT2C	-	NULL	ENSG00000055609		0.512	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3		0.00	35	0	T			151878492	-1			no_errors	ENST00000355193	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.517	A
KMT2D	8085	genome.wustl.edu	37	12	49443837	49443837	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:49443837C>A	ENST00000301067.7	-	11	3533	c.3534G>T	c.(3532-3534)caG>caT	p.Q1178H		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1178	Pro-rich.			Q -> R (in Ref. 1; AAC51734/AAC51735). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ATGGTGAGCCCTGCCCTGCTG	0.577																																																	0													68.0	74.0	72.0					12																	49443837		2017	4170	6187	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.3534G>T	12.37:g.49443837C>A	ENSP00000301067:p.Gln1178His		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q1178H	ENST00000301067.7	37	c.3534	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	10.01	1.234260	0.22626	.	.	ENSG00000167548	ENST00000301067	T	0.80909	-1.43	5.4	3.56	0.40772	.	0.000000	0.34828	N	0.003651	T	0.71384	0.3333	N	0.08118	0	0.26766	N	0.96989	D	0.61080	0.989	P	0.53809	0.735	T	0.65923	-0.6050	10	0.87932	D	0	.	9.5066	0.39051	0.0:0.7682:0.0:0.2318	.	1178	O14686	MLL2_HUMAN	H	1178	ENSP00000301067:Q1178H	ENSP00000301067:Q1178H	Q	-	3	2	MLL2	47730104	0.980000	0.34600	1.000000	0.80357	0.949000	0.60115	0.252000	0.18278	0.636000	0.30508	0.563000	0.77884	CAG	KMT2D	-	NULL	ENSG00000167548		0.577	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2		0.00	50	0	C			49443837	-1			no_errors	ENST00000301067	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
KPNA2	3838	genome.wustl.edu	37	17	66040117	66040117	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:66040117G>T	ENST00000537025.2	+	8	1714	c.1094G>T	c.(1093-1095)gGc>gTc	p.G365V	KPNA2_ENST00000330459.3_Missense_Mutation_p.G365V			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	365	NLS binding site (minor). {ECO:0000250}.		G -> S (in dbSNP:rs1059558).		cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATCACAGCCGGCCGCCAGGAC	0.473																																																	0													205.0	212.0	210.0					17																	66040117		2203	4296	6499	SO:0001583	missense	0			U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.1094G>T	17.37:g.66040117G>T	ENSP00000438483:p.Gly365Val		B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.G365V	ENST00000537025.2	37	c.1094	CCDS32713.1	17	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459309	0.84317	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	T;T	0.31769	1.48;1.48	5.51	5.51	0.81932	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.68165	0.2971	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77205	-0.2673	10	0.87932	D	0	.	19.4797	0.95005	0.0:0.0:1.0:0.0	.	365	P52292	IMA2_HUMAN	V	365	ENSP00000332455:G365V;ENSP00000438483:G365V	ENSP00000332455:G365V	G	+	2	0	KPNA2	63470579	1.000000	0.71417	0.986000	0.45419	0.601000	0.36947	9.646000	0.98474	2.591000	0.87537	0.552000	0.68991	GGC	KPNA2	-	superfamily_ARM-type_fold,pfscan_Armadillo	ENSG00000182481		0.473	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KPNA2	HGNC	protein_coding	OTTHUMT00000448111.1	-	0.00	112	0	G	NM_002266		66040117	+1	tier1	-	no_errors	ENST00000330459	ensembl	human	known	74_37	missense	14.84	131	23	SNP	1.000	T
KRBA1	84626	genome.wustl.edu	37	7	149425722	149425722	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:149425722G>C	ENST00000485033.2	+	11	1583	c.1583G>C	c.(1582-1584)gGa>gCa	p.G528A	KRBA1_ENST00000255992.10_Missense_Mutation_p.G528A|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Missense_Mutation_p.G528A			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	589										breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCAGACAGGGGACCGAGGAGA	0.622																																																	0													83.0	99.0	94.0					7																	149425722		2001	4171	6172	SO:0001583	missense	0			AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.1583G>C	7.37:g.149425722G>C	ENSP00000420112:p.Gly528Ala		A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	NULL	p.G528A	ENST00000485033.2	37	c.1583		7	.	.	.	.	.	.	.	.	.	.	G	5.029	0.190974	0.09547	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.33438	1.41;1.49;1.49	4.4	2.22	0.28083	.	0.194267	0.25744	N	0.028587	T	0.19446	0.0467	L	0.34521	1.04	0.09310	N	1	P;P	0.36144	0.539;0.539	B;B	0.32980	0.156;0.156	T	0.10800	-1.0614	10	0.46703	T	0.11	-8.5229	7.5457	0.27766	0.0:0.1663:0.6386:0.195	.	528;528	E7ENE9;A5PL33	.;KRBA1_HUMAN	A	528	ENSP00000255992:G528A;ENSP00000317165:G528A;ENSP00000420112:G528A	ENSP00000255992:G528A	G	+	2	0	KRBA1	149056655	0.004000	0.15560	0.013000	0.15412	0.053000	0.15095	-0.132000	0.10467	0.802000	0.34089	0.655000	0.94253	GGA	KRBA1	-	NULL	ENSG00000133619		0.622	KRBA1-004	PUTATIVE	basic	protein_coding	KRBA1	HGNC	protein_coding	OTTHUMT00000349841.3	-	0.00	50	0	G	NM_032534		149425722	+1	tier1	-	no_errors	ENST00000255992	ensembl	human	known	74_37	missense	7.81	59	5	SNP	0.001	C
KRT33B	3884	genome.wustl.edu	37	17	39521128	39521128	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:39521128G>C	ENST00000251646.3	-	6	1049	c.1000C>G	c.(1000-1002)Cgg>Ggg	p.R334G		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	334	Coil 2.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				TGGTTCTGCCGCTCCAGGTCA	0.637																																																	0													53.0	61.0	58.0					17																	39521128		2189	4296	6485	SO:0001583	missense	0			X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.1000C>G	17.37:g.39521128G>C	ENSP00000251646:p.Arg334Gly		O76010	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.R334G	ENST00000251646.3	37	c.1000	CCDS11389.1	17	.	.	.	.	.	.	.	.	.	.	g	19.31	3.802354	0.70682	.	.	ENSG00000131738	ENST00000251646	D	0.90133	-2.62	4.85	1.43	0.22495	Filament (1);	0.000000	0.64402	D	0.000017	D	0.94489	0.8226	M	0.90595	3.13	0.31060	N	0.71428	P	0.46987	0.888	P	0.60117	0.869	D	0.91978	0.5592	10	0.44086	T	0.13	.	10.4042	0.44248	0.0:0.117:0.5244:0.3586	.	334	Q14525	KT33B_HUMAN	G	334	ENSP00000251646:R334G	ENSP00000251646:R334G	R	-	1	2	KRT33B	36774654	0.418000	0.25440	1.000000	0.80357	0.997000	0.91878	0.000000	0.12993	0.700000	0.31782	0.650000	0.86243	CGG	KRT33B	-	pfam_IF	ENSG00000131738		0.637	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT33B	HGNC	protein_coding	OTTHUMT00000257292.1	-	0.00	104	0	G	NM_002279		39521128	-1	tier1	-	no_errors	ENST00000251646	ensembl	human	known	74_37	missense	19.86	117	29	SNP	1.000	C
KRT6C	286887	genome.wustl.edu	37	12	52867433	52867433	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:52867433C>G	ENST00000252250.6	-	1	136	c.89G>C	c.(88-90)cGc>cCc	p.R30P		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	30	Head.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		GAAGCCAGAGCGGCTGACCCC	0.652																																																	0													13.0	18.0	16.0					12																	52867433		2172	4244	6416	SO:0001583	missense	0			L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.89G>C	12.37:g.52867433C>G	ENSP00000252250:p.Arg30Pro		A1L4L5|P48666|Q2TAZ9|Q7RTN9	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.R30P	ENST00000252250.6	37	c.89	CCDS8829.1	12	.	.	.	.	.	.	.	.	.	.	c	13.48	2.249226	0.39797	.	.	ENSG00000170465	ENST00000252250;ENST00000411979	T	0.71103	-0.54	3.02	1.13	0.20643	.	0.198415	0.35970	N	0.002867	T	0.74390	0.3710	M	0.85373	2.75	0.39580	D	0.969413	D	0.53885	0.963	P	0.49047	0.599	T	0.74884	-0.3512	10	0.62326	D	0.03	.	7.5241	0.27645	0.1646:0.743:0.0:0.0924	.	30	P48668	K2C6C_HUMAN	P	30;15	ENSP00000252250:R30P	ENSP00000252250:R30P	R	-	2	0	KRT6C	51153700	0.995000	0.38212	0.945000	0.38365	0.752000	0.42762	1.866000	0.39489	0.287000	0.22375	0.514000	0.50259	CGC	KRT6C	-	NULL	ENSG00000170465		0.652	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6C	HGNC	protein_coding	OTTHUMT00000404976.1	-	0.00	128	0	C	NM_173086		52867433	-1	tier1	-	no_errors	ENST00000252250	ensembl	human	known	74_37	missense	6.67	139	10	SNP	0.999	G
KRT76	51350	genome.wustl.edu	37	12	53165004	53165004	+	Splice_Site	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:53165004C>A	ENST00000332411.2	-	7	1317		c.e7-1			NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76						cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGTTGGCATTCTGAGGTAGAA	0.517																																																	0													87.0	80.0	82.0					12																	53165004		2203	4300	6503	SO:0001630	splice_region_variant	0			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1264-1G>T	12.37:g.53165004C>A			B4DRR3|Q7Z795	Splice_Site	SNP	-	e7-1	ENST00000332411.2	37	c.1264-1	CCDS8838.1	12	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163672	0.38217	.	.	ENSG00000185069	ENST00000332411	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4674	0.94948	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT76	51451271	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	7.118000	0.77137	2.768000	0.95171	0.655000	0.94253	.	KRT76	-	-	ENSG00000185069		0.517	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT76	HGNC	protein_coding	OTTHUMT00000405928.1	-	0.00	59	0	C	NM_015848	Intron	53165004	-1	tier1	-	no_errors	ENST00000332411	ensembl	human	known	74_37	splice_site	10.53	68	8	SNP	1.000	A
LAIR1	3903	genome.wustl.edu	37	19	54872553	54872553	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:54872553G>T	ENST00000391742.2	-	3	486	c.334C>A	c.(334-336)Cag>Aag	p.Q112K	LAIR1_ENST00000474878.1_Missense_Mutation_p.Q111K|LAIR1_ENST00000348231.4_Missense_Mutation_p.Q112K|LAIR1_ENST00000391743.3_Missense_Mutation_p.Q94K|LAIR1_ENST00000463489.1_Intron|LAIR1_ENST00000434277.2_Missense_Mutation_p.Q111K|LAIR1_ENST00000313038.6_Missense_Mutation_p.Q105K			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	112	Ig-like C2-type.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		TAGTCACTCTGCTCAGACCAT	0.567																																																	0													126.0	120.0	122.0					19																	54872553		2203	4300	6503	SO:0001583	missense	0			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.334C>A	19.37:g.54872553G>T	ENSP00000375622:p.Gln112Lys			Missense_Mutation	SNP	smart_Ig_sub	p.Q112K	ENST00000391742.2	37	c.334	CCDS12891.1	19	.	.	.	.	.	.	.	.	.	.	.	6.017	0.371477	0.11409	.	.	ENSG00000167613	ENST00000391743;ENST00000391742;ENST00000434277;ENST00000348231;ENST00000313038;ENST00000474878;ENST00000444687	T;T;T;T;T;T;T	0.47177	2.62;2.62;2.62;2.62;2.62;2.62;0.85	3.01	1.95	0.26073	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.890590	0.02591	N	0.099999	T	0.28863	0.0716	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.14012	0.007;0.004;0.001;0.001;0.0;0.009	B;B;B;B;B;B	0.17979	0.002;0.012;0.0;0.001;0.0;0.02	T	0.19353	-1.0308	10	0.16420	T	0.52	.	7.4607	0.27294	0.0:0.0:0.7426:0.2574	.	112;94;111;111;112;112	Q6GTX8-4;A8MZ84;Q6GTX8-3;D3YTC8;Q6GTX8-2;Q6GTX8	.;.;.;.;.;LAIR1_HUMAN	K	94;112;111;112;105;111;2	ENSP00000375623:Q94K;ENSP00000375622:Q112K;ENSP00000391003:Q111K;ENSP00000301193:Q112K;ENSP00000319204:Q105K;ENSP00000418998:Q111K;ENSP00000392722:Q2K	ENSP00000319204:Q105K	Q	-	1	0	LAIR1	59564365	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.547000	0.23299	0.824000	0.34613	0.644000	0.83932	CAG	LAIR1	-	smart_Ig_sub	ENSG00000167613		0.567	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR1	HGNC	protein_coding	OTTHUMT00000140506.1	-	0.00	59	0	G			54872553	-1	tier1	-	no_errors	ENST00000391742	ensembl	human	known	74_37	missense	11.11	56	7	SNP	0.001	T
LAMB2	3913	genome.wustl.edu	37	3	49161855	49161855	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:49161855G>A	ENST00000418109.1	-	23	3464	c.3300C>T	c.(3298-3300)agC>agT	p.S1100S	LAMB2_ENST00000305544.4_Silent_p.S1100S|LAMB2_ENST00000464891.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1100	Laminin EGF-like 12. {ECO:0000255|PROSITE-ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTCTGGCCCGGCTTGGGTGGC	0.627																																																	0													36.0	38.0	38.0					3																	49161855		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.3300C>T	3.37:g.49161855G>A			Q16321	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.S1100	ENST00000418109.1	37	c.3300	CCDS2789.1	3																																																																																			LAMB2	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000172037		0.627	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	-	0.00	50	0	G	NM_002292		49161855	-1	tier1	-	no_errors	ENST00000305544	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.997	A
LAMB4	22798	genome.wustl.edu	37	7	107688467	107688467	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:107688467C>G	ENST00000388781.3	-	28	4295	c.4212G>C	c.(4210-4212)agG>agC	p.R1404S	LAMB4_ENST00000205386.4_Missense_Mutation_p.R1404S|LAMB4_ENST00000388780.3_Missense_Mutation_p.R1404S	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1404	Domain alpha.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AGCCGGGACCCCTACACTTCC	0.567																																																	0													69.0	74.0	73.0					7																	107688467		2203	4300	6503	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.4212G>C	7.37:g.107688467C>G	ENSP00000373433:p.Arg1404Ser		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R1404S	ENST00000388781.3	37	c.4212	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387253	0.25031	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.30981	1.51;1.51;1.91;1.53	3.01	-6.03	0.02185	.	0.665977	0.12943	N	0.426438	T	0.10937	0.0267	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.05099	-1.0906	10	0.62326	D	0.03	.	3.373	0.07228	0.5149:0.2828:0.0922:0.1101	.	1404;1404	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	S	1404;1404;430;1404	ENSP00000205386:R1404S;ENSP00000373433:R1404S;ENSP00000416562:R430S;ENSP00000373432:R1404S	ENSP00000205386:R1404S	R	-	3	2	LAMB4	107475703	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.660000	0.05317	-1.193000	0.02688	-0.518000	0.04402	AGG	LAMB4	-	NULL	ENSG00000091128		0.567	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	-	0.00	107	0	C	XM_209857		107688467	-1	tier1	-	no_errors	ENST00000205386	ensembl	human	known	74_37	missense	6.35	118	8	SNP	0.892	G
LARP7	51574	genome.wustl.edu	37	4	113568845	113568845	+	Splice_Site	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:113568845G>C	ENST00000344442.5	+	8	1275		c.e8-1		MIR302C_ENST00000362232.1_RNA|MIR367_ENST00000362299.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR302A_ENST00000385192.1_RNA|LARP7_ENST00000509061.1_Splice_Site|MIR302B_ENST00000505215.1_RNA|LARP7_ENST00000324052.6_Splice_Site|MIR302B_ENST00000362188.1_RNA|MIR302D_ENST00000362275.1_RNA|MIR302B_ENST00000509938.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7						RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		TTTATTTCAAGATATAGAAAT	0.299																																																	0													18.0	19.0	18.0					4																	113568845		2012	4202	6214	SO:0001630	splice_region_variant	0			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.998-1G>C	4.37:g.113568845G>C			B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Splice_Site	SNP	-	e7-1	ENST00000344442.5	37	c.998-1	CCDS3701.2	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.65|12.65	2.001342|2.001342	0.35320|0.35320	.|.	.|.	ENSG00000174720|ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000324052|ENST00000511529	.|.	.|.	.|.	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64011	.|0.2560	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.61237	.|-0.7103	.|4	.|.	.|.	.|.	.|.	11.5949|11.5949	0.50968|0.50968	0.0689:0.1261:0.8049:0.0|0.0689:0.1261:0.8049:0.0	.|.	.|.	.|.	.|.	.|N	-1|126	.|.	.|.	.|K	+|+	.|3	.|2	LARP7|LARP7	113788294|113788294	0.399000|0.399000	0.25287|0.25287	0.696000|0.696000	0.30242|0.30242	0.655000|0.655000	0.38815|0.38815	0.872000|0.872000	0.28037|0.28037	2.787000|2.787000	0.95880|0.95880	0.655000|0.655000	0.94253|0.94253	.|AAG	LARP7	-	-	ENSG00000174720		0.299	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP7	HGNC	protein_coding	OTTHUMT00000256417.2	-	0.00	75	0	G	NM_016648	Intron	113568845	+1	tier1	-	no_errors	ENST00000324052	ensembl	human	known	74_37	splice_site	15.38	110	20	SNP	0.550	C
LARS	51520	genome.wustl.edu	37	5	145543902	145543902	+	Missense_Mutation	SNP	T	T	C	rs199808937		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:145543902T>C	ENST00000394434.2	-	6	731	c.565A>G	c.(565-567)Att>Gtt	p.I189V	LARS_ENST00000274562.9_Missense_Mutation_p.I162V|LARS_ENST00000511505.1_5'UTR|LARS_ENST00000510191.1_Missense_Mutation_p.I135V|LARS_ENST00000545646.1_Missense_Mutation_p.I143V	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	189					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	AAATCCTGAATAGCCAGTGGC	0.363																																																	0													87.0	100.0	96.0					5																	145543902		2203	4300	6503	SO:0001583	missense	0			AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.565A>G	5.37:g.145543902T>C	ENSP00000377954:p.Ile189Val		A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Cys-tRNA/MSH_ligase,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Val/Leu/Ile-tRNA-synth_edit,tigrfam_Leu-tRNA-synth_Ia_arc/euk	p.I189V	ENST00000394434.2	37	c.565	CCDS34265.1	5	.	.	.	.	.	.	.	.	.	.	T	0.586	-0.835235	0.02713	.	.	ENSG00000133706	ENST00000394434;ENST00000545646;ENST00000510191;ENST00000274562	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.54	-2.94	0.05581	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.428702	0.25526	N	0.030062	T	0.12987	0.0315	N	0.10618	0.005	0.24357	N	0.99489	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.30327	-0.9982	10	0.10902	T	0.67	-5.071	7.7978	0.29158	0.0:0.4339:0.231:0.3351	.	162;143;189	B4DER1;F5H698;Q9P2J5	.;.;SYLC_HUMAN	V	189;143;135;162	ENSP00000377954:I189V;ENSP00000437791:I143V;ENSP00000426005:I135V;ENSP00000274562:I162V	ENSP00000274562:I162V	I	-	1	0	LARS	145524095	0.385000	0.25172	0.862000	0.33874	0.542000	0.35054	-0.316000	0.08071	-0.678000	0.05224	-1.319000	0.01295	ATT	LARS	-	pfam_aa-tRNA-synth_Ia,tigrfam_Leu-tRNA-synth_Ia_arc/euk	ENSG00000133706		0.363	LARS-001	KNOWN	basic|CCDS	protein_coding	LARS	HGNC	protein_coding	OTTHUMT00000373367.1	-	0.00	100	0	T	NM_020117		145543902	-1	tier1	rs199808937	no_errors	ENST00000394434	ensembl	human	known	74_37	missense	5.56	119	7	SNP	0.987	C
LAX1	54900	genome.wustl.edu	37	1	203743063	203743063	+	Missense_Mutation	SNP	G	G	C	rs151128475	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:203743063G>C	ENST00000442561.2	+	5	841	c.451G>C	c.(451-453)Gcg>Ccg	p.A151P	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Missense_Mutation_p.A135P	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	151					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CACAGAGTACGCGGTGGGTAT	0.552																																																	0													82.0	75.0	77.0					1																	203743063		2203	4300	6503	SO:0001583	missense	0			AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.451G>C	1.37:g.203743063G>C	ENSP00000406970:p.Ala151Pro		B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	NULL	p.A151P	ENST00000442561.2	37	c.451	CCDS1441.2	1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621693	0.28889	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.34	-4.57	0.03421	.	0.932856	0.08978	N	0.866221	T	0.29620	0.0739	L	0.53249	1.67	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.17979	0.02;0.02	T	0.37709	-0.9694	9	0.62326	D	0.03	-0.0641	0.2837	0.00248	0.2937:0.1856:0.2929:0.2279	.	135;151	B7Z744;Q8IWV1	.;LAX1_HUMAN	P	151;135	.	ENSP00000356186:A135P	A	+	1	0	LAX1	202009686	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.802000	0.04545	-1.408000	0.02040	-0.182000	0.12963	GCG	LAX1	-	NULL	ENSG00000122188		0.552	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAX1	HGNC	protein_coding	OTTHUMT00000087468.3	-	0.00	28	0	G	NM_017773		203743063	+1	tier1	-	no_errors	ENST00000442561	ensembl	human	known	74_37	missense	23.91	35	11	SNP	0.000	C
LCA5L	150082	genome.wustl.edu	37	21	40777894	40777894	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr21:40777894G>T	ENST00000358268.2	-	10	2455	c.1927C>A	c.(1927-1929)Cat>Aat	p.H643N	LCA5L_ENST00000495240.1_5'Flank|LCA5L_ENST00000380671.2_Missense_Mutation_p.H643N|WRB_ENST00000541890.1_Intron|LCA5L_ENST00000288350.3_Missense_Mutation_p.H643N			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	643										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				CCGAAAGCATGGCTGGTGGAG	0.423																																																	0													78.0	85.0	83.0					21																	40777894		2203	4300	6503	SO:0001583	missense	0			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1927C>A	21.37:g.40777894G>T	ENSP00000351008:p.His643Asn		D3DSI0|Q3ZCT0	Missense_Mutation	SNP	NULL	p.H643N	ENST00000358268.2	37	c.1927	CCDS13665.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.89|10.89	1.478810|1.478810	0.26511|0.26511	.|.	.|.	ENSG00000157578|ENSG00000182093	ENST00000288350;ENST00000380671;ENST00000358268|ENST00000415847	T;T;T|.	0.41065|.	1.01;1.01;1.01|.	4.98|4.98	2.38|2.38	0.29361|0.29361	.|.	0.246200|.	0.28371|.	N|.	0.015581|.	T|T	0.08088|0.08088	0.0202|0.0202	N|N	0.00182|0.00182	-1.905|-1.905	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.26883|0.26883	-1.0090|-1.0090	10|6	0.02654|0.87932	T|D	1|0	-21.5513|-21.5513	10.3979|10.3979	0.44211|0.44211	0.0:0.0:0.5063:0.4937|0.0:0.0:0.5063:0.4937	.|.	643|.	O95447|.	LCA5L_HUMAN|.	N|L	643|38	ENSP00000288350:H643N;ENSP00000370046:H643N;ENSP00000351008:H643N|.	ENSP00000288350:H643N|ENSP00000410228:W38L	H|W	-|+	1|2	0|0	LCA5L|WRB	39699764|39699764	0.997000|0.997000	0.39634|0.39634	0.930000|0.930000	0.37139|0.37139	0.803000|0.803000	0.45373|0.45373	0.895000|0.895000	0.28363|0.28363	0.314000|0.314000	0.23086|0.23086	-0.256000|-0.256000	0.11100|0.11100	CAT|TGG	LCA5L	-	NULL	ENSG00000157578		0.423	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	-	0.00	128	0	G	NM_152505		40777894	-1	tier1	-	no_errors	ENST00000288350	ensembl	human	known	74_37	missense	6.62	127	9	SNP	0.517	T
LCE2C	353140	genome.wustl.edu	37	1	152648660	152648660	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:152648660G>A	ENST00000368783.1	+	2	224	c.169G>A	c.(169-171)Ggt>Agt	p.G57S	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	57	Cys-rich.				keratinization (GO:0031424)					endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGCTGCTGTGGTCCCAGCTC	0.657																																																	0													86.0	96.0	93.0					1																	152648660		2203	4300	6503	SO:0001583	missense	0				CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.169G>A	1.37:g.152648660G>A	ENSP00000357772:p.Gly57Ser			Missense_Mutation	SNP	NULL	p.G57S	ENST00000368783.1	37	c.169	CCDS1019.1	1	.	.	.	.	.	.	.	.	.	.	G	2.181	-0.387485	0.04932	.	.	ENSG00000187180	ENST00000368783	T	0.03717	3.83	3.2	1.15	0.20763	.	.	.	.	.	T	0.01222	0.0040	L	0.39326	1.205	0.09310	N	1	B	0.21753	0.06	B	0.20767	0.031	T	0.45745	-0.9240	9	0.87932	D	0	.	6.0859	0.19966	0.2639:0.0:0.7361:0.0	.	57	Q5TA81	LCE2C_HUMAN	S	57	ENSP00000357772:G57S	ENSP00000357772:G57S	G	+	1	0	LCE2C	150915284	0.979000	0.34478	0.024000	0.17045	0.105000	0.19272	0.834000	0.27518	0.148000	0.19059	0.563000	0.77884	GGT	LCE2C	-	NULL	ENSG00000187180		0.657	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2C	HGNC	protein_coding	OTTHUMT00000034509.1	-	0.00	158	0	G	NM_178429		152648660	+1	tier1	-	no_errors	ENST00000368783	ensembl	human	known	74_37	missense	14.35	177	30	SNP	0.062	A
LDB3	11155	genome.wustl.edu	37	10	88466294	88466294	+	Silent	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:88466294T>A	ENST00000361373.4	+	7	924	c.903T>A	c.(901-903)ccT>ccA	p.P301P	LDB3_ENST00000352360.5_Intron|LDB3_ENST00000263066.6_Intron|LDB3_ENST00000429277.2_Intron|LDB3_ENST00000458213.2_Intron	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						TCAGCACCCCTATTGAGCATG	0.662																																																	0													97.0	110.0	106.0					10																	88466294		2203	4299	6502	SO:0001819	synonymous_variant	0			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.903T>A	10.37:g.88466294T>A				Silent	SNP	pfam_Znf_LIM,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_ZASP,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.P301	ENST00000361373.4	37	c.903	CCDS7377.1	10																																																																																			LDB3	-	NULL	ENSG00000122367		0.662	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LDB3	HGNC	protein_coding	OTTHUMT00000049160.2	-	0.00	98	0	T			88466294	+1	tier1	-	no_errors	ENST00000361373	ensembl	human	known	74_37	silent	5.13	148	8	SNP	0.989	A
LEMD2	221496	genome.wustl.edu	37	6	33752154	33752154	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:33752154G>T	ENST00000293760.5	-	3	847	c.828C>A	c.(826-828)ctC>ctA	p.L276L	LEMD2_ENST00000502643.1_5'Flank|LEMD2_ENST00000508327.1_5'UTR	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	276					negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)				central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						GGAAATTGTAGAGTTCATGCA	0.562																																																	0													121.0	109.0	113.0					6																	33752154		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.828C>A	6.37:g.33752154G>T			B4DVH5|E7EVT2|Q5T972|Q5T974	Silent	SNP	pfam_Inner-Nucl-membr_MAN1,pfam_LEM_dom,superfamily_LEM/LEM-like_dom,smart_LEM_dom,pfscan_LEM_dom	p.L276	ENST00000293760.5	37	c.828	CCDS4785.1	6																																																																																			LEMD2	-	pfam_Inner-Nucl-membr_MAN1	ENSG00000161904		0.562	LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEMD2	HGNC	protein_coding	OTTHUMT00000040209.3	-	0.00	77	0	G	XM_166338		33752154	-1	tier1	-	no_errors	ENST00000293760	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.007	T
HSPB6	126393	genome.wustl.edu	37	19	36243135	36243135	+	IGR	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:36243135G>A	ENST00000592984.1	-	0	1634				AC002398.9_ENST00000591613.2_3'UTR|LIN37_ENST00000301159.9_Silent_p.E31E|AC002398.12_ENST00000587767.1_RNA|AC002398.11_ENST00000591091.1_RNA			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTCTGCTGGAGAAGAGTCACA	0.637																																																	0													31.0	35.0	34.0					19																	36243135		2045	4207	6252	SO:0001628	intergenic_variant	0			AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36243135G>A			O14551|Q6NVI3|Q96MG9	Silent	SNP	NULL	p.E31	ENST00000592984.1	37	c.93	CCDS12475.1	19																																																																																			LIN37	-	NULL	ENSG00000267796		0.637	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN37	HGNC	protein_coding	OTTHUMT00000109498.3	-	0.00	42	0	G	NM_144617		36243135	+1	tier1	-	no_errors	ENST00000301159	ensembl	human	known	74_37	silent	8.16	45	4	SNP	1.000	A
LILRA6	79168	genome.wustl.edu	37	19	54744789	54744789	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:54744789C>A	ENST00000396365.2	-	5	912	c.873G>T	c.(871-873)ggG>ggT	p.G291G	LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000245621.5_Silent_p.G291G|LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000440558.2_Silent_p.G291G|LILRA6_ENST00000419410.2_Silent_p.G291G	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	291	Ig-like C2-type 1.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGTACTGGCCCCCGTGGGAGG	0.682																																																	0													54.0	66.0	62.0					19																	54744789		2203	4300	6503	SO:0001819	synonymous_variant	0			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.873G>T	19.37:g.54744789C>A				Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G291	ENST00000396365.2	37	c.873	CCDS42610.1	19																																																																																			LILRA6	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000244482		0.682	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	LILRA6	HGNC	protein_coding	OTTHUMT00000313725.1	-	0.00	264	0	C	NM_024318		54744789	-1	tier1	-	no_errors	ENST00000419410	ensembl	human	known	74_37	silent	5.09	261	14	SNP	0.068	A
LENG8	114823	genome.wustl.edu	37	19	54965711	54965711	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:54965711C>T	ENST00000326764.5	+	6	1008	c.529C>T	c.(529-531)Cac>Tac	p.H177Y	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	140										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		ACATGGGGCTCACACGCTGAA	0.682																																																	0													24.0	25.0	25.0					19																	54965711		2203	4300	6503	SO:0001583	missense	0			AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.529C>T	19.37:g.54965711C>T	ENSP00000318374:p.His177Tyr		B0VJY9|Q8IZ27|Q8NCX6	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.H177Y	ENST00000326764.5	37	c.529	CCDS12894.1	19	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746361	0.30955	.	.	ENSG00000167615	ENST00000326764;ENST00000301196;ENST00000439657;ENST00000376526;ENST00000431846	T;T;T;T	0.44083	1.5;0.93;1.47;1.48	5.23	5.23	0.72850	.	0.209202	0.38778	N	0.001576	T	0.48295	0.1492	L	0.50333	1.59	0.21697	N	0.999586	B;B	0.34103	0.437;0.053	B;B	0.43018	0.405;0.008	T	0.49670	-0.8915	10	0.56958	D	0.05	-15.3419	16.6815	0.85292	0.0:1.0:0.0:0.0	.	177;140	Q96PV6-2;F8W9Q9	.;.	Y	177;140;177;140;177	ENSP00000318374:H177Y;ENSP00000399507:H177Y;ENSP00000365709:H140Y;ENSP00000388053:H177Y	ENSP00000301196:H140Y	H	+	1	0	LENG8	59657523	0.188000	0.23250	0.023000	0.16930	0.095000	0.18619	3.713000	0.54882	2.608000	0.88229	0.655000	0.94253	CAC	LENG8	-	NULL	ENSG00000167615		0.682	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG8	HGNC	protein_coding	OTTHUMT00000140523.2	-	0.00	142	0	C	NM_052925		54965711	+1	tier1	-	no_errors	ENST00000326764	ensembl	human	known	74_37	missense	9.03	131	13	SNP	0.011	T
LINC00674	100499466	genome.wustl.edu	37	17	66110635	66110635	+	RNA	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:66110635G>A	ENST00000435469.2	+	0	189									long intergenic non-protein coding RNA 674																		ATTTCATGGAGAAGAAGGCCT	0.378																																																	0																																												0			BC045718, DA232946		17q24.2	2012-10-12			ENSG00000237854	ENSG00000237854		"""Long non-coding RNAs"""	44355	non-coding RNA	RNA, long non-coding							Standard	NR_027418		Approved		uc002jgq.3		OTTHUMG00000132303		17.37:g.66110635G>A				RNA	SNP	-	NULL	ENST00000435469.2	37	NULL		17																																																																																			LINC00674	-	-	ENSG00000237854		0.378	LINC00674-001	KNOWN	basic	processed_transcript	LINC00674	HGNC	pseudogene	OTTHUMT00000255408.1	-	0.00	103	0	G	NR_027418		66110635	+1	tier1	-	no_errors	ENST00000435469	ensembl	human	known	74_37	rna	12.40	106	15	SNP	1.000	A
LMBRD1	55788	genome.wustl.edu	37	6	70447905	70447905	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:70447905C>A	ENST00000370577.3	-	7	794	c.565G>T	c.(565-567)Ggt>Tgt	p.G189C	LMBRD1_ENST00000370570.1_Missense_Mutation_p.G116C	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	189					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						GCAGCTAAACCATCTGTGAAG	0.323																																																	0													47.0	45.0	46.0					6																	70447905		2202	4297	6499	SO:0001583	missense	0			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.565G>T	6.37:g.70447905C>A	ENSP00000359609:p.Gly189Cys		A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot	p.G189C	ENST00000370577.3	37	c.565	CCDS4969.1	6	.	.	.	.	.	.	.	.	.	.	c	24.1	4.496476	0.85069	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.30182	1.54;1.54	5.95	5.95	0.96441	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.51261	0.1664	M	0.84326	2.69	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.46527	-0.9185	10	0.39692	T	0.17	-13.78	19.1739	0.93594	0.0:1.0:0.0:0.0	.	189	Q9NUN5	LMBD1_HUMAN	C	189;116	ENSP00000359609:G189C;ENSP00000359602:G116C	ENSP00000359602:G116C	G	-	1	0	LMBRD1	70504626	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.706000	0.74649	2.827000	0.97445	0.650000	0.86243	GGT	LMBRD1	-	pfam_LMBR1-like_membr_prot	ENSG00000168216		0.323	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD1	HGNC	protein_coding	OTTHUMT00000041124.1		0.00	53	0	C	NM_018368		70447905	-1			no_errors	ENST00000370577	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	A
LMO4	8543	genome.wustl.edu	37	1	87805312	87805312	+	Silent	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:87805312T>A	ENST00000370544.5	+	3	1110	c.330T>A	c.(328-330)ctT>ctA	p.L110L	LMO4_ENST00000370542.1_Silent_p.L110L|LMO4_ENST00000489303.1_3'UTR	NM_006769.3	NP_006760.1	P61968	LMO4_HUMAN	LIM domain only 4	110	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of protein complex assembly (GO:0031333)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell activation (GO:0050865)|regulation of cell fate specification (GO:0042659)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron differentiation (GO:0021522)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)|ventral spinal cord interneuron differentiation (GO:0021514)|ventricular septum development (GO:0003281)	transcription factor complex (GO:0005667)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(1)	9		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		TGTATCATCTTAAGGTAGTAT	0.418																																																	0													76.0	76.0	76.0					1																	87805312		2203	4300	6503	SO:0001819	synonymous_variant	0			U24576	CCDS713.1	1p22.3	2008-02-05			ENSG00000143013	ENSG00000143013			6644	protein-coding gene	gene with protein product		603129					Standard	NM_006769		Approved		uc001dmi.3	P61968	OTTHUMG00000010248	ENST00000370544.5:c.330T>A	1.37:g.87805312T>A			D3DT23|O00158|O88894	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.L110	ENST00000370544.5	37	c.330	CCDS713.1	1																																																																																			LMO4	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000143013		0.418	LMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMO4	HGNC	protein_coding	OTTHUMT00000028264.2	-	0.00	60	0	T	NM_006769		87805312	+1	tier1	-	no_errors	ENST00000370542	ensembl	human	known	74_37	silent	7.46	62	5	SNP	0.990	A
LOC100128164	100128164	genome.wustl.edu	37	3	169663272	169663272	+	RNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:169663272C>A	ENST00000487580.1	-	0	263				RP11-379K17.4_ENST00000483289.2_RNA																							GGGTGAGCAGCGAGTTGAAGC	0.483																																																	0																																												0																															3.37:g.169663272C>A				RNA	SNP	-	NULL	ENST00000487580.1	37	NULL		3																																																																																			RP11-379K17.4	-	-	ENSG00000239219		0.483	RP11-379K17.4-003	KNOWN	basic|exp_conf	antisense	LOC100128164	Clone_based_vega_gene	antisense	OTTHUMT00000351957.1	-	0.00	10	0	C			169663272	-1	tier1	-	no_errors	ENST00000483289	ensembl	human	known	74_37	rna	50.00	4	4	SNP	0.003	A
SMG1P7	100506060	genome.wustl.edu	37	16	70267411	70267411	+	RNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:70267411C>A	ENST00000459379.1	-	0	0																											TAGTTGAACACGGCAAACATC	0.358																																																	0																																												0																															16.37:g.70267411C>A				RNA	SNP	-	NULL	ENST00000459379.1	37	NULL		16																																																																																			RP11-296I10.6	-	-	ENSG00000261556		0.358	snoU13.216-201	NOVEL	basic	snoRNA	LOC100506060	Clone_based_vega_gene	snoRNA		-	0.00	242	0	C			70267411	-1	tier1	-	no_errors	ENST00000568855	ensembl	human	known	74_37	rna	8.91	234	23	SNP	1.000	A
LAMA1	284217	genome.wustl.edu	37	18	6955526	6955526	+	Intron	SNP	C	C	A	rs555722981	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr18:6955526C>A	ENST00000389658.3	-	57	8188				RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1						axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTGACACACGCGTGTTCCGCC	0.562													C|||	2	0.000399361	0.0	0.0	5008	,	,		15673	0.0		0.0	False		,,,				2504	0.002																0																																										SO:0001627	intron_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8095-62G>T	18.37:g.6955526C>A				RNA	SNP	-	NULL	ENST00000389658.3	37	NULL	CCDS32787.1	18																																																																																			RP11-781P6.1	-	-	ENSG00000265069		0.562	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927188	Clone_based_vega_gene	protein_coding	OTTHUMT00000257369.1	-	0.00	29	0	C	NM_005559		6955526	+1	tier1	-	no_errors	ENST00000584722	ensembl	human	known	74_37	rna	13.33	39	6	SNP	0.000	A
ZNF98	148198	genome.wustl.edu	37	19	22706396	22706396	+	Intron	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:22706396G>T	ENST00000599879.1	-	1	147				CTC-457E21.1_ENST00000562262.1_RNA			A6NK75	ZNF98_HUMAN	zinc finger protein 98						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CCATTGGAACGGTTAAGGTCA	0.532																																																	0																																										SO:0001627	intron_variant	0				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000599879.1:c.345+8744C>A	19.37:g.22706396G>T				RNA	SNP	-	NULL	ENST00000599879.1	37	NULL		19																																																																																			CTC-457E21.1	-	-	ENSG00000260599		0.532	ZNF98-005	PUTATIVE	basic	processed_transcript	LOC101929124	Clone_based_vega_gene	protein_coding	OTTHUMT00000464565.1	-	0.00	114	0	G	NM_001098626		22706396	-1	tier1	-	no_errors	ENST00000562262	ensembl	human	known	74_37	rna	8.94	112	11	SNP	0.003	T
LONP2	83752	genome.wustl.edu	37	16	48385645	48385645	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:48385645C>T	ENST00000285737.4	+	15	2584	c.2491C>T	c.(2491-2493)Ctt>Ttt	p.L831F	LONP2_ENST00000564259.1_3'UTR|LONP2_ENST00000535754.1_Missense_Mutation_p.L787F	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GGATGAGGTTCTTAATGCAGC	0.403																																																	0													86.0	81.0	83.0					16																	48385645		2200	4300	6500	SO:0001583	missense	0			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.2491C>T	16.37:g.48385645C>T	ENSP00000285737:p.Leu831Phe			Missense_Mutation	SNP	pfam_Pept_S16_C,pfam_Pept_S16_N,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_P-loop_NTPase,superfamily_PUA-like_domain,smart_Pept_S16_N,smart_AAA+_ATPase,tigrfam_Lon_bac/euk-typ	p.L831F	ENST00000285737.4	37	c.2491	CCDS10734.1	16	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838234	0.91117	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754	T;T	0.40756	1.02;1.02	6.14	6.14	0.99180	Ribosomal protein S5 domain 2-type fold (1);Peptidase S16, Lon C-terminal (1);	0.117922	0.64402	D	0.000019	T	0.65688	0.2715	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.63449	-0.6635	10	0.66056	D	0.02	-18.8378	20.8597	0.99761	0.0:1.0:0.0:0.0	.	787;831	B7ZKL7;Q86WA8	.;LONP2_HUMAN	F	831;560;787	ENSP00000285737:L831F;ENSP00000445426:L787F	ENSP00000285737:L831F	L	+	1	0	LONP2	46943146	1.000000	0.71417	0.983000	0.44433	0.912000	0.54170	6.023000	0.70848	2.937000	0.99478	0.650000	0.86243	CTT	LONP2	-	pfam_Pept_S16_C,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_Lon_bac/euk-typ	ENSG00000102910		0.403	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP2	HGNC	protein_coding	OTTHUMT00000256839.2	-	0.00	54	0	C	NM_031490		48385645	+1	tier1	-	no_errors	ENST00000285737	ensembl	human	known	74_37	missense	8.22	67	6	SNP	1.000	T
PLPPR3	79948	genome.wustl.edu	37	19	815235	815235	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:815235G>T	ENST00000520876.3	-	4	432	c.354C>A	c.(352-354)gcC>gcA	p.A118A	LPPR3_ENST00000359894.2_Silent_p.A118A|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		118						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										TGCAGCCGCCGGCGTTGATGC	0.687																																																	0													16.0	21.0	19.0					19																	815235		2160	4261	6421	SO:0001819	synonymous_variant	0																														ENST00000520876.3:c.354C>A	19.37:g.815235G>T			Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.A118	ENST00000520876.3	37	c.354	CCDS58636.1	19																																																																																			LPPR3	-	superfamily_P_Acid_Pase_2/haloperoxidase	ENSG00000129951		0.687	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR3	Uniprot_gn	protein_coding	OTTHUMT00000379096.3	-	0.00	22	0	G			815235	-1	tier1	-	no_errors	ENST00000359894	ensembl	human	known	74_37	silent	21.05	15	4	SNP	0.079	T
LRP1	4035	genome.wustl.edu	37	12	57592327	57592327	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:57592327G>T	ENST00000243077.3	+	60	10016	c.9550G>T	c.(9550-9552)Gtg>Ttg	p.V3184L		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3184					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CAGCGTCATCGTGGACACCAA	0.592																																																	0													95.0	70.0	78.0					12																	57592327		2203	4300	6503	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.9550G>T	12.37:g.57592327G>T	ENSP00000243077:p.Val3184Leu		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.V3184L	ENST00000243077.3	37	c.9550	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862769	0.51482	.	.	ENSG00000123384	ENST00000243077	D	0.95690	-3.78	4.39	4.39	0.52855	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.191477	0.33553	N	0.004793	D	0.93284	0.7860	L	0.55017	1.72	0.80722	D	1	P	0.47034	0.889	B	0.42422	0.387	D	0.91805	0.5455	10	0.17832	T	0.49	.	16.2482	0.82460	0.0:0.0:1.0:0.0	.	3184	Q07954	LRP1_HUMAN	L	3184	ENSP00000243077:V3184L	ENSP00000243077:V3184L	V	+	1	0	LRP1	55878594	1.000000	0.71417	0.980000	0.43619	0.982000	0.71751	3.118000	0.50414	2.434000	0.82447	0.561000	0.74099	GTG	LRP1	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000123384		0.592	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2		0.00	45	0	G	NM_002332		57592327	+1			no_errors	ENST00000243077	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.977	T
LRP1B	53353	genome.wustl.edu	37	2	141128402	141128402	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:141128402C>A	ENST00000389484.3	-	71	11856	c.10885G>T	c.(10885-10887)Gtg>Ttg	p.V3629L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3629	LDL-receptor class A 28. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATTCAGTCACACAGTCCATC	0.383										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													133.0	121.0	125.0					2																	141128402		2202	4300	6502	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10885G>T	2.37:g.141128402C>A	ENSP00000374135:p.Val3629Leu		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.V3629L	ENST00000389484.3	37	c.10885	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584624	0.46110	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.49720	0.77	5.26	5.26	0.73747	.	0.000000	0.64402	U	0.000005	T	0.35998	0.0951	L	0.36672	1.1	0.45005	D	0.99802	B	0.32918	0.39	B	0.31547	0.132	T	0.13522	-1.0506	10	0.22109	T	0.4	.	12.2412	0.54544	0.0:0.922:0.0:0.078	.	3629	Q9NZR2	LRP1B_HUMAN	L	3629;3567	ENSP00000374135:V3629L	ENSP00000374135:V3629L	V	-	1	0	LRP1B	140844872	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.588000	0.60999	2.461000	0.83175	0.591000	0.81541	GTG	LRP1B	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.383	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	60	0	C	NM_018557		141128402	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	8.74	94	9	SNP	1.000	A
LRRC63	220416	genome.wustl.edu	37	13	46844599	46844599	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:46844599G>T	ENST00000446175.1	+	11	1933		c.e11-1		LRRC63_ENST00000595396.1_Intron	NM_001282460.1	NP_001269389.1	Q05C16	LRC63_HUMAN	leucine rich repeat containing 63											lung(1)|ovary(1)	2						TTCTCCATAAGCCATCTATTC	0.373																																																	0																																										SO:0001630	splice_region_variant	0				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000446175.1:c.1589-1G>T	13.37:g.46844599G>T			Q5TBN0	Splice_Site	SNP	-	e10-1	ENST00000446175.1	37	c.1589-1		13	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430925	0.25726	.	.	ENSG00000173988	ENST00000446175	.	.	.	1.23	1.23	0.21249	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7229	0.17996	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRC63	45742600	0.948000	0.32251	0.761000	0.31378	0.476000	0.33039	-0.046000	0.11983	0.658000	0.30925	0.205000	0.17691	.	LRRC63	-	-	ENSG00000173988		0.373	LRRC63-201	KNOWN	basic|appris_candidate	protein_coding	LRRC63	HGNC	protein_coding			0.00	12	0	G	XM_001718341	Intron	46844599	+1			no_errors	ENST00000446175	ensembl	human	known	74_37	splice_site	12.50	27	4	SNP	0.871	T
LRRC9	341883	genome.wustl.edu	37	14	60411431	60411431	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:60411431G>A	ENST00000445360.1	+	8	1055	c.851G>A	c.(850-852)cGa>cAa	p.R284Q	LRRC9_ENST00000454474.2_3'UTR			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	284																	CCAGAAGAACGAGTAAAATTA	0.308																																																	0																																										SO:0001583	missense	0			AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.851G>A	14.37:g.60411431G>A	ENSP00000454748:p.Arg284Gln			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R284Q	ENST00000445360.1	37	c.851		14																																																																																			LRRC9	-	NULL	ENSG00000131951		0.308	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC9	HGNC	protein_coding	OTTHUMT00000072281.3	-	0.00	65	0	G			60411431	+1	tier1	-	no_errors	ENST00000254271	ensembl	human	known	74_37	missense	7.41	75	6	SNP	0.959	A
LTBP1	4052	genome.wustl.edu	37	2	33585729	33585729	+	Missense_Mutation	SNP	G	G	C	rs569029644		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:33585729G>C	ENST00000404816.2	+	27	4419	c.4066G>C	c.(4066-4068)Gcc>Ccc	p.A1356P	LTBP1_ENST00000418533.2_Missense_Mutation_p.A988P|LTBP1_ENST00000354476.3_Missense_Mutation_p.A1357P|LTBP1_ENST00000407925.1_Missense_Mutation_p.A1030P|LTBP1_ENST00000272273.5_Missense_Mutation_p.A254P|LTBP1_ENST00000402934.1_Missense_Mutation_p.A975P|LTBP1_ENST00000404525.1_Missense_Mutation_p.A977P|LTBP1_ENST00000390003.4_Missense_Mutation_p.A1031P			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1356	TB 3.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCTCAATGACGCCAGTCTCTG	0.423																																																	0													119.0	111.0	114.0					2																	33585729		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4066G>C	2.37:g.33585729G>C	ENSP00000386043:p.Ala1356Pro		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.A1357P	ENST00000404816.2	37	c.4069	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256925	0.80246	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273;ENST00000422669	D;D;D;D;D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06;-3.06;-3.06;-3.06;-3.06	5.06	5.06	0.68205	Matrix fibril-associated (2);TGF-beta binding (1);	.	.	.	.	D	0.92688	0.7676	L	0.27053	0.805	0.58432	D	0.999996	D;D;D;D;D;D;D	0.76494	0.994;0.998;0.999;0.996;0.998;0.999;0.999	P;D;D;P;D;D;D	0.70227	0.775;0.925;0.93;0.872;0.942;0.968;0.966	D	0.90669	0.4596	9	0.21540	T	0.41	.	18.7975	0.92001	0.0:0.0:1.0:0.0	.	254;1356;988;977;1030;1031;1357	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	.;LTBP1_HUMAN;.;.;.;.;.	P	1356;1357;1031;988;975;977;1030;254;192	ENSP00000386043:A1356P;ENSP00000346467:A1357P;ENSP00000374653:A1031P;ENSP00000393057:A988P;ENSP00000384373:A975P;ENSP00000385359:A977P;ENSP00000384091:A1030P;ENSP00000272273:A254P;ENSP00000395211:A192P	ENSP00000272273:A254P	A	+	1	0	LTBP1	33439233	1.000000	0.71417	0.972000	0.41901	0.842000	0.47809	7.883000	0.87264	2.508000	0.84585	0.563000	0.77884	GCC	LTBP1	-	superfamily_TB_dom	ENSG00000049323		0.423	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	-	0.00	54	0	G	NM_206943		33585729	+1	tier1	-	no_errors	ENST00000354476	ensembl	human	known	74_37	missense	13.70	63	10	SNP	1.000	C
LRRTM1	347730	genome.wustl.edu	37	2	80529474	80529474	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:80529474C>T	ENST00000295057.3	-	2	2127	c.1471G>A	c.(1471-1473)Gat>Aat	p.D491N	CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000466387.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.D491N|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000541047.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	491					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GGTTTGTAATCAACGTAGTAT	0.542										HNSCC(69;0.2)																																							0													144.0	118.0	127.0					2																	80529474		2203	4300	6503	SO:0001583	missense	0			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1471G>A	2.37:g.80529474C>T	ENSP00000295057:p.Asp491Asn		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.D491N	ENST00000295057.3	37	c.1471	CCDS1966.1	2	.	.	.	.	.	.	.	.	.	.	C	22.4	4.291347	0.80914	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.49720	0.77;0.77	4.99	4.99	0.66335	.	0.000000	0.85682	U	0.000000	T	0.58736	0.2143	L	0.52573	1.65	0.80722	D	1	D	0.60575	0.988	P	0.57204	0.815	T	0.57429	-0.7813	9	.	.	.	.	18.2542	0.90014	0.0:1.0:0.0:0.0	.	491	Q86UE6	LRRT1_HUMAN	N	491	ENSP00000295057:D491N;ENSP00000386646:D491N	.	D	-	1	0	LRRTM1	80382985	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.814000	0.86154	2.276000	0.75962	0.561000	0.74099	GAT	LRRTM1	-	NULL	ENSG00000162951		0.542	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM1	HGNC	protein_coding	OTTHUMT00000313614.1	-	0.00	79	0	C	NM_178839		80529474	-1	tier1	-	no_errors	ENST00000295057	ensembl	human	known	74_37	missense	6.90	80	6	SNP	1.000	T
LRRFIP1	9208	genome.wustl.edu	37	2	238688092	238688092	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:238688092G>C	ENST00000308482.9	+	24	1909	c.1840G>C	c.(1840-1842)Gag>Cag	p.E614Q		NM_001137550.1	NP_001131022.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	463					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TAAAACAGAAGAGCTCGAGGT	0.483																																																	0													62.0	58.0	59.0					2																	238688092		1568	3582	5150	SO:0001583	missense	0			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000308482.9:c.1840G>C	2.37:g.238688092G>C	ENSP00000310109:p.Glu614Gln		E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_Prefoldin	p.E614Q	ENST00000308482.9	37	c.1840	CCDS46551.1	2	.	.	.	.	.	.	.	.	.	.	G	27.5	4.836921	0.91117	.	.	ENSG00000124831	ENST00000308482;ENST00000391999	D	0.86562	-2.14	4.85	4.85	0.62838	.	.	.	.	.	D	0.93835	0.8028	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.94733	0.7911	9	0.87932	D	0	.	17.3552	0.87334	0.0:0.0:1.0:0.0	.	368;614	B4DPC0;E9PGZ2	.;.	Q	614;604	ENSP00000310109:E614Q	ENSP00000310109:E614Q	E	+	1	0	LRRFIP1	238352831	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.375000	0.97178	2.409000	0.81822	0.563000	0.77884	GAG	LRRFIP1	-	NULL	ENSG00000124831		0.483	LRRFIP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRFIP1	HGNC	protein_coding	OTTHUMT00000257169.3	-	0.00	71	0	G	NM_004735		238688092	+1	tier1	-	no_errors	ENST00000308482	ensembl	human	putative	74_37	missense	9.41	77	8	SNP	1.000	C
MACF1	23499	genome.wustl.edu	37	1	39823254	39823254	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:39823254G>A	ENST00000372915.3	+	44	11734	c.11647G>A	c.(11647-11649)Gag>Aag	p.E3883K	MACF1_ENST00000564288.1_Missense_Mutation_p.E3878K|MACF1_ENST00000545844.1_Missense_Mutation_p.E1816K|MACF1_ENST00000289893.4_Missense_Mutation_p.E2318K|MACF1_ENST00000567887.1_Missense_Mutation_p.E3915K|MACF1_ENST00000539005.1_Missense_Mutation_p.E1816K|MACF1_ENST00000317713.7_Missense_Mutation_p.E1816K|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000361689.2_Missense_Mutation_p.E1816K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3883					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACTTCAGGATGAGTTGCAGAA	0.493																																																	0													66.0	67.0	67.0					1																	39823254		2203	4300	6503	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.11647G>A	1.37:g.39823254G>A	ENSP00000362006:p.Glu3883Lys		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E1816K	ENST00000372915.3	37	c.5446		1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559260	0.86335	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000530262;ENST00000289893	T;T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35;1.35	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000011	T	0.66107	0.2756	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.91635	0.999;0.997;0.978;0.994	T	0.67256	-0.5716	10	0.87932	D	0	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	3883;1816;1816;1781	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3	MACF1_HUMAN;.;.;.	K	1816;3883;1816;1816;1816;1965;2318	ENSP00000439537:E1816K;ENSP00000362006:E3883K;ENSP00000354573:E1816K;ENSP00000313438:E1816K;ENSP00000444364:E1816K;ENSP00000437059:E1965K;ENSP00000289893:E2318K	ENSP00000289893:E2318K	E	+	1	0	MACF1	39595841	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.501000	0.81600	2.884000	0.98904	0.655000	0.94253	GAG	MACF1	-	pfam_Spectrin_repeat	ENSG00000127603		0.493	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	61	0	G	NM_033044		39823254	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	6.73	97	7	SNP	1.000	A
MAGI2	9863	genome.wustl.edu	37	7	77764503	77764503	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:77764503G>T	ENST00000354212.4	-	17	3119	c.2866C>A	c.(2866-2868)Cgc>Agc	p.R956S	MAGI2_ENST00000419488.1_Missense_Mutation_p.R942S|MAGI2_ENST00000522391.1_Missense_Mutation_p.R956S	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	956	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TCAATGATGCGTCCGATTTTA	0.473																																																	0													120.0	110.0	113.0					7																	77764503		2203	4300	6503	SO:0001583	missense	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2866C>A	7.37:g.77764503G>T	ENSP00000346151:p.Arg956Ser		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.R956S	ENST00000354212.4	37	c.2866	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.471176	0.96274	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.26067	1.76;1.76;1.76	6.06	6.06	0.98353	PDZ/DHR/GLGF (4);	0.000000	0.35466	U	0.003199	T	0.42653	0.1212	L	0.28054	0.825	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.23904	-1.0175	10	0.66056	D	0.02	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	956;942;956	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	S	942;956;956;956	ENSP00000405766:R942S;ENSP00000346151:R956S;ENSP00000428389:R956S	ENSP00000346151:R956S	R	-	1	0	MAGI2	77602439	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.602000	0.67612	2.882000	0.98803	0.655000	0.94253	CGC	MAGI2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000187391		0.473	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	-	0.00	61	0	G	NM_012301		77764503	-1	tier1	-	no_errors	ENST00000354212	ensembl	human	known	74_37	missense	15.19	67	12	SNP	1.000	T
MALAT1	378938	genome.wustl.edu	37	11	65266504	65266504	+	lincRNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:65266504G>T	ENST00000534336.1	+	0	1272				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CGCCTCGCCCGAGCTGTGCGG	0.537																																																	0													124.0	127.0	126.0					11																	65266504		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266504G>T				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.537	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	74	0	G	NR_002819		65266504	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	6.67	70	5	SNP	0.000	T
MAML3	55534	genome.wustl.edu	37	4	140811081	140811081	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:140811081C>T	ENST00000509479.2	-	2	2365	c.1509G>A	c.(1507-1509)caG>caA	p.Q503Q	MAML3_ENST00000398940.1_Intron|MAML3_ENST00000327122.5_Silent_p.Q347Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.527																																																	0													23.0	31.0	29.0					4																	140811081		2165	4290	6455	SO:0001819	synonymous_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1509G>A	4.37:g.140811081C>T				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q503	ENST00000509479.2	37	c.1509	CCDS54805.1	4																																																																																			MAML3	-	NULL	ENSG00000196782		0.527	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2		0.00	51	0	C			140811081	-1			no_errors	ENST00000509479	ensembl	human	known	74_37	silent	7.14	39	3	SNP	1.000	T
MAP6	4135	genome.wustl.edu	37	11	75319308	75319308	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:75319308T>C	ENST00000304771.3	-	2	1715	c.965A>G	c.(964-966)cAg>cGg	p.Q322R	MAP6_ENST00000434603.2_Missense_Mutation_p.Q322R|MAP6_ENST00000526740.1_5'UTR	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	322					dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					GGGCTTGTACTGGGGCTTGGC	0.458																																					Esophageal Squamous(181;1115 2007 8647 17065 22697)												0													149.0	132.0	138.0					11																	75319308		2200	4293	6493	SO:0001583	missense	0			AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.965A>G	11.37:g.75319308T>C	ENSP00000307093:p.Gln322Arg		A7E2A1|Q6P3T0|Q6ZWB8	Missense_Mutation	SNP	pfam_MAP6/FAM154	p.Q322R	ENST00000304771.3	37	c.965	CCDS31641.1	11	.	.	.	.	.	.	.	.	.	.	T	26.6	4.751610	0.89753	.	.	ENSG00000171533	ENST00000304771;ENST00000434603	T;T	0.56444	0.46;0.61	5.73	5.73	0.89815	.	0.000000	0.44902	D	0.000417	T	0.71904	0.3395	M	0.74881	2.28	0.52501	D	0.999958	D	0.76494	0.999	D	0.83275	0.996	T	0.75150	-0.3419	10	0.66056	D	0.02	-19.1907	13.98	0.64299	0.0:0.0:0.0:1.0	.	322	Q96JE9	MAP6_HUMAN	R	322	ENSP00000307093:Q322R;ENSP00000415108:Q322R	ENSP00000307093:Q322R	Q	-	2	0	MAP6	74996956	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.929000	0.70096	2.173000	0.68751	0.528000	0.53228	CAG	MAP6	-	pfam_MAP6/FAM154	ENSG00000171533		0.458	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP6	HGNC	protein_coding	OTTHUMT00000383527.1	-	0.00	100	0	T	NM_033063		75319308	-1	tier1	-	no_errors	ENST00000304771	ensembl	human	known	74_37	missense	8.70	126	12	SNP	1.000	C
MEGF6	1953	genome.wustl.edu	37	1	3421858	3421858	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:3421858C>A	ENST00000356575.4	-	17	2328	c.2102G>T	c.(2101-2103)tGc>tTc	p.C701F	MEGF6_ENST00000294599.4_Missense_Mutation_p.C596F	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	701						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GCCCACTGGGCAGGTGCATGC	0.692																																					Ovarian(73;978 3658)												0													18.0	24.0	22.0					1																	3421858		2099	4213	6312	SO:0001583	missense	0			AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.2102G>T	1.37:g.3421858C>A	ENSP00000348982:p.Cys701Phe		Q4AC86|Q5VV39	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.C701F	ENST00000356575.4	37	c.2102	CCDS41237.1	1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718737	0.48622	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	T;T	0.67698	-0.28;-0.28	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	D	0.89643	0.6774	H	0.99312	4.51	0.51012	D	0.999908	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94399	0.7621	10	0.87932	D	0	-14.5733	16.9827	0.86333	0.0:1.0:0.0:0.0	.	701;596	O75095;O75095-2	MEGF6_HUMAN;.	F	596;701	ENSP00000294599:C596F;ENSP00000348982:C701F	ENSP00000294599:C596F	C	-	2	0	MEGF6	3411718	1.000000	0.71417	0.878000	0.34440	0.033000	0.12548	5.761000	0.68801	2.160000	0.67779	0.462000	0.41574	TGC	MEGF6	-	smart_EG-like_dom,smart_EGF_laminin	ENSG00000162591		0.692	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF6	HGNC	protein_coding	OTTHUMT00000354866.1	-	0.00	82	0	C	NM_001409		3421858	-1	tier1	-	no_errors	ENST00000356575	ensembl	human	known	74_37	missense	7.29	89	7	SNP	1.000	A
MFN2	9927	genome.wustl.edu	37	1	12056304	12056304	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:12056304C>T	ENST00000235329.5	+	5	725	c.403C>T	c.(403-405)Cgg>Tgg	p.R135W	MFN2_ENST00000444836.1_Missense_Mutation_p.R135W	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	135	Dynamin-type G.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		TTGCTTCCTGCGGGTAGAGGG	0.577																																																	0													130.0	113.0	119.0					1																	12056304		2203	4300	6503	SO:0001583	missense	0			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.403C>T	1.37:g.12056304C>T	ENSP00000235329:p.Arg135Trp		A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.R135W	ENST00000235329.5	37	c.403	CCDS30587.1	1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645436	0.87859	.	.	ENSG00000116688	ENST00000444836;ENST00000235329	D;D	0.96940	-4.18;-4.18	5.63	5.63	0.86233	Dynamin, GTPase domain (1);	0.000000	0.85682	D	0.000000	D	0.96981	0.9014	L	0.39245	1.2	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	D	0.96731	0.9539	10	0.46703	T	0.11	-31.582	19.0418	0.93002	0.0:1.0:0.0:0.0	.	135	O95140	MFN2_HUMAN	W	135	ENSP00000416338:R135W;ENSP00000235329:R135W	ENSP00000235329:R135W	R	+	1	2	MFN2	11978891	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.595000	0.61048	2.808000	0.96608	0.655000	0.94253	CGG	MFN2	-	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	ENSG00000116688		0.577	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN2	HGNC	protein_coding	OTTHUMT00000006859.2	-	0.00	46	0	C	NM_014874		12056304	+1	tier1	-	no_errors	ENST00000235329	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
METTL18	92342	genome.wustl.edu	37	1	169762250	169762250	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:169762250C>A	ENST00000310392.4	-	2	940	c.587G>T	c.(586-588)tGt>tTt	p.C196F	C1orf112_ENST00000498289.1_Intron|C1orf112_ENST00000286031.6_5'Flank|METTL18_ENST00000303469.2_Missense_Mutation_p.C196F|C1orf112_ENST00000456684.1_5'Flank|C1orf112_ENST00000413811.2_5'Flank|C1orf112_ENST00000359326.4_5'Flank	NM_033418.2	NP_219486.1	O95568	MET18_HUMAN	methyltransferase like 18	196						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			kidney(1)|large_intestine(3)|lung(4)	8						ACCTGATCCACAACCAAGATC	0.398																																																	0													115.0	116.0	115.0					1																	169762250		2203	4300	6503	SO:0001583	missense	0			AL035369	CCDS1284.1	1q24.2	2013-10-11	2011-03-02	2011-03-02	ENSG00000171806	ENSG00000171806			28793	protein-coding gene	gene with protein product	"""histidine protein methyltransferase 1"""	615255	"""chromosome 1 open reading frame 156"""	C1orf156		20864530	Standard	NM_033418		Approved	MGC9084, AsTP2, HPM1	uc001ggn.4	O95568	OTTHUMG00000035813	ENST00000310392.4:c.587G>T	1.37:g.169762250C>A	ENSP00000307975:p.Cys196Phe		B2R9T5	Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom	p.C196F	ENST00000310392.4	37	c.587	CCDS1284.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198948	0.79015	.	.	ENSG00000171806	ENST00000310392;ENST00000303469	T;T	0.79653	-1.29;-1.29	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.91801	0.7406	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92528	0.6031	10	0.66056	D	0.02	-0.4312	18.9761	0.92736	0.0:1.0:0.0:0.0	.	196	O95568	MET18_HUMAN	F	196	ENSP00000307975:C196F;ENSP00000307077:C196F	ENSP00000307077:C196F	C	-	2	0	METTL18	168028874	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.400000	0.79949	2.824000	0.97209	0.655000	0.94253	TGT	METTL18	-	pfam_Nicotinamide_N-MeTfrase-like,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom	ENSG00000171806		0.398	METTL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL18	HGNC	protein_coding	OTTHUMT00000087109.1		0.00	40	0	C	NM_033418		169762250	-1			no_errors	ENST00000303469	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	A
METTL13	51603	genome.wustl.edu	37	1	171759717	171759717	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:171759717G>C	ENST00000361735.3	+	5	1701	c.1435G>C	c.(1435-1437)Gct>Cct	p.A479P	METTL13_ENST00000362019.3_Missense_Mutation_p.A393P|METTL13_ENST00000367737.5_Missense_Mutation_p.A323P|METTL13_ENST00000458517.1_Missense_Mutation_p.A478P|METTL13_ENST00000466643.1_Intron	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	479							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						AGCCATGATCGCTGGCCTTGC	0.537																																																	0													86.0	86.0	86.0					1																	171759717		2203	4300	6503	SO:0001583	missense	0			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1435G>C	1.37:g.171759717G>C	ENSP00000354920:p.Ala479Pro		A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.A479P	ENST00000361735.3	37	c.1435	CCDS1299.1	1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903077	0.72754	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.91	5.91	0.95273	.	0.049242	0.85682	D	0.000000	D	0.87787	0.6265	M	0.87682	2.9	0.39904	D	0.973942	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.83275	0.959;0.996;0.981	D	0.89225	0.3573	10	0.72032	D	0.01	-30.7179	14.7059	0.69189	0.0:0.0:0.855:0.145	.	478;323;479	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	P	478;393;323;479	ENSP00000401955:A478P;ENSP00000355393:A393P;ENSP00000356711:A323P;ENSP00000354920:A479P	ENSP00000354920:A479P	A	+	1	0	METTL13	170026340	1.000000	0.71417	0.397000	0.26308	0.811000	0.45836	5.547000	0.67249	2.793000	0.96121	0.655000	0.94253	GCT	METTL13	-	NULL	ENSG00000010165		0.537	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	HGNC	protein_coding	OTTHUMT00000084528.5	-	0.00	60	0	G	NM_014955		171759717	+1	tier1	-	no_errors	ENST00000361735	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.583	C
MGAM	8972	genome.wustl.edu	37	7	141720844	141720844	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:141720844C>A	ENST00000549489.2	+	5	614	c.519C>A	c.(517-519)ctC>ctA	p.L173L	MGAM_ENST00000475668.2_Silent_p.L173L	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	173					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATGTTCTTCTCACAGCAGAAT	0.338																																																	0													107.0	97.0	100.0					7																	141720844		1835	4085	5920	SO:0001819	synonymous_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.519C>A	7.37:g.141720844C>A			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.L173	ENST00000549489.2	37	c.519	CCDS47727.1	7																																																																																			MGAM	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000257335		0.338	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	115	0	C			141720844	+1	tier1	-	no_errors	ENST00000549489	ensembl	human	known	74_37	silent	7.10	170	13	SNP	0.998	A
MIR412	574433	genome.wustl.edu	37	14	101531639	101531639	+	RNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:101531639G>T	ENST00000362142.2	+	0	0				MIR369_ENST00000362155.3_RNA|MIR656_ENST00000385224.1_RNA|MIR410_ENST00000362222.2_RNA|MIR409_ENST00000362237.1_RNA|MIR541_ENST00000401360.1_RNA	NR_030155.1				microRNA 412																		CCTCTCCATGGTACTCGGGGA	0.567																																																	0													59.0	60.0	59.0					14																	101531639		1568	3582	5150			0					14q32.31	2011-09-12		2008-12-18	ENSG00000199012	ENSG00000199012		"""ncRNAs / Micro RNAs"""	32064	non-coding RNA	RNA, micro				MIRN412			Standard	NR_030155		Approved	hsa-mir-412	uc021sds.1				14.37:g.101531639G>T				RNA	SNP	-	NULL	ENST00000362142.2	37	NULL		14																																																																																			MIR409	-	-	ENSG00000199107		0.567	MIR412-201	KNOWN	basic	miRNA	MIR409	HGNC	miRNA		-	0.00	74	0	G	NR_030155		101531639	+1	tier1	-	no_errors	ENST00000362237	ensembl	human	known	74_37	rna	6.60	99	7	SNP	1.000	T
CENPU	79682	genome.wustl.edu	37	4	185637644	185637644	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:185637644C>T	ENST00000281453.5	-	6	595	c.525G>A	c.(523-525)gaG>gaA	p.E175E	MLF1IP_ENST00000506535.1_5'Flank|MLF1IP_ENST00000541971.1_Silent_p.E175E	NM_024629.3	NP_078905.2														endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|stomach(1)	13		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		CAGCTGGTTTCTCTGAAAGTT	0.408																																																	0													123.0	115.0	118.0					4																	185637644		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000281453.5:c.525G>A	4.37:g.185637644C>T				Silent	SNP	NULL	p.E175	ENST00000281453.5	37	c.525	CCDS3838.1	4																																																																																			MLF1IP	-	NULL	ENSG00000151725		0.408	MLF1IP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLF1IP	HGNC	protein_coding	OTTHUMT00000360841.2	-	0.00	100	0	C			185637644	-1	tier1	-	no_errors	ENST00000281453	ensembl	human	known	74_37	silent	7.23	77	6	SNP	0.009	T
MPP5	64398	genome.wustl.edu	37	14	67799567	67799567	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:67799567C>A	ENST00000261681.4	+	15	2583	c.1922C>A	c.(1921-1923)aCg>aAg	p.T641K	ATP6V1D_ENST00000553974.1_Intron|MPP5_ENST00000555925.1_Missense_Mutation_p.T607K	NM_022474.3	NP_071919.2	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)	641	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|establishment of protein localization to plasma membrane (GO:0090002)|morphogenesis of an epithelial sheet (GO:0002011)|myelin assembly (GO:0032288)|peripheral nervous system myelin maintenance (GO:0032287)|protein localization to myelin sheath abaxonal region (GO:0035750)|tight junction assembly (GO:0070830)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lateral loop (GO:0043219)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)	p.T641M(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	18				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		TACTTTGATACGGCAATTGTG	0.403																																																	1	Substitution - Missense(1)	kidney(1)											96.0	86.0	90.0					14																	67799567		2203	4300	6503	SO:0001583	missense	0			AK022677	CCDS9779.1, CCDS58325.1	14q23.3	2008-08-11				ENSG00000072415			18669	protein-coding gene	gene with protein product	"""stardust"""	606958				11927608	Standard	NM_022474		Approved	PALS1, FLJ12615	uc001xjc.4	Q8N3R9		ENST00000261681.4:c.1922C>A	14.37:g.67799567C>A	ENSP00000261681:p.Thr641Lys		A1L380|Q7Z631|Q86T98|Q8N7I5|Q9H9Q0	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_L27_N,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,pfam_L27_C,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.T641K	ENST00000261681.4	37	c.1922	CCDS9779.1	14	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494916	0.44352	.	.	ENSG00000072415	ENST00000261681;ENST00000555925	T;T	0.17213	2.29;2.29	5.55	5.55	0.83447	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.101886	0.64402	D	0.000002	T	0.14270	0.0345	N	0.10782	0.045	0.80722	D	1	P	0.35124	0.485	B	0.40741	0.339	T	0.21552	-1.0242	10	0.23891	T	0.37	.	19.5081	0.95127	0.0:1.0:0.0:0.0	.	641	Q8N3R9	MPP5_HUMAN	K	641;607	ENSP00000261681:T641K;ENSP00000451488:T607K	ENSP00000261681:T641K	T	+	2	0	MPP5	66869320	1.000000	0.71417	0.986000	0.45419	0.908000	0.53690	5.919000	0.70005	2.616000	0.88540	0.591000	0.81541	ACG	MPP5	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like	ENSG00000072415		0.403	MPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP5	HGNC	protein_coding	OTTHUMT00000412498.1	-	0.00	50	0	C	NM_022474		67799567	+1	tier1	-	no_errors	ENST00000261681	ensembl	human	known	74_37	missense	8.51	86	8	SNP	0.999	A
MROH6	642475	genome.wustl.edu	37	8	144650733	144650733	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:144650733C>T	ENST00000398882.3	-	10	1889	c.1633G>A	c.(1633-1635)Gac>Aac	p.D545N	MROH6_ENST00000533679.1_5'UTR|MROH6_ENST00000534459.1_5'UTR|MROH6_ENST00000532704.1_5'Flank|MROH6_ENST00000524906.1_5'UTR	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	545																	TCAGCAGCGTCCCTGCTGGGG	0.701																																																	0													4.0	5.0	5.0					8																	144650733		1874	3901	5775	SO:0001583	missense	0			AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.1633G>A	8.37:g.144650733C>T	ENSP00000381857:p.Asp545Asn		A8MWB1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D545N	ENST00000398882.3	37	c.1633	CCDS47928.1	8	.	.	.	.	.	.	.	.	.	.	c	15.97	2.990128	0.54041	.	.	ENSG00000204839	ENST00000398882	T	0.41400	1.0	4.89	4.89	0.63831	Armadillo-type fold (1);	.	.	.	.	T	0.55369	0.1916	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.47446	-0.9117	9	0.21014	T	0.42	-20.3024	15.5415	0.76052	0.0:1.0:0.0:0.0	.	545	A6NGR9	CH073_HUMAN	N	545	ENSP00000381857:D545N	ENSP00000381857:D545N	D	-	1	0	C8orf73	144721876	0.004000	0.15560	0.036000	0.18154	0.135000	0.20990	0.535000	0.23114	2.266000	0.75297	0.543000	0.68304	GAC	MROH6	-	superfamily_ARM-type_fold	ENSG00000204839		0.701	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH6	HGNC	protein_coding	OTTHUMT00000382330.3	-	0.00	53	0	C	NM_001100878		144650733	-1	tier1	-	no_errors	ENST00000398882	ensembl	human	known	74_37	missense	14.29	48	8	SNP	0.125	T
MROH7	374977	genome.wustl.edu	37	1	55145629	55145629	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:55145629G>T	ENST00000421030.2	+	13	2577	c.2292G>T	c.(2290-2292)caG>caT	p.Q764H	MROH7_ENST00000339553.5_Missense_Mutation_p.Q764H|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.Q764H|MROH7_ENST00000395690.2_Missense_Mutation_p.Q764H|MROH7_ENST00000454855.2_Missense_Mutation_p.Q282H|MROH7_ENST00000409996.1_Missense_Mutation_p.Q332H|MROH7_ENST00000545244.1_Missense_Mutation_p.Q332H	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	764						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GGGCCCGCCAGGTGGCCCTGC	0.632																																																	0													104.0	118.0	113.0					1																	55145629		2018	4157	6175	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2292G>T	1.37:g.55145629G>T	ENSP00000396622:p.Gln764His		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q764H	ENST00000421030.2	37	c.2292	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.760056	0.31137	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	3.75	0.446	0.16602	.	0.336809	0.20719	N	0.086953	T	0.26593	0.0650	N	0.17474	0.49	0.09310	N	0.999991	P;P;P	0.41569	0.681;0.755;0.474	P;B;B	0.45138	0.471;0.26;0.232	T	0.09228	-1.0684	10	0.48119	T	0.1	-13.0623	4.9771	0.14146	0.4792:0.0:0.5208:0.0	.	764;764;332	F8W8P2;Q68CQ1;F5H7R4	.;HEAT8_HUMAN;.	H	764;332;793;764;332;282;764	ENSP00000396622:Q764H;ENSP00000442333:Q332H;ENSP00000343211:Q764H;ENSP00000387048:Q332H;ENSP00000401130:Q282H;ENSP00000379044:Q764H	ENSP00000343211:Q764H	Q	+	3	2	HEATR8	54918217	1.000000	0.71417	0.787000	0.31911	0.925000	0.55904	0.958000	0.29227	0.253000	0.21552	0.455000	0.32223	CAG	MROH7-TTC4	-	superfamily_ARM-type_fold	ENSG00000271723		0.632	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7-TTC4	HGNC	protein_coding	OTTHUMT00000346978.1	-	0.00	69	0	G	NM_198547		55145629	+1	tier1	-	no_errors	ENST00000414150	ensembl	human	known	74_37	missense	8.22	67	6	SNP	0.783	T
MROH8	140699	genome.wustl.edu	37	20	35749434	35749434	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:35749434G>A	ENST00000400441.3	-	16	1981	c.1982C>T	c.(1981-1983)gCc>gTc	p.A661V	MROH8_ENST00000217333.8_Missense_Mutation_p.A490V|MROH8_ENST00000441008.2_Missense_Mutation_p.A647V			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	0																	AGCCTGCATGGCAAAGCTAAA	0.463																																																	0													75.0	69.0	71.0					20																	35749434		1954	4145	6099	SO:0001583	missense	0			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1982C>T	20.37:g.35749434G>A	ENSP00000383291:p.Ala661Val		Q5JYQ6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A661V	ENST00000400441.3	37	c.1982		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.21|17.21	3.331936|3.331936	0.60853|0.60853	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000441008;ENST00000400441;ENST00000217333|ENST00000343811	T;T;T|.	0.04015|.	3.97;4.23;3.73|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.084814|.	0.51477|.	D|.	0.000095|.	T|T	0.58878|0.58878	0.2153|0.2153	L|L	0.36672|0.36672	1.1|1.1	0.44555|0.44555	D|D	0.997514|0.997514	D;D|.	0.67145|.	0.992;0.996|.	D;P|.	0.64410|.	0.925;0.906|.	T|T	0.52601|0.52601	-0.8554|-0.8554	10|5	0.20046|.	T|.	0.44|.	-12.2183|-12.2183	15.6512|15.6512	0.77095|0.77095	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	661;495|.	E7ETR9;Q9H579-2|.	.;.|.	V|S	647;661;490|688	ENSP00000392144:A647V;ENSP00000383291:A661V;ENSP00000217333:A490V|.	ENSP00000217333:A490V|.	A|P	-|-	2|1	0|0	C20orf132|C20orf132	35182848|35182848	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.555000|4.555000	0.60767|0.60767	2.778000|2.778000	0.95560|0.95560	0.655000|0.655000	0.94253|0.94253	GCC|CCA	MROH8	-	superfamily_ARM-type_fold	ENSG00000101353		0.463	MROH8-202	KNOWN	basic|appris_principal	protein_coding	MROH8	HGNC	protein_coding		-	0.00	88	0	G	NM_152503		35749434	-1	tier1	-	no_errors	ENST00000400441	ensembl	human	known	74_37	missense	15.79	80	15	SNP	1.000	A
MROH9	80133	genome.wustl.edu	37	1	170983336	170983336	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:170983336C>T	ENST00000367759.4	+	16	1829	c.1675C>T	c.(1675-1677)Cct>Tct	p.P559S		NM_001163629.1	NP_001157101.1	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	0																	TGATTCCAATCCTGTAGTTAG	0.353																																																	0													169.0	141.0	150.0					1																	170983336		692	1591	2283	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367759.4:c.1675C>T	1.37:g.170983336C>T	ENSP00000356733:p.Pro559Ser		A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.P559S	ENST00000367759.4	37	c.1675	CCDS53429.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.817|6.817	0.519817|0.519817	0.13005|0.13005	.|.	.|.	ENSG00000117501|ENSG00000117501	ENST00000367759|ENST00000426136	T|.	0.72051|.	-0.62|.	5.73|5.73	3.85|3.85	0.44370|0.44370	.|.	.|.	.|.	.|.	.|.	T|T	0.17023|0.17023	0.0409|0.0409	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	D|.	0.89917|.	1.0|.	D|.	0.79784|.	0.993|.	T|T	0.13522|0.13522	-1.0506|-1.0506	9|5	0.29301|.	T|.	0.29|.	.|.	9.0815|9.0815	0.36554|0.36554	0.0:0.8277:0.0:0.1723|0.0:0.8277:0.0:0.1723	.|.	559|.	F5GWX6|.	.|.	S|F	559|165	ENSP00000356733:P559S|.	ENSP00000356733:P559S|.	P|S	+|+	1|2	0|0	C1orf129|C1orf129	169249960|169249960	0.011000|0.011000	0.17503|0.17503	0.032000|0.032000	0.17829|0.17829	0.067000|0.067000	0.16453|0.16453	0.815000|0.815000	0.27253|0.27253	1.432000|1.432000	0.47375|0.47375	0.585000|0.585000	0.79938|0.79938	CCT|TCC	MROH9	-	superfamily_ARM-type_fold	ENSG00000117501		0.353	MROH9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH9	HGNC	protein_coding		-	0.00	31	0	C	NM_025063		170983336	+1	tier1	-	no_errors	ENST00000367759	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.083	T
MRPL18	29074	genome.wustl.edu	37	6	160212043	160212043	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:160212043G>A	ENST00000367034.4	+	2	246	c.124G>A	c.(124-126)Gaa>Aaa	p.E42K	TCP1_ENST00000321394.7_5'Flank|TCP1_ENST00000546023.1_5'Flank|TCP1_ENST00000420894.2_5'Flank|MRPL18_ENST00000480842.1_3'UTR|TCP1_ENST00000392168.2_5'Flank|TCP1_ENST00000544255.1_5'Flank	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18	42					rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		TGTGGAAAATGAAGCTGTCGC	0.612																																																	0													31.0	34.0	33.0					6																	160212043		2203	4300	6503	SO:0001583	missense	0			AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.124G>A	6.37:g.160212043G>A	ENSP00000356001:p.Glu42Lys		Q5TAP9|Q9NZW8	Missense_Mutation	SNP	pfam_Ribosomal_L18/L5	p.E42K	ENST00000367034.4	37	c.124	CCDS5270.1	6	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753849	0.69648	.	.	ENSG00000112110	ENST00000367034	T	0.49139	0.79	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.39279	0.1072	M	0.68952	2.095	0.80722	D	1	P	0.40050	0.7	B	0.37480	0.251	T	0.40831	-0.9542	10	0.44086	T	0.13	-15.0749	19.2079	0.93742	0.0:0.0:1.0:0.0	.	42	Q9H0U6	RM18_HUMAN	K	42	ENSP00000356001:E42K	ENSP00000356001:E42K	E	+	1	0	MRPL18	160132033	1.000000	0.71417	0.983000	0.44433	0.590000	0.36582	7.309000	0.78937	2.768000	0.95171	0.655000	0.94253	GAA	MRPL18	-	NULL	ENSG00000112110		0.612	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL18	HGNC	protein_coding	OTTHUMT00000042925.1	-	0.00	88	0	G			160212043	+1	tier1	-	no_errors	ENST00000367034	ensembl	human	known	74_37	missense	8.13	113	10	SNP	1.000	A
MTMR14	64419	genome.wustl.edu	37	3	9726928	9726928	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:9726928G>A	ENST00000296003.4	+	13	1283	c.1161G>A	c.(1159-1161)gaG>gaA	p.E387E	MTMR14_ENST00000351233.5_Silent_p.E387E|MTMR14_ENST00000420925.1_Silent_p.E141E|MTMR14_ENST00000353332.5_Silent_p.E387E	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	387					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					GCAAAGGGGAGGAGGTGAGTA	0.552																																																	0													151.0	142.0	145.0					3																	9726928		2129	4248	6377	SO:0001819	synonymous_variant	0			BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1161G>A	3.37:g.9726928G>A			Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Silent	SNP	NULL	p.E387	ENST00000296003.4	37	c.1161	CCDS43043.1	3																																																																																			MTMR14	-	NULL	ENSG00000163719		0.552	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR14	HGNC	protein_coding	OTTHUMT00000338435.1	-	0.00	58	0	G	NM_022485		9726928	+1	tier1	-	no_errors	ENST00000296003	ensembl	human	known	74_37	silent	12.35	71	10	SNP	1.000	A
MTUS2	23281	genome.wustl.edu	37	13	29599324	29599324	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:29599324G>T	ENST00000431530.3	+	1	577	c.519G>T	c.(517-519)ctG>ctT	p.L173L		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	163						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGGATAAACTGGCAAAGACCC	0.517																																																	0													86.0	88.0	87.0					13																	29599324		2018	4196	6214	SO:0001819	synonymous_variant	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.519G>T	13.37:g.29599324G>T			A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	NULL	p.L173	ENST00000431530.3	37	c.519	CCDS45022.1	13																																																																																			MTUS2	-	NULL	ENSG00000132938		0.517	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	-	0.00	50	0	G	XM_166270		29599324	+1	tier1	-	no_errors	ENST00000431530	ensembl	human	known	74_37	silent	12.77	41	6	SNP	0.146	T
MUC12	10071	genome.wustl.edu	37	7	100648403	100648403	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:100648403C>G	ENST00000379442.3	+	5	14988	c.14988C>G	c.(14986-14988)ttC>ttG	p.F4996L	MUC12_ENST00000536621.1_Missense_Mutation_p.F4853L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4996	Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CTACCACCTTCTACAGCAGCC	0.517																																																	0													148.0	128.0	134.0					7																	100648403		692	1591	2283	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.14988C>G	7.37:g.100648403C>G	ENSP00000368755:p.Phe4996Leu		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.F4853L	ENST00000379442.3	37	c.14559		7	.	.	.	.	.	.	.	.	.	.	C	2.669	-0.277968	0.05679	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12774	2.65;2.65	0.762	-0.805	0.10879	.	.	.	.	.	T	0.04634	0.0126	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.43782	-0.9370	7	0.10636	T	0.68	.	4.3957	0.11362	0.0:0.582:0.0:0.418	.	.	.	.	L	4996;4853	ENSP00000368755:F4996L;ENSP00000441929:F4853L	ENSP00000368755:F4996L	F	+	3	2	MUC12	100435123	0.000000	0.05858	0.001000	0.08648	0.047000	0.14425	0.130000	0.15850	-0.306000	0.08818	0.205000	0.17691	TTC	MUC12	-	NULL	ENSG00000205277		0.517	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	113	0	C	XM_379904		100648403	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	6.08	139	9	SNP	0.012	G
MUC12	10071	genome.wustl.edu	37	7	100648615	100648615	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:100648615C>T	ENST00000379442.3	+	5	15200	c.15200C>T	c.(15199-15201)tCc>tTc	p.S5067F	MUC12_ENST00000536621.1_Missense_Mutation_p.S4924F			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	5067					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CCTGCCCGCTCCACAGCCTCA	0.532																																																	0													154.0	144.0	147.0					7																	100648615		692	1591	2283	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.15200C>T	7.37:g.100648615C>T	ENSP00000368755:p.Ser5067Phe		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.S4924F	ENST00000379442.3	37	c.14771		7	.	.	.	.	.	.	.	.	.	.	C	0.800	-0.755718	0.03019	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11063	2.83;2.81	0.94	-0.0771	0.13720	.	.	.	.	.	T	0.05273	0.0140	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.37842	-0.9688	7	0.72032	D	0.01	.	3.2965	0.06968	0.0:0.6757:0.0:0.3243	.	.	.	.	F	5067;4924	ENSP00000368755:S5067F;ENSP00000441929:S4924F	ENSP00000368755:S5067F	S	+	2	0	MUC12	100435335	.	.	0.001000	0.08648	0.011000	0.07611	.	.	-0.032000	0.13758	0.196000	0.17591	TCC	MUC12	-	NULL	ENSG00000205277		0.532	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	138	0	C	XM_379904		100648615	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	11.88	141	19	SNP	0.001	T
MUC15	143662	genome.wustl.edu	37	11	26587248	26587248	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:26587248G>C	ENST00000455601.2	-	2	276	c.158C>G	c.(157-159)gCa>gGa	p.A53G	ANO3_ENST00000531568.1_Intron|MUC15_ENST00000281268.8_Missense_Mutation_p.A80G|MUC15_ENST00000527569.1_Missense_Mutation_p.A80G|ANO3_ENST00000256737.3_Intron|MUC15_ENST00000529533.1_Missense_Mutation_p.A80G|MUC15_ENST00000436318.2_Missense_Mutation_p.A80G|ANO3_ENST00000525139.1_Intron|ANO3_ENST00000537978.1_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	53					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						GTTTAAGTTTGCTTCACTTTC	0.363																																																	0													98.0	93.0	94.0					11																	26587248		2203	4300	6503	SO:0001583	missense	0			AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.158C>G	11.37:g.26587248G>C	ENSP00000397339:p.Ala53Gly		B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	NULL	p.A80G	ENST00000455601.2	37	c.239	CCDS7859.1	11	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621780	0.28889	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.25749	1.82;1.8;1.78;1.8;1.78	4.3	-4.71	0.03279	.	1.298270	0.05065	N	0.480570	T	0.17365	0.0417	L	0.38175	1.15	0.09310	N	1	P;B;B	0.38020	0.615;0.358;0.358	B;B;B	0.37144	0.242;0.154;0.154	T	0.27365	-1.0076	10	0.52906	T	0.07	-14.3462	3.9762	0.09475	0.4892:0.0:0.2266:0.2842	.	80;53;80	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	G	53;80;80;80;80	ENSP00000397339:A53G;ENSP00000416753:A80G;ENSP00000281268:A80G;ENSP00000431983:A80G;ENSP00000431945:A80G	ENSP00000281268:A80G	A	-	2	0	MUC15	26543824	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	-1.183000	0.03079	-0.718000	0.04949	0.555000	0.69702	GCA	MUC15	-	NULL	ENSG00000169550		0.363	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC15	HGNC	protein_coding	OTTHUMT00000387866.1	-	0.00	107	0	G	NM_145650		26587248	-1	tier1	-	no_errors	ENST00000436318	ensembl	human	known	74_37	missense	5.51	120	7	SNP	0.000	C
MUC19	283463	genome.wustl.edu	37	12	40858259	40858259	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:40858259G>T	ENST00000454784.4	+	41	4365	c.3632G>T	c.(3631-3633)aGc>aTc	p.S1211I				Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	1211	Approximate repeats of G-V-T-G-T-T-G-P-S- A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						ATCACTGCCAGCCCTGGAGCC	0.468																																																	0																																										SO:0001583	missense	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.3632G>T	12.37:g.40858259G>T	ENSP00000476404:p.Ser1211Ile		Q8NA85	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich	p.S1211I	ENST00000454784.4	37	c.3632		12	.	.	.	.	.	.	.	.	.	.	G	9.330	1.060218	0.19987	.	.	ENSG00000205592	ENST00000425730	.	.	.	1.72	0.792	0.18625	.	.	.	.	.	T	0.16981	0.0408	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.20739	-1.0266	6	0.38643	T	0.18	.	4.1769	0.10356	0.2198:0.0:0.7802:0.0	.	.	.	.	I	1440	.	ENSP00000395253:S1440I	S	+	2	0	MUC19	39144526	0.000000	0.05858	0.001000	0.08648	0.197000	0.23852	0.096000	0.15147	0.269000	0.21961	0.655000	0.94253	AGC	MUC19	-	NULL	ENSG00000205592		0.468	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	-	0.00	40	0	G	XM_003403524		40858259	+1	tier1	-	no_errors	ENST00000454784	ensembl	human	novel	74_37	missense	6.90	54	4	SNP	0.001	T
MUC4	4585	genome.wustl.edu	37	3	195517903	195517903	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:195517903G>T	ENST00000463781.3	-	2	1007	c.548C>A	c.(547-549)tCc>tAc	p.S183Y	MUC4_ENST00000475231.1_Missense_Mutation_p.S183Y|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	188					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGTCCTCCAGGAAGTTGTTCG	0.502																																																	0													230.0	213.0	219.0					3																	195517903		2051	4204	6255	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.548C>A	3.37:g.195517903G>T	ENSP00000417498:p.Ser183Tyr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S183Y	ENST00000463781.3	37	c.548	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	6.707	0.499075	0.12762	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.39056	1.1;1.1	3.34	-0.508	0.11980	.	0.825129	0.09888	U	0.742784	T	0.34279	0.0892	L	0.34521	1.04	0.09310	N	1	D;P	0.54772	0.968;0.936	P;P	0.47603	0.551;0.501	T	0.23797	-1.0178	10	0.66056	D	0.02	.	6.0737	0.19903	0.4993:0.0:0.5007:0.0	.	183;188	E7ESK3;Q99102	.;MUC4_HUMAN	Y	183;183;157	ENSP00000417498:S183Y;ENSP00000420243:S183Y	ENSP00000376209:S157Y	S	-	2	0	MUC4	197002298	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.626000	0.24492	-0.115000	0.11915	0.531000	0.56144	TCC	MUC4	-	NULL	ENSG00000145113		0.502	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	83	0	G	NM_018406		195517903	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	20.00	80	20	SNP	0.000	T
MUC5B	727897	genome.wustl.edu	37	11	1263506	1263506	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:1263506C>A	ENST00000529681.1	+	31	5454	c.5396C>A	c.(5395-5397)cCa>cAa	p.P1799Q	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.P1802Q	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1799	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGACTTCCCAACCTCAGGG	0.582																																																	0													60.0	69.0	66.0					11																	1263506		2055	4193	6248	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5396C>A	11.37:g.1263506C>A	ENSP00000436812:p.Pro1799Gln		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.P1802Q	ENST00000529681.1	37	c.5405	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	c	12.54	1.970029	0.34754	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.26660	1.72;1.72	4.32	4.32	0.51571	.	.	.	.	.	T	0.64382	0.2593	H	0.95645	3.7	0.32738	N	0.508019	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81125	-0.1075	9	0.87932	D	0	.	16.8169	0.85736	0.0:1.0:0.0:0.0	.	2492;1802	A7Y9J9;E9PBJ0	.;.	Q	1799;1802;1800;1869	ENSP00000436812:P1799Q;ENSP00000415793:P1802Q	ENSP00000343037:P1800Q	P	+	2	0	MUC5B	1220082	0.992000	0.36948	0.022000	0.16811	0.768000	0.43524	5.351000	0.66022	1.968000	0.57251	0.306000	0.20318	CCA	MUC5B	-	NULL	ENSG00000117983		0.582	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2		0.00	54	0	C	XM_001126093		1263506	+1			no_errors	ENST00000447027	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.932	A
MUC5B	727897	genome.wustl.edu	37	11	1272626	1272626	+	Missense_Mutation	SNP	C	C	A	rs375836524		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:1272626C>A	ENST00000529681.1	+	31	14574	c.14516C>A	c.(14515-14517)tCc>tAc	p.S4839Y	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.S4842Y	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4839	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCACCCTGTCCTCCACCCCA	0.647																																																	0								C	TYR/SER	0,4288		0,0,2144	117.0	142.0	133.0		14516	-5.3	0.0	11		133	1,8459		0,1,4229	no	missense	MUC5B	NM_002458.2	144	0,1,6373	AA,AC,CC		0.0118,0.0,0.0078	benign	4839/5763	1272626	1,12747	2144	4230	6374	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14516C>A	11.37:g.1272626C>A	ENSP00000436812:p.Ser4839Tyr		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.S4842Y	ENST00000529681.1	37	c.14525	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	3.452	-0.111844	0.06881	0.0	1.18E-4	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.24350	1.86;2.04	2.64	-5.28	0.02755	.	.	.	.	.	T	0.13243	0.0321	L	0.29908	0.895	0.09310	N	1	B;B	0.24186	0.099;0.029	B;B	0.19666	0.026;0.018	T	0.21381	-1.0247	9	0.87932	D	0	.	0.9823	0.01439	0.2914:0.3664:0.1436:0.1986	.	5161;4842	A7Y9J9;E9PBJ0	.;.	Y	4839;4842;4783;4538	ENSP00000436812:S4839Y;ENSP00000415793:S4842Y	ENSP00000343037:S4783Y	S	+	2	0	MUC5B	1229202	0.025000	0.19082	0.000000	0.03702	0.004000	0.04260	3.943000	0.56621	-2.350000	0.00617	-1.549000	0.00901	TCC	MUC5B	-	NULL	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	106	0	C	XM_001126093		1272626	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	8.70	147	14	SNP	0.002	A
MUC7	4589	genome.wustl.edu	37	4	71347113	71347113	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:71347113C>A	ENST00000304887.5	+	3	842	c.652C>A	c.(652-654)Cct>Act	p.P218T	MUC7_ENST00000413702.1_Missense_Mutation_p.P218T|MUC7_ENST00000456088.1_Missense_Mutation_p.P218T	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	218	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			CCCACCCACACCTCCTGCAAC	0.587																																																	0													434.0	375.0	395.0					4																	71347113		2201	4300	6501	SO:0001583	missense	0			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.652C>A	4.37:g.71347113C>A	ENSP00000302021:p.Pro218Thr		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	NULL	p.P218T	ENST00000304887.5	37	c.652	CCDS3541.1	4	.	.	.	.	.	.	.	.	.	.	C	1.396	-0.579490	0.03854	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.49720	0.77;0.77;0.77	1.77	-3.55	0.04639	.	.	.	.	.	T	0.23330	0.0564	N	0.19112	0.55	0.09310	N	1	B	0.28713	0.22	B	0.26517	0.07	T	0.11060	-1.0603	8	.	.	.	.	2.2146	0.03956	0.1496:0.5042:0.1496:0.1966	.	218	Q8TAX7	MUC7_HUMAN	T	218	ENSP00000407422:P218T;ENSP00000400585:P218T;ENSP00000302021:P218T	.	P	+	1	0	MUC7	71381702	0.116000	0.22171	0.000000	0.03702	0.001000	0.01503	-0.211000	0.09332	-2.045000	0.00910	-0.373000	0.07131	CCT	MUC7	-	NULL	ENSG00000171195		0.587	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC7	HGNC	protein_coding	OTTHUMT00000252168.2	-	0.00	165	0	C	NM_152291		71347113	+1	tier1	-	no_errors	ENST00000304887	ensembl	human	known	74_37	missense	14.94	205	36	SNP	0.001	A
LINC01317	104355287	genome.wustl.edu	37	2	33951234	33951234	+	lincRNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:33951234C>A	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							GCTGGAAGGCCACATCACTGT	0.348																																																	0																																												0																															2.37:g.33951234C>A				RNA	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-	ENSG00000239649		0.348	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1		0.00	24	0	C			33951234	-1			no_errors	ENST00000474610	ensembl	human	known	74_37	rna	11.54	22	3	SNP	0.002	A
MYH13	8735	genome.wustl.edu	37	17	10204930	10204930	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:10204930G>T	ENST00000418404.3	-	39	5921	c.5758C>A	c.(5758-5760)Cag>Aag	p.Q1920K	MYH13_ENST00000252172.4_Missense_Mutation_p.Q1920K|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1920					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TTGTTGACCTGGGACTCAGCG	0.592																																																	0													97.0	104.0	102.0					17																	10204930		2203	4300	6503	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5758C>A	17.37:g.10204930G>T	ENSP00000404570:p.Gln1920Lys		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1920K	ENST00000418404.3	37	c.5758	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876720	0.72180	.	.	ENSG00000006788	ENST00000252172	T	0.74842	-0.88	3.76	3.76	0.43208	Myosin tail (1);	.	.	.	.	D	0.88123	0.6352	H	0.94964	3.605	0.45087	D	0.998105	P	0.51933	0.949	P	0.58660	0.843	D	0.92044	0.5643	9	0.72032	D	0.01	.	16.1271	0.81402	0.0:0.0:1.0:0.0	.	1920	Q9UKX3	MYH13_HUMAN	K	1920	ENSP00000252172:Q1920K	ENSP00000252172:Q1920K	Q	-	1	0	MYH13	10145655	1.000000	0.71417	1.000000	0.80357	0.250000	0.25880	9.544000	0.98092	2.097000	0.63578	0.484000	0.47621	CAG	MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.592	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	-	0.00	80	0	G	NM_003802		10204930	-1	tier1	-	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	9.48	105	11	SNP	1.000	T
MYH13	8735	genome.wustl.edu	37	17	10216024	10216024	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:10216024G>T	ENST00000418404.3	-	30	4395	c.4232C>A	c.(4231-4233)gCg>gAg	p.A1411E	MYH13_ENST00000252172.4_Missense_Mutation_p.A1411E|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1411					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTTGGAGTTCGCCGTCTCCGT	0.542																																																	0													47.0	51.0	50.0					17																	10216024		2194	4295	6489	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4232C>A	17.37:g.10216024G>T	ENSP00000404570:p.Ala1411Glu		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1411E	ENST00000418404.3	37	c.4232	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	G	13.97	2.394980	0.42512	.	.	ENSG00000006788	ENST00000252172	T	0.78924	-1.22	3.96	1.8	0.24995	Myosin tail (1);	.	.	.	.	D	0.83008	0.5161	M	0.71036	2.16	0.26213	N	0.979273	B	0.22604	0.072	P	0.48227	0.571	T	0.78393	-0.2221	9	0.72032	D	0.01	.	5.1597	0.15054	0.6676:0.0:0.3324:0.0	.	1411	Q9UKX3	MYH13_HUMAN	E	1411	ENSP00000252172:A1411E	ENSP00000252172:A1411E	A	-	2	0	MYH13	10156749	0.960000	0.32886	0.059000	0.19551	0.541000	0.35023	3.174000	0.50847	0.323000	0.23307	0.462000	0.41574	GCG	MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.542	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	-	0.00	58	0	G	NM_003802		10216024	-1	tier1	-	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	6.59	85	6	SNP	0.911	T
MYH8	4626	genome.wustl.edu	37	17	10296408	10296408	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:10296408G>A	ENST00000403437.2	-	36	5380	c.5286C>T	c.(5284-5286)atC>atT	p.I1762I	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1762					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TTACATCAGTGATGGCCTTCT	0.388									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0													316.0	275.0	289.0					17																	10296408		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.5286C>T	17.37:g.10296408G>A			Q14910	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I1762	ENST00000403437.2	37	c.5286	CCDS11153.1	17																																																																																			MYH8	-	pfam_Myosin_tail	ENSG00000133020		0.388	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	-	0.00	142	0	G	NM_002472		10296408	-1	tier1	-	no_errors	ENST00000403437	ensembl	human	known	74_37	silent	6.70	181	13	SNP	1.000	A
MYH2	4620	genome.wustl.edu	37	17	10432019	10432019	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:10432019G>T	ENST00000245503.5	-	27	4116	c.3732C>A	c.(3730-3732)gtC>gtA	p.V1244V	MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000397183.2_Silent_p.V1244V|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1244					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TGGCTTTGGAGACCGTTTCTA	0.408																																																	0													123.0	119.0	121.0					17																	10432019		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3732C>A	17.37:g.10432019G>T			A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1244	ENST00000245503.5	37	c.3732	CCDS11156.1	17																																																																																			MYH2	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000125414		0.408	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	-	0.00	135	0	G	NM_017534		10432019	-1	tier1	-	no_errors	ENST00000245503	ensembl	human	known	74_37	silent	8.24	167	15	SNP	0.861	T
MYCBPAP	84073	genome.wustl.edu	37	17	48599356	48599356	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:48599356G>C	ENST00000323776.5	+	10	1462	c.1300G>C	c.(1300-1302)Gat>Cat	p.D434H	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.D397H	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			CAGTTCCTCTGATGTCTCCAT	0.512																																																	0													152.0	132.0	139.0					17																	48599356		2203	4300	6503	SO:0001583	missense	0			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1300G>C	17.37:g.48599356G>C	ENSP00000323184:p.Asp434His			Missense_Mutation	SNP	NULL	p.D434H	ENST00000323776.5	37	c.1300	CCDS32680.2	17	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629228	0.46944	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.49432	0.78;0.78	5.38	4.42	0.53409	.	0.405033	0.25166	N	0.032625	T	0.68293	0.2985	M	0.80847	2.515	0.25312	N	0.989199	D;D	0.89917	0.999;1.0	D;D	0.75484	0.975;0.986	T	0.62558	-0.6829	10	0.46703	T	0.11	-9.287	13.0574	0.58988	0.0789:0.0:0.9211:0.0	.	397;434	Q8TBZ2;B4DZQ1	MYBPP_HUMAN;.	H	434;397	ENSP00000323184:D434H;ENSP00000397209:D397H	ENSP00000323184:D434H	D	+	1	0	MYCBPAP	45954355	0.446000	0.25665	0.015000	0.15790	0.004000	0.04260	2.098000	0.41757	1.270000	0.44297	-0.145000	0.13849	GAT	MYCBPAP	-	NULL	ENSG00000136449		0.512	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYCBPAP	HGNC	protein_coding	OTTHUMT00000347814.1	-	0.00	85	0	G	NM_032133		48599356	+1	tier1	-	no_errors	ENST00000323776	ensembl	human	known	74_37	missense	12.00	88	12	SNP	0.365	C
MYL6	4637	genome.wustl.edu	37	12	56552187	56552187	+	Splice_Site	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:56552187T>C	ENST00000550697.1	+	1	243	c.2T>C	c.(1-3)aTg>aCg	p.M1T	MYL6_ENST00000547649.1_Splice_Site_p.M1T|MYL6_ENST00000536128.1_Start_Codon_SNP_p.M1T|MYL6_ENST00000548400.1_Splice_Site_p.M1T|MYL6_ENST00000348108.4_Splice_Site_p.M1T|MYL6_ENST00000548580.1_Splice_Site_p.M1T|MYL6_ENST00000551589.1_Splice_Site_p.M1T|MYL6_ENST00000548293.1_Splice_Site_p.M1T|MYL6_ENST00000547408.1_Splice_Site_p.M1T|MYL6_ENST00000549017.1_5'UTR|MYL6_ENST00000293422.5_Splice_Site_p.M1T|RP11-603J24.14_ENST00000548731.1_RNA|MYL6_ENST00000549566.1_Start_Codon_SNP_p.M1T	NM_021019.4	NP_066299.2	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and non-muscle	1					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)|vesicle (GO:0031982)	actin-dependent ATPase activity (GO:0030898)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			large_intestine(1)|lung(1)|ovary(1)|prostate(3)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			GCAGTCAAGATGGTGGGGCCC	0.617																																																	0													53.0	48.0	50.0					12																	56552187		2203	4300	6503	SO:0001630	splice_region_variant	0			AB046613	CCDS8906.1, CCDS31834.1	12q13.13	2013-01-10	2006-09-29			ENSG00000092841		"""Myosins / Light chain"", ""EF-hand domain containing"""	7587	protein-coding gene	gene with protein product		609931	"""myosin, light polypeptide 6, alkali, smooth muscle and non-muscle"""			8188229, 2304459, 2722814	Standard	NM_021019		Approved	ESMLC, MLC3NM, MLC1SM	uc001sjx.2	P60660		ENST00000550697.1:c.3+1T>C	12.37:g.56552187T>C			P16475|P24572|P24573|Q12790|Q561V9|Q6IAZ0|Q6IPY5	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.M1T	ENST00000550697.1	37	c.2	CCDS8906.1	12	.	.	.	.	.	.	.	.	.	.	t	13.99	2.402688	0.42613	.	.	ENSG00000092841	ENST00000550697;ENST00000548580;ENST00000293422;ENST00000348108;ENST00000549566;ENST00000536128;ENST00000547649;ENST00000547408;ENST00000551589;ENST00000553056;ENST00000549392;ENST00000548400;ENST00000548293	T;T;T;T;T;T;T;T;T;T;T;T	0.76709	-0.8;-0.55;-0.77;-0.73;-1.04;-1.0;-0.85;-0.84;-0.82;-0.72;-0.7;-0.8	4.69	4.69	0.59074	.	0.344590	0.18986	U	0.125743	D	0.85461	0.5702	.	.	.	0.80722	D	1	D;P;B;B	0.54601	0.967;0.919;0.079;0.068	D;P;B;B	0.63597	0.916;0.667;0.046;0.087	D	0.86513	0.1811	9	0.87932	D	0	.	10.7348	0.46117	0.0:0.0:0.0:1.0	.	1;1;1;1	B7Z6Z4;P60660-2;P60660;F8W1R7	.;.;MYL6_HUMAN;.	T	1	ENSP00000446955:M1T;ENSP00000446640:M1T;ENSP00000293422:M1T;ENSP00000301540:M1T;ENSP00000446709:M1T;ENSP00000441750:M1T;ENSP00000446714:M1T;ENSP00000446721:M1T;ENSP00000446687:M1T;ENSP00000450116:M1T;ENSP00000448859:M1T;ENSP00000448101:M1T	ENSP00000293422:M1T	M	+	2	0	MYL6	54838454	1.000000	0.71417	1.000000	0.80357	0.622000	0.37654	3.413000	0.52686	2.104000	0.64026	0.454000	0.30748	ATG	MYL6	-	NULL	ENSG00000092841		0.617	MYL6-003	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	MYL6	HGNC	protein_coding	OTTHUMT00000407928.3	-	0.00	56	0	T		Missense_Mutation	56552187	+1	tier1	-	no_errors	ENST00000547649	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	C
NBPF22P	285622	genome.wustl.edu	37	5	85583508	85583508	+	RNA	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:85583508G>C	ENST00000590707.1	+	0	774					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		GCCAGGAGCTGCCAGAGGTGA	0.527																																																	0																																												0			BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85583508G>C				RNA	SNP	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			NBPF22P	-	-	ENSG00000205449		0.527	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	HGNC	pseudogene	OTTHUMT00000453100.1	-	0.00	155	0	G	XM_208333		85583508	+1	tier1	-	no_errors	ENST00000590707	ensembl	human	known	74_37	rna	7.41	125	10	SNP	0.001	C
NDUFB10	4716	genome.wustl.edu	37	16	2011893	2011893	+	Missense_Mutation	SNP	G	G	A	rs375613670		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:2011893G>A	ENST00000268668.6	+	4	622	c.505G>A	c.(505-507)Gct>Act	p.A169T	NDUFB10_ENST00000543683.2_3'UTR|NDUFB10_ENST00000569148.1_Missense_Mutation_p.A158T|SNORA10_ENST00000384084.1_RNA|SNORA64_ENST00000384674.1_RNA	NM_004548.2	NP_004539.1	O96000	NDUBA_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa	169					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			lung(1)|urinary_tract(1)	2						AGAGGCCGCCGCTGCCACCTC	0.582																																																	0								G	THR/ALA	1,4339		0,1,2169	17.0	22.0	20.0		505	3.8	0.7	16		20	1,8493		0,1,4246	no	missense	NDUFB10	NM_004548.2	58	0,2,6415	AA,AG,GG		0.0118,0.023,0.0156	benign	169/173	2011893	2,12832	2170	4247	6417	SO:0001583	missense	0			AF044954	CCDS10451.1	16p13.3	2011-07-04	2002-08-29		ENSG00000140990	ENSG00000140990		"""Mitochondrial respiratory chain complex / Complex I"""	7696	protein-coding gene	gene with protein product	"""complex I PDSW subunit"""	603843	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (22kD, PDSW)"""			9763677, 9878551	Standard	NM_004548		Approved	PDSW	uc002cni.2	O96000	OTTHUMG00000128709	ENST00000268668.6:c.505G>A	16.37:g.2011893G>A	ENSP00000268668:p.Ala169Thr		Q96II6	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_su10	p.A169T	ENST00000268668.6	37	c.505	CCDS10451.1	16	.	.	.	.	.	.	.	.	.	.	g	13.51	2.257848	0.39896	2.3E-4	1.18E-4	ENSG00000140990	ENST00000268668	.	.	.	4.75	3.79	0.43588	.	0.000000	0.32028	U	0.006684	T	0.35682	0.0940	M	0.68317	2.08	0.19945	N	0.999944	B	0.28470	0.213	B	0.16289	0.015	T	0.33394	-0.9870	9	0.49607	T	0.09	.	6.6561	0.22988	0.0979:0.1811:0.721:0.0	.	169	O96000	NDUBA_HUMAN	T	169	.	ENSP00000268668:A169T	A	+	1	0	NDUFB10	1951894	0.362000	0.24980	0.677000	0.29947	0.108000	0.19459	1.922000	0.40045	1.010000	0.39314	0.563000	0.77884	GCT	NDUFB10	-	NULL	ENSG00000140990		0.582	NDUFB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB10	HGNC	protein_coding	OTTHUMT00000250614.2		0.00	61	0	G	NM_004548		2011893	+1			no_errors	ENST00000268668	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.374	A
NEDD8	4738	genome.wustl.edu	37	14	24686403	24686403	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:24686403T>A	ENST00000250495.5	-	4	362	c.176A>T	c.(175-177)tAc>tTc	p.Y59F	NEDD8-MDP1_ENST00000534348.1_Intron|AL136419.6_ENST00000565988.1_RNA|MDP1_ENST00000396833.2_5'Flank|MDP1_ENST00000532557.1_5'Flank|NEDD8-MDP1_ENST00000604306.1_Intron|MDP1_ENST00000288087.7_5'Flank	NM_006156.2	NP_006147.1	Q15843	NEDD8_HUMAN	neural precursor cell expressed, developmentally down-regulated 8	59					anatomical structure morphogenesis (GO:0009653)|cellular protein modification process (GO:0006464)|protein localization (GO:0008104)|protein neddylation (GO:0045116)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to organic cyclic compound (GO:0014070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5				GBM - Glioblastoma multiforme(265;0.0186)		TAAAATCTTGTAATCAGCTGC	0.428																																																	0													77.0	63.0	68.0					14																	24686403		2203	4300	6503	SO:0001583	missense	0			D23662	CCDS9621.1	14q11.2	2008-08-13			ENSG00000129559	ENSG00000129559			7732	protein-coding gene	gene with protein product		603171				9353319	Standard	NM_006156		Approved	Nedd-8		Q15843	OTTHUMG00000029325	ENST00000250495.5:c.176A>T	14.37:g.24686403T>A	ENSP00000250495:p.Tyr59Phe		Q3SXN8|Q6LES6	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.Y59F	ENST00000250495.5	37	c.176	CCDS9621.1	14	.	.	.	.	.	.	.	.	.	.	T	21.9	4.212703	0.79352	.	.	ENSG00000129559	ENST00000250495	T	0.80824	-1.42	4.96	4.96	0.65561	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	T	0.76147	0.3947	.	.	.	0.80722	D	1	B	0.23806	0.091	B	0.25140	0.058	T	0.75693	-0.3229	9	0.87932	D	0	-4.7474	13.7442	0.62865	0.0:0.0:0.0:1.0	.	59	Q15843	NEDD8_HUMAN	F	59	ENSP00000250495:Y59F	ENSP00000250495:Y59F	Y	-	2	0	NEDD8	23756243	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.657000	0.74402	2.071000	0.62044	0.477000	0.44152	TAC	NEDD8-MDP1	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	ENSG00000255526		0.428	NEDD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEDD8-MDP1	HGNC	protein_coding	OTTHUMT00000073146.2		0.00	43	0	T	NM_006156		24686403	-1			no_errors	ENST00000605847	ensembl	human	known	74_37	missense	6.33	74	5	SNP	1.000	A
NEK10	152110	genome.wustl.edu	37	3	27385845	27385845	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:27385845C>A	ENST00000429845.2	-	6	642	c.280G>T	c.(280-282)Gag>Tag	p.E94*	NEK10_ENST00000341435.5_Nonsense_Mutation_p.E94*			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	94					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						AAATTTCTCTCATTCTTGTAG	0.368																																																	0													102.0	85.0	90.0					3																	27385845		1565	3580	5145	SO:0001587	stop_gained	0			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.280G>T	3.37:g.27385845C>A	ENSP00000395849:p.Glu94*		A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Aminoglycoside_PTrfase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E94*	ENST00000429845.2	37	c.280		3	.	.	.	.	.	.	.	.	.	.	C	40	8.133856	0.98670	.	.	ENSG00000163491	ENST00000341435;ENST00000396636;ENST00000435750;ENST00000429845	.	.	.	5.76	5.76	0.90799	.	0.169368	0.50627	D	0.000111	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	18.1155	0.89553	0.0:1.0:0.0:0.0	.	.	.	.	X	94	.	ENSP00000343847:E94X	E	-	1	0	NEK10	27360849	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.189000	0.65098	2.880000	0.98712	0.650000	0.86243	GAG	NEK10	-	NULL	ENSG00000163491		0.368	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	HGNC	protein_coding	OTTHUMT00000438156.1	-	0.00	71	0	C	NM_152534		27385845	-1	tier1	-	no_errors	ENST00000341435	ensembl	human	known	74_37	nonsense	7.25	64	5	SNP	1.000	A
NFKB1	4790	genome.wustl.edu	37	4	103518697	103518697	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:103518697G>A	ENST00000505458.1	+	15	1790	c.1513G>A	c.(1513-1515)Gct>Act	p.A505T	NFKB1_ENST00000394820.4_Missense_Mutation_p.A505T|NFKB1_ENST00000600343.1_Missense_Mutation_p.A325T|NFKB1_ENST00000226574.4_Missense_Mutation_p.A506T			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	505	Interaction with CFLAR.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	TCTAGAGAAGGCTATGCAGCT	0.483																																																	0													109.0	99.0	102.0					4																	103518697		2203	4300	6503	SO:0001583	missense	0			M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.1513G>A	4.37:g.103518697G>A	ENSP00000424790:p.Ala505Thr		A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	pfam_RHD,pfam_Ankyrin_rpt,pfam_Death_domain,superfamily_p53-like_TF_DNA-bd,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ig_E-set,superfamily_DEATH-like_dom,smart_IPT,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_RHD,prints_NF_Rel_Dor,prints_Ankyrin_rpt	p.A506T	ENST00000505458.1	37	c.1516	CCDS54783.1	4	.	.	.	.	.	.	.	.	.	.	G	24.3	4.515459	0.85389	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000505458	T;T;T	0.38401	1.15;1.14;1.14	4.57	4.57	0.56435	.	0.150817	0.42821	D	0.000657	T	0.53481	0.1799	L	0.56769	1.78	0.48762	D	0.999701	D;D;D	0.69078	0.997;0.997;0.996	P;P;P	0.60609	0.877;0.877;0.857	T	0.55114	-0.8191	10	0.49607	T	0.09	.	17.5817	0.87970	0.0:0.0:1.0:0.0	.	325;505;506	B3KVE8;P19838;P19838-2	.;NFKB1_HUMAN;.	T	506;505;505	ENSP00000226574:A506T;ENSP00000378297:A505T;ENSP00000424790:A505T	ENSP00000226574:A506T	A	+	1	0	NFKB1	103737735	1.000000	0.71417	0.996000	0.52242	0.908000	0.53690	4.954000	0.63631	2.376000	0.81061	0.655000	0.94253	GCT	NFKB1	-	NULL	ENSG00000109320		0.483	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	NFKB1	HGNC	protein_coding	OTTHUMT00000363411.1	-	0.00	61	0	G			103518697	+1	tier1	-	no_errors	ENST00000226574	ensembl	human	known	74_37	missense	19.35	50	12	SNP	1.000	A
NKAIN4	128414	genome.wustl.edu	37	20	61879034	61879034	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:61879034C>G	ENST00000370316.3	-	4	456	c.367G>C	c.(367-369)Ggc>Cgc	p.G123R	NKAIN4_ENST00000370313.1_Missense_Mutation_p.G61R|NKAIN4_ENST00000466885.1_5'UTR|NKAIN4_ENST00000370307.2_Missense_Mutation_p.G61R	NM_152864.3	NP_690603.3	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|lung(1)|ovary(1)	4	all_cancers(38;2.72e-09)					GCCCCGAGGCCCACTGCTGGC	0.667																																																	0													17.0	17.0	17.0					20																	61879034		1909	3598	5507	SO:0001583	missense	0			BC041812	CCDS13514.1	20q13.33	2007-10-04	2007-10-04	2007-10-04	ENSG00000101198	ENSG00000101198		"""Na+/K+ transporting ATPase interacting"""	16191	protein-coding gene	gene with protein product		612873	"""chromosome 20 open reading frame 58"""	C20orf58		17606467	Standard	NM_152864		Approved	bA261N11.2, FAM77A	uc002yek.3	Q8IVV8	OTTHUMG00000032959	ENST00000370316.3:c.367G>C	20.37:g.61879034C>G	ENSP00000359340:p.Gly123Arg		Q4VXQ6|Q9BQU8|Q9BQU9	Missense_Mutation	SNP	pfam_Na/K-Atpase_Interacting	p.G123R	ENST00000370316.3	37	c.367	CCDS13514.1	20	.	.	.	.	.	.	.	.	.	.	C	1.316	-0.600697	0.03744	.	.	ENSG00000101198	ENST00000370313;ENST00000370316;ENST00000370307;ENST00000370317	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	3.48	1.19	0.21007	.	0.064971	0.64402	U	0.000009	T	0.23171	0.0560	L	0.55103	1.725	0.09310	N	0.999999	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.17258	-1.0375	10	0.10111	T	0.7	-17.7757	8.5914	0.33690	0.0:0.795:0.0:0.205	.	61;123	A6NNM2;Q8IVV8	.;NKAI4_HUMAN	R	61;123;61;53	ENSP00000359336:G61R;ENSP00000359340:G123R;ENSP00000359330:G61R;ENSP00000359341:G53R	ENSP00000359330:G61R	G	-	1	0	NKAIN4	61349479	0.007000	0.16637	0.002000	0.10522	0.003000	0.03518	0.734000	0.26101	-0.061000	0.13110	0.313000	0.20887	GGC	NKAIN4	-	pfam_Na/K-Atpase_Interacting	ENSG00000101198		0.667	NKAIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN4	HGNC	protein_coding	OTTHUMT00000080117.3	-	0.00	57	0	C	NM_152864		61879034	-1	tier1	-	no_errors	ENST00000370316	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.121	G
NMUR1	10316	genome.wustl.edu	37	2	232393634	232393634	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:232393634C>T	ENST00000305141.4	-	2	231	c.98G>A	c.(97-99)gGg>gAg	p.G33E		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	33					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GTCAAAGTGCCCCCTGGCCGC	0.597																																																	0													49.0	45.0	46.0					2																	232393634		2203	4300	6503	SO:0001583	missense	0			AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.98G>A	2.37:g.232393634C>T	ENSP00000305877:p.Gly33Glu		O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NeuromedU_rcpt_1,prints_NeuromedU_rcpt,prints_GPCR_Rhodpsn	p.G33E	ENST00000305141.4	37	c.98	CCDS2486.1	2	.	.	.	.	.	.	.	.	.	.	c	8.344	0.829411	0.16749	.	.	ENSG00000171596	ENST00000305141	T	0.65364	-0.15	4.93	2.08	0.27032	.	1.574730	0.03967	N	0.291027	T	0.47135	0.1429	L	0.38531	1.155	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.25745	-1.0123	10	0.02654	T	1	-9.0274	5.3222	0.15887	0.0:0.6449:0.1668:0.1883	.	33	Q9HB89	NMUR1_HUMAN	E	33	ENSP00000305877:G33E	ENSP00000305877:G33E	G	-	2	0	NMUR1	232101878	0.000000	0.05858	0.001000	0.08648	0.057000	0.15508	-0.282000	0.08445	0.127000	0.18452	-0.324000	0.08512	GGG	NMUR1	-	prints_NeuromedU_rcpt_1	ENSG00000171596		0.597	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR1	HGNC	protein_coding	OTTHUMT00000256961.1		0.00	36	0	C	NM_006056		232393634	-1			no_errors	ENST00000305141	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.006	T
NOB1	28987	genome.wustl.edu	37	16	69788599	69788599	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:69788599C>A	ENST00000268802.5	-	2	123	c.94G>T	c.(94-96)Gag>Tag	p.E32*		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	32	PINc.				visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GTGACCACCTCCCGGATGGTG	0.637																																																	0													72.0	63.0	66.0					16																	69788599		2198	4300	6498	SO:0001587	stop_gained	0			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.94G>T	16.37:g.69788599C>A	ENSP00000268802:p.Glu32*		Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Nonsense_Mutation	SNP	pfam_NOB1_Zn-bd,smart_PIN_dom,pirsf_D-site_20S_pre-rRNA_nuclease	p.E32*	ENST00000268802.5	37	c.94	CCDS10884.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.317628	0.95682	.	.	ENSG00000141101	ENST00000268802	.	.	.	4.45	3.5	0.40072	.	0.196946	0.42682	U	0.000666	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4274	0.55556	0.0:0.9166:0.0:0.0834	.	.	.	.	X	32	.	.	E	-	1	0	NOB1	68346100	1.000000	0.71417	0.999000	0.59377	0.888000	0.51559	5.211000	0.65219	1.229000	0.43630	0.591000	0.81541	GAG	NOB1	-	smart_PIN_dom,pirsf_D-site_20S_pre-rRNA_nuclease	ENSG00000141101		0.637	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOB1	HGNC	protein_coding	OTTHUMT00000268958.2	-	0.00	40	0	C	NM_014062		69788599	-1	tier1	-	no_errors	ENST00000268802	ensembl	human	known	74_37	nonsense	10.34	52	6	SNP	1.000	A
NOL8	55035	genome.wustl.edu	37	9	95076562	95076562	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:95076562G>C	ENST00000535387.1	-	6	2344	c.2345C>G	c.(2344-2346)gCt>gGt	p.A782G	NOL8_ENST00000542053.1_Missense_Mutation_p.A714G|NOL8_ENST00000442668.2_Missense_Mutation_p.A782G|NOL8_ENST00000358855.4_Missense_Mutation_p.A714G|NOL8_ENST00000545558.1_Missense_Mutation_p.A782G					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						ATTTGCCAGAGCATTATGCAC	0.418																																																	0													82.0	77.0	78.0					9																	95076562		1943	4134	6077	SO:0001583	missense	0			AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.2345C>G	9.37:g.95076562G>C	ENSP00000441300:p.Ala782Gly			Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A782G	ENST00000535387.1	37	c.2345	CCDS47993.1	9	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744666	0.89663	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000358855;ENST00000545558;ENST00000535387;ENST00000542053;ENST00000432670	T;T;T;T;T;T	0.52526	1.74;1.74;1.74;0.66;1.74;0.66	5.38	5.38	0.77491	.	0.049103	0.85682	D	0.000000	T	0.72269	0.3439	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76214	-0.3041	10	0.87932	D	0	-15.5305	19.1291	0.93397	0.0:0.0:1.0:0.0	.	782	Q76FK4	NOL8_HUMAN	G	782;784;714;782;782;714;782	ENSP00000401177:A782G;ENSP00000351723:A714G;ENSP00000441140:A782G;ENSP00000441300:A782G;ENSP00000440709:A714G;ENSP00000414112:A782G	ENSP00000351723:A714G	A	-	2	0	NOL8	94116383	1.000000	0.71417	0.467000	0.27180	0.941000	0.58515	8.641000	0.91032	2.506000	0.84524	0.561000	0.74099	GCT	NOL8	-	NULL	ENSG00000198000		0.418	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	NOL8	HGNC	protein_coding	OTTHUMT00000053082.2		0.00	38	0	G	NM_017948		95076562	-1			no_errors	ENST00000442668	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	C
NOMO2	283820	genome.wustl.edu	37	16	18540863	18540863	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:18540863C>A	ENST00000381474.3	-	15	1831	c.1766G>T	c.(1765-1767)gGc>gTc	p.G589V	NOMO2_ENST00000543392.1_Missense_Mutation_p.G422V|NOMO2_ENST00000330537.6_Missense_Mutation_p.G589V	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	589						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						CAGCATGTAGCCCGTCTGCCT	0.512																																																	0													10.0	8.0	9.0					16																	18540863		2176	4245	6421	SO:0001583	missense	0			AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.1766G>T	16.37:g.18540863C>A	ENSP00000370883:p.Gly589Val		Q4G177	Missense_Mutation	SNP	pfam_DUF2012,superfamily_Carb-bd-like_fold,superfamily_CarboxyPept-like_regulatory,superfamily_Collagen-bd_Cna_B-typ_dom	p.G589V	ENST00000381474.3	37	c.1766	CCDS32394.1	16	.	.	.	.	.	.	.	.	.	.	.	18.82	3.704311	0.68615	.	.	ENSG00000185164	ENST00000330537;ENST00000381474;ENST00000543392	T;T;T	0.26518	1.91;1.78;1.73	3.0	3.0	0.34707	.	0.000000	0.85682	D	0.000000	T	0.51176	0.1659	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.60193	-0.7311	10	0.72032	D	0.01	-21.641	13.4203	0.60994	0.0:1.0:0.0:0.0	.	422;589	Q4G177;Q5JPE7	.;NOMO2_HUMAN	V	589;589;422	ENSP00000331851:G589V;ENSP00000370883:G589V;ENSP00000439970:G422V	ENSP00000331851:G589V	G	-	2	0	NOMO2	18448364	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	7.587000	0.82613	1.657000	0.50732	0.305000	0.20034	GGC	NOMO2	-	NULL	ENSG00000185164		0.512	NOMO2-002	KNOWN	basic|CCDS	protein_coding	NOMO2	HGNC	protein_coding	OTTHUMT00000435858.1		0.00	137	0	C	NM_001004060		18540863	-1			no_errors	ENST00000381474	ensembl	human	known	74_37	missense	6.82	123	9	SNP	1.000	A
NPAS3	64067	genome.wustl.edu	37	14	34269169	34269169	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:34269169G>A	ENST00000356141.4	+	12	1656	c.1656G>A	c.(1654-1656)gcG>gcA	p.A552A	NPAS3_ENST00000357798.5_Silent_p.A539A|NPAS3_ENST00000551492.1_Silent_p.A557A|NPAS3_ENST00000346562.2_Silent_p.A520A|NPAS3_ENST00000548645.1_Silent_p.A522A			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	552				A -> P (in Ref. 3; AAO17043). {ECO:0000305}.	locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CTCTGGGCGCGATGCAGATCA	0.652																																																	0													48.0	49.0	49.0					14																	34269169		2203	4300	6503	SO:0001819	synonymous_variant	0			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.1656G>A	14.37:g.34269169G>A			Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pfscan_PAS,pfscan_bHLH_dom	p.A552	ENST00000356141.4	37	c.1656	CCDS53891.1	14																																																																																			NPAS3	-	NULL	ENSG00000151322		0.652	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	HGNC	protein_coding	OTTHUMT00000276645.1	-	0.00	72	0	G			34269169	+1	tier1	-	no_errors	ENST00000356141	ensembl	human	known	74_37	silent	14.47	64	11	SNP	0.849	A
NPBWR2	2832	genome.wustl.edu	37	20	62737512	62737512	+	Missense_Mutation	SNP	C	C	G	rs75874947	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:62737512C>G	ENST00000369768.1	-	1	1012	c.673G>C	c.(673-675)Gtg>Ctg	p.V225L		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	225					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					ATGGTGCACACGGGCAGCACG	0.662																																																	0													59.0	50.0	53.0					20																	62737512		2202	4293	6495	SO:0001583	missense	0			U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.673G>C	20.37:g.62737512C>G	ENSP00000358783:p.Val225Leu		Q6NWQ6|Q9H4K3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt	p.V225L	ENST00000369768.1	37	c.673	CCDS13557.1	20	.	.	.	.	.	.	.	.	.	.	C	9.718	1.158894	0.21454	.	.	ENSG00000125522	ENST00000369768	T	0.30182	1.54	3.59	1.22	0.21188	GPCR, rhodopsin-like superfamily (1);	0.082902	0.47093	U	0.000257	T	0.12135	0.0295	N	0.04787	-0.16	0.39370	D	0.966063	P	0.43542	0.81	B	0.38616	0.277	T	0.12760	-1.0535	10	0.45353	T	0.12	.	5.3555	0.16059	0.1983:0.6705:0.0:0.1312	.	225	P48146	NPBW2_HUMAN	L	225	ENSP00000358783:V225L	ENSP00000358783:V225L	V	-	1	0	NPBWR2	62207956	0.024000	0.19004	0.002000	0.10522	0.155000	0.21991	0.719000	0.25881	-0.068000	0.12953	0.491000	0.48974	GTG	NPBWR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000125522		0.662	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR2	HGNC	protein_coding	OTTHUMT00000080300.1	-	0.00	50	0	C	NM_005286		62737512	-1	tier1	-	no_errors	ENST00000369768	ensembl	human	known	74_37	missense	15.79	48	9	SNP	0.983	G
NPHP3	27031	genome.wustl.edu	37	3	132441160	132441160	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:132441160C>A	ENST00000337331.5	-	1	126	c.40G>T	c.(40-42)Gaa>Taa	p.E14*	NPHP3_ENST00000383282.2_Nonsense_Mutation_p.E14*|NPHP3-AS1_ENST00000489343.1_RNA|NPHP3_ENST00000343113.4_Nonsense_Mutation_p.E14*|NPHP3-AS1_ENST00000504440.1_RNA|NPHP3_ENST00000326682.8_Nonsense_Mutation_p.E14*	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	14					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCGATCACTTCCCCGCCCGCG	0.706																																																	0													11.0	13.0	12.0					3																	132441160		1842	3706	5548	SO:0001587	stop_gained	0			AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.40G>T	3.37:g.132441160C>A	ENSP00000338766:p.Glu14*		Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Nonsense_Mutation	SNP	pfam_TPR_1,pfam_TPR-3,superfamily_P-loop_NTPase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E14*	ENST00000337331.5	37	c.40	CCDS3078.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.214550	0.79352	.	.	ENSG00000113971	ENST00000326682;ENST00000337331;ENST00000343113;ENST00000383282	.	.	.	3.58	3.58	0.41010	.	0.129031	0.50627	D	0.000118	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-17.0516	15.3629	0.74496	0.0:1.0:0.0:0.0	.	.	.	.	X	14	.	ENSP00000319909:E14X	E	-	1	0	NPHP3	133923850	1.000000	0.71417	0.989000	0.46669	0.082000	0.17680	6.730000	0.74780	1.981000	0.57761	0.500000	0.49745	GAA	NPHP3	-	NULL	ENSG00000113971		0.706	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHP3	HGNC	protein_coding	OTTHUMT00000357020.2	-	0.00	21	0	C	NM_153240		132441160	-1	tier1	-	no_errors	ENST00000337331	ensembl	human	known	74_37	nonsense	19.05	17	4	SNP	1.000	A
NPIPA7	101059938	genome.wustl.edu	37	16	16481333	16481333	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:16481333G>T	ENST00000530217.2	+	3	460	c.270G>T	c.(268-270)agG>agT	p.R90S	NPIPA7_ENST00000422673.2_5'UTR|NPIPA7_ENST00000327792.5_5'Flank	NM_001282507.1|NM_001282511.1	NP_001269436.1|NP_001269440.1	E9PJI5	NPIA7_HUMAN	nuclear pore complex interacting protein family, member A7	90																	GAGCCAGGAGGTCCAACCGCC	0.473																																																	0																																										SO:0001583	missense	0				CCDS61864.1	16p13.11	2013-06-11			ENSG00000214967	ENSG00000214967			41982	protein-coding gene	gene with protein product							Standard	NM_001282507		Approved			E9PJI5	OTTHUMG00000166307	ENST00000530217.2:c.270G>T	16.37:g.16481333G>T	ENSP00000431814:p.Arg90Ser			Missense_Mutation	SNP	NULL	p.R90S	ENST00000530217.2	37	c.270		16	.	.	.	.	.	.	.	.	.	.	g	8.966	0.971719	0.18736	.	.	ENSG00000214967	ENST00000530217	T	0.57107	0.42	.	.	.	.	.	.	.	.	T	0.52613	0.1745	.	.	.	.	.	.	.	.	.	.	.	.	T	0.61247	-0.7101	3	0.87932	D	0	.	.	.	.	.	.	.	.	S	90	ENSP00000431814:R90S	ENSP00000431814:R90S	R	+	3	2	RP11-467M13.1	16388834	0.986000	0.35501	0.183000	0.23137	0.185000	0.23345	0.740000	0.26188	0.064000	0.16427	0.064000	0.15345	AGG	NPIPA7	-	NULL	ENSG00000214967		0.473	NPIPA7-003	NOVEL	basic|appris_candidate_longest	protein_coding	NPIPA7	HGNC	protein_coding	OTTHUMT00000399247.1	-	0.00	25	0	G			16481333	+1	tier1	-	no_errors	ENST00000530217	ensembl	human	novel	74_37	missense	22.73	17	5	SNP	0.187	T
NPTX2	4885	genome.wustl.edu	37	7	98256637	98256637	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:98256637T>C	ENST00000265634.3	+	4	1214	c.1049T>C	c.(1048-1050)cTg>cCg	p.L350P		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	350	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GGGGGCGTGCTGATCCTTGGA	0.667																																																	0													50.0	41.0	44.0					7																	98256637		2203	4300	6503	SO:0001583	missense	0				CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.1049T>C	7.37:g.98256637T>C	ENSP00000265634:p.Leu350Pro		A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.L350P	ENST00000265634.3	37	c.1049	CCDS5657.1	7	.	.	.	.	.	.	.	.	.	.	T	22.7	4.321464	0.81580	.	.	ENSG00000106236	ENST00000265634	T	0.08008	3.14	5.39	5.39	0.77823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.060082	0.64402	D	0.000004	T	0.39655	0.1086	H	0.94264	3.515	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.55335	-0.8157	10	0.87932	D	0	-30.6792	14.8789	0.70516	0.0:0.0:0.0:1.0	.	350	P47972	NPTX2_HUMAN	P	350	ENSP00000265634:L350P	ENSP00000265634:L350P	L	+	2	0	NPTX2	98094573	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.984000	0.88150	2.166000	0.68216	0.533000	0.62120	CTG	NPTX2	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	ENSG00000106236		0.667	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX2	HGNC	protein_coding	OTTHUMT00000334982.1	-	0.00	44	0	T	NM_002523		98256637	+1	tier1	-	no_errors	ENST00000265634	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	C
NPTXR	23467	genome.wustl.edu	37	22	39222664	39222664	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr22:39222664C>A	ENST00000333039.2	-	3	1062	c.939G>T	c.(937-939)ctG>ctT	p.L313L		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	313	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					AGAGCTCGGGCAGAGCCTTCC	0.647																																					Pancreas(139;2521 3281 36965)												0													92.0	81.0	84.0					22																	39222664		2203	4300	6503	SO:0001819	synonymous_variant	0			AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.939G>T	22.37:g.39222664C>A				Silent	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.L313	ENST00000333039.2	37	c.939	CCDS33647.1	22																																																																																			NPTXR	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin	ENSG00000221890		0.647	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	HGNC	protein_coding	OTTHUMT00000318194.2	-	0.00	32	0	C	NM_014293		39222664	-1	tier1	-	no_errors	ENST00000333039	ensembl	human	known	74_37	silent	11.54	45	6	SNP	1.000	A
NRXN1	9378	genome.wustl.edu	37	2	50148877	50148877	+	3'UTR	SNP	C	C	A	rs571641298		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:50148877C>A	ENST00000406316.2	-	0	6115				NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTTATTGGCCCCTGTTTTTTG	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*205G>T	2.37:g.50148877C>A			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	SNP	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			NRXN1	-	-	ENSG00000179915		0.348	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	65	0	C			50148877	-1	tier1	-	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	6.09	108	7	SNP	1.000	A
NUP107	57122	genome.wustl.edu	37	12	69083376	69083376	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:69083376C>T	ENST00000229179.4	+	3	496	c.164C>T	c.(163-165)aCt>aTt	p.T55I	RP11-637A17.2_ENST00000500695.2_lincRNA|NUP107_ENST00000539906.1_Missense_Mutation_p.L17F|NUP107_ENST00000378905.2_5'UTR	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	55					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			ATCCCTCGAACTCCTAGCTCA	0.313																																																	0													111.0	109.0	109.0					12																	69083376		2203	4300	6503	SO:0001583	missense	0			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.164C>T	12.37:g.69083376C>T	ENSP00000229179:p.Thr55Ile		B4DZ67|Q6PJE1	Missense_Mutation	SNP	pfam_Nup84_Nup100	p.T55I	ENST00000229179.4	37	c.164	CCDS8985.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.87|16.87	3.243337|3.243337	0.58995|0.58995	.|.	.|.	ENSG00000111581|ENSG00000111581	ENST00000539906|ENST00000229179	.|.	.|.	.|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.096296	.|0.64402	.|D	.|0.000001	T|T	0.57344|0.57344	0.2047|0.2047	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	B|B	0.26258|0.20052	0.145|0.041	B|B	0.28011|0.17979	0.085|0.02	T|T	0.51513|0.51513	-0.8696|-0.8696	7|8	.|.	.|.	.|.	-24.0094|-24.0094	15.1663|15.1663	0.72828|0.72828	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	17|55	B4DZ67|P57740	.|NU107_HUMAN	F|I	17|55	.|.	.|.	L|T	+|+	1|2	0|0	NUP107|NUP107	67369643|67369643	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	1.763000|1.763000	0.38461|0.38461	2.722000|2.722000	0.93159|0.93159	0.655000|0.655000	0.94253|0.94253	CTC|ACT	NUP107	-	NULL	ENSG00000111581		0.313	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1		0.00	45	0	C	NM_020401		69083376	+1			no_errors	ENST00000229179	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
NWD1	284434	genome.wustl.edu	37	19	16883997	16883997	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:16883997C>A	ENST00000552788.1	+	9	2471	c.2471C>A	c.(2470-2472)cCa>cAa	p.P824Q	NWD1_ENST00000523826.1_Missense_Mutation_p.P618Q|NWD1_ENST00000339803.6_Missense_Mutation_p.P689Q|NWD1_ENST00000379808.3_Missense_Mutation_p.P824Q|NWD1_ENST00000549814.1_Missense_Mutation_p.P824Q|NWD1_ENST00000524140.2_Missense_Mutation_p.P824Q			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	824							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACCTCACATCCAGCACTGGTG	0.587																																																	0													76.0	74.0	75.0					19																	16883997		2203	4300	6503	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.2471C>A	19.37:g.16883997C>A	ENSP00000447224:p.Pro824Gln		C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P824Q	ENST00000552788.1	37	c.2471		19	.	.	.	.	.	.	.	.	.	.	-	13.90	2.374940	0.42105	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.59772	0.27;0.32;0.27;0.24;0.32;0.3	4.04	1.8	0.24995	.	0.396039	0.24662	N	0.036625	T	0.70640	0.3247	M	0.76002	2.32	0.09310	N	0.999999	D;D;D	0.76494	0.971;0.999;0.998	P;D;P	0.66979	0.548;0.948;0.889	T	0.62291	-0.6885	10	0.59425	D	0.04	-4.3437	10.4618	0.44583	0.0:0.6173:0.3827:0.0	.	824;824;689	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	Q	689;824;824;824;618;824;689	ENSP00000428579:P824Q;ENSP00000447548:P824Q;ENSP00000369136:P824Q;ENSP00000428955:P618Q;ENSP00000447224:P824Q;ENSP00000340159:P689Q	ENSP00000340159:P689Q	P	+	2	0	NWD1	16744997	0.922000	0.31269	0.002000	0.10522	0.976000	0.68499	1.816000	0.38992	0.200000	0.20447	0.459000	0.35465	CCA	NWD1	-	NULL	ENSG00000188039		0.587	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	-	0.00	61	0	C	NM_001007525		16883997	+1	tier1	-	no_errors	ENST00000379808	ensembl	human	known	74_37	missense	9.09	50	5	SNP	0.071	A
OBSCN	84033	genome.wustl.edu	37	1	228495817	228495817	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:228495817G>T	ENST00000422127.1	+	47	12516	c.12472G>T	c.(12472-12474)Gag>Tag	p.E4158*	OBSCN_ENST00000366709.4_Nonsense_Mutation_p.E1277*|OBSCN_ENST00000284548.11_Nonsense_Mutation_p.E4158*|OBSCN_ENST00000570156.2_Nonsense_Mutation_p.E5115*|OBSCN_ENST00000366707.4_Nonsense_Mutation_p.E1792*	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4158	Ig-like 42.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTCAGAGCCTGAGGTGACCAT	0.612																																																	0													75.0	84.0	81.0					1																	228495817		2095	4214	6309	SO:0001587	stop_gained	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12472G>T	1.37:g.228495817G>T	ENSP00000409493:p.Glu4158*		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.E4158*	ENST00000422127.1	37	c.12472	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	63	75.045426	0.99993	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	.	.	.	6.04	4.19	0.49359	.	0.070741	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	12.5657	0.56308	0.1351:0.0:0.8649:0.0	.	.	.	.	X	4158;4158;1792;1277	.	ENSP00000284548:E4158X	E	+	1	0	OBSCN	226562440	1.000000	0.71417	0.771000	0.31576	0.923000	0.55619	5.524000	0.67105	0.898000	0.36418	0.563000	0.77884	GAG	OBSCN	-	pfscan_Ig-like_dom	ENSG00000154358		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding			0.00	64	0	G	NM_052843		228495817	+1			no_errors	ENST00000422127	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	0.955	T
OCA2	4948	genome.wustl.edu	37	15	28326850	28326850	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:28326850C>A	ENST00000354638.3	-	2	326	c.171G>T	c.(169-171)ggG>ggT	p.G57G	OCA2_ENST00000353809.5_Silent_p.G57G|OCA2_ENST00000382996.2_Silent_p.G57G	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	57					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AAGAGCTCTGCCCGGCAGCCC	0.602									Oculocutaneous Albinism																																								0													37.0	36.0	36.0					15																	28326850		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.171G>T	15.37:g.28326850C>A			Q15211|Q15212|Q96EN1|Q9UMI5	Silent	SNP	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB	p.G57	ENST00000354638.3	37	c.171	CCDS10020.1	15																																																																																			OCA2	-	NULL	ENSG00000104044		0.602	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCA2	HGNC	protein_coding	OTTHUMT00000250823.1	-	0.00	22	0	C	NM_000275		28326850	-1	tier1	-	no_errors	ENST00000354638	ensembl	human	known	74_37	silent	26.09	17	6	SNP	0.001	A
OGDHL	55753	genome.wustl.edu	37	10	50953480	50953480	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:50953480C>A	ENST00000374103.4	-	12	1624	c.1539G>T	c.(1537-1539)atG>atT	p.M513I	OGDHL_ENST00000419399.1_Missense_Mutation_p.M456I|OGDHL_ENST00000432695.1_Missense_Mutation_p.M304I	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	513					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						TCTGCTTGTACATGAGCGGCT	0.607																																																	0													110.0	97.0	101.0					10																	50953480		2203	4300	6503	SO:0001583	missense	0			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1539G>T	10.37:g.50953480C>A	ENSP00000363216:p.Met513Ile		A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.M513I	ENST00000374103.4	37	c.1539	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.216801	0.95104	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;D	0.95756	2.49;2.49;-3.8	5.3	5.3	0.74995	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98544	0.9514	H	0.95504	3.68	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.99449	1.0940	10	0.87932	D	0	.	19.3156	0.94211	0.0:1.0:0.0:0.0	.	456;304;513	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	I	513;456;304	ENSP00000363216:M513I;ENSP00000401356:M456I;ENSP00000390240:M304I	ENSP00000363216:M513I	M	-	3	0	OGDHL	50623486	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.734000	0.84928	2.647000	0.89833	0.650000	0.86243	ATG	OGDHL	-	pfam_DH_E1,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000197444		0.607	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	-	0.00	54	0	C	NM_018245		50953480	-1	tier1	-	no_errors	ENST00000374103	ensembl	human	known	74_37	missense	19.67	49	12	SNP	1.000	A
OR2D3	120775	genome.wustl.edu	37	11	6942744	6942744	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:6942744T>A	ENST00000317834.3	+	1	540	c.512T>A	c.(511-513)gTg>gAg	p.V171E		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GGGGCACTAGTGTCTTTAGTA	0.507																																																	0													137.0	114.0	122.0					11																	6942744		2201	4296	6497	SO:0001583	missense	0			BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.512T>A	11.37:g.6942744T>A	ENSP00000320560:p.Val171Glu		B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V171E	ENST00000317834.3	37	c.512	CCDS31417.1	11	.	.	.	.	.	.	.	.	.	.	T	14.89	2.670175	0.47677	.	.	ENSG00000178358	ENST00000317834	T	0.38560	1.13	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40385	N	0.001108	T	0.47303	0.1438	L	0.54323	1.7	0.36721	D	0.88117	D	0.52996	0.957	P	0.52598	0.703	T	0.57849	-0.7740	10	0.59425	D	0.04	-25.0442	8.6012	0.33745	0.1709:0.0:0.0:0.8291	.	171	Q8NGH3	OR2D3_HUMAN	E	171	ENSP00000320560:V171E	ENSP00000320560:V171E	V	+	2	0	OR2D3	6899320	0.000000	0.05858	0.974000	0.42286	0.776000	0.43924	-0.504000	0.06375	2.310000	0.77875	0.533000	0.62120	GTG	OR2D3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000178358		0.507	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D3	HGNC	protein_coding	OTTHUMT00000385987.1	-	0.00	55	0	T	NM_001004684		6942744	+1	tier1	-	no_errors	ENST00000317834	ensembl	human	known	74_37	missense	13.46	45	7	SNP	0.785	A
OR10G6	79490	genome.wustl.edu	37	11	123865350	123865350	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:123865350C>A	ENST00000307002.3	-	1	518	c.519G>T	c.(517-519)ggG>ggT	p.G173G				Q8NH81	O10G6_HUMAN	olfactory receptor, family 10, subfamily G, member 6	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AATGGATAGTCCCTCCCAGCC	0.502																																																	0																																										SO:0001819	synonymous_variant	0			AB065508		11q24.1	2013-03-28	2004-03-04	2004-03-05	ENSG00000198674	ENSG00000198674		"""GPCR / Class A : Olfactory receptors"""	14836	other	unknown			"""olfactory receptor, family 10, subfamily G, member 6 pseudogene"""	OR10G6P			Standard	NG_002255		Approved	OR10G6Q		Q8NH81	OTTHUMG00000165964	ENST00000307002.3:c.519G>T	11.37:g.123865350C>A				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G173	ENST00000307002.3	37	c.519		11																																																																																			OR10G6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198674		0.502	OR10G6-001	KNOWN	basic|appris_principal	protein_coding	OR10G6	HGNC	protein_coding	OTTHUMT00000387266.2	-	0.00	58	0	C	NG_002255		123865350	-1	tier1	-	no_errors	ENST00000307002	ensembl	human	known	74_37	silent	7.14	65	5	SNP	0.001	A
OR10G4	390264	genome.wustl.edu	37	11	123887127	123887127	+	Silent	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:123887127C>G	ENST00000320891.4	+	1	846	c.846C>G	c.(844-846)ctC>ctG	p.L282L		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CGCCCCTTCTCAACCCTGTTG	0.463																																																	0													97.0	87.0	90.0					11																	123887127		2201	4299	6500	SO:0001819	synonymous_variant	0			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.846C>G	11.37:g.123887127C>G			Q6IEW0	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L282	ENST00000320891.4	37	c.846	CCDS31702.1	11																																																																																			OR10G4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000254737		0.463	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G4	HGNC	protein_coding	OTTHUMT00000387268.1	-	0.00	145	0	C	NM_001004462		123887127	+1	tier1	-	no_errors	ENST00000320891	ensembl	human	known	74_37	silent	5.00	152	8	SNP	0.179	G
OPCML	4978	genome.wustl.edu	37	11	132289974	132289974	+	3'UTR	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:132289974T>A	ENST00000331898.7	-	0	1729				OPCML_ENST00000374778.4_3'UTR|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000524381.1_3'UTR	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		aaaacaaatctagaataacag	0.433																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.*113A>T	11.37:g.132289974T>A			B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	RNA	SNP	-	NULL	ENST00000331898.7	37	NULL	CCDS8492.1	11																																																																																			OPCML	-	-	ENSG00000183715		0.433	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	-	0.00	51	0	T	NM_001012393		132289974	-1	tier1	-	no_errors	ENST00000529038	ensembl	human	known	74_37	rna	13.33	52	8	SNP	0.003	A
OR2K2	26248	genome.wustl.edu	37	9	114089878	114089878	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:114089878A>T	ENST00000374428.1	-	1	922	c.923T>A	c.(922-924)gTg>gAg	p.V308E	OR2K2_ENST00000302681.1_Missense_Mutation_p.V279E			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						AGGGGTAAGCACTCCGTAAAG	0.378																																																	0													132.0	125.0	127.0					9																	114089878		2203	4300	6503	SO:0001583	missense	0			X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.923T>A	9.37:g.114089878A>T	ENSP00000363550:p.Val308Glu		Q2TA61|Q5VYK4|Q6IFI5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V308E	ENST00000374428.1	37	c.923		9	.	.	.	.	.	.	.	.	.	.	A	16.49	3.137067	0.56936	.	.	ENSG00000171133	ENST00000302681;ENST00000374428	T;T	0.00316	8.13;8.13	4.65	4.65	0.58169	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36555	U	0.002526	T	0.00784	0.0026	H	0.97365	3.99	0.22050	N	0.9994	D	0.53151	0.958	P	0.51742	0.678	T	0.15009	-1.0452	10	0.87932	D	0	.	12.3631	0.55215	1.0:0.0:0.0:0.0	.	308	Q8NGT1	OR2K2_HUMAN	E	279;308	ENSP00000305055:V279E;ENSP00000363550:V308E	ENSP00000305055:V279E	V	-	2	0	OR2K2	113129699	0.025000	0.19082	0.984000	0.44739	0.947000	0.59692	2.971000	0.49248	2.085000	0.62840	0.482000	0.46254	GTG	OR2K2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000171133		0.378	OR2K2-201	KNOWN	basic	protein_coding	OR2K2	HGNC	protein_coding		-	0.00	84	0	A	NM_205859		114089878	-1	tier1	-	no_errors	ENST00000374428	ensembl	human	known	74_37	missense	13.00	87	13	SNP	0.054	T
OR2L2	26246	genome.wustl.edu	37	1	248201852	248201852	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:248201852G>T	ENST00000366479.2	+	1	379	c.283G>T	c.(283-285)Gga>Tga	p.G95*	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ctccttcactggatgtgggat	0.423																																																	0													152.0	144.0	147.0					1																	248201852		2203	4300	6503	SO:0001587	stop_gained	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.283G>T	1.37:g.248201852G>T	ENSP00000355435:p.Gly95*		Q2M3T5	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G95*	ENST00000366479.2	37	c.283	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	17.76	3.467772	0.63625	.	.	ENSG00000203663	ENST00000366479	.	.	.	1.9	1.9	0.25705	.	0.000000	0.31495	U	0.007548	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.3658	0.49671	0.0:0.0:1.0:0.0	.	.	.	.	X	95	.	ENSP00000355435:G95X	G	+	1	0	OR2L2	246268475	0.000000	0.05858	0.660000	0.29694	0.186000	0.23388	0.680000	0.25306	0.897000	0.36392	0.194000	0.17425	GGA	OR2L2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000203663		0.423	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	-	0.00	121	0	G	NM_001004686		248201852	+1	tier1	-	no_errors	ENST00000366479	ensembl	human	known	74_37	nonsense	12.44	183	26	SNP	0.042	T
OR2L3	391192	genome.wustl.edu	37	1	248224700	248224700	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:248224700C>A	ENST00000359959.3	+	1	717	c.717C>A	c.(715-717)acC>acA	p.T239T	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CCTACCTGACCTGCAGCACCC	0.478																																																	0													169.0	154.0	159.0					1																	248224700		2203	4300	6503	SO:0001819	synonymous_variant	0			AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.717C>A	1.37:g.248224700C>A			B9EH44	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T239	ENST00000359959.3	37	c.717	CCDS31104.1	1																																																																																			OR2L3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000198128		0.478	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L3	HGNC	protein_coding	OTTHUMT00000096852.1	-	0.00	198	0	C	NM_001004687		248224700	+1	tier1	-	no_errors	ENST00000359959	ensembl	human	known	74_37	silent	14.04	196	32	SNP	0.842	A
OR2T33	391195	genome.wustl.edu	37	1	248436323	248436323	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:248436323G>T	ENST00000318021.2	-	1	815	c.794C>A	c.(793-795)tCc>tAc	p.S265Y		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATGGTTAGTGGACCTATGGGA	0.483																																																	0													140.0	152.0	148.0					1																	248436323		2203	4300	6503	SO:0001583	missense	0				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.794C>A	1.37:g.248436323G>T	ENSP00000324687:p.Ser265Tyr		B2RNN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S265Y	ENST00000318021.2	37	c.794	CCDS31109.1	1	.	.	.	.	.	.	.	.	.	.	-	4.279	0.050853	0.08243	.	.	ENSG00000177212	ENST00000318021	T	0.00277	8.34	1.77	1.77	0.24775	GPCR, rhodopsin-like superfamily (1);	0.000000	0.28815	U	0.014041	T	0.00724	0.0024	M	0.89968	3.075	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.20974	-1.0259	10	0.87932	D	0	.	11.0627	0.47957	0.0:0.0:1.0:0.0	.	265	Q8NG76	O2T33_HUMAN	Y	265	ENSP00000324687:S265Y	ENSP00000324687:S265Y	S	-	2	0	OR2T33	246502946	0.034000	0.19679	0.112000	0.21494	0.019000	0.09904	2.268000	0.43338	1.286000	0.44565	0.418000	0.28097	TCC	OR2T33	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177212		0.483	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T33	HGNC	protein_coding	OTTHUMT00000097354.1	-	0.00	143	0	G	NM_001004695		248436323	-1	tier1	-	no_errors	ENST00000318021	ensembl	human	known	74_37	missense	5.88	159	10	SNP	0.001	T
OR2T4	127074	genome.wustl.edu	37	1	248525025	248525025	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:248525025G>A	ENST00000366475.1	+	1	143	c.143G>A	c.(142-144)gGa>gAa	p.G48E		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATCCTGTTGGGACTCTTCAGA	0.458																																																	0													155.0	139.0	145.0					1																	248525025		2203	4299	6502	SO:0001583	missense	0			BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.143G>A	1.37:g.248525025G>A	ENSP00000355431:p.Gly48Glu		Q6IEZ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G48E	ENST00000366475.1	37	c.143	CCDS31113.1	1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693417	0.48202	.	.	ENSG00000196944	ENST00000366475	T	0.00655	5.95	3.21	3.21	0.36854	.	0.000000	0.44285	D	0.000479	T	0.04227	0.0117	M	0.83012	2.62	0.23232	N	0.99808	D	0.76494	0.999	D	0.83275	0.996	T	0.03875	-1.0996	10	0.87932	D	0	.	11.3177	0.49401	0.0:0.1861:0.8139:0.0	.	48	Q8NH00	OR2T4_HUMAN	E	48	ENSP00000355431:G48E	ENSP00000355431:G48E	G	+	2	0	OR2T4	246591648	0.183000	0.23186	0.443000	0.26883	0.190000	0.23558	0.531000	0.23052	1.315000	0.45114	0.306000	0.20318	GGA	OR2T4	-	NULL	ENSG00000196944		0.458	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T4	HGNC	protein_coding	OTTHUMT00000097349.2	-	0.00	112	0	G	NM_001004696		248525025	+1	tier1	-	no_errors	ENST00000366475	ensembl	human	known	74_37	missense	10.43	103	12	SNP	0.430	A
OR4A15	81328	genome.wustl.edu	37	11	55135605	55135605	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:55135605C>A	ENST00000314706.3	+	1	246	c.246C>A	c.(244-246)tcC>tcA	p.S82S		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						CCAGCCAGTCCCTGGGTTCCC	0.428																																																	0													102.0	97.0	98.0					11																	55135605		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.246C>A	11.37:g.55135605C>A			Q6IFL4|Q96R65	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S82	ENST00000314706.3	37	c.246	CCDS31500.1	11																																																																																			OR4A15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181958		0.428	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	HGNC	protein_coding	OTTHUMT00000391161.1	-	0.00	78	0	C	NM_001005275		55135605	+1	tier1	-	no_errors	ENST00000314706	ensembl	human	known	74_37	silent	6.09	108	7	SNP	0.001	A
OR4C15	81309	genome.wustl.edu	37	11	55322145	55322145	+	Silent	SNP	C	C	T	rs550631405		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:55322145C>T	ENST00000314644.2	+	1	363	c.363C>T	c.(361-363)ttC>ttT	p.F121F		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TCCTGTCCTTCCTGGATGCGT	0.473										HNSCC(20;0.049)			c|||	1	0.000199681	0.0008	0.0	5008	,	,		20061	0.0		0.0	False		,,,				2504	0.0																0													186.0	151.0	163.0					11																	55322145		2201	4296	6497	SO:0001819	synonymous_variant	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.363C>T	11.37:g.55322145C>T			Q6IFE2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F121	ENST00000314644.2	37	c.363	CCDS31501.1	11																																																																																			OR4C15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181939		0.473	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	-	0.00	82	0	C	NM_001001920		55322145	+1	tier1	-	no_errors	ENST00000314644	ensembl	human	known	74_37	silent	11.97	103	14	SNP	0.000	T
OR51I1	390063	genome.wustl.edu	37	11	5462136	5462136	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:5462136C>G	ENST00000380211.1	-	1	608	c.609G>C	c.(607-609)ttG>ttC	p.L203F	HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	203					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAATGATCACCAAGAGCCCAT	0.448																																																	0													62.0	61.0	62.0					11																	5462136		2201	4297	6498	SO:0001583	missense	0			BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.609G>C	11.37:g.5462136C>G	ENSP00000369559:p.Leu203Phe		B9EKW2|Q6IF33	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L203F	ENST00000380211.1	37	c.609	CCDS31382.1	11	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.428451	0.00184	.	.	ENSG00000167359	ENST00000321307;ENST00000380211	T	0.00058	8.79	5.47	-3.92	0.04155	GPCR, rhodopsin-like superfamily (1);	0.218942	0.32655	N	0.005819	T	0.00039	0.0001	N	0.00246	-1.78	0.18873	N	0.999984	B	0.02656	0.0	B	0.01281	0.0	T	0.42378	-0.9455	10	0.02654	T	1	.	7.9289	0.29891	0.5039:0.1128:0.3833:0.0	.	203	Q9H343	O51I1_HUMAN	F	200;203	ENSP00000369559:L203F	ENSP00000439622:L200F	L	-	3	2	OR51I1	5418712	0.000000	0.05858	0.925000	0.36789	0.121000	0.20230	-1.361000	0.02597	-0.790000	0.04492	-1.582000	0.00854	TTG	OR51I1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000167359		0.448	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51I1	HGNC	protein_coding	OTTHUMT00000143399.1	-	0.00	30	0	C	NM_001005288		5462136	-1	tier1	-	no_errors	ENST00000380211	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.043	G
OR4C6	219432	genome.wustl.edu	37	11	55432966	55432966	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:55432966G>C	ENST00000314259.3	+	1	353	c.324G>C	c.(322-324)gtG>gtC	p.V108V		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						TTGGTGGTGTGGGGATCATCC	0.542																																																	0													116.0	105.0	109.0					11																	55432966		2200	4296	6496	SO:0001819	synonymous_variant	0			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.324G>C	11.37:g.55432966G>C			B2RP11|Q6IFD2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V108	ENST00000314259.3	37	c.324	CCDS31506.1	11																																																																																			OR4C6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181903		0.542	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C6	HGNC	protein_coding	OTTHUMT00000391504.1	-	0.00	50	0	G	NM_001004704		55432966	+1	tier1	-	no_errors	ENST00000314259	ensembl	human	known	74_37	silent	11.86	52	7	SNP	0.000	C
OR5D13	390142	genome.wustl.edu	37	11	55541210	55541210	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:55541210C>A	ENST00000361760.1	+	1	297	c.297C>A	c.(295-297)tgC>tgA	p.C99*		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				TCTCTGGTTGCATCATGCAAT	0.413																																																	0													190.0	184.0	186.0					11																	55541210		2200	4296	6496	SO:0001587	stop_gained	0			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.297C>A	11.37:g.55541210C>A	ENSP00000354800:p.Cys99*		Q6IF68|Q6IFC9	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C99*	ENST00000361760.1	37	c.297	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689689	0.29962	.	.	ENSG00000198877	ENST00000361760	.	.	.	3.52	0.498	0.16908	.	0.000000	0.37178	U	0.002207	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9498	6.8149	0.23824	0.0:0.5804:0.0:0.4196	.	.	.	.	X	99	.	ENSP00000354800:C99X	C	+	3	2	OR5D13	55297786	0.000000	0.05858	0.007000	0.13788	0.013000	0.08279	-1.416000	0.02467	0.015000	0.14971	0.486000	0.48141	TGC	OR5D13	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000198877		0.413	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1	-	0.00	77	0	C	NM_001001967		55541210	+1	tier1	-	no_errors	ENST00000361760	ensembl	human	known	74_37	nonsense	5.22	109	6	SNP	0.968	A
OR5H1	26341	genome.wustl.edu	37	3	97851625	97851625	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:97851625C>G	ENST00000354565.2	+	1	84	c.84C>G	c.(82-84)ttC>ttG	p.F28L	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TACCCCTGTTCCTGGCATTCT	0.433																																																	0													46.0	50.0	49.0					3																	97851625		2162	4201	6363	SO:0001583	missense	0			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.84C>G	3.37:g.97851625C>G	ENSP00000346575:p.Phe28Leu			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F28L	ENST00000354565.2	37	c.84	CCDS33797.1	3	.	.	.	.	.	.	.	.	.	.	C	12.17	1.858137	0.32791	.	.	ENSG00000231192	ENST00000354565	T	0.04454	3.62	3.63	2.75	0.32379	.	0.000000	0.44902	D	0.000420	T	0.10637	0.0260	M	0.83483	2.645	0.22541	N	0.999002	P	0.50943	0.94	P	0.48304	0.573	T	0.11690	-1.0577	10	0.59425	D	0.04	.	5.5276	0.16967	0.0:0.7439:0.0:0.2561	.	28	A6NKK0	OR5H1_HUMAN	L	28	ENSP00000346575:F28L	ENSP00000346575:F28L	F	+	3	2	OR5H1	99334315	0.000000	0.05858	0.915000	0.36163	0.300000	0.27592	-1.413000	0.02473	0.717000	0.32145	0.195000	0.17529	TTC	OR5H1	-	prints_GPCR_Rhodpsn	ENSG00000231192		0.433	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H1	HGNC	protein_coding	OTTHUMT00000359100.2	-	0.00	112	0	C	NM_001005338		97851625	+1	tier1	-	no_errors	ENST00000354565	ensembl	human	known	74_37	missense	7.19	129	10	SNP	0.794	G
OR6J1	79549	genome.wustl.edu	37	14	23103617	23103617	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:23103617A>G	ENST00000540461.1	-	1	99	c.100T>C	c.(100-102)Ttc>Ctc	p.F34L				Q8NGC5	OR6J1_HUMAN	olfactory receptor, family 6, subfamily J, member 1 (gene/pseudogene)	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										GTCAGCAGGAACGTGGGCAGC	0.577																																																	0																																										SO:0001583	missense	0			AC023226		14q11.2	2012-08-09	2012-04-20	2004-03-10	ENSG00000255804	ENSG00000255804		"""GPCR / Class A : Olfactory receptors"""	14707	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily J, member 1"""	OR6J2, OR6J1P			Standard	NG_002274		Approved			Q8NGC5	OTTHUMG00000168897	ENST00000540461.1:c.100T>C	14.37:g.23103617A>G	ENSP00000437629:p.Phe34Leu			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.F34L	ENST00000540461.1	37	c.100		14	.	.	.	.	.	.	.	.	.	.	A	12.60	1.985498	0.35036	.	.	ENSG00000255804	ENST00000540461	T	0.00581	6.42	4.48	3.31	0.37934	.	.	.	.	.	T	0.00998	0.0033	.	.	.	0.26891	N	0.967337	.	.	.	.	.	.	T	0.46665	-0.9175	6	0.87932	D	0	.	9.4246	0.38572	0.8201:0.1799:0.0:0.0	.	.	.	.	L	34	ENSP00000437629:F34L	ENSP00000437629:F34L	F	-	1	0	OR6J1	22173457	0.206000	0.23470	0.367000	0.25926	0.314000	0.28054	3.246000	0.51414	0.548000	0.28955	-0.687000	0.03738	TTC	OR6J1	-	prints_GPCR_Rhodpsn	ENSG00000255804		0.577	OR6J1-001	KNOWN	basic|appris_principal	protein_coding	OR6J1	HGNC	protein_coding	OTTHUMT00000401548.1	-	0.00	65	0	A			23103617	-1	tier1	-	no_errors	ENST00000540461	ensembl	human	known	74_37	missense	9.52	76	8	SNP	0.975	G
OR8D2	283160	genome.wustl.edu	37	11	124190034	124190034	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:124190034G>T	ENST00000357438.2	-	1	150	c.60C>A	c.(58-60)cgC>cgA	p.R20R		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		GAAGTTCTGGGCGTTGTGTCA	0.438																																																	0													67.0	68.0	68.0					11																	124190034		2200	4299	6499	SO:0001819	synonymous_variant	0			AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.60C>A	11.37:g.124190034G>T			B9EH49|Q6IFR0	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R20	ENST00000357438.2	37	c.60	CCDS31707.1	11																																																																																			OR8D2	-	NULL	ENSG00000197263		0.438	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D2	HGNC	protein_coding	OTTHUMT00000387286.1		0.00	62	0	G	NM_001002918		124190034	-1			no_errors	ENST00000357438	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.003	T
OR8S1	341568	genome.wustl.edu	37	12	48919789	48919789	+	Silent	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:48919789C>G	ENST00000310194.1	+	1	375	c.375C>G	c.(373-375)gcC>gcG	p.A125A	OR8S1_ENST00000551654.1_Intron	NM_001005203.2	NP_001005203.2	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S, member 1	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A125A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|skin(4)	22						GCCATGCTGCCATCTGCCGCC	0.542																																																	1	Substitution - coding silent(1)	lung(1)											131.0	119.0	123.0					12																	48919789		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS31789.1	12q13.2	2012-08-09				ENSG00000197376		"""GPCR / Class A : Olfactory receptors"""	19628	protein-coding gene	gene with protein product							Standard	NM_001005203		Approved		uc010slu.2	Q8NH09		ENST00000310194.1:c.375C>G	12.37:g.48919789C>G				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A125	ENST00000310194.1	37	c.375	CCDS31789.1	12																																																																																			OR8S1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197376		0.542	OR8S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8S1	HGNC	protein_coding	OTTHUMT00000406881.1	-	0.00	32	0	C			48919789	+1	tier1	-	no_errors	ENST00000310194	ensembl	human	known	74_37	silent	15.71	59	11	SNP	1.000	G
OSBPL10	114884	genome.wustl.edu	37	3	31774813	31774813	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:31774813T>A	ENST00000396556.2	-	6	1153	c.1031A>T	c.(1030-1032)aAc>aTc	p.N344I	OSBPL10_ENST00000438237.2_Missense_Mutation_p.N280I|OSBPL10_ENST00000467647.1_5'UTR	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	344					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CCAGGTTATGTTGGCACTGGC	0.493																																																	0													156.0	146.0	150.0					3																	31774813		2203	4300	6503	SO:0001583	missense	0			AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.1031A>T	3.37:g.31774813T>A	ENSP00000379804:p.Asn344Ile		B4E212|Q9BTU5	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.N344I	ENST00000396556.2	37	c.1031	CCDS2651.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.55|14.55	2.568242|2.568242	0.45798|0.45798	.|.	.|.	ENSG00000144645|ENSG00000144645	ENST00000396556;ENST00000438237;ENST00000428241|ENST00000429492	T;T;T|.	0.47177|.	1.91;2.24;0.85|.	5.66|5.66	2.09|2.09	0.27110|0.27110	.|.	0.833683|.	0.11600|.	N|.	0.547818|.	T|T	0.54806|0.54806	0.1881|0.1881	L|L	0.47716|0.47716	1.5|1.5	0.36310|0.36310	D|D	0.857604|0.857604	B;B;B|.	0.30686|.	0.29;0.19;0.047|.	B;B;B|.	0.28849|.	0.095;0.093;0.08|.	T|T	0.58216|0.58216	-0.7675|-0.7675	10|5	0.62326|.	D|.	0.03|.	-26.6136|-26.6136	8.8606|8.8606	0.35256|0.35256	0.0:0.2244:0.0:0.7756|0.0:0.2244:0.0:0.7756	.|.	280;344;112|.	B4E212;Q9BXB5;Q59ED9|.	.;OSB10_HUMAN;.|.	I|S	344;280;152|113	ENSP00000379804:N344I;ENSP00000406124:N280I;ENSP00000399200:N152I|.	ENSP00000379804:N344I|.	N|T	-|-	2|1	0|0	OSBPL10|OSBPL10	31749817|31749817	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	0.575000|0.575000	0.23729|0.23729	0.983000|0.983000	0.38602|0.38602	0.454000|0.454000	0.30748|0.30748	AAC|ACA	OSBPL10	-	NULL	ENSG00000144645		0.493	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL10	HGNC	protein_coding	OTTHUMT00000253165.2	-	0.00	86	0	T			31774813	-1	tier1	-	no_errors	ENST00000396556	ensembl	human	known	74_37	missense	5.21	91	5	SNP	1.000	A
OTOG	340990	genome.wustl.edu	37	11	17582284	17582284	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:17582284G>T	ENST00000399391.2	+	12	1407	c.1407G>T	c.(1405-1407)gtG>gtT	p.V469V	OTOG_ENST00000399397.1_Silent_p.V396V	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	469					adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						GGGGCTGCGTGGCACCAGCTG	0.572																																																	0																																										SO:0001819	synonymous_variant	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.1407G>T	11.37:g.17582284G>T			A8MTX6|A8MUJ0|B7WPC4	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.V469	ENST00000399391.2	37	c.1407	CCDS59225.1	11																																																																																			OTOG	-	superfamily_TIL_dom	ENSG00000188162		0.572	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		-	0.00	49	0	G			17582284	+1	tier1	-	no_errors	ENST00000399391	ensembl	human	known	74_37	silent	7.55	49	4	SNP	1.000	T
OTOL1	131149	genome.wustl.edu	37	3	161216961	161216961	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:161216961C>G	ENST00000327928.4	+	2	367	c.367C>G	c.(367-369)Cct>Gct	p.P123A		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	123	Collagen-like 1.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						ATTTCTAGGTCCTAAAGGAGA	0.393																																																	0													33.0	32.0	33.0					3																	161216961		1802	4069	5871	SO:0001583	missense	0				CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.367C>G	3.37:g.161216961C>G	ENSP00000330808:p.Pro123Ala			Missense_Mutation	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.P123A	ENST00000327928.4	37	c.367	CCDS46948.1	3	.	.	.	.	.	.	.	.	.	.	C	0.361	-0.939128	0.02322	.	.	ENSG00000182447	ENST00000327928	D	0.97642	-4.47	5.55	-1.1	0.09872	.	0.677754	0.15200	N	0.275063	D	0.90463	0.7013	N	0.17312	0.475	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.79482	-0.1785	10	0.16420	T	0.52	.	8.7599	0.34667	0.0:0.5166:0.2914:0.1921	.	123	A6NHN0	OTOL1_HUMAN	A	123	ENSP00000330808:P123A	ENSP00000330808:P123A	P	+	1	0	OTOL1	162699655	0.051000	0.20477	0.231000	0.23993	0.393000	0.30537	0.285000	0.18883	-0.502000	0.06596	-1.938000	0.00498	CCT	OTOL1	-	pfam_Collagen	ENSG00000182447		0.393	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOL1	HGNC	protein_coding	OTTHUMT00000353184.1	-	0.00	107	0	C	NM_001080440		161216961	+1	tier1	-	no_errors	ENST00000327928	ensembl	human	known	74_37	missense	6.40	117	8	SNP	0.066	G
OTOP2	92736	genome.wustl.edu	37	17	72927175	72927175	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:72927175C>T	ENST00000580223.1	+	5	1475	c.1445C>T	c.(1444-1446)tCa>tTa	p.S482L	OTOP2_ENST00000331427.4_Missense_Mutation_p.S482L			Q7RTS6	OTOP2_HUMAN	otopetrin 2	482						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					GCCATCGTCTCAACCCCCAGA	0.592																																																	0													80.0	84.0	82.0					17																	72927175		2203	4300	6503	SO:0001583	missense	0			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1445C>T	17.37:g.72927175C>T	ENSP00000463837:p.Ser482Leu			Missense_Mutation	SNP	pfam_Otopetrin	p.S482L	ENST00000580223.1	37	c.1445	CCDS11708.1	17	.	.	.	.	.	.	.	.	.	.	C	0.365	-0.937062	0.02340	.	.	ENSG00000183034	ENST00000331427	T	0.10192	2.9	4.96	-2.7	0.06004	.	2.671000	0.01581	N	0.021099	T	0.09113	0.0225	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33033	-0.9884	10	0.19590	T	0.45	-21.208	7.3921	0.26915	0.1222:0.6212:0.1236:0.133	.	482	Q7RTS6	OTOP2_HUMAN	L	482	ENSP00000332528:S482L	ENSP00000332528:S482L	S	+	2	0	OTOP2	70438770	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.936000	0.03946	-0.425000	0.07371	-0.379000	0.06801	TCA	OTOP2	-	NULL	ENSG00000183034		0.592	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	HGNC	protein_coding	OTTHUMT00000445306.1	-	0.00	58	0	C	NM_178160		72927175	+1	tier1	-	no_errors	ENST00000331427	ensembl	human	known	74_37	missense	12.64	76	11	SNP	0.000	T
OXCT2	64064	genome.wustl.edu	37	1	40236196	40236196	+	Silent	SNP	C	C	T	rs374640877		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:40236196C>T	ENST00000327582.5	-	1	824	c.732G>A	c.(730-732)gaG>gaA	p.E244E	BMP8B_ENST00000372827.3_Intron|BMP8B_ENST00000397360.2_Intron	NM_022120.1	NP_071403.1	Q9BYC2	SCOT2_HUMAN	3-oxoacid CoA transferase 2	244					ketone body catabolic process (GO:0046952)	mitochondrion (GO:0005739)|motile cilium (GO:0031514)	3-oxoacid CoA-transferase activity (GO:0008260)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|pancreas(1)|upper_aerodigestive_tract(1)	6	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		Succinic acid(DB00139)	TCTCTTCCACCTCCACCGCCG	0.557											OREG0013400	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								C	,	1,4385	2.1+/-5.4	0,1,2192	56.0	66.0	62.0		,732	0.6	0.8	1		62	0,8590		0,0,4295	no	intron,coding-synonymous	BMP8B,OXCT2	NM_001720.3,NM_022120.1	,	0,1,6487	TT,TC,CC		0.0,0.0228,0.0077	,	,244/518	40236196	1,12975	2193	4295	6488	SO:0001819	synonymous_variant	0			AB050193	CCDS445.1	1p34	2008-02-05			ENSG00000198754	ENSG00000198754			18606	protein-coding gene	gene with protein product		610289				11214971, 11756565	Standard	NM_022120		Approved	FKSG25, FLJ00030, SCOT-T	uc001ceb.1	Q9BYC2	OTTHUMG00000009249	ENST00000327582.5:c.732G>A	1.37:g.40236196C>T		891	B2RBB4|Q5QPK4|Q8NHR1|Q9H1I4	Silent	SNP	pfam_CoA_trans_fam_I,smart_CoA_trans_fam_I,pirsf_3-oxoacid_CoA-transferase,tigrfam_3-oxoacid_CoA-transf_B,tigrfam_3-oxoacid_CoA-transf_A	p.E244	ENST00000327582.5	37	c.732	CCDS445.1	1																																																																																			OXCT2	-	pfam_CoA_trans_fam_I,smart_CoA_trans_fam_I,pirsf_3-oxoacid_CoA-transferase	ENSG00000198754		0.557	OXCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXCT2	HGNC	protein_coding	OTTHUMT00000025656.1	-	0.00	38	0	C	NM_022120		40236196	-1	tier1	-	no_errors	ENST00000327582	ensembl	human	known	74_37	silent	12.70	55	8	SNP	1.000	T
P2RY13	53829	genome.wustl.edu	37	3	151046747	151046747	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:151046747A>T	ENST00000325602.5	-	2	116	c.97T>A	c.(97-99)Tct>Act	p.S33T	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	33					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			CACCGCTCAGATCTGTTGAAG	0.458																																																	0													117.0	112.0	113.0					3																	151046747		2203	4300	6503	SO:0001583	missense	0			AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.97T>A	3.37:g.151046747A>T	ENSP00000320376:p.Ser33Thr		B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_P2Y13_rcpt,prints_GPCR_Rhodpsn,prints_P2Y14_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.S33T	ENST00000325602.5	37	c.97	CCDS3158.2	3	.	.	.	.	.	.	.	.	.	.	A	10.07	1.249882	0.22880	.	.	ENSG00000181631	ENST00000325602	T	0.37058	1.22	5.77	5.77	0.91146	.	0.053680	0.85682	D	0.000000	T	0.20981	0.0505	N	0.08118	0	0.43750	D	0.996255	B	0.22146	0.065	B	0.16289	0.015	T	0.08576	-1.0715	10	0.20519	T	0.43	-22.7377	16.0985	0.81148	1.0:0.0:0.0:0.0	.	33	Q9BPV8	P2Y13_HUMAN	T	33	ENSP00000320376:S33T	ENSP00000320376:S33T	S	-	1	0	P2RY13	152529437	0.998000	0.40836	0.964000	0.40570	0.214000	0.24535	4.433000	0.59929	2.197000	0.70478	0.455000	0.32223	TCT	P2RY13	-	prints_P2Y13_rcpt	ENSG00000181631		0.458	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY13	HGNC	protein_coding	OTTHUMT00000341468.1		0.00	57	0	A	NM_023914		151046747	-1			no_errors	ENST00000325602	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.989	T
PABPC3	5042	genome.wustl.edu	37	13	25670529	25670529	+	Missense_Mutation	SNP	G	G	A	rs143942354		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:25670529G>A	ENST00000281589.3	+	1	230	c.193G>A	c.(193-195)Gcg>Acg	p.A65T		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	65	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TACGAAGGACGCGGAGCATGC	0.537																																																	0													87.0	77.0	81.0					13																	25670529		2203	4300	6503	SO:0001583	missense	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.193G>A	13.37:g.25670529G>A	ENSP00000281589:p.Ala65Thr		Q8NHV0|Q9H086	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.A65T	ENST00000281589.3	37	c.193	CCDS9311.1	13	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617463	0.66787	.	.	ENSG00000151846	ENST00000281589	T	0.30714	1.52	0.546	0.546	0.17196	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.44688	U	0.000427	T	0.47173	0.1431	M	0.93808	3.46	0.46981	D	0.999274	D	0.63046	0.992	P	0.50082	0.63	T	0.55503	-0.8131	10	0.87932	D	0	.	6.848	0.23998	1.0E-4:0.0:0.9999:0.0	.	65	Q9H361	PABP3_HUMAN	T	65	ENSP00000281589:A65T	ENSP00000281589:A65T	A	+	1	0	PABPC3	24568529	1.000000	0.71417	0.024000	0.17045	0.163000	0.22366	6.590000	0.74085	0.558000	0.29135	0.305000	0.20034	GCG	PABPC3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000151846		0.537	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	-	0.00	90	0	G	NM_030979		25670529	+1	tier1	-	no_errors	ENST00000281589	ensembl	human	known	74_37	missense	5.00	95	5	SNP	1.000	A
PACRG	135138	genome.wustl.edu	37	6	163483273	163483273	+	Missense_Mutation	SNP	G	G	T	rs370616018		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:163483273G>T	ENST00000337019.3	+	4	607	c.383G>T	c.(382-384)cGg>cTg	p.R128L	PACRG_ENST00000366888.2_Missense_Mutation_p.R128L|PACRG_ENST00000366889.2_Missense_Mutation_p.R128L	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	128					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)				endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		TTTTTTGCTCGGCAAGGAATC	0.423																																																	0													97.0	94.0	95.0					6																	163483273		2203	4300	6503	SO:0001583	missense	0			AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.383G>T	6.37:g.163483273G>T	ENSP00000337946:p.Arg128Leu		E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Missense_Mutation	SNP	pfam_Parkin_co-regulated_protein,superfamily_ARM-type_fold	p.R128L	ENST00000337019.3	37	c.383	CCDS5284.1	6	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228054	0.39399	.	.	ENSG00000112530	ENST00000337019;ENST00000366889;ENST00000366888	T;T;T	0.62941	0.31;-0.01;-0.01	4.85	4.85	0.62838	.	0.179187	0.49916	D	0.000131	T	0.46852	0.1414	L	0.56340	1.77	0.80722	D	1	B;B	0.32245	0.182;0.361	B;B	0.34093	0.062;0.175	T	0.48222	-0.9054	10	0.22109	T	0.4	-19.5539	18.3664	0.90392	0.0:0.0:1.0:0.0	.	128;128	Q96M98-2;Q96M98	.;PACRG_HUMAN	L	128	ENSP00000337946:R128L;ENSP00000355855:R128L;ENSP00000355854:R128L	ENSP00000337946:R128L	R	+	2	0	PACRG	163403263	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.366000	0.97143	2.401000	0.81631	0.609000	0.83330	CGG	PACRG	-	pfam_Parkin_co-regulated_protein,superfamily_ARM-type_fold	ENSG00000112530		0.423	PACRG-003	KNOWN	basic|CCDS	protein_coding	PACRG	HGNC	protein_coding	OTTHUMT00000400424.1	-	0.00	61	0	G	NM_152410		163483273	+1	tier1	-	no_errors	ENST00000337019	ensembl	human	known	74_37	missense	6.25	75	5	SNP	0.971	T
PARD3	56288	genome.wustl.edu	37	10	34408625	34408625	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:34408625G>A	ENST00000374789.3	-	24	3918	c.3593C>T	c.(3592-3594)tCc>tTc	p.S1198F	PARD3_ENST00000545260.1_Missense_Mutation_p.S1108F|PARD3_ENST00000545693.1_Missense_Mutation_p.S1182F|PARD3_ENST00000350537.4_Missense_Mutation_p.S1152F|PARD3_ENST00000374788.3_Missense_Mutation_p.S1195F|PARD3_ENST00000374794.3_Missense_Mutation_p.S1086F|PARD3_ENST00000346874.4_Missense_Mutation_p.S1161F|PARD3_ENST00000374790.3_Missense_Mutation_p.S1138F	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1198					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CACCTCCACGGACACCGAGTG	0.617																																																	0													25.0	23.0	23.0					10																	34408625		2202	4298	6500	SO:0001583	missense	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.3593C>T	10.37:g.34408625G>A	ENSP00000363921:p.Ser1198Phe		F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S1198F	ENST00000374789.3	37	c.3593	CCDS7178.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.173375	0.94807	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790	T;T;T;T;T;T;T;T	0.19532	2.28;2.19;2.36;2.35;2.19;2.14;2.2;2.29	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	L	0.47716	1.5	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.998;0.998;0.999;0.999;0.999;0.998;0.999;0.999	D;D;D;D;D;D;D;D	0.87578	0.966;0.992;0.998;0.998;0.998;0.966;0.998;0.996	T	0.19451	-1.0305	10	0.59425	D	0.04	.	19.172	0.93581	0.0:0.0:1.0:0.0	.	1086;1108;1115;1152;1182;1161;1195;1198	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0	.;.;.;.;.;.;.;PARD3_HUMAN	F	1182;1108;1198;1195;1161;1086;1152;1138	ENSP00000443147:S1182F;ENSP00000440857:S1108F;ENSP00000363921:S1198F;ENSP00000363920:S1195F;ENSP00000340591:S1161F;ENSP00000363926:S1086F;ENSP00000311986:S1152F;ENSP00000363922:S1138F	ENSP00000340591:S1161F	S	-	2	0	PARD3	34448631	1.000000	0.71417	0.974000	0.42286	0.922000	0.55478	9.467000	0.97671	2.541000	0.85698	0.650000	0.86243	TCC	PARD3	-	NULL	ENSG00000148498		0.617	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	HGNC	protein_coding	OTTHUMT00000047527.1	-	0.00	63	0	G	NM_019619		34408625	-1	tier1	-	no_errors	ENST00000374789	ensembl	human	known	74_37	missense	15.85	69	13	SNP	1.000	A
PARD3B	117583	genome.wustl.edu	37	2	205986337	205986337	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:205986337G>T	ENST00000406610.2	+	8	1036	c.829G>T	c.(829-831)Gca>Tca	p.A277S	PARD3B_ENST00000349953.3_Missense_Mutation_p.A277S|PARD3B_ENST00000351153.1_Missense_Mutation_p.A277S|PARD3B_ENST00000462231.1_Missense_Mutation_p.A277S|PARD3B_ENST00000358768.2_Missense_Mutation_p.A277S	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	277	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CTTCCGCCAGGCAATGAAATC	0.448																																																	0													120.0	120.0	120.0					2																	205986337		1977	4165	6142	SO:0001583	missense	0			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.829G>T	2.37:g.205986337G>T	ENSP00000385848:p.Ala277Ser		E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A277S	ENST00000406610.2	37	c.829		2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342775	0.82022	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	6.16	6.16	0.99307	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	D	0.91290	0.7254	M	0.74647	2.275	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.964;1.0;1.0	D;D;P;D;D	0.91635	0.997;0.996;0.864;0.999;0.999	D	0.88419	0.3027	10	0.34782	T	0.22	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	277;277;277;277;277	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	S	277	ENSP00000385848:A277S;ENSP00000351618:A277S;ENSP00000317261:A277S;ENSP00000340280:A277S	ENSP00000340280:A277S	A	+	1	0	PARD3B	205694582	1.000000	0.71417	0.996000	0.52242	0.394000	0.30568	9.230000	0.95299	2.937000	0.99478	0.650000	0.86243	GCA	PARD3B	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000116117		0.448	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	PARD3B	HGNC	protein_coding	OTTHUMT00000335992.1	-	0.00	59	0	G	NM_057177		205986337	+1	tier1	-	no_errors	ENST00000406610	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
PAX9	5083	genome.wustl.edu	37	14	37131038	37131038	+	5'UTR	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:37131038G>A	ENST00000402703.2	+	0	470				PAX9_ENST00000554201.1_5'Flank|PAX9_ENST00000361487.6_5'Flank	NM_006194.3	NP_006185.1	P55771	PAX9_HUMAN	paired box 9						cellular response to growth factor stimulus (GO:0071363)|endoderm development (GO:0007492)|face morphogenesis (GO:0060325)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|regulation of odontogenesis (GO:0042481)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(3)	12	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		CCCAGTGAGTGATAGACGGAG	0.592																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AJ238381	CCDS9662.1	14q13.3	2007-07-12	2007-07-12		ENSG00000198807	ENSG00000198807		"""Paired boxes"""	8623	protein-coding gene	gene with protein product		167416	"""paired box gene 9"""			7981748	Standard	NM_006194		Approved		uc001wty.4	P55771	OTTHUMG00000140251	ENST00000402703.2:c.-257G>A	14.37:g.37131038G>A			Q99582|Q9UQR4	RNA	SNP	-	NULL	ENST00000402703.2	37	NULL	CCDS9662.1	14																																																																																			PAX9	-	-	ENSG00000198807		0.592	PAX9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX9	HGNC	protein_coding		-	0.00	26	0	G			37131038	+1	tier1	-	no_errors	ENST00000553267	ensembl	human	putative	74_37	rna	10.34	52	6	SNP	1.000	A
PCDH12	51294	genome.wustl.edu	37	5	141331136	141331136	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:141331136G>T	ENST00000231484.3	-	2	4110	c.2900C>A	c.(2899-2901)tCc>tAc	p.S967Y	AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	967					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGCAGCAAGGACAGCAGCTG	0.542											OREG0016877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													100.0	94.0	96.0					5																	141331136		2203	4300	6503	SO:0001583	missense	0			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2900C>A	5.37:g.141331136G>T	ENSP00000231484:p.Ser967Tyr	1663	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S967Y	ENST00000231484.3	37	c.2900	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003132	0.93287	.	.	ENSG00000113555	ENST00000231484	T	0.74842	-0.88	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.86435	0.5932	M	0.73962	2.25	0.58432	D	0.999996	D	0.89917	1.0	D	0.75484	0.986	D	0.86795	0.1988	10	0.87932	D	0	.	18.1573	0.89696	0.0:0.0:1.0:0.0	.	967	Q9NPG4	PCD12_HUMAN	Y	967	ENSP00000231484:S967Y	ENSP00000231484:S967Y	S	-	2	0	PCDH12	141311320	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.894000	0.99253	0.655000	0.94253	TCC	PCDH12	-	NULL	ENSG00000113555		0.542	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1	-	0.00	74	0	G	NM_016580		141331136	-1	tier1	-	no_errors	ENST00000231484	ensembl	human	known	74_37	missense	7.06	79	6	SNP	1.000	T
PCDH18	54510	genome.wustl.edu	37	4	138452880	138452880	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:138452880G>C	ENST00000344876.4	-	1	749	c.363C>G	c.(361-363)ttC>ttG	p.F121L	PCDH18_ENST00000412923.2_Missense_Mutation_p.F121L|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_5'UTR	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	121	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CTTCAATATGGAAAAGCTGCA	0.423																																																	0													106.0	106.0	106.0					4																	138452880		2203	4300	6503	SO:0001583	missense	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.363C>G	4.37:g.138452880G>C	ENSP00000355082:p.Phe121Leu		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F121L	ENST00000344876.4	37	c.363	CCDS34064.1	4	.	.	.	.	.	.	.	.	.	.	G	13.43	2.233865	0.39498	.	.	ENSG00000189184	ENST00000344876;ENST00000412923	T;T	0.36520	1.25;1.25	5.81	4.96	0.65561	Cadherin (3);Cadherin-like (1);	0.000000	0.45606	D	0.000342	T	0.35008	0.0917	L	0.55834	1.745	0.80722	D	1	B;B	0.32573	0.004;0.376	B;B	0.27380	0.011;0.079	T	0.10543	-1.0625	10	0.39692	T	0.17	.	16.7792	0.85559	0.0:0.129:0.871:0.0	.	121;121	Q9HCL0-2;Q9HCL0	.;PCD18_HUMAN	L	121	ENSP00000355082:F121L;ENSP00000390688:F121L	ENSP00000355082:F121L	F	-	3	2	PCDH18	138672330	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.944000	0.56629	1.427000	0.47276	0.650000	0.86243	TTC	PCDH18	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000189184		0.423	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	-	0.00	83	0	G	NM_019035		138452880	-1	tier1	-	no_errors	ENST00000344876	ensembl	human	known	74_37	missense	6.59	85	6	SNP	1.000	C
PCDHB14	56122	genome.wustl.edu	37	5	140603152	140603152	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:140603152G>T	ENST00000239449.4	+	1	75	c.75G>T	c.(73-75)cgG>cgT	p.R25R	PCDHB14_ENST00000515856.2_Intron	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	25					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GATTGTCTCGGGCAGGTACTG	0.498																																					Ovarian(141;50 1831 27899 33809 37648)												0													97.0	94.0	95.0					5																	140603152		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.75G>T	5.37:g.140603152G>T			B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R25	ENST00000239449.4	37	c.75	CCDS4256.1	5																																																																																			PCDHB14	-	NULL	ENSG00000120327		0.498	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	-	0.00	98	0	G	NM_018934		140603152	+1	tier1	-	no_errors	ENST00000239449	ensembl	human	known	74_37	silent	7.22	90	7	SNP	0.030	T
PCNXL3	399909	genome.wustl.edu	37	11	65403111	65403111	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:65403111C>T	ENST00000355703.3	+	32	5835	c.5296C>T	c.(5296-5298)Cgc>Tgc	p.R1766C	MIR4690_ENST00000578459.1_RNA|SIPA1_ENST00000534313.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1766						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GCAGGCGCTTCGCAACATGAT	0.677																																																	0													25.0	31.0	29.0					11																	65403111		2172	4256	6428	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.5296C>T	11.37:g.65403111C>T	ENSP00000347931:p.Arg1766Cys		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.R1766C	ENST00000355703.3	37	c.5296	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511440	0.64522	.	.	ENSG00000197136	ENST00000355703	T	0.64438	-0.1	4.11	4.11	0.48088	.	0.063133	0.64402	D	0.000011	T	0.81795	0.4898	M	0.93283	3.4	0.46542	D	0.999092	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	D	0.84802	0.0785	10	0.87932	D	0	.	9.1807	0.37141	0.2168:0.7832:0.0:0.0	.	653;1766	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	C	1766	ENSP00000347931:R1766C	ENSP00000347931:R1766C	R	+	1	0	PCNXL3	65159687	0.991000	0.36638	0.997000	0.53966	0.900000	0.52787	1.615000	0.36922	2.142000	0.66516	0.462000	0.41574	CGC	PCNXL3	-	pfam_Pecanex	ENSG00000197136		0.677	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	-	0.00	57	0	C	NM_032223		65403111	+1	tier1	-	no_errors	ENST00000355703	ensembl	human	known	74_37	missense	11.96	81	11	SNP	1.000	T
PDE1B	5153	genome.wustl.edu	37	12	54962952	54962952	+	Intron	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:54962952C>A	ENST00000243052.3	+	4	663				PDE1B_ENST00000550620.1_Intron|PDE1B_ENST00000394277.3_Intron|PDE1B_ENST00000538346.1_Intron	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTGTGACTCCCCTTCTGGGGT	0.592																																																	0													59.0	63.0	62.0					12																	54962952		2203	4300	6503	SO:0001627	intron_variant	0			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.228-16C>A	12.37:g.54962952C>A			Q92825|Q96KP3	Missense_Mutation	SNP	NULL	p.P92T	ENST00000243052.3	37	c.274	CCDS8882.1	12																																																																																			PDE1B	-	NULL	ENSG00000123360		0.592	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	HGNC	protein_coding	OTTHUMT00000406203.1	-	0.00	114	0	C			54962952	+1	tier1	-	no_errors	ENST00000550285	ensembl	human	known	74_37	missense	5.71	165	10	SNP	0.000	A
PDE6C	5146	genome.wustl.edu	37	10	95399842	95399842	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:95399842G>A	ENST00000371447.3	+	12	1636	c.1498G>A	c.(1498-1500)Gac>Aac	p.D500N		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	500					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	GGACTTGCCAGACCCACGCTC	0.423																																																	0													120.0	102.0	108.0					10																	95399842		2203	4300	6503	SO:0001583	missense	0			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.1498G>A	10.37:g.95399842G>A	ENSP00000360502:p.Asp500Asn		A6NCR6|Q5VY29	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.D500N	ENST00000371447.3	37	c.1498	CCDS7429.1	10	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624845	0.28889	.	.	ENSG00000095464	ENST00000371447	T	0.78003	-1.14	4.99	4.0	0.46444	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.294568	0.36101	N	0.002798	T	0.69223	0.3087	L	0.45051	1.395	0.47094	D	0.999319	B	0.14012	0.009	B	0.09377	0.004	T	0.64601	-0.6369	10	0.28530	T	0.3	.	13.9508	0.64116	0.0845:0.0:0.9155:0.0	.	500	P51160	PDE6C_HUMAN	N	500	ENSP00000360502:D500N	ENSP00000360502:D500N	D	+	1	0	PDE6C	95389832	1.000000	0.71417	0.999000	0.59377	0.804000	0.45430	3.689000	0.54706	2.595000	0.87683	0.563000	0.77884	GAC	PDE6C	-	NULL	ENSG00000095464		0.423	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6C	HGNC	protein_coding	OTTHUMT00000049437.1	-	0.00	76	0	G	NM_006204		95399842	+1	tier1	-	no_errors	ENST00000371447	ensembl	human	known	74_37	missense	6.25	90	6	SNP	0.997	A
PDIA2	64714	genome.wustl.edu	37	16	336368	336368	+	Missense_Mutation	SNP	C	C	A	rs199813441		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:336368C>A	ENST00000219406.6	+	8	1153	c.1135C>A	c.(1135-1137)Cag>Aag	p.Q379K	PDIA2_ENST00000404312.1_Missense_Mutation_p.Q376K	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	379	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				TCTCCTGAGCCAGGAGATACC	0.587																																																	0													47.0	52.0	50.0					16																	336368		1875	4100	5975	SO:0001583	missense	0			U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.1135C>A	16.37:g.336368C>A	ENSP00000219406:p.Gln379Lys		A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Prot_disulphide_isomerase	p.Q379K	ENST00000219406.6	37	c.1135	CCDS42089.1	16	.	.	.	.	.	.	.	.	.	.	c	10.95	1.496157	0.26774	.	.	ENSG00000185615	ENST00000219406;ENST00000455994;ENST00000404312	T;T	0.14022	2.54;2.54	4.04	4.04	0.47022	Thioredoxin-like fold (3);	0.134375	0.49916	D	0.000135	T	0.25158	0.0611	M	0.67517	2.055	0.37160	D	0.902544	P	0.51537	0.946	P	0.53062	0.717	T	0.13872	-1.0493	10	0.87932	D	0	.	10.4388	0.44452	0.0:0.6637:0.3363:0.0	.	379	Q13087	PDIA2_HUMAN	K	379;348;376	ENSP00000219406:Q379K;ENSP00000384410:Q376K	ENSP00000219406:Q379K	Q	+	1	0	PDIA2	276369	0.157000	0.22836	0.984000	0.44739	0.888000	0.51559	0.818000	0.27295	2.112000	0.64535	0.479000	0.44913	CAG	PDIA2	-	superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase	ENSG00000185615		0.587	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDIA2	HGNC	protein_coding	OTTHUMT00000139315.3	-	0.00	80	0	C	NM_006849		336368	+1	tier1	-	no_errors	ENST00000219406	ensembl	human	known	74_37	missense	8.08	91	8	SNP	0.998	A
PDZD2	23037	genome.wustl.edu	37	5	31983407	31983407	+	Missense_Mutation	SNP	G	G	A	rs149201593	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:31983407G>A	ENST00000438447.1	+	3	1011	c.623G>A	c.(622-624)cGa>cAa	p.R208Q	PDZD2_ENST00000282493.3_Missense_Mutation_p.R208Q			O15018	PDZD2_HUMAN	PDZ domain containing 2	208					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CTGGGTGACCGAACTGCGAAA	0.537													G|||	2	0.000399361	0.0015	0.0	5008	,	,		20309	0.0		0.0	False		,,,				2504	0.0																0								G	GLN/ARG	5,4401	9.9+/-24.2	0,5,2198	89.0	88.0	88.0		623	-3.3	0.0	5	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PDZD2	NM_178140.2	43	0,6,6497	AA,AG,GG		0.0116,0.1135,0.0461	benign	208/2840	31983407	6,13000	2203	4300	6503	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.623G>A	5.37:g.31983407G>A	ENSP00000402033:p.Arg208Gln		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R208Q	ENST00000438447.1	37	c.623	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	3.152	-0.173922	0.06421	0.001135	1.16E-4	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.63580	-0.05;-0.05	5.23	-3.29	0.05017	.	1.550270	0.04017	N	0.299179	T	0.32194	0.0821	N	0.03608	-0.345	0.09310	N	0.999993	B;B	0.25312	0.041;0.123	B;B	0.12837	0.003;0.008	T	0.16571	-1.0398	10	0.10902	T	0.67	.	7.0473	0.25052	0.5096:0.1174:0.3731:0.0	.	34;208	B4E3P2;O15018	.;PDZD2_HUMAN	Q	208	ENSP00000402033:R208Q;ENSP00000282493:R208Q	ENSP00000282493:R208Q	R	+	2	0	PDZD2	32019164	0.219000	0.23619	0.024000	0.17045	0.121000	0.20230	0.431000	0.21444	-0.975000	0.03546	-0.355000	0.07637	CGA	PDZD2	-	NULL	ENSG00000133401		0.537	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	-	0.00	80	0	G			31983407	+1	tier1	rs149201593	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	5.32	89	5	SNP	0.002	A
PGA3	643834	genome.wustl.edu	37	11	60971723	60971723	+	Silent	SNP	C	C	A	rs527696591	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:60971723C>A	ENST00000325558.6	+	2	386	c.201C>A	c.(199-201)ccC>ccA	p.P67P		NM_001079807.1	NP_001073275.1	P0DJD8	PEPA3_HUMAN	pepsinogen 3, group I (pepsinogen A)	67					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.P67P(1)		endometrium(1)|lung(1)|ovary(1)|skin(2)	5						ATGAACAGCCCCTGGAGAACT	0.602													C|||	4	0.000798722	0.003	0.0	5008	,	,		20048	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	ovary(1)											64.0	72.0	69.0					11																	60971723		1901	3872	5773	SO:0001819	synonymous_variant	0			AL832946	CCDS31574.1	11q13	2006-12-13			ENSG00000229859	ENSG00000229859	3.4.23.1		8885	protein-coding gene	gene with protein product		169710				6300126	Standard	NM_001079807		Approved		uc001nqx.3	P0DJD8	OTTHUMG00000168071	ENST00000325558.6:c.201C>A	11.37:g.60971723C>A			A8K749|B2R7D6|B7ZW75|P00790|Q7M4R0|Q8N1E3	Silent	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.P67	ENST00000325558.6	37	c.201	CCDS31574.1	11																																																																																			PGA3	-	superfamily_Peptidase_aspartic_dom	ENSG00000229859		0.602	PGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGA3	HGNC	protein_coding	OTTHUMT00000397955.2		0.00	132	0	C	NM_001079807		60971723	+1			no_errors	ENST00000325558	ensembl	human	known	74_37	silent	5.81	146	9	SNP	0.076	A
PGK2	5232	genome.wustl.edu	37	6	49754035	49754035	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:49754035C>T	ENST00000304801.3	-	1	1018	c.866G>A	c.(865-867)gGg>gAg	p.G289E		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	289					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					AAACTTGTCCCCAGTAACAAA	0.458																																																	0													150.0	148.0	148.0					6																	49754035		2203	4300	6503	SO:0001583	missense	0			K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.866G>A	6.37:g.49754035C>T	ENSP00000305995:p.Gly289Glu		B2R6Y8|Q9H107	Missense_Mutation	SNP	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase,prints_Phosphoglycerate_kinase	p.G289E	ENST00000304801.3	37	c.866	CCDS4930.1	6	.	.	.	.	.	.	.	.	.	.	C	12.37	1.917236	0.33815	.	.	ENSG00000170950	ENST00000304801	D	0.91351	-2.83	4.09	-0.419	0.12340	Phosphoglycerate kinase, C-terminal (1);	0.158321	0.56097	D	0.000034	D	0.86180	0.5871	L	0.46567	1.45	0.30507	N	0.769811	P	0.34757	0.467	P	0.46585	0.521	T	0.82880	-0.0238	10	0.87932	D	0	-4.413	16.1035	0.81203	0.0:0.6331:0.3669:0.0	.	289	P07205	PGK2_HUMAN	E	289	ENSP00000305995:G289E	ENSP00000305995:G289E	G	-	2	0	PGK2	49861994	1.000000	0.71417	0.728000	0.30774	0.472000	0.32918	4.118000	0.57884	-0.094000	0.12374	-1.141000	0.01876	GGG	PGK2	-	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase	ENSG00000170950		0.458	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK2	HGNC	protein_coding	OTTHUMT00000040872.1	-	0.00	56	0	C			49754035	-1	tier1	-	no_errors	ENST00000304801	ensembl	human	known	74_37	missense	9.86	64	7	SNP	0.951	T
PGLYRP2	114770	genome.wustl.edu	37	19	15582811	15582811	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:15582811G>T	ENST00000340880.4	-	3	1713	c.1233C>A	c.(1231-1233)caC>caA	p.H411Q	PGLYRP2_ENST00000292609.4_Missense_Mutation_p.H411Q	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	411					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						GCACGTAGGTGTGATGCACGT	0.677																																																	0													61.0	51.0	55.0					19																	15582811		2203	4300	6503	SO:0001583	missense	0			AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.1233C>A	19.37:g.15582811G>T	ENSP00000345968:p.His411Gln		A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.H411Q	ENST00000340880.4	37	c.1233	CCDS12330.2	19	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711082	0.48517	.	.	ENSG00000161031	ENST00000340880;ENST00000292609	T;T	0.25250	1.81;1.81	4.43	2.24	0.28232	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.000000	0.85682	D	0.000000	T	0.57007	0.2024	H	0.94698	3.57	0.50813	D	0.999896	D;D	0.69078	0.978;0.997	D;D	0.78314	0.976;0.991	T	0.64812	-0.6319	10	0.87932	D	0	-11.2272	9.1676	0.37060	0.1984:0.0:0.8016:0.0	.	411;411	Q96PD5-2;Q96PD5	.;PGRP2_HUMAN	Q	411	ENSP00000345968:H411Q;ENSP00000292609:H411Q	ENSP00000292609:H411Q	H	-	3	2	PGLYRP2	15443811	1.000000	0.71417	0.996000	0.52242	0.149000	0.21700	2.646000	0.46630	0.991000	0.38814	0.561000	0.74099	CAC	PGLYRP2	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	ENSG00000161031		0.677	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP2	HGNC	protein_coding	OTTHUMT00000319626.1	-	0.00	109	0	G	NM_052890		15582811	-1	tier1	-	no_errors	ENST00000292609	ensembl	human	known	74_37	missense	9.45	115	12	SNP	1.000	T
PHACTR1	221692	genome.wustl.edu	37	6	13228205	13228205	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:13228205G>T	ENST00000379350.1	+	8	1273	c.1144G>T	c.(1144-1146)Gag>Tag	p.E382*	PHACTR1_ENST00000379345.2_Intron|PHACTR1_ENST00000457702.2_Nonsense_Mutation_p.E237*|PHACTR1_ENST00000332995.7_Nonsense_Mutation_p.E382*			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	382					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TGTGCCTCATGAGTCAGACTA	0.458																																																	0													153.0	160.0	158.0					6																	13228205		1998	4169	6167	SO:0001587	stop_gained	0			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.1144G>T	6.37:g.13228205G>T	ENSP00000368655:p.Glu382*		A8K1V2|Q3MJ93|Q5JSJ2	Nonsense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.E382*	ENST00000379350.1	37	c.1144		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.400753|5.400753	0.96030|0.96030	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000379350;ENST00000332995;ENST00000432934;ENST00000457702|ENST00000415087	.|.	.|.	.|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.045872|.	0.85682|.	D|.	0.000000|.	.|T	.|0.70098	.|0.3185	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.66540	.|-0.5898	.|4	0.72032|.	D|.	0.01|.	-11.4001|-11.4001	19.3193|19.3193	0.94231|0.94231	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	382;382;451;237|216	.|.	ENSP00000329880:E382X|.	E|M	+|+	1|3	0|0	PHACTR1|PHACTR1	13336184|13336184	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.976000|0.976000	0.68499|0.68499	7.333000|7.333000	0.79214|0.79214	2.871000|2.871000	0.98454|0.98454	0.655000|0.655000	0.94253|0.94253	GAG|ATG	PHACTR1	-	NULL	ENSG00000112137		0.458	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHACTR1	HGNC	protein_coding	OTTHUMT00000039876.1	-	0.00	61	0	G	XM_166420		13228205	+1	tier1	-	no_errors	ENST00000379350	ensembl	human	known	74_37	nonsense	10.39	69	8	SNP	1.000	T
PHACTR3	116154	genome.wustl.edu	37	20	58330273	58330273	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:58330273C>T	ENST00000371015.1	+	4	862	c.395C>T	c.(394-396)cCc>cTc	p.P132L	PHACTR3_ENST00000541461.1_Missense_Mutation_p.P91L|PHACTR3_ENST00000361300.4_Missense_Mutation_p.P91L|PHACTR3_ENST00000359926.3_Missense_Mutation_p.P129L|PHACTR3_ENST00000355648.4_Missense_Mutation_p.P91L|PHACTR3_ENST00000395636.2_Missense_Mutation_p.P91L|PHACTR3_ENST00000395639.4_Missense_Mutation_p.P91L	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	132						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GATGGAGGACCCCGATCTGTA	0.587																																																	0													63.0	59.0	60.0					20																	58330273		2203	4300	6503	SO:0001583	missense	0			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.395C>T	20.37:g.58330273C>T	ENSP00000360054:p.Pro132Leu		B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.P132L	ENST00000371015.1	37	c.395	CCDS13480.1	20	.	.	.	.	.	.	.	.	.	.	C	0.576	-0.838991	0.02692	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.29142	1.99;2.03;1.58;2.01;2.01;2.01;1.58	3.8	2.82	0.32997	.	0.687552	0.14295	N	0.328685	T	0.15565	0.0375	N	0.14661	0.345	0.09310	N	1	B;B;B	0.24823	0.069;0.02;0.112	B;B;B	0.25140	0.055;0.016;0.058	T	0.28586	-1.0039	10	0.08599	T	0.76	-5.2295	9.1039	0.36685	0.2198:0.7802:0.0:0.0	.	91;132;129	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	L	129;132;91;91;91;91;91	ENSP00000353002:P129L;ENSP00000360054:P132L;ENSP00000379001:P91L;ENSP00000442483:P91L;ENSP00000347866:P91L;ENSP00000378998:P91L;ENSP00000354555:P91L	ENSP00000347866:P91L	P	+	2	0	PHACTR3	57763668	0.003000	0.15002	0.009000	0.14445	0.012000	0.07955	0.702000	0.25631	0.863000	0.35553	0.591000	0.81541	CCC	PHACTR3	-	NULL	ENSG00000087495		0.587	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHACTR3	HGNC	protein_coding	OTTHUMT00000079923.3	-	0.00	63	0	C	NM_080672		58330273	+1	tier1	-	no_errors	ENST00000371015	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.016	T
PHB	5245	genome.wustl.edu	37	17	47486521	47486521	+	Splice_Site	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:47486521C>A	ENST00000300408.3	-	5	466		c.e5-1		PHB_ENST00000511832.1_Splice_Site|PHB_ENST00000508009.1_Splice_Site|RP11-81K2.1_ENST00000576461.1_Intron	NM_001281496.1|NM_001281715.1|NM_002634.2	NP_001268425.1|NP_001268644.1|NP_002625.1	P35232	PHB_HUMAN	prohibitin						cellular response to interleukin-6 (GO:0071354)|DNA replication (GO:0006260)|histone deacetylation (GO:0016575)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone receptor signaling pathway (GO:0050847)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|transcription regulatory region DNA binding (GO:0044212)			endometrium(4)|large_intestine(2)|lung(4)	10	all_cancers(4;2.62e-14)|Breast(4;4.21e-29)|all_epithelial(4;6.9e-18)		Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)			CAAAGCGAGCCTGGTTTCAAA	0.557																																																	0													27.0	26.0	26.0					17																	47486521		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS11548.1, CCDS62244.1	17q21	2010-11-25			ENSG00000167085	ENSG00000167085			8912	protein-coding gene	gene with protein product		176705				10376528, 8244394	Standard	NM_001281496		Approved	PHB1	uc002iox.1	P35232	OTTHUMG00000134271	ENST00000300408.3:c.394-1G>T	17.37:g.47486521C>A			B4DY47|Q4VBQ0	Splice_Site	SNP	-	e4-1	ENST00000300408.3	37	c.394-1	CCDS11548.1	17	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344611	0.82022	.	.	ENSG00000167085	ENST00000300408;ENST00000511832;ENST00000419140;ENST00000504124;ENST00000512041;ENST00000446735	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3101	0.90195	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PHB	44841520	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.431000	0.80335	2.428000	0.82296	0.462000	0.41574	.	PHB	-	-	ENSG00000167085		0.557	PHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHB	HGNC	protein_coding	OTTHUMT00000258826.1	-	0.00	54	0	C	NM_002634	Intron	47486521	-1	tier1	-	no_errors	ENST00000300408	ensembl	human	known	74_37	splice_site	6.32	89	6	SNP	1.000	A
PHLDB1	23187	genome.wustl.edu	37	11	118499143	118499143	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:118499143G>A	ENST00000361417.2	+	7	2015	c.1604G>A	c.(1603-1605)aGt>aAt	p.S535N	PHLDB1_ENST00000356063.5_Missense_Mutation_p.S535N	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	535										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GGCAGCTTCAGTGGCAGGCTG	0.657																																																	0													11.0	13.0	13.0					11																	118499143		2189	4277	6466	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1604G>A	11.37:g.118499143G>A	ENSP00000354498:p.Ser535Asn		B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S535N	ENST00000361417.2	37	c.1604	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268518	0.40095	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000356063	T;T	0.32753	1.45;1.44	5.55	5.55	0.83447	.	0.607647	0.19556	N	0.111443	T	0.26557	0.0649	N	0.22421	0.69	0.80722	D	1	P;B;P	0.36465	0.554;0.065;0.546	B;B;B	0.39419	0.299;0.035;0.101	T	0.03717	-1.1010	10	0.24483	T	0.36	-13.3395	17.6889	0.88263	0.0:0.0:1.0:0.0	.	535;535;535	Q86UU1-3;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	N	535;294;535	ENSP00000354498:S535N;ENSP00000348359:S535N	ENSP00000348359:S535N	S	+	2	0	PHLDB1	118004353	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.190000	0.72057	2.612000	0.88384	0.655000	0.94253	AGT	PHLDB1	-	NULL	ENSG00000019144		0.657	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	-	0.00	81	0	G	NM_015157		118499143	+1	tier1	-	no_errors	ENST00000361417	ensembl	human	known	74_37	missense	7.78	83	7	SNP	1.000	A
PIGR	5284	genome.wustl.edu	37	1	207110474	207110474	+	Silent	SNP	C	C	T	rs148222338		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:207110474C>T	ENST00000356495.4	-	4	1194	c.1011G>A	c.(1009-1011)tcG>tcA	p.S337S		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	337	Ig-like V-type 3.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCTGGATAGGCGAGCCTTCCT	0.597																																																	0								C		2,4404	4.2+/-10.8	0,2,2201	63.0	56.0	58.0		1011	-0.4	0.0	1	dbSNP_134	58	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	PIGR	NM_002644.3		0,4,6499	TT,TC,CC		0.0233,0.0454,0.0308		337/765	207110474	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1011G>A	1.37:g.207110474C>T			Q68D81|Q8IZY7	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.S337	ENST00000356495.4	37	c.1011	CCDS1474.1	1																																																																																			PIGR	-	smart_Ig_sub	ENSG00000162896		0.597	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGR	HGNC	protein_coding	OTTHUMT00000088975.1	-	0.00	41	0	C	NM_002644		207110474	-1	tier1	rs148222338	no_errors	ENST00000356495	ensembl	human	known	74_37	silent	11.67	53	7	SNP	0.002	T
PIK3R5	23533	genome.wustl.edu	37	17	8791623	8791623	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:8791623G>A	ENST00000447110.1	-	10	1605	c.1481C>T	c.(1480-1482)gCc>gTc	p.A494V	PIK3R5_ENST00000581552.1_Missense_Mutation_p.A494V|PIK3R5_ENST00000584803.1_Missense_Mutation_p.A494V	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	494					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						TGAAGCAGGGGCCAGAAGCCA	0.667																																					NSCLC(18;589 615 7696 20311 50332)												0													30.0	34.0	32.0					17																	8791623		2203	4300	6503	SO:0001583	missense	0			AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.1481C>T	17.37:g.8791623G>A	ENSP00000392812:p.Ala494Val		B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	pfam_PI3K_1B_gamma_p101_su	p.A494V	ENST00000447110.1	37	c.1481	CCDS11147.1	17	.	.	.	.	.	.	.	.	.	.	G	9.320	1.057792	0.19907	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.76968	-1.06	5.48	5.48	0.80851	.	0.450948	0.24325	N	0.039518	T	0.66247	0.2770	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.51220	-0.8733	10	0.25751	T	0.34	-24.3067	17.119	0.86697	0.0:0.0:1.0:0.0	.	494	Q8WYR1	PI3R5_HUMAN	V	494	ENSP00000392812:A494V	ENSP00000269300:A494V	A	-	2	0	PIK3R5	8732348	0.624000	0.27102	0.999000	0.59377	0.045000	0.14185	2.299000	0.43611	2.568000	0.86640	0.650000	0.86243	GCC	PIK3R5	-	pfam_PI3K_1B_gamma_p101_su	ENSG00000141506		0.667	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIK3R5	HGNC	protein_coding	OTTHUMT00000227003.2		0.00	50	0	G	NM_014308		8791623	-1			no_errors	ENST00000447110	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.179	A
PITPNC1	26207	genome.wustl.edu	37	17	65688960	65688960	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:65688960G>T	ENST00000581322.1	+	9	955	c.955G>T	c.(955-957)Ggc>Tgc	p.G319C	PITPNC1_ENST00000335257.6_Missense_Mutation_p.G319C|PITPNC1_ENST00000580974.1_3'UTR|PITPNC1_ENST00000299954.9_3'UTR			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	319					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			GAATTTACCCGGCATGCACTC	0.423																																																	0													84.0	84.0	84.0					17																	65688960		1805	4070	5875	SO:0001583	missense	0			AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.955G>T	17.37:g.65688960G>T	ENSP00000464006:p.Gly319Cys		A8K473|J3QR20|Q96I07	Missense_Mutation	SNP	pfam_PI_transfer,prints_PI_transfer	p.G319C	ENST00000581322.1	37	c.955	CCDS58588.1	17	.	.	.	.	.	.	.	.	.	.	G	17.10	3.301932	0.60195	.	.	ENSG00000154217	ENST00000335257	T	0.47177	0.85	5.87	3.82	0.43975	.	0.207171	0.40818	N	0.001015	T	0.30572	0.0769	N	0.24115	0.695	0.80722	D	1	B	0.10296	0.003	B	0.12156	0.007	T	0.18429	-1.0337	10	0.87932	D	0	-8.074	5.8475	0.18673	0.128:0.0:0.5639:0.3081	.	319	Q9UKF7	PITC1_HUMAN	C	319	ENSP00000335618:G319C	ENSP00000335618:G319C	G	+	1	0	PITPNC1	63119422	1.000000	0.71417	0.964000	0.40570	0.875000	0.50365	3.442000	0.52900	1.561000	0.49584	0.655000	0.94253	GGC	PITPNC1	-	NULL	ENSG00000154217		0.423	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNC1	HGNC	protein_coding	OTTHUMT00000447194.1	-	0.00	47	0	G	NM_012417		65688960	+1	tier1	-	no_errors	ENST00000335257	ensembl	human	known	74_37	missense	16.33	41	8	SNP	1.000	T
PKN1	5585	genome.wustl.edu	37	19	14578588	14578588	+	Silent	SNP	C	C	A	rs567970117		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:14578588C>A	ENST00000242783.6	+	14	2032	c.1867C>A	c.(1867-1869)Cgg>Agg	p.R623R	PKN1_ENST00000342216.4_Silent_p.R629R	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	623	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						GGTGCTGGGCCGGGGTCATTT	0.622																																					NSCLC(185;2539 2965 10733 52867)												0													51.0	56.0	55.0					19																	14578588		1929	4131	6060	SO:0001819	synonymous_variant	0			S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.1867C>A	19.37:g.14578588C>A			A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Silent	SNP	pfam_Prot_kinase_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_dom,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.R629	ENST00000242783.6	37	c.1885	CCDS42513.1	19																																																																																			PKN1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000123143		0.622	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN1	HGNC	protein_coding	OTTHUMT00000095510.1	-	0.00	100	0	C	NM_002741, NM_213560		14578588	+1	tier1	-	no_errors	ENST00000342216	ensembl	human	known	74_37	silent	11.22	87	11	SNP	1.000	A
PLB1	151056	genome.wustl.edu	37	2	28820876	28820876	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:28820876G>T	ENST00000327757.5	+	34	2370	c.2326G>T	c.(2326-2328)Gga>Tga	p.G776*	PLB1_ENST00000422425.2_Nonsense_Mutation_p.G765*	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	776	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					CTACAGTGCAGGAGGGGACGG	0.517																																																	0													112.0	95.0	101.0					2																	28820876		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2326G>T	2.37:g.28820876G>T	ENSP00000330442:p.Gly776*		A8KAX2|Q53S03|Q8IUP7|Q96DP9	Nonsense_Mutation	SNP	pfam_Lipase_GDSL	p.G765*	ENST00000327757.5	37	c.2293	CCDS33168.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.398610|7.398610	0.98258|0.98258	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425|ENST00000404858	.|.	.|.	.|.	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	0.092793|.	0.47455|.	D|.	0.000222|.	.|T	.|0.74230	.|0.3689	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71300	.|-0.4634	.|4	0.87932|.	D|.	0|.	-17.655|-17.655	17.4764|17.4764	0.87660|0.87660	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|H	776;765|763	.|.	ENSP00000330442:G776X|.	G|Q	+|+	1|3	0|2	PLB1|PLB1	28674380|28674380	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.487000|0.487000	0.33371|0.33371	5.903000|5.903000	0.69877|0.69877	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	GGA|CAG	PLB1	-	pfam_Lipase_GDSL	ENSG00000163803		0.517	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PLB1	HGNC	protein_coding	OTTHUMT00000353348.2	-	0.00	64	0	G			28820876	+1	tier1	-	no_errors	ENST00000422425	ensembl	human	known	74_37	nonsense	10.78	91	11	SNP	0.997	T
PLK5	126520	genome.wustl.edu	37	19	1531846	1531846	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:1531846G>C	ENST00000334770.4	+	11	1567	c.678G>C	c.(676-678)acG>acC	p.T226T	PLK5_ENST00000454744.2_Silent_p.T226T			Q496M5	PLK5_HUMAN	polo-like kinase 5	226					cellular response to growth factor stimulus (GO:0071363)|defense response to tumor cell (GO:0002357)|G2 DNA damage checkpoint (GO:0031572)|mitotic nuclear division (GO:0007067)|positive regulation of neuron projection development (GO:0010976)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)										GGGGGCGCACGGGACGGCACC	0.637																																																	0																																										SO:0001819	synonymous_variant	0			DQ424898	CCDS59328.1	19p13.3	2012-11-19	2011-07-14	2011-07-14	ENSG00000185988	ENSG00000185988			27001	protein-coding gene	gene with protein product			"""polo-like kinase 5 pseudogene"", ""polo-like kinase 5, pseudogene"""	PLK5P		21245385	Standard	NM_001243079		Approved	SgK384ps	uc002ltf.3	Q496M5	OTTHUMG00000180073	ENST00000334770.4:c.678G>C	19.37:g.1531846G>C			B3KNR4|Q1ZYM0	Silent	SNP	superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.T226	ENST00000334770.4	37	c.678	CCDS59328.1	19																																																																																			PLK5	-	NULL	ENSG00000185988		0.637	PLK5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLK5	HGNC	protein_coding	OTTHUMT00000449628.1	-	0.00	66	0	G	NR_026557		1531846	+1	tier1	-	no_errors	ENST00000334770	ensembl	human	known	74_37	silent	9.41	77	8	SNP	1.000	C
PMS2	5395	genome.wustl.edu	37	7	6045569	6045569	+	Silent	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:6045569T>C	ENST00000265849.7	-	2	222	c.117A>G	c.(115-117)gtA>gtG	p.V39V	PMS2_ENST00000382321.4_Silent_p.V39V|PMS2_ENST00000406569.3_Silent_p.V39V|PMS2_ENST00000441476.2_5'Flank|PMS2_ENST00000469652.1_Intron|Y_RNA_ENST00000365120.1_RNA	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	39					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		CTAACTCCTTTACCGCAGTGC	0.438			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													305.0	372.0	347.0					7																	6045569		1375	2331	3706	SO:0001819	synonymous_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.117A>G	7.37:g.6045569T>C			B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Silent	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_MutL_C,tigrfam_DNA_mismatch_repair_N	p.V39	ENST00000265849.7	37	c.117	CCDS5343.1	7																																																																																			PMS2	-	pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,tigrfam_DNA_mismatch_repair_N	ENSG00000122512		0.438	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2	HGNC	protein_coding	OTTHUMT00000207353.3	-	0.00	424	0	T	NM_000535		6045569	-1	tier1	rs34839707	no_errors	ENST00000265849	ensembl	human	known	74_37	silent	7.46	459	37	SNP	0.993	C
PLXNA4	91584	genome.wustl.edu	37	7	132169579	132169579	+	Intron	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:132169579G>T	ENST00000359827.3	-	3	2334				PLXNA4_ENST00000321063.4_Intron|PLXNA4_ENST00000423507.2_Intron|PLXNA4_ENST00000378539.5_Missense_Mutation_p.S522Y			Q9HCM2	PLXA4_HUMAN	plexin A4						anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GTAATTTTAGGAAGAATTCCC	0.388																																																	0													70.0	70.0	70.0					7																	132169579		2203	4300	6503	SO:0001627	intron_variant	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1371+4471C>A	7.37:g.132169579G>T			A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	p.S522Y	ENST00000359827.3	37	c.1565	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	G	9.308	1.054830	0.19907	.	.	ENSG00000221866	ENST00000378539	T	0.02737	4.18	3.34	-6.68	0.01778	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.49133	-0.8971	9	0.87932	D	0	.	7.6428	0.28303	0.2264:0.0:0.6346:0.139	.	522	A4D1N6	.	Y	522	ENSP00000367800:S522Y	ENSP00000367800:S522Y	S	-	2	0	PLXNA4	131820119	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-0.232000	0.09055	-1.771000	0.01293	-0.367000	0.07326	TCC	PLXNA4	-	NULL	ENSG00000221866		0.388	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	-	0.00	83	0	G	NM_181775		132169579	-1	tier1	-	no_errors	ENST00000378539	ensembl	human	known	74_37	missense	8.08	91	8	SNP	0.000	T
PNMA3	29944	genome.wustl.edu	37	X	152226335	152226335	+	Missense_Mutation	SNP	G	G	C	rs371005134		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:152226335G>C	ENST00000370264.4	+	1	949	c.923G>C	c.(922-924)cGa>cCa	p.R308P	PNMA3_ENST00000447306.1_Missense_Mutation_p.R308P|PNMA3_ENST00000370265.4_Missense_Mutation_p.R308P			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	308					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					gacaaactccgagataagctt	0.512																																																	0													58.0	54.0	56.0					X																	152226335		2203	4300	6503	SO:0001583	missense	0			AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.923G>C	X.37:g.152226335G>C	ENSP00000359286:p.Arg308Pro		D3DWT7|Q9H0A4	Missense_Mutation	SNP	superfamily_Znf_CCHC,pfscan_Znf_CCHC	p.R308P	ENST00000370264.4	37	c.923	CCDS35435.2	X	.	.	.	.	.	.	.	.	.	.	g	11.19	1.566265	0.27915	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.11063	2.81;2.81;2.81	1.98	0.137	0.14787	.	.	.	.	.	T	0.23014	0.0556	M	0.61703	1.905	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.09596	-1.0667	9	0.56958	D	0.05	.	4.1399	0.10188	0.4069:0.0:0.5931:0.0	.	308	Q9UL41	PNMA3_HUMAN	P	308	ENSP00000359288:R308P;ENSP00000407642:R308P;ENSP00000359286:R308P	ENSP00000359286:R308P	R	+	2	0	PNMA3	151976991	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.044000	0.12023	-0.053000	0.13289	-0.381000	0.06696	CGA	PNMA3	-	NULL	ENSG00000183837		0.512	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA3	HGNC	protein_coding	OTTHUMT00000060946.2	-	0.00	64	0	G	NM_013364		152226335	+1	tier1	-	no_errors	ENST00000370264	ensembl	human	known	74_37	missense	7.04	66	5	SNP	0.000	C
POFUT1	23509	genome.wustl.edu	37	20	30818726	30818726	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:30818726G>T	ENST00000375749.3	+	6	902	c.840G>T	c.(838-840)atG>atT	p.M280I	POFUT1_ENST00000539210.1_Missense_Mutation_p.M69I|POFUT1_ENST00000486717.1_3'UTR	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	280					angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCCTCACGATGACTATGTGCC	0.617																																																	0													95.0	86.0	89.0					20																	30818726		2203	4300	6503	SO:0001583	missense	0			AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.840G>T	20.37:g.30818726G>T	ENSP00000364902:p.Met280Ile		A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Missense_Mutation	SNP	pfam_GDP-Fuc_O-FucTrfase	p.M280I	ENST00000375749.3	37	c.840	CCDS13198.1	20	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229325	0.39399	.	.	ENSG00000101346	ENST00000375749;ENST00000539210	T;T	0.28895	1.59;1.59	5.19	3.21	0.36854	.	0.542116	0.21731	N	0.069973	T	0.27241	0.0668	L	0.60455	1.87	0.33677	D	0.611626	B	0.06786	0.001	B	0.15052	0.012	T	0.30031	-0.9992	10	0.17832	T	0.49	-11.5451	10.027	0.42076	0.0725:0.0:0.7895:0.138	.	280	Q9H488	OFUT1_HUMAN	I	280;69	ENSP00000364902:M280I;ENSP00000446154:M69I	ENSP00000364902:M280I	M	+	3	0	POFUT1	30282387	1.000000	0.71417	0.995000	0.50966	0.855000	0.48748	4.624000	0.61254	0.566000	0.29273	0.585000	0.79938	ATG	POFUT1	-	pfam_GDP-Fuc_O-FucTrfase	ENSG00000101346		0.617	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	POFUT1	HGNC	protein_coding	OTTHUMT00000078613.1	-	0.00	44	0	G	NM_015352		30818726	+1	tier1	-	no_errors	ENST00000375749	ensembl	human	known	74_37	missense	10.67	67	8	SNP	1.000	T
POLM	27434	genome.wustl.edu	37	7	44113285	44113285	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:44113285C>T	ENST00000242248.5	-	10	1438	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	POLM_ENST00000395831.3_Missense_Mutation_p.R366H|POLM_ENST00000335195.6_Missense_Mutation_p.R409H|POLM_ENST00000492971.1_5'Flank	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	446					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						CCGGCTGAAGCGGCGCAGCTC	0.642								DNA polymerases (catalytic subunits)																																									0													52.0	56.0	54.0					7																	44113285		2203	4300	6503	SO:0001583	missense	0			AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.1337G>A	7.37:g.44113285C>T	ENSP00000242248:p.Arg446His		D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	pfam_DNA_pol_lambd_fingers_domain,superfamily_DNA_pol_b-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_DNA-dir_DNA_pol_X,pirsf_TdT/Mu,pfscan_BRCT_dom,prints_TdT/Mu,prints_DNA_pol_X,prints_DNA_pol_X_beta-like	p.R446H	ENST00000242248.5	37	c.1337	CCDS34625.1	7	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709472	0.89018	.	.	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831	T;T;T	0.46451	0.87;0.87;0.87	5.45	3.51	0.40186	DNA-directed DNA polymerase X (1);	0.189178	0.39475	N	0.001351	T	0.61874	0.2382	M	0.78344	2.41	0.21967	N	0.999445	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70716	0.97;0.945;0.941	T	0.55114	-0.8191	10	0.87932	D	0	-12.0498	11.4757	0.50297	0.3215:0.6785:0.0:0.0	.	366;409;446	Q86WQ9;Q6P5X8;Q9NP87	.;.;DPOLM_HUMAN	H	409;446;366	ENSP00000335141:R409H;ENSP00000242248:R446H;ENSP00000379174:R366H	ENSP00000242248:R446H	R	-	2	0	POLM	44079810	0.996000	0.38824	0.991000	0.47740	0.992000	0.81027	6.218000	0.72224	1.414000	0.47017	0.650000	0.86243	CGC	POLM	-	smart_DNA-dir_DNA_pol_X,pirsf_TdT/Mu,prints_TdT/Mu	ENSG00000122678		0.642	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLM	HGNC	protein_coding	OTTHUMT00000339594.1		0.00	38	0	C	NM_013284		44113285	-1			no_errors	ENST00000242248	ensembl	human	known	74_37	missense	5.56	67	4	SNP	0.898	T
POU5F2	134187	genome.wustl.edu	37	5	93076834	93076834	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:93076834C>A	ENST00000510627.4	-	1	509	c.436G>T	c.(436-438)Gat>Tat	p.D146Y	RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000509163.1_Intron|FAM172A_ENST00000509739.1_Intron|FAM172A_ENST00000505869.1_Intron|POU5F2_ENST00000606183.1_5'Flank|FAM172A_ENST00000395965.3_Intron	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	146	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		ATCCCCACATCGGCCTGCGAG	0.587																																																	0													95.0	103.0	100.0					5																	93076834		2147	4269	6416	SO:0001583	missense	0				CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.436G>T	5.37:g.93076834C>A	ENSP00000464890:p.Asp146Tyr		Q15169|Q6MZL7|Q8N748	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.D146Y	ENST00000510627.4	37	c.436	CCDS59489.1	5																																																																																			POU5F2	-	pfam_POU_specific,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,pfscan_POU_specific,prints_POU	ENSG00000248483		0.587	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU5F2	HGNC	protein_coding	OTTHUMT00000369873.5	-	0.00	54	0	C	NM_153216		93076834	-1	tier1	-	no_errors	ENST00000510627	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.997	A
PPAP2B	8613	genome.wustl.edu	37	1	56977762	56977762	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:56977762G>T	ENST00000371250.3	-	5	1247	c.696C>A	c.(694-696)ttC>ttA	p.F232L	PPAP2B_ENST00000459962.1_5'UTR	NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	232					Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						TGATCAAGGTGAACTGCAGGA	0.557																																																	0													68.0	65.0	66.0					1																	56977762		2203	4300	6503	SO:0001583	missense	0			AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.696C>A	1.37:g.56977762G>T	ENSP00000360296:p.Phe232Leu		B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.F232L	ENST00000371250.3	37	c.696	CCDS604.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.441486	0.96187	.	.	ENSG00000162407	ENST00000371250	T	0.72942	-0.7	6.04	6.04	0.98038	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.045787	0.85682	N	0.000000	T	0.78710	0.4326	L	0.41906	1.305	0.80722	D	1	P	0.40376	0.715	P	0.57548	0.823	T	0.74532	-0.3634	10	0.40728	T	0.16	.	19.583	0.95478	0.0:0.0:1.0:0.0	.	232	O14495	LPP3_HUMAN	L	232	ENSP00000360296:F232L	ENSP00000360296:F232L	F	-	3	2	PPAP2B	56750350	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.494000	0.60347	2.873000	0.98535	0.563000	0.77884	TTC	PPAP2B	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	ENSG00000162407		0.557	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2B	HGNC	protein_coding	OTTHUMT00000022334.2	-	0.00	58	0	G	NM_003713		56977762	-1	tier1	-	no_errors	ENST00000371250	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
PPFIA2	8499	genome.wustl.edu	37	12	81762631	81762631	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:81762631C>A	ENST00000549396.1	-	13	1515	c.1355G>T	c.(1354-1356)aGg>aTg	p.R452M	PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R452M|PPFIA2_ENST00000541017.1_De_novo_Start_OutOfFrame|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R353M|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R378M|PPFIA2_ENST00000541570.2_Missense_Mutation_p.R19M|PPFIA2_ENST00000550359.2_Missense_Mutation_p.R299M|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R452M|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R452M|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R434M|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R434M	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	452	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CTCTCTTTGCCTAGCCTTACA	0.303																																																	0													188.0	169.0	175.0					12																	81762631		1807	4087	5894	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1355G>T	12.37:g.81762631C>A	ENSP00000450337:p.Arg452Met		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R452M	ENST00000549396.1	37	c.1355	CCDS55857.1	12	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496716	0.64186	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000553058;ENST00000548670	T;T;T;T;T;T;T;T;T	0.42513	0.97;0.97;1.56;0.97;0.97;0.97;0.97;0.97;0.97	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.52933	0.1765	M	0.84773	2.715	0.80722	D	1	P	0.50943	0.94	B	0.41723	0.365	T	0.65261	-0.6211	10	0.62326	D	0.03	-17.4348	19.4993	0.95086	0.0:1.0:0.0:0.0	.	452	O75334	LIPA2_HUMAN	M	452;434;19;378;463;434;452;353;452;33;19	ENSP00000450337:R452M;ENSP00000450298:R434M;ENSP00000438337:R19M;ENSP00000385093:R378M;ENSP00000327416:R434M;ENSP00000449338:R452M;ENSP00000388373:R353M;ENSP00000447868:R452M;ENSP00000448941:R33M	ENSP00000327416:R434M	R	-	2	0	PPFIA2	80286762	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.818000	0.86416	2.687000	0.91594	0.563000	0.77884	AGG	PPFIA2	-	NULL	ENSG00000139220		0.303	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	-	0.00	74	0	C			81762631	-1	tier1	-	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	9.28	88	9	SNP	1.000	A
PPP1R12B	4660	genome.wustl.edu	37	1	202532001	202532001	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:202532001C>A	ENST00000608999.1	+	20	2756	c.2603C>A	c.(2602-2604)gCc>gAc	p.A868D	PPP1R12B_ENST00000367270.4_Missense_Mutation_p.A94D|PPP1R12B_ENST00000391959.3_Missense_Mutation_p.A94D|PPP1R12B_ENST00000290419.5_3'UTR|PPP1R12B_ENST00000336894.4_Missense_Mutation_p.A868D	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	868					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCCCGCCTAGCCACCCTGACC	0.512																																																	0													46.0	57.0	53.0					1																	202532001		2200	4299	6499	SO:0001583	missense	0			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.2603C>A	1.37:g.202532001C>A	ENSP00000476755:p.Ala868Asp		A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_12A/B/C_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A868D	ENST00000608999.1	37	c.2603	CCDS1426.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.033121	0.75504	.	.	ENSG00000077157	ENST00000406302;ENST00000336894;ENST00000391959;ENST00000367270	T;T;T;T	0.47869	0.96;0.99;0.83;0.83	5.07	5.07	0.68467	.	0.103173	0.42548	D	0.000684	T	0.62307	0.2417	M	0.62723	1.935	0.48452	D	0.99965	D;D;P	0.89917	1.0;0.993;0.956	D;P;P	0.71414	0.973;0.777;0.72	T	0.56195	-0.8019	10	0.13470	T	0.59	.	15.7557	0.78021	0.0:1.0:0.0:0.0	.	94;868;868	O60237-3;O60237;F8W8M3	.;MYPT2_HUMAN;.	D	868;868;94;94	ENSP00000384496:A868D;ENSP00000337897:A868D;ENSP00000375821:A94D;ENSP00000356239:A94D	ENSP00000337897:A868D	A	+	2	0	PPP1R12B	200798624	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.338000	0.59316	2.505000	0.84491	0.655000	0.94253	GCC	PPP1R12B	-	pirsf_Pase-1_reg_su_12A/B/C_euk	ENSG00000077157		0.512	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	HGNC	protein_coding	OTTHUMT00000099166.3	-	0.00	82	0	C	NM_032105		202532001	+1	tier1	-	no_errors	ENST00000336894	ensembl	human	known	74_37	missense	5.98	110	7	SNP	1.000	A
PPP1R16B	26051	genome.wustl.edu	37	20	37531341	37531341	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:37531341G>T	ENST00000299824.1	+	6	791	c.602G>T	c.(601-603)cGg>cTg	p.R201L	PPP1R16B_ENST00000373331.2_Missense_Mutation_p.R201L	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	201					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				AACGAGATGCGGGTGGCTCCT	0.587																																																	0													124.0	105.0	111.0					20																	37531341		2203	4300	6503	SO:0001583	missense	0			AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.602G>T	20.37:g.37531341G>T	ENSP00000299824:p.Arg201Leu		A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R201L	ENST00000299824.1	37	c.602	CCDS13309.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.222451|5.222451	0.95139|0.95139	.|.	.|.	ENSG00000101445|ENSG00000101445	ENST00000438192|ENST00000299824;ENST00000373331	.|T;T	.|0.52295	.|0.67;0.67	4.42|4.42	4.42|4.42	0.53409|0.53409	.|Ankyrin repeat-containing domain (3);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.69124|0.69124	0.3076|0.3076	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.998	T|T	0.73142|0.73142	-0.4076|-0.4076	5|10	.|0.59425	.|D	.|0.04	.|.	17.5774|17.5774	0.87955|0.87955	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|201;201	.|E9PFS8;Q96T49	.|.;PP16B_HUMAN	W|L	144|201	.|ENSP00000299824:R201L;ENSP00000362428:R201L	.|ENSP00000299824:R201L	G|R	+|+	1|2	0|0	PPP1R16B|PPP1R16B	36964755|36964755	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	9.345000|9.345000	0.97053|0.97053	2.440000|2.440000	0.82611|0.82611	0.655000|0.655000	0.94253|0.94253	GGG|CGG	PPP1R16B	-	superfamily_Ankyrin_rpt-contain_dom,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt-contain_dom	ENSG00000101445		0.587	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16B	HGNC	protein_coding	OTTHUMT00000079220.2	-	0.00	41	0	G	NM_015568		37531341	+1	tier1	-	no_errors	ENST00000299824	ensembl	human	known	74_37	missense	13.33	39	6	SNP	1.000	T
PPP2R5C	5527	genome.wustl.edu	37	14	102349849	102349849	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:102349849C>A	ENST00000334743.5	+	5	627	c.579C>A	c.(577-579)ttC>ttA	p.F193L	PPP2R5C_ENST00000422945.2_Missense_Mutation_p.F224L|PPP2R5C_ENST00000350249.3_Missense_Mutation_p.F193L|PPP2R5C_ENST00000557095.1_Missense_Mutation_p.F193L|PPP2R5C_ENST00000445439.3_Missense_Mutation_p.F193L|PPP2R5C_ENST00000328724.5_Missense_Mutation_p.F248L	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	193					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						ATGGGAAATTCCTAGGCTTGA	0.393																																																	0													73.0	83.0	80.0					14																	102349849		2201	4296	6497	SO:0001583	missense	0			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.579C>A	14.37:g.102349849C>A	ENSP00000333905:p.Phe193Leu		B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.F224L	ENST00000334743.5	37	c.672	CCDS9964.1	14	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347825	0.61183	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000334756;ENST00000557621;ENST00000445439;ENST00000334743;ENST00000557095	T;T;T;T;T	0.53206	0.64;0.65;0.63;0.69;0.64	4.62	4.62	0.57501	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67116	0.2859	M	0.84082	2.675	0.80722	D	1	D;D;D;D;P;D	0.65815	0.981;0.977;0.995;0.984;0.656;0.982	P;P;D;P;B;D	0.64410	0.842;0.885;0.924;0.878;0.402;0.925	T	0.72027	-0.4414	10	0.72032	D	0.01	-18.7268	11.3857	0.49785	0.0:0.9162:0.0:0.0838	.	224;91;193;193;193;248	F5GWP3;E9PHN5;Q13362-3;Q13362;Q13362-2;Q6ZN33	.;.;.;2A5G_HUMAN;.;.	L	224;248;222;193;91;162;193;193;193	ENSP00000412324:F224L;ENSP00000329009:F248L;ENSP00000450931:F222L;ENSP00000262239:F193L;ENSP00000333905:F193L	ENSP00000329009:F248L	F	+	3	2	PPP2R5C	101419602	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.482000	0.45224	2.284000	0.76573	0.655000	0.94253	TTC	PPP2R5C	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000078304		0.393	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	HGNC	protein_coding	OTTHUMT00000414373.2	-	0.00	93	0	C	NM_002719		102349849	+1	tier1	-	no_errors	ENST00000422945	ensembl	human	known	74_37	missense	16.26	103	20	SNP	1.000	A
PRAC1	84366	genome.wustl.edu	37	17	46801787	46801787	+	5'Flank	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:46801787G>C	ENST00000290294.3	-	0	0				PRAC2_ENST00000422730.2_RNA|MIR3185_ENST00000583892.1_RNA|PRAC2_ENST00000432056.1_RNA	NM_032391.2	NP_115767.1	Q96KF2	PRAC1_HUMAN	prostate cancer susceptibility candidate 1							nucleus (GO:0005634)											ACAGAAGGCGGATGGCTCTGC	0.542											OREG0024525	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001631	upstream_gene_variant	0			AF331165	CCDS11535.1	17q21	2013-08-29	2013-08-29	2013-08-29	ENSG00000159182	ENSG00000159182			30591	protein-coding gene	gene with protein product	"""prostate, rectum and colon"""	609819	"""chromosome 17 open reading frame 92"", ""prostate cancer susceptibility candidate"""	C17orf92, PRAC		11340635	Standard	NM_032391		Approved		uc002iny.3	Q96KF2	OTTHUMG00000159899		17.37:g.46801787G>C	Exception_encountered	942		RNA	SNP	-	NULL	ENST00000290294.3	37	NULL	CCDS11535.1	17																																																																																			PRAC2	-	-	ENSG00000229637		0.542	PRAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAC2	HGNC	protein_coding	OTTHUMT00000358086.1	-	0.00	91	0	G	NM_032391		46801787	+1	tier1	-	no_errors	ENST00000422730	ensembl	human	known	74_37	rna	11.88	89	12	SNP	0.000	C
PRAMEF12	390999	genome.wustl.edu	37	1	12835017	12835017	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:12835017C>A	ENST00000357726.4	+	1	34	c.7C>A	c.(7-9)Ctc>Atc	p.L3I		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	3					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGATGAGCCTCCAGGCCCC	0.542																																																	0													42.0	49.0	47.0					1																	12835017		2192	4298	6490	SO:0001583	missense	0				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.7C>A	1.37:g.12835017C>A	ENSP00000350358:p.Leu3Ile			Missense_Mutation	SNP	NULL	p.L3I	ENST00000357726.4	37	c.7	CCDS41254.1	1	.	.	.	.	.	.	.	.	.	.	.	0.028	-1.353826	0.01256	.	.	ENSG00000116726	ENST00000357726	T	0.04809	3.55	2.68	-5.36	0.02689	.	3.958300	0.00877	N	0.002094	T	0.01976	0.0062	N	0.04636	-0.2	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.40887	-0.9539	10	0.14252	T	0.57	.	2.2329	0.04001	0.2251:0.4666:0.1474:0.1609	.	3	O95522	PRA12_HUMAN	I	3	ENSP00000350358:L3I	ENSP00000350358:L3I	L	+	1	0	PRAMEF12	12757604	0.000000	0.05858	0.002000	0.10522	0.222000	0.24845	-6.659000	0.00058	-1.123000	0.02940	0.195000	0.17529	CTC	PRAMEF12	-	NULL	ENSG00000116726		0.542	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF12	HGNC	protein_coding	OTTHUMT00000005457.1	-	0.00	102	0	C	XM_372760		12835017	+1	tier1	-	no_errors	ENST00000357726	ensembl	human	known	74_37	missense	11.02	105	13	SNP	0.001	A
PRIM1	5557	genome.wustl.edu	37	12	57132266	57132266	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:57132266C>A	ENST00000338193.6	-	11	1132	c.1096G>T	c.(1096-1098)Gaa>Taa	p.E366*		NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	366					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						TCCTCTTTTTCCTCTTCATTA	0.348																																																	0													117.0	107.0	110.0					12																	57132266		1859	4102	5961	SO:0001587	stop_gained	0			BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.1096G>T	12.37:g.57132266C>A	ENSP00000350491:p.Glu366*			Nonsense_Mutation	SNP	pfam_DNA_primase_S,tigrfam_DNA_primase_ssu_euk/arc	p.E366*	ENST00000338193.6	37	c.1096	CCDS44926.1	12	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379224	0.24944	.	.	ENSG00000198056	ENST00000537418;ENST00000338193;ENST00000549549	.	.	.	3.18	2.28	0.28536	.	0.454073	0.21706	N	0.070341	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-4.7778	6.5196	0.22266	0.0:0.8584:0.0:0.1416	.	.	.	.	X	373;366;147	.	ENSP00000350491:E366X	E	-	1	0	PRIM1	55418533	0.290000	0.24343	0.681000	0.30009	0.403000	0.30841	0.520000	0.22878	0.668000	0.31126	-0.216000	0.12614	GAA	PRIM1	-	NULL	ENSG00000198056		0.348	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIM1	HGNC	protein_coding	OTTHUMT00000406956.1	-	0.00	51	0	C	NM_000946		57132266	-1	tier1	-	no_errors	ENST00000338193	ensembl	human	known	74_37	nonsense	15.00	51	9	SNP	0.977	A
PRKAR1B	5575	genome.wustl.edu	37	7	716865	716865	+	Splice_Site	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:716865C>A	ENST00000406797.1	-	4	615		c.e4+1		PRKAR1B_ENST00000403562.1_Splice_Site|PRKAR1B_ENST00000544935.1_Splice_Site|PRKAR1B_ENST00000360274.4_Splice_Site|PRKAR1B_ENST00000537384.1_Splice_Site	NM_001164761.1	NP_001158233.1	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, beta						activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)			endometrium(4)|large_intestine(1)|liver(1)|lung(10)|prostate(1)	17		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		AGTCTGCCTACCTCCTCTCGT	0.642																																																	0													267.0	186.0	213.0					7																	716865		2203	4300	6503	SO:0001630	splice_region_variant	0			M65066	CCDS34579.1	7p22.3	2013-09-19			ENSG00000188191	ENSG00000188191	2.7.11.1		9390	protein-coding gene	gene with protein product		176911				1358799, 3479018	Standard	NM_002735		Approved		uc003siw.2	P31321	OTTHUMG00000151411	ENST00000406797.1:c.440+1G>T	7.37:g.716865C>A			Q8N422	Splice_Site	SNP	-	e3+1	ENST00000406797.1	37	c.440+1	CCDS34579.1	7	.	.	.	.	.	.	.	.	.	.	C	14.38	2.518610	0.44763	.	.	ENSG00000188191	ENST00000537384;ENST00000544935;ENST00000406797;ENST00000403562;ENST00000360274;ENST00000430040;ENST00000414568;ENST00000417852	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5007	0.87731	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKAR1B	683391	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	7.177000	0.77650	2.181000	0.69327	0.655000	0.94253	.	PRKAR1B	-	-	ENSG00000188191		0.642	PRKAR1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRKAR1B	HGNC	protein_coding	OTTHUMT00000322525.1	-	0.00	45	0	C		Intron	716865	-1	tier1	-	no_errors	ENST00000360274	ensembl	human	known	74_37	splice_site	11.59	60	8	SNP	1.000	A
PRKCB	5579	genome.wustl.edu	37	16	24135200	24135200	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:24135200G>T	ENST00000321728.7	+	9	1138	c.963G>T	c.(961-963)acG>acT	p.T321T	PRKCB_ENST00000303531.7_Silent_p.T321T	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	321					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	AAGAAAAGACGACCAACACTG	0.483																																																	0													140.0	131.0	134.0					16																	24135200		2197	4300	6497	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.963G>T	16.37:g.24135200G>T			C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.T321	ENST00000321728.7	37	c.963	CCDS10618.1	16																																																																																			PRKCB	-	superfamily_Kinase-like_dom,pirsf_Protein_kinase_C_a/b/g	ENSG00000166501		0.483	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	-	0.00	80	0	G	NM_212535		24135200	+1	tier1	-	no_errors	ENST00000303531	ensembl	human	known	74_37	silent	10.67	67	8	SNP	0.000	T
PRMT8	56341	genome.wustl.edu	37	12	3661874	3661874	+	Intron	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:3661874C>T	ENST00000382622.3	+	4	807				PRMT8_ENST00000261252.4_3'UTR|PRMT8_ENST00000452611.2_Intron	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8						histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CGTAGGTGCCCTCACCCTTCC	0.627																																																	0													9.0	8.0	8.0					12																	3661874		873	1981	2854	SO:0001627	intron_variant	0			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.418-943C>T	12.37:g.3661874C>T			B2RDP0|Q8TBJ8	RNA	SNP	-	NULL	ENST00000382622.3	37	NULL	CCDS8521.2	12																																																																																			PRMT8	-	-	ENSG00000111218		0.627	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT8	HGNC	protein_coding	OTTHUMT00000250297.2	-	0.00	58	0	C	NM_019854		3661874	+1	tier1	-	no_errors	ENST00000261252	ensembl	human	known	74_37	rna	6.76	69	5	SNP	0.002	T
PRPH	5630	genome.wustl.edu	37	12	49689244	49689244	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:49689244C>G	ENST00000257860.4	+	1	1760	c.261C>G	c.(259-261)aaC>aaG	p.N87K	RP11-161H23.9_ENST00000553259.1_RNA	NM_006262.3	NP_006253.2	P23942	PRPH2_HUMAN	peripherin	0					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(8)|skin(1)	12						AGGCCCTCAACCAGGAGTTCC	0.677																																																	0													13.0	13.0	13.0					12																	49689244		2195	4296	6491	SO:0001583	missense	0				CCDS8783.1	12q12-q13	2013-01-16						"""Intermediate filaments type III"""	9461	protein-coding gene	gene with protein product		170710		NEF4		1378416	Standard	XM_005269025		Approved	PRPH1	uc001rtu.3	P41219		ENST00000257860.4:c.261C>G	12.37:g.49689244C>G	ENSP00000257860:p.Asn87Lys		Q5TFH5|Q6DK65	Missense_Mutation	SNP	pfam_IF,pfam_Intermed_filament_DNA-bd,prints_Keratin_I	p.N87K	ENST00000257860.4	37	c.261	CCDS8783.1	12	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192234	0.78902	.	.	ENSG00000135406	ENST00000257860;ENST00000451891	D	0.89681	-2.55	4.61	3.73	0.42828	Intermediate filament head, DNA-binding domain (1);	0.000000	0.43416	D	0.000572	D	0.93213	0.7838	M	0.80616	2.505	0.52501	D	0.999959	D	0.59357	0.985	D	0.67382	0.951	D	0.92943	0.6374	10	0.59425	D	0.04	.	10.4432	0.44477	0.0:0.9046:0.0:0.0954	.	87	P41219	PERI_HUMAN	K	87;6	ENSP00000257860:N87K	ENSP00000257860:N87K	N	+	3	2	PRPH	47975511	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.772000	0.62324	1.181000	0.42912	-0.251000	0.11542	AAC	PRPH	-	pfam_Intermed_filament_DNA-bd	ENSG00000135406		0.677	PRPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPH	HGNC	protein_coding	OTTHUMT00000393381.1		0.00	26	0	C	NM_006262		49689244	+1			no_errors	ENST00000257860	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	G
PRR16	51334	genome.wustl.edu	37	5	120022148	120022148	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:120022148G>T	ENST00000407149.2	+	2	868	c.659G>T	c.(658-660)tGt>tTt	p.C220F	PRR16_ENST00000379551.2_Missense_Mutation_p.C197F|PRR16_ENST00000446965.1_Missense_Mutation_p.C150F|PRR16_ENST00000505123.1_Missense_Mutation_p.C150F			Q569H4	LARGN_HUMAN	proline rich 16	220	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		TGTCCTGACTGTGATACCCGG	0.502																																																	0													76.0	76.0	76.0					5																	120022148		2203	4300	6503	SO:0001583	missense	0			AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.659G>T	5.37:g.120022148G>T	ENSP00000385118:p.Cys220Phe		D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	NULL	p.C220F	ENST00000407149.2	37	c.659		5	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769625	0.69992	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000505123;ENST00000446965	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.86209	0.5878	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.85164	0.0994	9	.	.	.	-0.6275	18.1142	0.89545	0.0:0.0:1.0:0.0	.	220;197	Q569H4;Q569H4-3	PRR16_HUMAN;.	F	220;197;150;150	ENSP00000385118:C220F;ENSP00000368869:C197F;ENSP00000423446:C150F;ENSP00000405491:C150F	.	C	+	2	0	PRR16	120050047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.388000	0.97237	2.563000	0.86464	0.650000	0.86243	TGT	PRR16	-	NULL	ENSG00000184838		0.502	PRR16-002	KNOWN	basic|appris_principal	protein_coding	PRR16	HGNC	protein_coding	OTTHUMT00000371059.1	-	0.00	59	0	G	NM_016644		120022148	+1	tier1	-	no_errors	ENST00000407149	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
PSMA1	5682	genome.wustl.edu	37	11	14632583	14632583	+	5'UTR	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:14632583G>T	ENST00000418988.2	-	0	277					NM_148976.2	NP_683877.1	P25786	PSA1_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3						ACATAGGTCTGGATTTGACTT	0.443																																																	0													90.0	82.0	85.0					11																	14632583		2200	4294	6494	SO:0001623	5_prime_UTR_variant	0			X61969	CCDS7816.1, CCDS31431.1	11p15.1	2005-10-10			ENSG00000129084	ENSG00000129084		"""Proteasome (prosome, macropain) subunits"""	9530	protein-coding gene	gene with protein product		602854				1398136, 2025653	Standard	NM_148976		Approved	HC2, NU, PROS30, MGC14542, MGC14575, MGC14751, MGC1667, MGC21459, MGC22853, MGC23915	uc001mlk.3	P25786	OTTHUMG00000165825	ENST00000418988.2:c.-51C>A	11.37:g.14632583G>T			A8K400|Q53YE8|Q9BRV9	RNA	SNP	-	NULL	ENST00000418988.2	37	NULL	CCDS31431.1	11																																																																																			PSMA1	-	-	ENSG00000129084		0.443	PSMA1-002	KNOWN	basic|CCDS	protein_coding	PSMA1	HGNC	protein_coding	OTTHUMT00000386422.2	-	0.00	62	0	G	NM_002786		14632583	-1	tier1	-	no_errors	ENST00000528018	ensembl	human	putative	74_37	rna	8.45	65	6	SNP	0.245	T
PSMA4	5685	genome.wustl.edu	37	15	78834886	78834886	+	Silent	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:78834886A>T	ENST00000044462.7	+	4	258	c.108A>T	c.(106-108)ggA>ggT	p.G36G	PSMA4_ENST00000558281.1_Silent_p.G36G|PSMA4_ENST00000558341.1_Silent_p.G36G|PSMA4_ENST00000557929.1_3'UTR|PSMA4_ENST00000559082.1_Silent_p.G36G|PSMA4_ENST00000560217.1_Intron|PSMA4_ENST00000413382.2_Intron|PSMA4_ENST00000558094.1_5'Flank	NM_002789.4	NP_002780.1	P25789	PSA4_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 4	36					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						CCTGTTTGGGAATTTTAGCAA	0.398																																																	0													191.0	192.0	191.0					15																	78834886		2196	4293	6489	SO:0001819	synonymous_variant	0			BC005361	CCDS10303.1, CCDS45319.1	15q24.1	2004-01-19			ENSG00000041357	ENSG00000041357		"""Proteasome (prosome, macropain) subunits"""	9533	protein-coding gene	gene with protein product		176846				2025653	Standard	NM_002789		Approved	HC9, HsT17706	uc010blf.3	P25789	OTTHUMG00000143859	ENST00000044462.7:c.108A>T	15.37:g.78834886A>T			D3DW86|Q53XP2|Q567Q5|Q8TBD1	Silent	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.G36	ENST00000044462.7	37	c.108	CCDS10303.1	15																																																																																			PSMA4	-	pfam_Proteasome_sua/b	ENSG00000041357		0.398	PSMA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA4	HGNC	protein_coding	OTTHUMT00000290107.5		0.00	86	0	A	NM_002789		78834886	+1			no_errors	ENST00000044462	ensembl	human	known	74_37	silent	6.09	108	7	SNP	0.981	T
PTCHD2	57540	genome.wustl.edu	37	1	11576105	11576105	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:11576105C>A	ENST00000294484.6	+	6	1774	c.1636C>A	c.(1636-1638)Cac>Aac	p.H546N	PTCHD2_ENST00000389575.3_Missense_Mutation_p.H546N	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	546	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CCAGGCCACCCACCTGGAAGA	0.592																																																	0													79.0	93.0	88.0					1																	11576105		2153	4247	6400	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1636C>A	1.37:g.11576105C>A	ENSP00000294484:p.His546Asn		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.H546N	ENST00000294484.6	37	c.1636	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876315	0.91664	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.95412	-3.7;-3.7	5.54	5.54	0.83059	Sterol-sensing domain (1);	0.045053	0.85682	D	0.000000	D	0.95796	0.8632	L	0.55990	1.75	0.80722	D	1	P	0.48834	0.916	P	0.53185	0.72	D	0.94328	0.7559	10	0.26408	T	0.33	-37.1547	18.4729	0.90781	0.0:1.0:0.0:0.0	.	546	Q9P2K9	PTHD2_HUMAN	N	546	ENSP00000294484:H546N;ENSP00000374226:H546N	ENSP00000294484:H546N	H	+	1	0	PTCHD2	11498692	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	7.662000	0.83803	2.602000	0.87976	0.555000	0.69702	CAC	PTCHD2	-	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	ENSG00000204624		0.592	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	-	0.00	73	0	C	XM_052561		11576105	+1	tier1	-	no_errors	ENST00000294484	ensembl	human	known	74_37	missense	9.72	65	7	SNP	1.000	A
PTGIR	5739	genome.wustl.edu	37	19	47124858	47124858	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:47124858G>A	ENST00000291294.2	-	3	973	c.840C>T	c.(838-840)ttC>ttT	p.F280F	PTGIR_ENST00000597185.1_Silent_p.F9F|PTGIR_ENST00000598865.1_Silent_p.F68F|PTGIR_ENST00000594275.1_Silent_p.F37F	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	280					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	TGAAGGCGTAGAAGCGGAAGG	0.632																																																	0													49.0	47.0	48.0					19																	47124858		2200	4295	6495	SO:0001819	synonymous_variant	0				CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.840C>T	19.37:g.47124858G>A				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_IP_rcpt,prints_Prostanoid_rcpt,prints_Thbox_rcpt	p.F280	ENST00000291294.2	37	c.840	CCDS12686.1	19																																																																																			PTGIR	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000160013		0.632	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIR	HGNC	protein_coding	OTTHUMT00000466581.1	-	0.00	59	0	G			47124858	-1	tier1	-	no_errors	ENST00000291294	ensembl	human	known	74_37	silent	5.68	83	5	SNP	0.954	A
PTPRB	5787	genome.wustl.edu	37	12	70986244	70986244	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:70986244C>T	ENST00000261266.5	-	5	973	c.944G>A	c.(943-945)gGa>gAa	p.G315E	PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000550358.1_Missense_Mutation_p.G533E|PTPRB_ENST00000551525.1_Missense_Mutation_p.G532E|PTPRB_ENST00000550857.1_Missense_Mutation_p.G315E|PTPRB_ENST00000334414.6_Missense_Mutation_p.G533E|PTPRB_ENST00000451516.2_Missense_Mutation_p.G315E|PTPRB_ENST00000538708.1_Missense_Mutation_p.G315E	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	315	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ATCCACATTTCCAGGAGGTCT	0.413																																																	0													64.0	59.0	60.0					12																	70986244		1852	4099	5951	SO:0001583	missense	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.944G>A	12.37:g.70986244C>T	ENSP00000261266:p.Gly315Glu		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.G533E	ENST00000261266.5	37	c.1598	CCDS44944.1	12	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817592	0.90790	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000544694;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19;3.19;3.19;3.19	5.96	5.96	0.96718	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.38665	0.1049	M	0.88105	2.93	0.58432	D	0.999998	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.17776	-1.0358	10	0.51188	T	0.08	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	315;315;412;533;532;533;315;533	P23467-2;F5H3G6;Q6ZR19;Q6ZTX7;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;.;PTPRB_HUMAN;.	E	533;315;533;533;315;315;315;532;412	ENSP00000334928:G533E;ENSP00000393028:G315E;ENSP00000448058:G533E;ENSP00000438927:G315E;ENSP00000447302:G315E;ENSP00000261266:G315E;ENSP00000448349:G532E;ENSP00000446982:G412E	ENSP00000261266:G315E	G	-	2	0	PTPRB	69272511	1.000000	0.71417	0.988000	0.46212	0.990000	0.78478	5.677000	0.68142	2.832000	0.97577	0.655000	0.94253	GGA	PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.413	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	-	0.00	30	0	C			70986244	-1	tier1	-	no_errors	ENST00000334414	ensembl	human	known	74_37	missense	8.33	55	5	SNP	0.997	T
PVRL1	5818	genome.wustl.edu	37	11	119535678	119535680	+	In_Frame_Del	DEL	CCT	CCT	-	rs539461545|rs375181781|rs369523216		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:119535678_119535680delCCT	ENST00000264025.3	-	6	1861_1863	c.1331_1333delAGG	c.(1330-1335)gagggc>ggc	p.E444del	PVRL1_ENST00000341398.2_Intron	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	444	Poly-Glu.				adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)	p.E444fs*>73(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		CCTCCACCGCcctcctcctcctc	0.66																																																	1	Deletion - Frameshift(1)	kidney(1)																																								SO:0001651	inframe_deletion	0			X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.1331_1333delAGG	11.37:g.119535687_119535689delCCT	ENSP00000264025:p.Glu444del		O75465|Q2M3D3|Q9HBE6|Q9HBW2	In_Frame_Del	DEL	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E444in_frame_del	ENST00000264025.3	37	c.1333_1331	CCDS8426.1	11																																																																																			PVRL1	-	NULL	ENSG00000110400		0.660	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL1	HGNC	protein_coding	OTTHUMT00000388231.1		0.00	40	0	CCT			119535680	-1	tier1		no_errors	ENST00000264025	ensembl	human	known	74_37	in_frame_del	8.89	41	4	DEL	0.989:0.994:0.997	-
PXDNL	137902	genome.wustl.edu	37	8	52321611	52321611	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:52321611G>T	ENST00000356297.4	-	17	2673	c.2573C>A	c.(2572-2574)cCc>cAc	p.P858H	PXDNL_ENST00000543296.1_Missense_Mutation_p.P858H	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	858					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GAGCATGCAGGGCGCGTGGGT	0.672																																																	0													20.0	24.0	23.0					8																	52321611		2024	4143	6167	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2573C>A	8.37:g.52321611G>T	ENSP00000348645:p.Pro858His		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.P858H	ENST00000356297.4	37	c.2573	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	10.76	1.440731	0.25900	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.73152	-0.72;-0.72	3.56	0.336	0.15958	.	1.121650	0.06902	U	0.806144	T	0.53449	0.1797	L	0.27053	0.805	0.20196	N	0.999924	B	0.06786	0.001	B	0.15484	0.013	T	0.48091	-0.9065	10	0.62326	D	0.03	.	1.9316	0.03328	0.1267:0.3287:0.3665:0.178	.	858	A1KZ92	PXDNL_HUMAN	H	858	ENSP00000348645:P858H;ENSP00000444865:P858H	ENSP00000348645:P858H	P	-	2	0	PXDNL	52484164	0.001000	0.12720	0.004000	0.12327	0.001000	0.01503	1.099000	0.31013	0.606000	0.29965	-0.145000	0.13849	CCC	PXDNL	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000147485		0.672	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	-	0.00	27	0	G	NM_144651		52321611	-1	tier1	-	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	15.38	44	8	SNP	0.607	T
R3HDM2	22864	genome.wustl.edu	37	12	57686359	57686359	+	Intron	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:57686359C>G	ENST00000347140.3	-	10	1201				R3HDM2_ENST00000403821.2_Intron|R3HDM2_ENST00000413953.2_Intron|RP11-123K3.4_ENST00000548184.1_Intron|R3HDM2_ENST00000358907.2_Intron|R3HDM2_ENST00000402412.1_Missense_Mutation_p.R301P			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						ACTTACCTCTCGGGCAAATAT	0.438																																																	0																																										SO:0001627	intron_variant	0			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.810+2822G>C	12.37:g.57686359C>G			Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.R301P	ENST00000347140.3	37	c.902	CCDS8937.2	12	.	.	.	.	.	.	.	.	.	.	C	18.85	3.711975	0.68730	.	.	ENSG00000179912	ENST00000402412;ENST00000429355	T;T	0.43688	0.94;0.94	5.29	5.29	0.74685	.	.	.	.	.	T	0.63558	0.2521	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.59156	-0.7507	8	0.33141	T	0.24	-4.9196	17.8742	0.88819	0.0:1.0:0.0:0.0	.	301	B5MCU0	.	P	301;52	ENSP00000385839:R301P;ENSP00000394676:R52P	ENSP00000385839:R301P	R	-	2	0	R3HDM2	55972626	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.848000	0.55903	2.752000	0.94435	0.655000	0.94253	CGA	R3HDM2	-	NULL	ENSG00000179912		0.438	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	HGNC	protein_coding	OTTHUMT00000326570.2	-	0.00	102	0	C	NM_014925		57686359	-1	tier1	-	no_errors	ENST00000402412	ensembl	human	novel	74_37	missense	6.96	107	8	SNP	1.000	G
RABGAP1L	9910	genome.wustl.edu	37	1	174517040	174517040	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:174517040G>T	ENST00000357444.6	+	14	1946	c.1665G>T	c.(1663-1665)atG>atT	p.M555I	RABGAP1L_ENST00000251507.4_Intron			B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						AAGGGTCTATGAAGGTCTCCA	0.333																																																	0																																										SO:0001583	missense	0			AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000357444.6:c.1665G>T	1.37:g.174517040G>T	ENSP00000350027:p.Met555Ile		B7ZAA4	Missense_Mutation	SNP	pfam_Kinesin-like,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.M555I	ENST00000357444.6	37	c.1665		1	.	.	.	.	.	.	.	.	.	.	G	9.063	0.995032	0.19043	.	.	ENSG00000152061	ENST00000357444	T	0.03920	3.76	4.0	-2.1	0.07210	.	.	.	.	.	T	0.03608	0.0103	.	.	.	0.18873	N	0.999988	B	0.02656	0.0	B	0.01281	0.0	T	0.42015	-0.9476	8	0.87932	D	0	.	4.697	0.12809	0.4507:0.1614:0.3879:0.0	.	555	Q5R372-2	.	I	555	ENSP00000350027:M555I	ENSP00000350027:M555I	M	+	3	0	RABGAP1L	172783663	0.020000	0.18652	0.007000	0.13788	0.004000	0.04260	-0.294000	0.08309	-0.285000	0.09089	-0.350000	0.07774	ATG	RABGAP1L	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000152061		0.333	RABGAP1L-003	KNOWN	basic	protein_coding	RABGAP1L	HGNC	protein_coding	OTTHUMT00000084499.1	-	0.00	90	0	G	NM_001243765		174517040	+1	tier1	-	no_errors	ENST00000357444	ensembl	human	known	74_37	missense	7.45	87	7	SNP	0.048	T
RAD18	56852	genome.wustl.edu	37	3	8983397	8983397	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:8983397C>A	ENST00000264926.2	-	5	474	c.358G>T	c.(358-360)Gta>Tta	p.V120L	RAD18_ENST00000495087.1_5'UTR	NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	120					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		CTGGAGGCTACAGGAGTATAT	0.403								Rad6 pathway																																									0													113.0	117.0	115.0					3																	8983397		2203	4300	6503	SO:0001583	missense	0				CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.358G>T	3.37:g.8983397C>A	ENSP00000264926:p.Val120Leu		Q58F55|Q9NRT6	Missense_Mutation	SNP	pfam_SAP_dom,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_Rad18_put,smart_SAP_dom,pfscan_Znf_RING,pfscan_SAP_dom	p.V120L	ENST00000264926.2	37	c.358	CCDS2571.1	3	.	.	.	.	.	.	.	.	.	.	C	9.248	1.040133	0.19669	.	.	ENSG00000070950	ENST00000264926	T	0.22945	1.93	5.14	0.00235	0.14050	.	0.980542	0.08330	N	0.962416	T	0.21509	0.0518	L	0.57536	1.79	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.33059	-0.9883	10	0.25751	T	0.34	-15.6418	4.1599	0.10278	0.0:0.4495:0.1684:0.382	.	120	Q9NS91	RAD18_HUMAN	L	120	ENSP00000264926:V120L	ENSP00000264926:V120L	V	-	1	0	RAD18	8958397	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.037000	0.13840	0.070000	0.16634	-0.794000	0.03295	GTA	RAD18	-	NULL	ENSG00000070950		0.403	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD18	HGNC	protein_coding	OTTHUMT00000207071.2		0.00	54	0	C	NM_020165		8983397	-1			no_errors	ENST00000264926	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	A
RAD54B	25788	genome.wustl.edu	37	8	95412652	95412652	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:95412652C>T	ENST00000336148.5	-	7	1108	c.984G>A	c.(982-984)atG>atA	p.M328I		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	328	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TCCCTAAACCCATTTCATCAG	0.368								Direct reversal of damage;Homologous recombination																																									0													63.0	55.0	58.0					8																	95412652		2203	4300	6503	SO:0001583	missense	0			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.984G>A	8.37:g.95412652C>T	ENSP00000336606:p.Met328Ile		F6WBS8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M328I	ENST00000336148.5	37	c.984	CCDS6262.1	8	.	.	.	.	.	.	.	.	.	.	C	31	5.091842	0.94149	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	D	0.94497	-3.44	5.5	5.5	0.81552	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98811	0.9599	H	0.99726	4.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99338	1.0911	10	0.87932	D	0	-24.6649	19.4017	0.94632	0.0:1.0:0.0:0.0	.	328	Q9Y620	RA54B_HUMAN	I	328;1	ENSP00000336606:M328I	ENSP00000336606:M328I	M	-	3	0	RAD54B	95481828	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.584000	0.87258	0.650000	0.86243	ATG	RAD54B	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000197275		0.368	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54B	HGNC	protein_coding	OTTHUMT00000257806.3	-	0.00	76	0	C	NM_012415		95412652	-1	tier1	-	no_errors	ENST00000336148	ensembl	human	known	74_37	missense	9.41	77	8	SNP	1.000	T
RANBP3	8498	genome.wustl.edu	37	19	5941834	5941834	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:5941834C>A	ENST00000340578.6	-	4	352	c.295G>T	c.(295-297)Ggc>Tgc	p.G99C	RANBP3_ENST00000591092.1_Missense_Mutation_p.G31C|RANBP3_ENST00000541471.1_Intron|RANBP3_ENST00000034275.8_Missense_Mutation_p.G31C|RANBP3_ENST00000439268.2_Missense_Mutation_p.G99C|RANBP3_ENST00000591124.1_5'UTR	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	99					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						GGACTGGAGCCGCCAGCTGAC	0.532																																																	0													57.0	60.0	59.0					19																	5941834		2013	4197	6210	SO:0001583	missense	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.295G>T	19.37:g.5941834C>A	ENSP00000341483:p.Gly99Cys		B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.G99C	ENST00000340578.6	37	c.295	CCDS42478.1	19	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380073	0.61845	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000324807	T;T;T	0.39997	1.09;1.05;2.12	5.2	3.07	0.35406	.	0.101398	0.64402	D	0.000002	T	0.47893	0.1470	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.72338	0.926;0.966;0.977;0.949	T	0.44159	-0.9346	10	0.72032	D	0.01	-13.7225	9.1697	0.37074	0.0:0.8185:0.0:0.1815	.	31;31;99;99	B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;RANB3_HUMAN	C	99;99;31;30	ENSP00000341483:G99C;ENSP00000404837:G99C;ENSP00000034275:G31C	ENSP00000034275:G31C	G	-	1	0	RANBP3	5892834	0.998000	0.40836	0.800000	0.32199	0.946000	0.59487	3.026000	0.49689	0.577000	0.29470	-0.126000	0.14955	GGC	RANBP3	-	NULL	ENSG00000031823		0.532	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	-	0.00	36	0	C	NM_007322		5941834	-1	tier1	-	no_errors	ENST00000340578	ensembl	human	known	74_37	missense	13.33	39	6	SNP	0.993	A
RAPH1	65059	genome.wustl.edu	37	2	204304271	204304271	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:204304271C>T	ENST00000319170.5	-	14	3941	c.3642G>A	c.(3640-3642)caG>caA	p.Q1214Q	ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000374493.3_Silent_p.Q1266Q|RAPH1_ENST00000457812.1_Intron	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	1214					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AACCAGCCTTCTGTTGATCAG	0.562																																																	0													91.0	82.0	85.0					2																	204304271		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.3642G>A	2.37:g.204304271C>T			Q96Q37|Q9C0I2	Silent	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,prints_Paxillin	p.Q1266	ENST00000319170.5	37	c.3798	CCDS2359.1	2																																																																																			RAPH1	-	NULL	ENSG00000173166		0.562	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPH1	HGNC	protein_coding	OTTHUMT00000256363.2		0.00	51	0	C	NM_025252		204304271	-1			no_errors	ENST00000374493	ensembl	human	known	74_37	silent	5.06	75	4	SNP	1.000	T
RASGRP4	115727	genome.wustl.edu	37	19	38905515	38905515	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:38905515G>T	ENST00000587738.1	-	9	1273	c.1203C>A	c.(1201-1203)gcC>gcA	p.A401A	RASGRP4_ENST00000433821.2_Intron|RASGRP4_ENST00000293062.9_Silent_p.A304A|RASGRP4_ENST00000587753.1_Silent_p.A332A|RASGRP4_ENST00000454404.2_Silent_p.A367A|RASGRP4_ENST00000426920.2_Intron|RASGRP4_ENST00000586305.1_Silent_p.A387A			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	401	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GATCCTCATTGGCGCTGCAGG	0.647																																																	0													16.0	20.0	19.0					19																	38905515		2005	4157	6162	SO:0001819	synonymous_variant	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1203C>A	19.37:g.38905515G>T			A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Silent	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.A401	ENST00000587738.1	37	c.1203	CCDS46068.1	19																																																																																			RASGRP4	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000171777		0.647	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1	-	0.00	90	0	G	NM_170604		38905515	-1	tier1	-	no_errors	ENST00000587738	ensembl	human	known	74_37	silent	10.00	81	9	SNP	1.000	T
RBMX2	51634	genome.wustl.edu	37	X	129545421	129545421	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:129545421G>T	ENST00000305536.6	+	5	467	c.403G>T	c.(403-405)Ggc>Tgc	p.G135C	RBMX2_ENST00000469953.1_3'UTR	NM_016024.2	NP_057108.2	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	135							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(2)|large_intestine(1)|liver(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	19						CCAGGAGAAGGGCTGTGGGGC	0.443																																																	0													112.0	100.0	103.0					X																	129545421		1880	4088	5968	SO:0001583	missense	0			AF078865	CCDS43993.1	Xq26.1	2013-02-12			ENSG00000134597	ENSG00000134597		"""RNA binding motif (RRM) containing"""	24282	protein-coding gene	gene with protein product						10810093	Standard	NM_016024		Approved	CGI-79	uc004evt.3	Q9Y388	OTTHUMG00000022395	ENST00000305536.6:c.403G>T	X.37:g.129545421G>T	ENSP00000339090:p.Gly135Cys		A8K9Z0|Q5JY82|Q9Y3I8	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G135C	ENST00000305536.6	37	c.403	CCDS43993.1	X	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607791	0.46527	.	.	ENSG00000134597	ENST00000305536;ENST00000538614	T	0.16897	2.31	5.26	5.26	0.73747	.	0.095757	0.64402	D	0.000001	T	0.29028	0.0721	M	0.63428	1.95	0.80722	D	1	P	0.44816	0.844	P	0.48304	0.573	T	0.02464	-1.1155	10	0.87932	D	0	.	15.4681	0.75419	0.0:0.0:1.0:0.0	.	135	Q9Y388	RBMX2_HUMAN	C	135	ENSP00000339090:G135C	ENSP00000339090:G135C	G	+	1	0	RBMX2	129373102	1.000000	0.71417	0.994000	0.49952	0.004000	0.04260	8.530000	0.90606	2.334000	0.79466	0.600000	0.82982	GGC	RBMX2	-	NULL	ENSG00000134597		0.443	RBMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX2	HGNC	protein_coding	OTTHUMT00000058265.1	-	0.00	96	0	G	NM_016024		129545421	+1	tier1	-	no_errors	ENST00000305536	ensembl	human	known	74_37	missense	7.22	90	7	SNP	1.000	T
RBPJL	11317	genome.wustl.edu	37	20	43942722	43942722	+	Missense_Mutation	SNP	G	G	T	rs568551533		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:43942722G>T	ENST00000343694.3	+	8	877	c.805G>T	c.(805-807)Gtt>Ttt	p.V269F	RBPJL_ENST00000372741.3_Missense_Mutation_p.V269F|RBPJL_ENST00000464504.1_3'UTR|RBPJL_ENST00000372743.1_Missense_Mutation_p.V269F	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	269					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				AGAGGGCTACGTTCGCTATGG	0.607																																																	0													121.0	119.0	119.0					20																	43942722		2203	4300	6503	SO:0001583	missense	0			AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.805G>T	20.37:g.43942722G>T	ENSP00000341243:p.Val269Phe		O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	pfam_Beta-trefoil_DNA-bd_dom,pfam_LAG1_DNA-bd,superfamily_Beta-trefoil_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set	p.V269F	ENST00000343694.3	37	c.805	CCDS13349.1	20	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887401	0.52014	.	.	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	T;T;T	0.36878	1.23;1.23;1.23	5.25	3.3	0.37823	Beta-trefoil (2);	0.166790	0.40385	N	0.001120	T	0.35189	0.0923	L	0.39898	1.24	0.37078	D	0.89883	P;P	0.47841	0.901;0.81	P;P	0.49999	0.628;0.574	T	0.36432	-0.9748	10	0.87932	D	0	-25.5547	6.375	0.21503	0.3074:0.0:0.6926:0.0	.	269;269	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	F	269	ENSP00000361828:V269F;ENSP00000361826:V269F;ENSP00000341243:V269F	ENSP00000341243:V269F	V	+	1	0	RBPJL	43376136	1.000000	0.71417	0.995000	0.50966	0.397000	0.30659	2.457000	0.45005	0.766000	0.33244	0.563000	0.77884	GTT	RBPJL	-	pfam_Beta-trefoil_DNA-bd_dom,superfamily_Beta-trefoil_DNA-bd_dom	ENSG00000124232		0.607	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBPJL	HGNC	protein_coding	OTTHUMT00000080391.1		0.00	57	0	G	NM_014276		43942722	+1			no_errors	ENST00000343694	ensembl	human	known	74_37	missense	8.57	64	6	SNP	1.000	T
REL	5966	genome.wustl.edu	37	2	61118917	61118917	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:61118917G>T	ENST00000295025.8	+	2	430	c.110G>T	c.(109-111)gGg>gTg	p.G37V	REL_ENST00000394479.3_Missense_Mutation_p.G37V	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	37	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			AGCATTCCAGGGGAGCACAGC	0.448			A		Hodgkin Lymphoma																																			Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	0													193.0	172.0	179.0					2																	61118917		2203	4300	6503	SO:0001583	missense	0			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.110G>T	2.37:g.61118917G>T	ENSP00000295025:p.Gly37Val		Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NF_Rel_Dor	p.G37V	ENST00000295025.8	37	c.110	CCDS1864.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.115103	0.94339	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.58210	0.35;0.35	5.47	5.47	0.80525	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.81437	0.4822	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86599	0.1865	10	0.87932	D	0	-10.7364	19.3204	0.94236	0.0:0.0:1.0:0.0	.	37;37	Q17RU2;Q04864	.;REL_HUMAN	V	37	ENSP00000295025:G37V;ENSP00000377989:G37V	ENSP00000295025:G37V	G	+	2	0	REL	60972421	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.863000	0.99569	2.554000	0.86153	0.650000	0.86243	GGG	REL	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000162924		0.448	REL-001	KNOWN	basic|CCDS	protein_coding	REL	HGNC	protein_coding	OTTHUMT00000251576.3	-	0.00	80	0	G	NM_002908		61118917	+1	tier1	-	no_errors	ENST00000295025	ensembl	human	known	74_37	missense	6.67	112	8	SNP	1.000	T
RELN	5649	genome.wustl.edu	37	7	103292142	103292142	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:103292142G>T	ENST00000428762.1	-	15	2017	c.1858C>A	c.(1858-1860)Cac>Aac	p.H620N	RELN_ENST00000424685.2_Missense_Mutation_p.H620N|RELN_ENST00000343529.5_Missense_Mutation_p.H620N	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	620					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACAGTGCTGTGGGGGAGGTGG	0.453																																					NSCLC(146;835 1944 15585 22231 52158)												0													75.0	65.0	68.0					7																	103292142		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1858C>A	7.37:g.103292142G>T	ENSP00000392423:p.His620Asn		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.H620N	ENST00000428762.1	37	c.1858	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	24.0	4.481103	0.84747	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.22539	1.95;1.95;1.95	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.40171	0.1106	L	0.40543	1.245	0.58432	D	0.999999	D;P	0.69078	0.997;0.936	D;P	0.77557	0.99;0.885	T	0.03060	-1.1077	10	0.40728	T	0.16	.	19.6676	0.95898	0.0:0.0:1.0:0.0	.	620;620	P78509-2;P78509	.;RELN_HUMAN	N	620	ENSP00000392423:H620N;ENSP00000345694:H620N;ENSP00000388446:H620N	ENSP00000345694:H620N	H	-	1	0	RELN	103079378	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	9.476000	0.97823	2.656000	0.90262	0.563000	0.77884	CAC	RELN	-	superfamily_Sialidases	ENSG00000189056		0.453	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	62	0	G	NM_005045		103292142	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	missense	12.64	76	11	SNP	1.000	T
RFC3	5983	genome.wustl.edu	37	13	34410426	34410426	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:34410426G>T	ENST00000380071.3	+	9	1195	c.1065G>T	c.(1063-1065)atG>atT	p.M355I	RFC3_ENST00000434425.1_Intron	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	355					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		AAGGCATGATGTTCTGACTTC	0.373																																																	0													169.0	161.0	164.0					13																	34410426		2203	4299	6502	SO:0001583	missense	0				CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.1065G>T	13.37:g.34410426G>T	ENSP00000369411:p.Met355Ile		C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.M355I	ENST00000380071.3	37	c.1065	CCDS9352.1	13	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622004	0.28889	.	.	ENSG00000133119	ENST00000380071	T	0.40476	1.03	5.22	3.44	0.39384	.	0.069735	0.85682	N	0.000000	T	0.20088	0.0483	N	0.08118	0	0.80722	D	1	B	0.14805	0.011	B	0.06405	0.002	T	0.05053	-1.0909	10	0.12766	T	0.61	-11.7371	10.1955	0.43051	0.1671:0.0:0.8329:0.0	.	355	P40938	RFC3_HUMAN	I	355	ENSP00000369411:M355I	ENSP00000369411:M355I	M	+	3	0	RFC3	33308426	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.092000	0.50207	0.664000	0.31047	0.655000	0.94253	ATG	RFC3	-	NULL	ENSG00000133119		0.373	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC3	HGNC	protein_coding	OTTHUMT00000044450.2	-	0.00	54	0	G	NM_002915		34410426	+1	tier1	-	no_errors	ENST00000380071	ensembl	human	known	74_37	missense	7.41	75	6	SNP	1.000	T
RNF111	54778	genome.wustl.edu	37	15	59373269	59373269	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:59373269C>T	ENST00000557998.1	+	8	2370	c.2083C>T	c.(2083-2085)Caa>Taa	p.Q695*	RNF111_ENST00000559209.1_Nonsense_Mutation_p.Q695*|RNF111_ENST00000434298.1_Nonsense_Mutation_p.Q695*|RNF111_ENST00000561186.1_Nonsense_Mutation_p.Q695*|RNF111_ENST00000348370.4_Nonsense_Mutation_p.Q695*	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	695	Pro-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		TTTCCATTCTCAAATATCTTC	0.507																																					NSCLC(72;983 1365 10746 34387 47081)												0													280.0	246.0	258.0					15																	59373269		2192	4291	6483	SO:0001587	stop_gained	0			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.2083C>T	15.37:g.59373269C>T	ENSP00000452732:p.Gln695*		C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q695*	ENST00000557998.1	37	c.2083	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	C	42	9.771563	0.99260	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	.	.	.	5.31	5.31	0.75309	.	0.177305	0.47852	D	0.000201	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-12.092	5.5772	0.17231	0.0:0.661:0.1771:0.1619	.	.	.	.	X	695	.	ENSP00000288199:Q695X	Q	+	1	0	RNF111	57160561	0.981000	0.34729	0.997000	0.53966	0.987000	0.75469	2.897000	0.48664	2.497000	0.84241	0.467000	0.42956	CAA	RNF111	-	NULL	ENSG00000157450		0.507	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	HGNC	protein_coding	OTTHUMT00000416012.1	-	0.00	127	0	C	NM_017610		59373269	+1	tier1	-	no_errors	ENST00000434298	ensembl	human	known	74_37	nonsense	7.63	121	10	SNP	0.239	T
RNPC3	55599	genome.wustl.edu	37	1	104076467	104076467	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:104076467delA	ENST00000533099.1	+	4	583	c.347delA	c.(346-348)gaafs	p.E116fs	RNPC3_ENST00000423855.2_Frame_Shift_Del_p.E116fs|RNPC3_ENST00000524631.1_Frame_Shift_Del_p.E116fs			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	116	Necessary for interaction with PDCD7.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		TCAGGCTCTGAAAAAAAAAAA	0.318																																																	0										85,435,1262		6,1,72,18,398,396	50.0	39.0	43.0			4.6	0.6	1		49	197,914,2651		20,3,154,16,879,809	no	codingComplex	RNPC3	NM_017619.3		26,4,226,34,1277,1205	A1A1,A1A2,A1R,A2A2,A2R,RR		29.5322,29.1807,29.4192			104076467	282,1349,3913	692	1590	2282	SO:0001589	frameshift_variant	0			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.347delA	1.37:g.104076467delA	ENSP00000432886:p.Glu116fs		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K119fs	ENST00000533099.1	37	c.347	CCDS781.1	1																																																																																			RNPC3	-	NULL	ENSG00000185946		0.318	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1		0.00	40	0	A	NM_017619		104076467	+1	tier1		no_errors	ENST00000423855	ensembl	human	known	74_37	frame_shift_del	11.54	46	6	DEL	0.784	-
ROR2	4920	genome.wustl.edu	37	9	94486219	94486219	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:94486219G>T	ENST00000375708.3	-	9	2755	c.2557C>A	c.(2557-2559)Cct>Act	p.P853T	ROR2_ENST00000375715.1_Intron|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	853	Pro-rich.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						ACCATCTGAGGAGGCACCTGC	0.652																																																	0													90.0	91.0	91.0					9																	94486219		2203	4300	6503	SO:0001583	missense	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2557C>A	9.37:g.94486219G>T	ENSP00000364860:p.Pro853Thr		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P853T	ENST00000375708.3	37	c.2557	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	G	1.823	-0.471805	0.04445	.	.	ENSG00000169071	ENST00000375708	T	0.77229	-1.08	4.73	0.471	0.16752	.	0.384670	0.18713	N	0.133224	T	0.56202	0.1969	N	0.08118	0	0.09310	N	1	B	0.18741	0.03	B	0.15870	0.014	T	0.44922	-0.9296	10	0.32370	T	0.25	.	11.9752	0.53087	0.0802:0.2753:0.6444:0.0	.	853	Q01974	ROR2_HUMAN	T	853	ENSP00000364860:P853T	ENSP00000364860:P853T	P	-	1	0	ROR2	93526040	0.993000	0.37304	0.036000	0.18154	0.034000	0.12701	4.072000	0.57563	0.220000	0.20860	-0.502000	0.04539	CCT	ROR2	-	pirsf_Tyr_kinase_rcpt_ROR	ENSG00000169071		0.652	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	-	0.00	48	0	G			94486219	-1	tier1	-	no_errors	ENST00000375708	ensembl	human	known	74_37	missense	15.79	64	12	SNP	0.014	T
RPGR	6103	genome.wustl.edu	37	X	38178137	38178137	+	Silent	SNP	G	G	T	rs376887697		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:38178137G>T	ENST00000339363.3	-	5	581	c.414C>A	c.(412-414)tcC>tcA	p.S138S	RPGR_ENST00000318842.7_Silent_p.S138S|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000342811.3_Silent_p.S138S|RPGR_ENST00000338898.3_Silent_p.S138S|RPGR_ENST00000309513.3_Silent_p.S138S|RPGR_ENST00000378505.2_Silent_p.S138S			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	138					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						TCTTATGCTCGGATGTAAAAA	0.418																																																	0													115.0	93.0	100.0					X																	38178137		2202	4300	6502	SO:0001819	synonymous_variant	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.414C>A	X.37:g.38178137G>T			B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Silent	SNP	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S138	ENST00000339363.3	37	c.414		X																																																																																			RPGR	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens	ENSG00000156313		0.418	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		-	0.00	84	0	G	NM_000328		38178137	-1	tier1	-	no_errors	ENST00000378505	ensembl	human	known	74_37	silent	5.32	89	5	SNP	0.000	T
RPH3A	22895	genome.wustl.edu	37	12	113312942	113312942	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:113312942C>T	ENST00000389385.4	+	11	1347	c.850C>T	c.(850-852)Cag>Tag	p.Q284*	RPH3A_ENST00000420983.2_Nonsense_Mutation_p.Q284*|RPH3A_ENST00000447659.2_Nonsense_Mutation_p.Q235*|RPH3A_ENST00000551052.1_Nonsense_Mutation_p.Q280*|RPH3A_ENST00000415485.3_Nonsense_Mutation_p.Q284*|RPH3A_ENST00000543106.2_Nonsense_Mutation_p.Q284*|RPH3A_ENST00000548866.1_Nonsense_Mutation_p.Q235*|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	284	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AGGCTCGGTGCAGAGCCCAGC	0.602																																																	0													11.0	13.0	12.0					12																	113312942		2195	4289	6484	SO:0001587	stop_gained	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.850C>T	12.37:g.113312942C>T	ENSP00000374036:p.Gln284*		B7Z3C3|Q96AE0	Nonsense_Mutation	SNP	pfam_C2_dom,pfam_Znf_FYVE-typ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel,prints_Synaptotagmin,prints_C2_dom	p.Q284*	ENST00000389385.4	37	c.850	CCDS44979.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.669477	0.96754	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983	.	.	.	5.2	5.2	0.72013	.	0.392142	0.21341	N	0.076134	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	16.228	0.82311	0.0:1.0:0.0:0.0	.	.	.	.	X	284;284;235;280;284;235;284	.	ENSP00000374036:Q284X	Q	+	1	0	RPH3A	111797325	0.981000	0.34729	0.966000	0.40874	0.513000	0.34164	2.447000	0.44917	2.428000	0.82296	0.460000	0.39030	CAG	RPH3A	-	NULL	ENSG00000089169		0.602	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	-	0.00	58	0	C	NM_014954		113312942	+1	tier1	-	no_errors	ENST00000389385	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	0.999	T
RPL10	6134	genome.wustl.edu	37	X	153626899	153626899	+	Intron	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:153626899G>T	ENST00000369817.2	+	3	599				RPL10_ENST00000406022.2_5'Flank|RPL10_ENST00000479366.1_3'UTR|RPL10_ENST00000424325.2_Intron|SNORA70_ENST00000384436.1_RNA			P27635	RL10_HUMAN	ribosomal protein L10						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCTTGAATCCGTGTACTTTCA	0.602																																																	0													136.0	141.0	139.0					X																	153626899		2203	4300	6503	SO:0001627	intron_variant	0			AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.23+16G>T	X.37:g.153626899G>T			A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	RNA	SNP	-	NULL	ENST00000369817.2	37	NULL	CCDS14746.1	X																																																																																			RPL10	-	-	ENSG00000147403		0.602	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10	HGNC	protein_coding	OTTHUMT00000127774.5	-	0.00	56	0	G	NM_006013		153626899	+1	tier1	-	no_errors	ENST00000479366	ensembl	human	known	74_37	rna	12.50	35	5	SNP	0.000	T
RPL12P38	645688	genome.wustl.edu	37	17	58512743	58512743	+	RNA	SNP	G	G	T	rs140422815	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:58512743G>T	ENST00000588627.1	-	0	614									ribosomal protein L12 pseudogene 38																		TCTGTGGTTCGTCCTTCGTCT	0.542																																																	0																																												0					17q23.2	2013-01-23			ENSG00000213228	ENSG00000213228			36838	pseudogene	pseudogene						19123937	Standard	NG_010298		Approved				OTTHUMG00000157897		17.37:g.58512743G>T				RNA	SNP	-	NULL	ENST00000588627.1	37	NULL		17																																																																																			RPL12P38	-	-	ENSG00000213228		0.542	RPL12P38-002	KNOWN	basic	processed_transcript	RPL12P38	HGNC	pseudogene	OTTHUMT00000449464.1	-	0.00	65	0	G	NG_010298		58512743	-1	tier1	-	no_errors	ENST00000588627	ensembl	human	known	74_37	rna	9.76	74	8	SNP	0.775	T
RPSAP52	204010	genome.wustl.edu	37	12	66152024	66152024	+	RNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:66152024C>A	ENST00000489520.2	-	0	919					NR_026825.2				ribosomal protein SA pseudogene 52																		ACAGAGGGCACCTGCATGCCT	0.527																																																	0																																												0					12q14.3	2010-09-24			ENSG00000241749	ENSG00000241749			35752	pseudogene	pseudogene						19123937	Standard	NR_026825		Approved		uc001sso.4		OTTHUMG00000157608		12.37:g.66152024C>A				RNA	SNP	-	NULL	ENST00000489520.2	37	NULL		12																																																																																			RPSAP52	-	-	ENSG00000241749		0.527	RPSAP52-002	KNOWN	basic	processed_transcript	RPSAP52	HGNC	pseudogene	OTTHUMT00000349256.2		0.00	71	0	C	NG_006174		66152024	-1			no_errors	ENST00000489520	ensembl	human	known	74_37	rna	5.63	67	4	SNP	1.000	A
RRP9	9136	genome.wustl.edu	37	3	51969420	51969420	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:51969420C>A	ENST00000232888.6	-	10	982	c.909G>T	c.(907-909)cgG>cgT	p.R303R		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	303					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CAGTCCCATCCCGGCCCCCAG	0.637																																																	0													46.0	45.0	46.0					3																	51969420		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.909G>T	3.37:g.51969420C>A			B2R996|Q8IZ30	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R303	ENST00000232888.6	37	c.909	CCDS2837.1	3																																																																																			RRP9	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000114767		0.637	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP9	HGNC	protein_coding	OTTHUMT00000346637.1	-	0.00	43	0	C	NM_004704		51969420	-1	tier1	-	no_errors	ENST00000232888	ensembl	human	known	74_37	silent	9.43	48	5	SNP	1.000	A
RTEL1	51750	genome.wustl.edu	37	20	62309668	62309668	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:62309668G>C	ENST00000360203.5	+	12	1331	c.1006G>C	c.(1006-1008)Gga>Cga	p.G336R	RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.G336R|RTEL1_ENST00000370018.3_Missense_Mutation_p.G336R|RTEL1_ENST00000318100.4_Missense_Mutation_p.G336R|RTEL1_ENST00000508582.2_Missense_Mutation_p.G360R					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			TGAGCTGCCTGGAGACGACAG	0.657																																																	0													42.0	41.0	41.0					20																	62309668		2203	4300	6503	SO:0001583	missense	0			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1006G>C	20.37:g.62309668G>C	ENSP00000353332:p.Gly336Arg			Missense_Mutation	SNP	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.G336R	ENST00000360203.5	37	c.1006		20	.	.	.	.	.	.	.	.	.	.	G	11.83	1.754743	0.31046	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203	D;D;D;D	0.82344	-1.57;-1.6;-1.52;-1.58	4.26	4.26	0.50523	.	0.452976	0.23056	N	0.052434	D	0.88047	0.6332	M	0.72118	2.19	0.29579	N	0.84932	P;P;B	0.48162	0.906;0.57;0.321	P;B;B	0.59546	0.859;0.254;0.205	D	0.83855	0.0265	10	0.45353	T	0.12	-8.684	12.0389	0.53442	0.0:0.3275:0.6725:0.0	.	360;336;336	Q9NZ71-7;Q9NZ71;Q9NZ71-6	.;RTEL1_HUMAN;.	R	336;336;360;336	ENSP00000359035:G336R;ENSP00000322287:G336R;ENSP00000424307:G360R;ENSP00000353332:G336R	ENSP00000353332:G336R	G	+	1	0	AL353715.1	61780112	0.775000	0.28604	0.957000	0.39632	0.202000	0.24057	1.519000	0.35888	2.099000	0.63709	0.313000	0.20887	GGA	RTEL1	-	superfamily_P-loop_NTPase	ENSG00000258366		0.657	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	-	0.00	52	0	G	NM_032957		62309668	+1	tier1	-	no_errors	ENST00000318100	ensembl	human	known	74_37	missense	12.16	65	9	SNP	0.801	C
RUNX1T1	862	genome.wustl.edu	37	8	92972711	92972711	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:92972711G>A	ENST00000523629.1	-	12	2028	c.1574C>T	c.(1573-1575)aCc>aTc	p.T525I	RUNX1T1_ENST00000518844.1_Missense_Mutation_p.T498I|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.T498I|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.T525I|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.T488I|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.T488I|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.T488I|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.T536I	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	525					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GCCACTGCAGGTTTCACTCGC	0.488																																																	0													65.0	62.0	63.0					8																	92972711		2203	4300	6503	SO:0001583	missense	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1574C>T	8.37:g.92972711G>A	ENSP00000428543:p.Thr525Ile		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.T536I	ENST00000523629.1	37	c.1607	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273818	0.80580	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.36520	1.26;1.26;1.26;1.27;1.27;1.27;1.25;1.26	5.86	5.86	0.93980	Zinc finger, MYND-type (3);	0.000000	0.85682	D	0.000000	T	0.57198	0.2037	L	0.45744	1.44	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;0.995	D;D;D;D	0.97110	0.994;0.994;1.0;0.97	T	0.56086	-0.8037	10	0.87932	D	0	-16.7163	20.1802	0.98196	0.0:0.0:1.0:0.0	.	536;488;525;498	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	I	525;498;525;488;488;488;536;498	ENSP00000428543:T525I;ENSP00000379520:T498I;ENSP00000265814:T525I;ENSP00000353504:T488I;ENSP00000390137:T488I;ENSP00000428742:T488I;ENSP00000402257:T536I;ENSP00000430728:T498I	ENSP00000265814:T525I	T	-	2	0	RUNX1T1	93041887	1.000000	0.71417	0.982000	0.44146	0.976000	0.68499	9.869000	0.99810	2.777000	0.95525	0.655000	0.94253	ACC	RUNX1T1	-	pfam_Znf_MYND,pfscan_Znf_MYND	ENSG00000079102		0.488	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	-	0.00	53	0	G	NM_004349, NM_175635		92972711	-1	tier1	-	no_errors	ENST00000436581	ensembl	human	known	74_37	missense	22.08	60	17	SNP	1.000	A
S100A4	6275	genome.wustl.edu	37	1	153516390	153516390	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:153516390C>G	ENST00000368716.4	-	3	298	c.151G>C	c.(151-153)Gat>Cat	p.D51H	S100A4_ENST00000481009.1_5'UTR|S100A5_ENST00000359215.1_5'Flank|S100A4_ENST00000368715.1_Missense_Mutation_p.D51H|S100A5_ENST00000368718.1_5'Flank|S100A4_ENST00000354332.4_Missense_Mutation_p.D51H|S100A4_ENST00000368714.1_Missense_Mutation_p.D51H	NM_002961.2	NP_002952.1	P26447	S10A4_HUMAN	S100 calcium binding protein A4	51	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				epithelial to mesenchymal transition (GO:0001837)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)			large_intestine(2)|lung(1)|prostate(1)	4	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Trifluoperazine(DB00831)	GCAGCTTCATCTGTCCTTTTC	0.522																																																	0													187.0	170.0	176.0					1																	153516390		2203	4300	6503	SO:0001583	missense	0			BC016300	CCDS1042.1	1q12-q22	2013-01-10	2006-09-11		ENSG00000196154	ENSG00000196154		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10494	protein-coding gene	gene with protein product	"""fibroblast-specific protein-1"""	114210	"""S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"", ""S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"""	MTS1, CAPL		3155863	Standard	NM_019554		Approved	P9KA, 18A2, PEL98, 42A, FSP1	uc001fbz.3	P26447	OTTHUMG00000013546	ENST00000368716.4:c.151G>C	1.37:g.153516390C>G	ENSP00000357705:p.Asp51His		A8K7R8|D3DV46|Q6ICP8	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_dom,pfscan_EF_hand_dom	p.D51H	ENST00000368716.4	37	c.151	CCDS1042.1	1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053677	0.55218	.	.	ENSG00000196154	ENST00000368715;ENST00000354332;ENST00000368716;ENST00000368714;ENST00000545360	T;T;T;T	0.16073	2.37;2.37;2.37;2.37	4.75	4.75	0.60458	EF-hand-like domain (1);	0.053821	0.64402	D	0.000001	T	0.17408	0.0418	M	0.88704	2.975	0.53005	D	0.999961	B	0.13594	0.008	B	0.17098	0.017	T	0.09618	-1.0666	10	0.72032	D	0.01	.	13.2685	0.60148	0.0:1.0:0.0:0.0	.	51	P26447	S10A4_HUMAN	H	51;51;51;51;40	ENSP00000357704:D51H;ENSP00000346294:D51H;ENSP00000357705:D51H;ENSP00000357703:D51H	ENSP00000346294:D51H	D	-	1	0	S100A4	151783014	0.938000	0.31826	0.926000	0.36857	0.989000	0.77384	2.940000	0.49003	2.202000	0.70862	0.561000	0.74099	GAT	S100A4	-	pfscan_EF_hand_dom	ENSG00000196154		0.522	S100A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A4	HGNC	protein_coding	OTTHUMT00000037714.1	-	0.00	78	0	C	NM_002961		153516390	-1	tier1	-	no_errors	ENST00000354332	ensembl	human	known	74_37	missense	17.02	77	16	SNP	0.995	G
S100A3	6274	genome.wustl.edu	37	1	153520323	153520323	+	Splice_Site	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:153520323C>T	ENST00000368713.3	-	3	338		c.e3-1		S100A3_ENST00000368712.1_Splice_Site|S100A4_ENST00000481009.1_5'Flank|S100A4_ENST00000368715.1_5'Flank|S100A4_ENST00000354332.4_5'Flank|S100A4_ENST00000368716.4_5'Flank|S100A4_ENST00000368714.1_Intron	NM_002960.1	NP_002951.1	P33764	S10A3_HUMAN	S100 calcium binding protein A3							cytoplasm (GO:0005737)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|liver(1)|lung(1)	3	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAAACTCAGTCTGTGCAAGGG	0.547																																																	0													181.0	164.0	170.0					1																	153520323		2203	4300	6503	SO:0001630	splice_region_variant	0			BC012893	CCDS1043.1	1q21	2008-02-05	2001-11-28		ENSG00000188015	ENSG00000188015		"""S100 calcium binding proteins"""	10493	protein-coding gene	gene with protein product		176992	"""S100 calcium-binding protein A3"""	S100E		8341667	Standard	NM_002960		Approved		uc001fca.1	P33764	OTTHUMG00000013550	ENST00000368713.3:c.142-1G>A	1.37:g.153520323C>T			D3DV51|Q6FGE4	Splice_Site	SNP	-	e2-1	ENST00000368713.3	37	c.142-1	CCDS1043.1	1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634261	0.47049	.	.	ENSG00000188015	ENST00000368713;ENST00000368712	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5136	0.61528	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	S100A3	151786947	1.000000	0.71417	0.659000	0.29680	0.352000	0.29268	1.454000	0.35178	2.308000	0.77769	0.561000	0.74099	.	S100A3	-	-	ENSG00000188015		0.547	S100A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A3	HGNC	protein_coding	OTTHUMT00000037726.1		0.00	57	0	C	NM_002960	Intron	153520323	-1			no_errors	ENST00000368712	ensembl	human	known	74_37	splice_site	14.58	41	7	SNP	0.759	T
RYR2	6262	genome.wustl.edu	37	1	237666780	237666780	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:237666780C>A	ENST00000366574.2	+	22	2905	c.2588C>A	c.(2587-2589)aCa>aAa	p.T863K	RYR2_ENST00000542537.1_Missense_Mutation_p.T847K|RYR2_ENST00000360064.6_Missense_Mutation_p.T861K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	863	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTGCCTTCACACCCATCCCT	0.512																																																	0													101.0	104.0	103.0					1																	237666780		2067	4202	6269	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2588C>A	1.37:g.237666780C>A	ENSP00000355533:p.Thr863Lys		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.T861K	ENST00000366574.2	37	c.2582	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622075	0.87460	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.90844	-2.74;-2.74;-2.74	5.62	5.62	0.85841	Ryanodine receptor Ryr (1);	0.000000	0.64402	D	0.000005	D	0.88555	0.6468	N	0.10685	0.025	0.80722	D	1	D	0.71674	0.998	D	0.66351	0.943	D	0.88529	0.3101	10	0.40728	T	0.16	.	13.262	0.60111	0.0:0.9273:0.0:0.0727	.	863	Q92736	RYR2_HUMAN	K	863;861;847	ENSP00000355533:T863K;ENSP00000353174:T861K;ENSP00000443798:T847K	ENSP00000353174:T861K	T	+	2	0	RYR2	235733403	0.995000	0.38212	0.966000	0.40874	0.943000	0.58893	3.266000	0.51569	2.801000	0.96364	0.650000	0.86243	ACA	RYR2	-	pfam_Ryanodine_rcpt	ENSG00000198626		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	46	0	C	NM_001035		237666780	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	6.41	73	5	SNP	0.997	A
SALL2	6297	genome.wustl.edu	37	14	21993201	21993201	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:21993201C>T	ENST00000327430.3	-	2	955	c.661G>A	c.(661-663)Gcc>Acc	p.A221T	SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GAGGGACTGGCAGGGGCACCC	0.597																																																	0													44.0	44.0	44.0					14																	21993201		2203	4300	6503	SO:0001583	missense	0			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.661G>A	14.37:g.21993201C>T	ENSP00000333537:p.Ala221Thr		B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A221T	ENST00000327430.3	37	c.661	CCDS32045.1	14	.	.	.	.	.	.	.	.	.	.	C	6.486	0.457890	0.12342	.	.	ENSG00000165821	ENST00000327430;ENST00000541876	T	0.03920	3.76	4.46	3.56	0.40772	.	0.416917	0.17530	N	0.170904	T	0.03011	0.0089	N	0.24115	0.695	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.40289	-0.9571	10	0.11794	T	0.64	-20.9772	5.253	0.15532	0.2177:0.6788:0.0:0.1034	.	219;221	B4DFD9;Q9Y467	.;SALL2_HUMAN	T	221	ENSP00000333537:A221T	ENSP00000333537:A221T	A	-	1	0	SALL2	21063041	0.015000	0.18098	0.997000	0.53966	0.986000	0.74619	-0.120000	0.10660	1.078000	0.41014	0.655000	0.94253	GCC	SALL2	-	NULL	ENSG00000165821		0.597	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL2	HGNC	protein_coding	OTTHUMT00000401242.1	-	0.00	55	0	C	NM_005407		21993201	-1	tier1	-	no_errors	ENST00000327430	ensembl	human	known	74_37	missense	7.04	65	5	SNP	0.999	T
SAMD7	344658	genome.wustl.edu	37	3	169639075	169639075	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:169639075G>T	ENST00000428432.2	+	4	549	c.160G>T	c.(160-162)Gtt>Ttt	p.V54F	SAMD7_ENST00000335556.3_Missense_Mutation_p.V54F	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	54										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			TGGATCCTCTGTTCTACCAAA	0.413																																																	0													157.0	137.0	144.0					3																	169639075		2203	4300	6503	SO:0001583	missense	0			BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.160G>T	3.37:g.169639075G>T	ENSP00000391299:p.Val54Phe			Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.V54F	ENST00000428432.2	37	c.160	CCDS3209.1	3	.	.	.	.	.	.	.	.	.	.	G	12.40	1.925334	0.34002	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.51574	0.7;0.7	5.85	4.03	0.46877	.	0.549745	0.18449	N	0.140892	T	0.43411	0.1246	L	0.34521	1.04	0.19575	N	0.999968	D	0.54397	0.966	P	0.49665	0.618	T	0.20505	-1.0273	10	0.42905	T	0.14	-4.3905	9.6211	0.39721	0.0743:0.1411:0.7846:0.0	.	54	Q7Z3H4	SAMD7_HUMAN	F	54	ENSP00000391299:V54F;ENSP00000334668:V54F	ENSP00000334668:V54F	V	+	1	0	SAMD7	171121769	0.926000	0.31397	0.153000	0.22517	0.401000	0.30781	1.269000	0.33074	0.909000	0.36697	0.655000	0.94253	GTT	SAMD7	-	NULL	ENSG00000187033		0.413	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD7	HGNC	protein_coding	OTTHUMT00000351959.1	-	0.00	77	0	G	NM_182610		169639075	+1	tier1	-	no_errors	ENST00000335556	ensembl	human	known	74_37	missense	18.97	94	22	SNP	0.358	T
SAMD9	54809	genome.wustl.edu	37	7	92733886	92733886	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:92733886C>A	ENST00000379958.2	-	3	1794	c.1525G>T	c.(1525-1527)Gat>Tat	p.D509Y		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	509						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GAACTTGGATCAAAGGGTTTA	0.393																																																	0													90.0	93.0	92.0					7																	92733886		2203	4300	6503	SO:0001583	missense	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.1525G>T	7.37:g.92733886C>A	ENSP00000369292:p.Asp509Tyr		A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_SAM,pfscan_SAM	p.D509Y	ENST00000379958.2	37	c.1525	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	C	15.13	2.740664	0.49045	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.13901	2.55;2.55	4.35	4.35	0.52113	.	0.081321	0.45867	D	0.000335	T	0.26412	0.0645	L	0.48642	1.525	0.38446	D	0.946844	D	0.89917	1.0	D	0.68765	0.96	T	0.01972	-1.1237	10	0.87932	D	0	.	9.7047	0.40209	0.0:0.9024:0.0:0.0976	.	509	Q5K651	SAMD9_HUMAN	Y	509	ENSP00000369292:D509Y;ENSP00000414529:D509Y	ENSP00000369292:D509Y	D	-	1	0	SAMD9	92571822	0.002000	0.14202	0.997000	0.53966	0.864000	0.49448	0.343000	0.19944	2.417000	0.82017	0.603000	0.83216	GAT	SAMD9	-	NULL	ENSG00000205413		0.393	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	-	0.00	56	0	C	NM_017654		92733886	-1	tier1	-	no_errors	ENST00000379958	ensembl	human	known	74_37	missense	8.24	78	7	SNP	0.998	A
SCAF4	57466	genome.wustl.edu	37	21	33060625	33060625	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr21:33060625G>C	ENST00000286835.7	-	16	2420	c.2038C>G	c.(2038-2040)Cca>Gca	p.P680A	SCAF4_ENST00000399804.1_Missense_Mutation_p.P680A|SCAF4_ENST00000434667.3_Missense_Mutation_p.P665A	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	680						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						CTCACCTGTGGAGGTGGCACT	0.423																																																	0													230.0	211.0	218.0					21																	33060625		2203	4300	6503	SO:0001583	missense	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.2038C>G	21.37:g.33060625G>C	ENSP00000286835:p.Pro680Ala		C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_CID_dom,smart_RRM_dom,pfscan_RRM_dom	p.P680A	ENST00000286835.7	37	c.2038	CCDS33537.1	21	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187085	0.57909	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.48522	0.82;0.81;0.85	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000004	T	0.62171	0.2406	L	0.42245	1.32	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.85130	0.994;0.991;0.997;0.994	T	0.54370	-0.8304	10	0.31617	T	0.26	-9.9478	18.3612	0.90375	0.0:0.0:1.0:0.0	.	665;680;680;680	C9JLZ0;C9J1W7;O95104-2;O95104	.;.;.;SFR15_HUMAN	A	665;680;680	ENSP00000402377:P665A;ENSP00000286835:P680A;ENSP00000382703:P680A	ENSP00000286835:P680A	P	-	1	0	SCAF4	31982496	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.575000	0.60908	2.840000	0.97914	0.655000	0.94253	CCA	SCAF4	-	NULL	ENSG00000156304		0.423	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCAF4	HGNC	protein_coding	OTTHUMT00000192659.1	-	0.00	132	0	G	XM_047889		33060625	-1	tier1	-	no_errors	ENST00000286835	ensembl	human	known	74_37	missense	6.87	122	9	SNP	1.000	C
SCAF8	22828	genome.wustl.edu	37	6	155141311	155141311	+	Splice_Site	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:155141311A>T	ENST00000367178.3	+	15	2212	c.1636A>T	c.(1636-1638)Atc>Ttc	p.I546F	SCAF8_ENST00000417268.1_Splice_Site_p.I546F|SCAF8_ENST00000367186.4_Splice_Site_p.I612F	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	546	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						TTTACAATAGATCGCTTGGGC	0.294																																																	0													69.0	66.0	67.0					6																	155141311		2203	4300	6503	SO:0001630	splice_region_variant	0			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.1636-1A>T	6.37:g.155141311A>T			B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_CID_dom,smart_RRM_dom,pfscan_RRM_dom	p.I612F	ENST00000367178.3	37	c.1834	CCDS5247.1	6	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799545	0.70567	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.51071	0.72;0.72;0.72	5.24	5.24	0.73138	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.64402	U	0.000001	T	0.68796	0.3040	M	0.90309	3.105	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.995;0.999	D;D;D;D	0.78314	0.991;0.991;0.979;0.991	T	0.76537	-0.2923	9	.	.	.	.	15.4394	0.75171	1.0:0.0:0.0:0.0	.	591;612;624;546	B7Z876;B7Z888;B7Z3A4;Q9UPN6	.;.;.;SCAF8_HUMAN	F	546;546;612	ENSP00000356146:I546F;ENSP00000413098:I546F;ENSP00000356154:I612F	.	I	+	1	0	SCAF8	155183003	1.000000	0.71417	1.000000	0.80357	0.396000	0.30629	9.287000	0.95975	2.098000	0.63641	0.533000	0.62120	ATC	SCAF8	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000213079		0.294	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF8	HGNC	protein_coding	OTTHUMT00000042798.1	-	0.00	83	0	A	NM_014892	Missense_Mutation	155141311	+1	tier1	-	no_errors	ENST00000367186	ensembl	human	known	74_37	missense	6.20	121	8	SNP	1.000	T
SCN1A	6323	genome.wustl.edu	37	2	166847874	166847874	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:166847874C>A	ENST00000303395.4	-	26	5910	c.5911G>T	c.(5911-5913)Gaa>Taa	p.E1971*	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Nonsense_Mutation_p.E1943*|SCN1A_ENST00000423058.2_Nonsense_Mutation_p.E1971*|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Nonsense_Mutation_p.E1960*			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1971					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCAGTTTTTTCTGTAATAGAG	0.373																																																	0													90.0	85.0	87.0					2																	166847874		2203	4300	6503	SO:0001587	stop_gained	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5911G>T	2.37:g.166847874C>A	ENSP00000303540:p.Glu1971*		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.E1971*	ENST00000303395.4	37	c.5911	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	43	10.073388	0.99331	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	.	.	.	5.67	5.67	0.87782	.	0.432569	0.21783	N	0.069166	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.7714	0.96367	0.0:1.0:0.0:0.0	.	.	.	.	X	1971;1971;1960;1943	.	ENSP00000303540:E1971X	E	-	1	0	SCN1A	166556120	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	4.255000	0.58804	2.672000	0.90937	0.484000	0.47621	GAA	SCN1A	-	prints_Na_channel_a1su	ENSG00000144285		0.373	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	-	0.00	81	0	C	NM_006920		166847874	-1	tier1	-	no_errors	ENST00000303395	ensembl	human	known	74_37	nonsense	9.64	75	8	SNP	1.000	A
SCN3A	6328	genome.wustl.edu	37	2	165984514	165984514	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:165984514G>A	ENST00000360093.3	-	18	3511	c.3020C>T	c.(3019-3021)gCa>gTa	p.A1007V	SCN3A_ENST00000409101.3_Missense_Mutation_p.A958V|SCN3A_ENST00000283254.7_Missense_Mutation_p.A1007V	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1007					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTCCTACTGCAATCTGCAG	0.363																																																	0													58.0	60.0	59.0					2																	165984514		2203	4300	6503	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.3020C>T	2.37:g.165984514G>A	ENSP00000353206:p.Ala1007Val		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.A1007V	ENST00000360093.3	37	c.3020		2	.	.	.	.	.	.	.	.	.	.	G	35	5.480816	0.96307	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	6.04	6.04	0.98038	Sodium ion transport-associated (1);	0.215229	0.33092	N	0.005290	D	0.98061	0.9361	M	0.93507	3.425	0.80722	D	1	D;P;D;D;D	0.64830	0.994;0.943;0.971;0.971;0.978	D;P;P;P;D	0.65443	0.935;0.808;0.783;0.783;0.932	D	0.98281	1.0508	10	0.87932	D	0	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	1007;958;958;958;1007	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	V	1007;1007;958;958	ENSP00000353206:A1007V;ENSP00000283254:A1007V;ENSP00000386726:A958V;ENSP00000403348:A958V	ENSP00000283254:A1007V	A	-	2	0	SCN3A	165692760	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	9.809000	0.99208	2.873000	0.98535	0.561000	0.74099	GCA	SCN3A	-	pfam_Na_trans_assoc	ENSG00000153253		0.363	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding			0.00	47	0	G	NM_006922		165984514	-1			no_errors	ENST00000283254	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
SCN1A	6323	genome.wustl.edu	37	2	166848261	166848261	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:166848261G>C	ENST00000303395.4	-	26	5523	c.5524C>G	c.(5524-5526)Cca>Gca	p.P1842A	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.P1814A|SCN1A_ENST00000423058.2_Missense_Mutation_p.P1842A|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.P1831A			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1842					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTGGTTGTGGCAGATTGAGA	0.453																																																	0													93.0	96.0	95.0					2																	166848261		2203	4300	6503	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5524C>G	2.37:g.166848261G>C	ENSP00000303540:p.Pro1842Ala		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.P1842A	ENST00000303395.4	37	c.5524	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	G	0.966	-0.701606	0.03255	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.95918	-3.85;-3.85;-3.81;-3.79	5.6	4.7	0.59300	.	0.094676	0.47093	N	0.000252	D	0.87724	0.6249	N	0.05351	-0.065	0.43698	D	0.996151	B	0.12630	0.006	B	0.19391	0.025	T	0.82408	-0.0472	10	0.05525	T	0.97	.	15.107	0.72329	0.0:0.268:0.732:0.0	.	1831	P35498-2	.	A	1842;1842;1831;1814	ENSP00000407030:P1842A;ENSP00000303540:P1842A;ENSP00000364554:P1831A;ENSP00000386312:P1814A	ENSP00000303540:P1842A	P	-	1	0	SCN1A	166556507	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	2.645000	0.46621	1.455000	0.47813	0.650000	0.86243	CCA	SCN1A	-	NULL	ENSG00000144285		0.453	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1		0.00	61	0	G	NM_006920		166848261	-1			no_errors	ENST00000303395	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	C
SCP2D1	140856	genome.wustl.edu	37	20	18794792	18794792	+	Silent	SNP	G	G	T	rs368734818		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:18794792G>T	ENST00000377428.2	+	1	423	c.333G>T	c.(331-333)ccG>ccT	p.P111P	C20orf78_ENST00000278779.4_Intron|C20orf78_ENST00000463425.1_5'Flank	NM_178483.2	NP_848578.1	Q9UJQ7	SCP2D_HUMAN	SCP2 sterol-binding domain containing 1	111	SCP2.							p.P111P(1)									TTACAATCCCGGAGTCTGTCT	0.512																																																	1	Substitution - coding silent(1)	large_intestine(1)											57.0	62.0	60.0					20																	18794792		2203	4300	6503	SO:0001819	synonymous_variant	0			AL035563	CCDS13139.1	20p11.23	2012-10-29	2012-10-29	2012-10-29	ENSG00000132631	ENSG00000132631			16211	protein-coding gene	gene with protein product	"""sterol carrier protein 2-like protein"""		"""chromosome 20 open reading frame 79"""	C20orf79		16501878	Standard	NM_178483		Approved	dJ1068E13.2, HSD22	uc002wrk.3	Q9UJQ7	OTTHUMG00000031983	ENST00000377428.2:c.333G>T	20.37:g.18794792G>T			Q548A4	Silent	SNP	pfam_SCP2_sterol-bd_dom,superfamily_SCP2_sterol-bd_dom	p.P111	ENST00000377428.2	37	c.333	CCDS13139.1	20																																																																																			SCP2D1	-	pfam_SCP2_sterol-bd_dom,superfamily_SCP2_sterol-bd_dom	ENSG00000132631		0.512	SCP2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCP2D1	HGNC	protein_coding	OTTHUMT00000078193.1	-	0.00	56	0	G	NM_178483		18794792	+1	tier1	-	no_errors	ENST00000377428	ensembl	human	known	74_37	silent	8.05	79	7	SNP	0.065	T
SDHB	6390	genome.wustl.edu	37	1	17349305	17349305	+	Intron	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:17349305G>T	ENST00000375499.3	-	7	793					NM_003000.2	NP_002991.2	P21912	SDHB_HUMAN	succinate dehydrogenase complex, subunit B, iron sulfur (Ip)						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)|ubiquinone binding (GO:0048039)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	10		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0049)|COAD - Colon adenocarcinoma(227;1.18e-05)|BRCA - Breast invasive adenocarcinoma(304;2.41e-05)|Kidney(64;0.000188)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	Succinic acid(DB00139)	AGCTCTGGGAGTGCAGAGGAA	0.488			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																														yes	Rec		Familial paraganglioma	1	1p36.1-p35	6390	"""succinate dehydrogenase complex, subunit B, iron sulfur (Ip)"""		O	0																																										SO:0001627	intron_variant	0	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	U17248	CCDS176.1	1p36.1-p35	2014-09-17			ENSG00000117118	ENSG00000117118	1.3.99.1	"""Mitochondrial respiratory chain complex / Complex II"""	10681	protein-coding gene	gene with protein product		185470		SDH1, SDH			Standard	NM_003000		Approved		uc001bae.3	P21912	OTTHUMG00000002289	ENST00000375499.3:c.643-80C>A	1.37:g.17349305G>T			B2R545|Q0QEY7|Q9NQ12	RNA	SNP	-	NULL	ENST00000375499.3	37	NULL	CCDS176.1	1																																																																																			SDHB	-	-	ENSG00000117118		0.488	SDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDHB	HGNC	protein_coding	OTTHUMT00000006603.1	-	0.00	31	0	G	NM_003000		17349305	-1	tier1	-	no_errors	ENST00000485092	ensembl	human	known	74_37	rna	19.05	17	4	SNP	0.001	T
SDK2	54549	genome.wustl.edu	37	17	71437045	71437045	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:71437045C>A	ENST00000392650.3	-	6	631	c.631G>T	c.(631-633)Gac>Tac	p.D211Y	SDK2_ENST00000388726.3_Missense_Mutation_p.D211Y	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	211					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCGATGGGGTCTGCAGGCCCC	0.587																																																	0													76.0	85.0	82.0					17																	71437045		692	1591	2283	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.631G>T	17.37:g.71437045C>A	ENSP00000376421:p.Asp211Tyr		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D211Y	ENST00000392650.3	37	c.631	CCDS45769.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.6|23.6	4.434807|4.434807	0.83885|0.83885	.|.	.|.	ENSG00000069188|ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893|ENST00000416616	T;T|.	0.60424|.	0.19;0.22|.	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	0.072867|.	0.52532|.	U|.	0.000072|.	T|T	0.71567|0.71567	0.3355|0.3355	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	P|.	0.50819|.	0.939|.	B|.	0.42738|.	0.396|.	T|T	0.71038|0.71038	-0.4708|-0.4708	10|5	0.72032|.	D|.	0.01|.	.|.	17.6666|17.6666	0.88205|0.88205	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	211|.	Q58EX2|.	SDK2_HUMAN|.	Y|I	211|115	ENSP00000376421:D211Y;ENSP00000373378:D211Y|.	ENSP00000324967:D211Y|.	D|R	-|-	1|2	0|0	SDK2|SDK2	68948640|68948640	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.986000|0.986000	0.74619|0.74619	7.255000|7.255000	0.78338|0.78338	2.170000|2.170000	0.68504|0.68504	0.556000|0.556000	0.70494|0.70494	GAC|AGA	SDK2	-	NULL	ENSG00000069188		0.587	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	-	0.00	52	0	C	NM_019064		71437045	-1	tier1	-	no_errors	ENST00000392650	ensembl	human	known	74_37	missense	10.00	53	6	SNP	1.000	A
SEC24B	10427	genome.wustl.edu	37	4	110446037	110446037	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:110446037C>T	ENST00000265175.5	+	15	2627	c.2572C>T	c.(2572-2574)Cag>Tag	p.Q858*	SEC24B_ENST00000504968.2_Nonsense_Mutation_p.Q888*|SEC24B_ENST00000399100.2_Nonsense_Mutation_p.Q823*	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	858					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TTGCTCGGGACAGCAAACTGC	0.378																																																	0													132.0	121.0	125.0					4																	110446037		1833	4095	5928	SO:0001587	stop_gained	0			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.2572C>T	4.37:g.110446037C>T	ENSP00000265175:p.Gln858*		B7ZKM8|B7ZKN4|Q0VG08	Nonsense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.Q858*	ENST00000265175.5	37	c.2572	CCDS47124.1	4	.	.	.	.	.	.	.	.	.	.	C	40	8.531837	0.98852	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	.	.	.	6.17	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-12.0544	17.0573	0.86537	0.1275:0.8725:0.0:0.0	.	.	.	.	X	888;823;858	.	ENSP00000265175:Q858X	Q	+	1	0	SEC24B	110665486	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.067000	0.71193	2.941000	0.99782	0.655000	0.94253	CAG	SEC24B	-	pfam_Sec23/24_trunk_dom	ENSG00000138802		0.378	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24B	HGNC	protein_coding	OTTHUMT00000364693.2		0.00	50	0	C			110446037	+1			no_errors	ENST00000265175	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	1.000	T
SEC24D	9871	genome.wustl.edu	37	4	119754883	119754883	+	5'UTR	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:119754883C>G	ENST00000280551.6	-	0	207				SEC24D_ENST00000419654.2_5'UTR|SEC24D_ENST00000379735.5_5'UTR			O94855	SC24D_HUMAN	SEC24 family member D						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						GATAATTCTACAAAAGAAGTC	0.353																																																	0													60.0	61.0	61.0					4																	119754883		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.-32G>C	4.37:g.119754883C>G			Q8IYI7	RNA	SNP	-	NULL	ENST00000280551.6	37	NULL	CCDS3710.1	4																																																																																			SEC24D	-	-	ENSG00000150961		0.353	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4	-	0.00	58	0	C			119754883	-1	tier1	-	no_errors	ENST00000505280	ensembl	human	known	74_37	rna	14.81	69	12	SNP	0.004	G
SEMA6B	10501	genome.wustl.edu	37	19	4552571	4552571	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:4552571delG	ENST00000586582.1	-	10	1162	c.852delC	c.(850-852)tccfs	p.S284fs	SEMA6B_ENST00000301293.3_Frame_Shift_Del_p.S284fs|SEMA6B_ENST00000586965.1_Frame_Shift_Del_p.S284fs	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	284	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTTCAGGAAGGACGTCCACT	0.667																																																	0													35.0	30.0	32.0					19																	4552571		2203	4297	6500	SO:0001589	frameshift_variant	0			AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.852delC	19.37:g.4552571delG	ENSP00000467290:p.Ser284fs		A5PKU4|F6IB19|Q9NRK9	Frame_Shift_Del	DEL	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,pfscan_Semap_dom	p.F285fs	ENST00000586582.1	37	c.852	CCDS12131.1	19																																																																																			SEMA6B	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000167680		0.667	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6B	HGNC	protein_coding	OTTHUMT00000458656.2		0.00	122	0	G	NM_032108		4552571	-1			no_errors	ENST00000301293	ensembl	human	known	74_37	frame_shift_del	5.26	126	7	DEL	0.968	0
SERPINA5	5104	genome.wustl.edu	37	14	95058482	95058482	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:95058482G>T	ENST00000554866.1	+	5	1241	c.1127G>T	c.(1126-1128)cGc>cTc	p.R376L	SERPINA5_ENST00000554276.1_Missense_Mutation_p.R376L|SERPINA5_ENST00000329597.7_Missense_Mutation_p.R376L|SERPINA5_ENST00000553780.1_Missense_Mutation_p.R376L|RP11-986E7.7_ENST00000553947.1_Intron			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	376					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	AGGTCGGCCCGCCTGAACTCT	0.562																																																	0													215.0	223.0	221.0					14																	95058482		2203	4300	6503	SO:0001583	missense	0			M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.1127G>T	14.37:g.95058482G>T	ENSP00000451126:p.Arg376Leu		Q07616|Q9UG30	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.R376L	ENST00000554866.1	37	c.1127	CCDS9928.1	14	.	.	.	.	.	.	.	.	.	.	G	6.853	0.526601	0.13066	.	.	ENSG00000188488	ENST00000553780;ENST00000554866;ENST00000329597;ENST00000537685;ENST00000438291;ENST00000554276	D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52	5.49	-5.52	0.02560	Serpin domain (3);	2.186560	0.02369	N	0.077603	T	0.60599	0.2281	N	0.25144	0.715	0.09310	N	0.999998	B	0.10296	0.003	B	0.04013	0.001	T	0.51655	-0.8678	10	0.10377	T	0.69	.	1.9764	0.03417	0.4717:0.1059:0.2228:0.1996	.	376	P05154	IPSP_HUMAN	L	376;376;376;228;300;376	ENSP00000450837:R376L;ENSP00000451126:R376L;ENSP00000333203:R376L;ENSP00000451610:R376L	ENSP00000333203:R376L	R	+	2	0	SERPINA5	94128235	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-1.315000	0.02713	-1.189000	0.02702	-0.137000	0.14449	CGC	SERPINA5	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000188488		0.562	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA5	HGNC	protein_coding	OTTHUMT00000410726.1	-	0.00	48	0	G	NM_000624		95058482	+1	tier1	-	no_errors	ENST00000329597	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.000	T
SERPINA13P	388007	genome.wustl.edu	37	14	95107765	95107765	+	RNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:95107765C>A	ENST00000469935.1	+	0	370					NR_015340.1		Q6UXR4	SPA13_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13, pseudogene						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)										GCCCCCAGGACAGCAGCCCTG	0.587																																																	0													39.0	32.0	34.0					14																	95107765		2203	4300	6503			0			AY358238		14q32.13	2014-02-18	2012-10-03	2012-10-03	ENSG00000187483	ENSG00000187483		"""Serine (or cysteine) peptidase inhibitors"""	30909	pseudogene	pseudogene			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13"", ""serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13"""	SERPINA13		15014966, 16395595, 24172014	Standard	NR_015340		Approved	UNQ6121	uc001ydt.3	Q6UXR4	OTTHUMG00000150191		14.37:g.95107765C>A				RNA	SNP	-	NULL	ENST00000469935.1	37	NULL		14																																																																																			SERPINA13P	-	-	ENSG00000187483		0.587	SERPINA13P-002	KNOWN	basic	processed_transcript	SERPINA13P	HGNC	pseudogene	OTTHUMT00000316754.1		0.00	24	0	C	NR_015340		95107765	+1			no_errors	ENST00000469935	ensembl	human	known	74_37	rna	11.76	45	6	SNP	0.000	A
SERPINE2	5270	genome.wustl.edu	37	2	224866556	224866556	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:224866556T>A	ENST00000258405.4	-	2	304	c.62A>T	c.(61-63)cAc>cTc	p.H21L	SERPINE2_ENST00000409304.1_Missense_Mutation_p.H21L|SERPINE2_ENST00000409840.3_Missense_Mutation_p.H21L|SERPINE2_ENST00000447280.2_Missense_Mutation_p.H33L	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	21					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		AGGATTGAAGTGGGAGCAGAT	0.512																																																	0													108.0	117.0	114.0					2																	224866556		2203	4300	6503	SO:0001583	missense	0			M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.62A>T	2.37:g.224866556T>A	ENSP00000258405:p.His21Leu		B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.H21L	ENST00000258405.4	37	c.62	CCDS2460.1	2	.	.	.	.	.	.	.	.	.	.	T	8.172	0.792000	0.16258	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738;ENST00000454956;ENST00000423446	D;T;D;D;T;D	0.84146	-1.81;-0.7;-1.81;-1.81;-1.45;-1.51	5.17	-0.501	0.12008	Serpin domain (1);	1.242000	0.05104	N	0.487742	T	0.68375	0.2994	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.54510	-0.8283	10	0.45353	T	0.12	.	2.6819	0.05096	0.1116:0.1083:0.2309:0.5492	.	33;21	B4DIF2;P07093	.;GDN_HUMAN	L	21;21;21;33;21;21;21	ENSP00000386412:H21L;ENSP00000258405:H21L;ENSP00000386969:H21L;ENSP00000415786:H33L;ENSP00000408452:H21L;ENSP00000399655:H21L	ENSP00000258405:H21L	H	-	2	0	SERPINE2	224574800	0.995000	0.38212	0.148000	0.22405	0.131000	0.20780	1.175000	0.31944	-0.212000	0.10109	0.533000	0.62120	CAC	SERPINE2	-	superfamily_Serpin_dom	ENSG00000135919		0.512	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SERPINE2	HGNC	protein_coding	OTTHUMT00000256865.2	-	0.00	66	0	T	NM_006216		224866556	-1	tier1	-	no_errors	ENST00000258405	ensembl	human	known	74_37	missense	12.12	58	8	SNP	0.144	A
SFXN3	81855	genome.wustl.edu	37	10	102799314	102799314	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:102799314A>C	ENST00000224807.5	+	12	1406	c.950A>C	c.(949-951)gAa>gCa	p.E317A	SFXN3_ENST00000466982.1_3'UTR|SFXN3_ENST00000393459.1_Missense_Mutation_p.E313A	NM_030971.3	NP_112233.2	Q9BWM7	SFXN3_HUMAN	sideroflexin 3	317					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(252;0.234)		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCCAGCGTTGAAGTGGTCTAC	0.532																																																	0													180.0	156.0	165.0					10																	102799314		2203	4300	6503	SO:0001583	missense	0			AK074707	CCDS7508.2	10q24.32	2008-09-04			ENSG00000107819	ENSG00000107819		"""Sideroflexins"""	16087	protein-coding gene	gene with protein product		615571					Standard	NM_030971		Approved	SFX3	uc001ksp.3	Q9BWM7	OTTHUMG00000018921	ENST00000224807.5:c.950A>C	10.37:g.102799314A>C	ENSP00000224807:p.Glu317Ala		Q8NCJ0|Q9NTP4	Missense_Mutation	SNP	pfam_Mtc,tigrfam_Mtc	p.E317A	ENST00000224807.5	37	c.950	CCDS7508.2	10	.	.	.	.	.	.	.	.	.	.	A	9.086	1.000451	0.19121	.	.	ENSG00000107819	ENST00000393459;ENST00000224807	T;T	0.32272	1.46;1.46	5.31	4.1	0.47936	.	0.516507	0.23265	N	0.050100	T	0.23054	0.0557	L	0.33624	1.015	0.09310	N	1	B;B;B	0.10296	0.003;0.001;0.0	B;B;B	0.12837	0.008;0.003;0.003	T	0.10917	-1.0609	10	0.34782	T	0.22	-7.5421	11.1923	0.48691	0.8463:0.1537:0.0:0.0	.	321;317;317	B4DRS6;A6NCZ6;Q9BWM7	.;.;SFXN3_HUMAN	A	313;317	ENSP00000377103:E313A;ENSP00000224807:E317A	ENSP00000224807:E317A	E	+	2	0	SFXN3	102789304	0.401000	0.25303	0.483000	0.27378	0.432000	0.31715	2.785000	0.47782	2.008000	0.58898	0.459000	0.35465	GAA	SFXN3	-	pfam_Mtc,tigrfam_Mtc	ENSG00000107819		0.532	SFXN3-201	KNOWN	basic|CCDS	protein_coding	SFXN3	HGNC	protein_coding		-	0.00	71	0	A	NM_030971		102799314	+1	tier1	-	no_errors	ENST00000224807	ensembl	human	known	74_37	missense	8.11	68	6	SNP	0.006	C
SHCBP1L	81626	genome.wustl.edu	37	1	182872292	182872292	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:182872292G>T	ENST00000367547.3	-	9	1828	c.1592C>A	c.(1591-1593)gCt>gAt	p.A531D	SHCBP1L_ENST00000423786.1_Missense_Mutation_p.A412D|SHCBP1L_ENST00000488956.1_5'UTR	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	603										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TTCAACACCAGCACCCTGTAA	0.328																																																	0													89.0	96.0	93.0					1																	182872292		2203	4300	6503	SO:0001583	missense	0			AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.1592C>A	1.37:g.182872292G>T	ENSP00000356518:p.Ala531Asp		Q4G195|Q9BZQ3|Q9H2B6	Missense_Mutation	SNP	superfamily_Pectin_lyase_fold/virulence,smart_Carb-bd_sugar_hydrolysis-dom,smart_PbH1	p.A531D	ENST00000367547.3	37	c.1592	CCDS30955.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986684	0.74589	.	.	ENSG00000157060	ENST00000367547;ENST00000287709;ENST00000423786	T;T	0.46451	0.87;0.87	4.94	4.94	0.65067	Pectin lyase fold/virulence factor (1);Carbohydrate-binding/sugar hydrolysis domain (1);Pectin lyase fold (1);	0.000000	0.52532	D	0.000079	T	0.57829	0.2080	L	0.47190	1.495	0.47905	D	0.999541	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.999	T	0.58758	-0.7580	10	0.56958	D	0.05	-18.1307	15.4272	0.75061	0.0:0.0:1.0:0.0	.	603;412;531	Q9BZQ2;Q9BZQ2-2;Q9BZQ2-3	SHP1L_HUMAN;.;.	D	531;600;412	ENSP00000356518:A531D;ENSP00000397308:A412D	ENSP00000287709:A600D	A	-	2	0	SHCBP1L	181138915	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.947000	0.70242	2.442000	0.82660	0.557000	0.71058	GCT	SHCBP1L	-	superfamily_Pectin_lyase_fold/virulence,smart_Carb-bd_sugar_hydrolysis-dom,smart_PbH1	ENSG00000157060		0.328	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1L	HGNC	protein_coding	OTTHUMT00000085956.1	-	0.00	49	0	G	NM_030933		182872292	-1	tier1	-	no_errors	ENST00000367547	ensembl	human	known	74_37	missense	5.26	70	4	SNP	1.000	T
SH3BP5L	80851	genome.wustl.edu	37	1	249110698	249110698	+	Intron	SNP	C	C	A	rs375738910		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:249110698C>A	ENST00000366472.5	-	4	1605				SH3BP5L_ENST00000475978.1_Intron|SH3BP5L_ENST00000411742.2_Intron	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like											endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			AGGCTCAGCACGTAGCCTTCC	0.592																																																	0													41.0	42.0	42.0					1																	249110698		2203	4300	6503	SO:0001627	intron_variant	0			AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.375+34G>T	1.37:g.249110698C>A			B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	RNA	SNP	-	NULL	ENST00000366472.5	37	NULL	CCDS31126.1	1																																																																																			SH3BP5L	-	-	ENSG00000175137		0.592	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5L	HGNC	protein_coding	OTTHUMT00000097140.1	-	0.00	39	0	C	NM_030645		249110698	-1	tier1	-	no_errors	ENST00000494837	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.000	A
SHPRH	257218	genome.wustl.edu	37	6	146269407	146269407	+	Splice_Site	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:146269407C>T	ENST00000367505.2	-	5	1326		c.e5+1		SHPRH_ENST00000438092.2_Splice_Site|SHPRH_ENST00000275233.7_Splice_Site|SHPRH_ENST00000367503.3_Splice_Site			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase						DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TTTTGCCTTACCAGCCTGTAT	0.318																																																	0													61.0	59.0	60.0					6																	146269407		1791	4059	5850	SO:0001630	splice_region_variant	0			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.1061+1G>A	6.37:g.146269407C>T			Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Splice_Site	SNP	-	e4+1	ENST00000367505.2	37	c.1061+1	CCDS43513.2	6	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622675	0.87460	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5344	0.91004	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SHPRH	146311100	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.031000	0.76491	2.826000	0.97356	0.655000	0.94253	.	SHPRH	-	-	ENSG00000146414		0.318	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2	-	0.00	103	0	C	NM_173082	Intron	146269407	-1	tier1	-	no_errors	ENST00000367503	ensembl	human	known	74_37	splice_site	6.09	108	7	SNP	1.000	T
SIAH2	6478	genome.wustl.edu	37	3	150460351	150460351	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:150460351C>T	ENST00000312960.3	-	2	1079	c.552G>A	c.(550-552)gtG>gtA	p.V184V		NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	184	SBD.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GATGGGACATCACAGCTTCCA	0.522																																																	0													123.0	110.0	114.0					3																	150460351		2203	4300	6503	SO:0001819	synonymous_variant	0			U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.552G>A	3.37:g.150460351C>T			O43270	Silent	SNP	pfam_7-in-absentia-prot_TRAF-dom,superfamily_TRAF-like,pfscan_Znf_RING,pfscan_Znf_SIAH	p.V184	ENST00000312960.3	37	c.552	CCDS3152.1	3																																																																																			SIAH2	-	pfam_7-in-absentia-prot_TRAF-dom,superfamily_TRAF-like,pfscan_Znf_SIAH	ENSG00000181788		0.522	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAH2	HGNC	protein_coding	OTTHUMT00000357697.1	-	0.00	76	0	C	NM_005067		150460351	-1	tier1	-	no_errors	ENST00000312960	ensembl	human	known	74_37	silent	8.18	101	9	SNP	1.000	T
SIN3B	23309	genome.wustl.edu	37	19	16989100	16989100	+	Missense_Mutation	SNP	G	G	A	rs372894104		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:16989100G>A	ENST00000248054.5	+	18	3082	c.3061G>A	c.(3061-3063)Gac>Aac	p.D1021N	SIN3B_ENST00000594235.1_3'UTR|SIN3B_ENST00000379803.1_Missense_Mutation_p.D1053N|SIN3B_ENST00000595541.1_Missense_Mutation_p.D611N					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						GAGCGCCTGCGACGTGGACTG	0.667																																																	0								G	ASN/ASP	1,4399		0,1,2199	23.0	18.0	20.0		3157	3.9	1.0	19		20	0,8592		0,0,4296	no	missense	SIN3B	NM_015260.2	23	0,1,6495	AA,AG,GG		0.0,0.0227,0.0077	benign	1053/1163	16989100	1,12991	2200	4296	6496	SO:0001583	missense	0			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.3061G>A	19.37:g.16989100G>A	ENSP00000248054:p.Asp1021Asn			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.D1053N	ENST00000248054.5	37	c.3157		19	.	.	.	.	.	.	.	.	.	.	G	7.701	0.693152	0.15039	2.27E-4	0.0	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.40476	1.03;1.05	4.92	3.89	0.44902	.	0.151387	0.64402	N	0.000015	T	0.11793	0.0287	N	0.00879	-1.12	0.29263	N	0.871224	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.16689	-1.0394	10	0.14252	T	0.57	-28.618	4.8467	0.13517	0.8035:0.0:0.1965:0.0	.	611;1021;1053	B7Z392;O75182-2;O75182	.;.;SIN3B_HUMAN	N	1053;1021	ENSP00000369131:D1053N;ENSP00000248054:D1021N	ENSP00000248054:D1021N	D	+	1	0	SIN3B	16850100	1.000000	0.71417	0.957000	0.39632	0.728000	0.41692	7.227000	0.78070	0.894000	0.36317	0.561000	0.74099	GAC	SIN3B	-	NULL	ENSG00000127511		0.667	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	SIN3B	HGNC	protein_coding	OTTHUMT00000462846.1		0.00	48	0	G	NM_015260		16989100	+1			no_errors	ENST00000379803	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.997	A
SKIDA1	387640	genome.wustl.edu	37	10	21805376	21805376	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:21805376A>G	ENST00000449193.2	-	4	3628	c.1376T>C	c.(1375-1377)gTg>gCg	p.V459A	SKIDA1_ENST00000444772.3_Missense_Mutation_p.V380A	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	378						nucleus (GO:0005634)											CTGCACTGACACTTGGCTGGA	0.657																																																	0													16.0	20.0	19.0					10																	21805376		2107	4219	6326	SO:0001583	missense	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1376T>C	10.37:g.21805376A>G	ENSP00000410041:p.Val459Ala		B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.V459A	ENST00000449193.2	37	c.1376	CCDS44363.1	10	.	.	.	.	.	.	.	.	.	.	A	14.65	2.599266	0.46318	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.67135	0.2861	L	0.36672	1.1	0.53005	D	0.999967	D	0.76494	0.999	D	0.78314	0.991	T	0.70332	-0.4901	9	0.66056	D	0.02	-17.9769	14.5124	0.67797	1.0:0.0:0.0:0.0	.	459	E9PAX1	.	A	459;380	.	ENSP00000442432:V380A	V	-	2	0	C10orf140	21845382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.364000	0.90105	1.919000	0.55581	0.454000	0.30748	GTG	SKIDA1	-	NULL	ENSG00000180592		0.657	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2	-	0.00	65	0	A	NM_207371		21805376	-1	tier1	-	no_errors	ENST00000449193	ensembl	human	known	74_37	missense	16.33	82	16	SNP	1.000	G
SLC13A2	9058	genome.wustl.edu	37	17	26820661	26820661	+	Silent	SNP	C	C	A	rs149127873	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:26820661C>A	ENST00000314669.5	+	7	1371	c.951C>A	c.(949-951)acC>acA	p.T317T	SLC13A2_ENST00000444914.3_Silent_p.T366T|SLC13A2_ENST00000545060.1_Silent_p.T274T|SLC13A2_ENST00000537681.1_Silent_p.T246T	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	317					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	TCATCCAGACCGAGCACAGGC	0.592																																																	0													59.0	52.0	55.0					17																	26820661		2203	4300	6503	SO:0001819	synonymous_variant	0			U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.951C>A	17.37:g.26820661C>A			B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Silent	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.T366	ENST00000314669.5	37	c.1098	CCDS11231.1	17																																																																																			SLC13A2	-	pfam_Na/sul_symport	ENSG00000007216		0.592	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A2	HGNC	protein_coding	OTTHUMT00000255722.1	-	0.00	45	0	C	NM_003984		26820661	+1	tier1	-	no_errors	ENST00000444914	ensembl	human	known	74_37	silent	16.09	73	14	SNP	0.000	A
SLC17A3	10786	genome.wustl.edu	37	6	25862543	25862543	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:25862543G>T	ENST00000360657.3	-	3	506	c.221C>A	c.(220-222)tCc>tAc	p.S74Y	SLC17A3_ENST00000361703.6_Missense_Mutation_p.S74Y|SLC17A3_ENST00000397060.4_Missense_Mutation_p.S74Y			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3	74					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						ATTGAGCTGGGATTGAGGGCT	0.448																																																	0													196.0	152.0	167.0					6																	25862543		2203	4300	6503	SO:0001583	missense	0			U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.221C>A	6.37:g.25862543G>T	ENSP00000353873:p.Ser74Tyr		B7WNJ5|B7Z511|Q8WWC7|Q9H533	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S74Y	ENST00000360657.3	37	c.221	CCDS4566.2	6	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259957	0.23051	.	.	ENSG00000124564	ENST00000397060;ENST00000360657;ENST00000361703	T;T;T	0.63255	0.31;-0.03;-0.03	3.81	-0.919	0.10478	.	.	.	.	.	T	0.41465	0.1160	L	0.46157	1.445	0.09310	N	1	P;P;P;P	0.44380	0.561;0.834;0.834;0.561	B;P;P;B	0.52554	0.178;0.702;0.702;0.086	T	0.40757	-0.9546	9	0.87932	D	0	.	0.4997	0.00578	0.2806:0.1844:0.3468:0.1882	.	74;55;74;74	B7Z531;B7Z3L7;B7Z511;O00476	.;.;.;NPT4_HUMAN	Y	74	ENSP00000380250:S74Y;ENSP00000353873:S74Y;ENSP00000355307:S74Y	ENSP00000353873:S74Y	S	-	2	0	SLC17A3	25970522	0.000000	0.05858	0.000000	0.03702	0.333000	0.28666	-0.358000	0.07641	-0.205000	0.10219	0.557000	0.71058	TCC	SLC17A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000124564		0.448	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	SLC17A3	HGNC	protein_coding	OTTHUMT00000040070.2		0.00	62	0	G			25862543	-1			no_errors	ENST00000397060	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.000	T
SLC22A18AS	5003	genome.wustl.edu	37	11	2909808	2909808	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:2909808C>T	ENST00000533594.1	-	4	860	c.364G>A	c.(364-366)Gca>Aca	p.A122T	SLC22A18AS_ENST00000455942.2_Missense_Mutation_p.A19T|CDKN1C_ENST00000380725.1_5'Flank|CDKN1C_ENST00000440480.2_5'Flank|CDKN1C_ENST00000430149.2_5'Flank|SLC22A18AS_ENST00000526203.1_Missense_Mutation_p.A19T|CDKN1C_ENST00000313407.6_5'Flank|CDKN1C_ENST00000414822.3_5'Flank	NM_007105.2	NP_009036.2	Q8N1D0	BWR1B_HUMAN	solute carrier family 22 (organic cation transporter), member 18 antisense	122										NS(1)|endometrium(2)	3						ATGGAGGCTGCAGACCCTGCG	0.587											OREG0020687	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													42.0	45.0	44.0					11																	2909808		692	1591	2283	SO:0001583	missense	0			AF035407	CCDS7739.1	11p15.5	2011-02-10	2005-08-23	2005-08-23	ENSG00000254827	ENSG00000254827			10965	protein-coding gene	gene with protein product		603240	"""solute carrier family 22 (organic cation transporter), member 1-like antisense"""	BWSCR1B, ORCTL2S, SLC22A1LS		9570947, 9520460, 15175115	Standard	NM_007105		Approved	BWR1B, p27-BWR1B	uc001lwv.4	Q8N1D0	OTTHUMG00000010038	ENST00000533594.1:c.364G>A	11.37:g.2909808C>T	ENSP00000433282:p.Ala122Thr	607	E9PLK8|O43563	Missense_Mutation	SNP	NULL	p.A122T	ENST00000533594.1	37	c.364	CCDS7739.1	11	.	.	.	.	.	.	.	.	.	.	C	8.364	0.833745	0.16820	.	.	ENSG00000254827	ENST00000533594;ENST00000526203;ENST00000455942	T;T;T	0.55052	1.14;0.54;0.54	1.92	1.92	0.25849	.	.	.	.	.	T	0.31420	0.0796	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.23018	0.043	T	0.28004	-1.0057	9	0.87932	D	0	.	7.3643	0.26764	0.0:1.0:0.0:0.0	.	122	E9PLK8	.	T	122;19;19	ENSP00000433282:A122T;ENSP00000435592:A19T;ENSP00000434027:A19T	ENSP00000434027:A19T	A	-	1	0	SLC22A18AS	2866384	0.000000	0.05858	0.004000	0.12327	0.150000	0.21749	-0.989000	0.03736	1.398000	0.46701	0.313000	0.20887	GCA	SLC22A18AS	-	NULL	ENSG00000254827		0.587	SLC22A18AS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A18AS	HGNC	protein_coding	OTTHUMT00000027771.3	-	0.00	38	0	C	NM_007105		2909808	-1	tier1	-	no_errors	ENST00000533594	ensembl	human	known	74_37	missense	12.00	44	6	SNP	0.004	T
SLC22A2	6582	genome.wustl.edu	37	6	160664752	160664752	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:160664752G>T	ENST00000366953.3	-	7	1389	c.1131C>A	c.(1129-1131)taC>taA	p.Y377*	SLC22A2_ENST00000491092.1_5'UTR	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	377					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	AGAAATCCAGGTAGATATTGT	0.532																																																	0													107.0	97.0	101.0					6																	160664752		2203	4300	6503	SO:0001587	stop_gained	0			X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.1131C>A	6.37:g.160664752G>T	ENSP00000355920:p.Tyr377*		Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Nonsense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.Y377*	ENST00000366953.3	37	c.1131	CCDS5276.1	6	.	.	.	.	.	.	.	.	.	.	g	36	5.957013	0.97145	.	.	ENSG00000112499	ENST00000366953	.	.	.	5.35	2.43	0.29744	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7769	0.40626	0.3311:0.0:0.6689:0.0	.	.	.	.	X	377	.	ENSP00000355920:Y377X	Y	-	3	2	SLC22A2	160584742	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	0.795000	0.26972	0.849000	0.35215	-0.119000	0.15052	TAC	SLC22A2	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000112499		0.532	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A2	HGNC	protein_coding	OTTHUMT00000042943.1	-	0.00	52	0	G	NM_003058		160664752	-1	tier1	-	no_errors	ENST00000366953	ensembl	human	known	74_37	nonsense	19.77	69	17	SNP	1.000	T
SLC2A3	6515	genome.wustl.edu	37	12	8077066	8077066	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:8077066C>G	ENST00000075120.7	-	8	1248	c.1008G>C	c.(1006-1008)atG>atC	p.M336I		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	336					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		CAAGGCCTATCATATGCAGAG	0.428																																					Colon(96;424 1461 14416 20933 23688)												0													46.0	51.0	50.0					12																	8077066		2201	4297	6498	SO:0001583	missense	0			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.1008G>C	12.37:g.8077066C>G	ENSP00000075120:p.Met336Ile		B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_3,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.M336I	ENST00000075120.7	37	c.1008	CCDS8586.1	12	.	.	.	.	.	.	.	.	.	.	C	10.59	1.391673	0.25118	.	.	ENSG00000059804	ENST00000075120;ENST00000540978	T	0.72167	-0.63	4.0	4.0	0.46444	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.250907	0.40469	N	0.001083	T	0.54415	0.1857	N	0.16368	0.405	0.09310	N	0.999999	B	0.23058	0.079	B	0.32762	0.152	T	0.44605	-0.9317	10	0.30078	T	0.28	.	9.2644	0.37632	0.2152:0.7848:0.0:0.0	.	336	P11169	GTR3_HUMAN	I	336;262	ENSP00000075120:M336I	ENSP00000075120:M336I	M	-	3	0	SLC2A3	7968333	0.000000	0.05858	0.112000	0.21494	0.987000	0.75469	-0.462000	0.06704	2.217000	0.71921	0.563000	0.77884	ATG	SLC2A3	-	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000059804		0.428	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A3	HGNC	protein_coding	OTTHUMT00000257914.1		0.00	68	0	C	NM_006931		8077066	-1			no_errors	ENST00000075120	ensembl	human	known	74_37	missense	5.81	81	5	SNP	0.024	G
SLC2A3	6515	genome.wustl.edu	37	12	8077078	8077078	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:8077078C>T	ENST00000075120.7	-	8	1236	c.996G>A	c.(994-996)agG>agA	p.R332R		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	332					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		TATGCAGAGTCCTTCTTCCTG	0.413																																					Colon(96;424 1461 14416 20933 23688)												0													32.0	35.0	34.0					12																	8077078		2196	4280	6476	SO:0001819	synonymous_variant	0			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.996G>A	12.37:g.8077078C>T			B2R606|D3DUU6|Q6I9U2|Q9UG15	Silent	SNP	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_3,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.R332	ENST00000075120.7	37	c.996	CCDS8586.1	12																																																																																			SLC2A3	-	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000059804		0.413	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A3	HGNC	protein_coding	OTTHUMT00000257914.1		0.00	61	0	C	NM_006931		8077078	-1			no_errors	ENST00000075120	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.998	T
SLC2A6	11182	genome.wustl.edu	37	9	136339163	136339163	+	Silent	SNP	G	G	T	rs372931255		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:136339163G>T	ENST00000371899.4	-	7	1052	c.975C>A	c.(973-975)tcC>tcA	p.S325S	SLC2A6_ENST00000371897.4_Silent_p.S325S|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	325					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CGATCAGCACGGACAGGAGCC	0.687																																																	0													33.0	29.0	30.0					9																	136339163		2196	4297	6493	SO:0001819	synonymous_variant	0			AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.975C>A	9.37:g.136339163G>T			A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.S325	ENST00000371899.4	37	c.975	CCDS6975.1	9																																																																																			SLC2A6	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000160326		0.687	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A6	HGNC	protein_coding	OTTHUMT00000054909.1	-	0.00	91	0	G	NM_017585		136339163	-1	tier1	-	no_errors	ENST00000371899	ensembl	human	known	74_37	silent	12.22	79	11	SNP	0.267	T
SLC35C2	51006	genome.wustl.edu	37	20	44979257	44979257	+	Intron	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:44979257C>A	ENST00000372227.1	-	10	1508				SLC35C2_ENST00000243896.2_Intron|SLC35C2_ENST00000372230.5_Intron|SLC35C2_ENST00000372229.1_Intron|SLC35C2_ENST00000493599.1_5'UTR|SLC35C2_ENST00000317734.8_Intron|SLC35C2_ENST00000543605.1_Intron	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2						negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				AGGCCCCACCCACCCACTCTG	0.557																																																	0																																										SO:0001627	intron_variant	0				CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.968-94G>T	20.37:g.44979257C>A			B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	RNA	SNP	-	NULL	ENST00000372227.1	37	NULL	CCDS13396.1	20																																																																																			SLC35C2	-	-	ENSG00000080189		0.557	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35C2	HGNC	protein_coding	OTTHUMT00000080363.1	-	0.00	35	0	C	NM_015945		44979257	-1	tier1	-	no_errors	ENST00000480329	ensembl	human	known	74_37	rna	10.81	33	4	SNP	0.019	A
SLC44A5	204962	genome.wustl.edu	37	1	75708676	75708677	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:75708676_75708677TG>CT	ENST00000370855.5	-	8	478_479	c.365_366CA>AG	c.(364-366)cCA>cAG	p.P122Q	SLC44A5_ENST00000469525.1_5'UTR|SLC44A5_ENST00000535611.1_5'UTR|SLC44A5_ENST00000370859.3_Missense_Mutation_p.P122Q	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	122					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						AAAATTTTTCTGGGCACTTGGA	0.396																																																	0																																										SO:0001583	missense	0			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.365_366delinsCT	1.37:g.75708676_75708677delinsCT	ENSP00000359892:p.Pro122Gln		B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent|Missense_Mutation	SNP	pfam_Choline_transptr-like	p.P122|p.P122Q	ENST00000370855.5	37	c.366|c.365	CCDS667.1	1																																																																																			SLC44A5	-	NULL	ENSG00000137968		0.396	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026921.1		0.00	43	0	T|G	NM_152697		75708676|75708677	-1			no_errors	ENST00000370855	ensembl	human	known	74_37	silent|missense	5.77|6.00	49|47	3	SNP	1.000	C|T
SLC4A10	57282	genome.wustl.edu	37	2	162480885	162480885	+	5'Flank	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:162480885G>A	ENST00000446997.1	+	0	0				SLC4A10_ENST00000535165.1_5'Flank|SLC4A10_ENST00000375514.5_5'UTR|SLC4A10_ENST00000421911.1_5'Flank|SLC4A10_ENST00000415876.2_5'UTR|SLC4A10_ENST00000272716.5_5'Flank	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10						bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TAGGAGCCATGTGACTCTGGT	0.557																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938		2.37:g.162480885G>A	Exception_encountered		B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	RNA	SNP	-	NULL	ENST00000446997.1	37	NULL	CCDS54411.1	2																																																																																			SLC4A10	-	-	ENSG00000144290		0.557	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	HGNC	protein_coding	OTTHUMT00000333090.1	-	0.00	85	0	G	NM_022058		162480885	+1	tier1	-	no_errors	ENST00000605990	ensembl	human	known	74_37	rna	7.92	93	8	SNP	1.000	A
SLC4A8	9498	genome.wustl.edu	37	12	51865176	51865176	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:51865176C>G	ENST00000453097.2	+	14	1981	c.1764C>G	c.(1762-1764)taC>taG	p.Y588*	SLC4A8_ENST00000546663.1_3'UTR|SLC4A8_ENST00000514353.3_Nonsense_Mutation_p.Y535*|SLC4A8_ENST00000535225.2_Nonsense_Mutation_p.Y535*|SLC4A8_ENST00000394856.1_Nonsense_Mutation_p.Y535*|SLC4A8_ENST00000358657.3_Nonsense_Mutation_p.Y615*	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		TTGTCTGCTACATTACCCGTT	0.453																																																	0													253.0	211.0	226.0					12																	51865176		2203	4300	6503	SO:0001587	stop_gained	0			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1764C>G	12.37:g.51865176C>G	ENSP00000405812:p.Tyr588*			Nonsense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.Y588*	ENST00000453097.2	37	c.1764	CCDS44890.1	12	.	.	.	.	.	.	.	.	.	.	C	39	7.397498	0.98258	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	.	.	.	5.33	1.43	0.22495	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2264	0.37410	0.0:0.6151:0.0:0.3849	.	.	.	.	X	535;615;588;535;588;535;535	.	ENSP00000315789:Y588X	Y	+	3	2	SLC4A8	50151443	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.610000	0.46325	0.339000	0.23719	0.563000	0.77884	TAC	SLC4A8	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	ENSG00000050438		0.453	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A8	HGNC	protein_coding	OTTHUMT00000404356.1	-	0.00	98	0	C	NM_004858		51865176	+1	tier1	-	no_errors	ENST00000453097	ensembl	human	known	74_37	nonsense	8.80	114	11	SNP	1.000	G
SLC8A2	6543	genome.wustl.edu	37	19	47969259	47969259	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:47969259C>A	ENST00000236877.6	-	2	797	c.402G>T	c.(400-402)atG>atT	p.M134I	SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	134					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		AGCCCAGGGCCATGAGCGTGA	0.612																																																	0													83.0	55.0	64.0					19																	47969259		2203	4300	6503	SO:0001583	missense	0			AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.402G>T	19.37:g.47969259C>A	ENSP00000236877:p.Met134Ile		B4DYQ9	Missense_Mutation	SNP	pfam_Calx_beta,pfam_NaCa_Exmemb,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.M134I	ENST00000236877.6	37	c.402	CCDS33065.1	19	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371984	0.61624	.	.	ENSG00000118160	ENST00000236877	T	0.62639	0.01	4.25	4.25	0.50352	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.85504	0.5712	H	0.96777	3.88	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.90784	0.4681	10	0.87932	D	0	.	15.6004	0.76620	0.0:1.0:0.0:0.0	.	134	Q9UPR5	NAC2_HUMAN	I	134	ENSP00000236877:M134I	ENSP00000236877:M134I	M	-	3	0	SLC8A2	52661071	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.597000	0.82733	2.210000	0.71456	0.462000	0.41574	ATG	SLC8A2	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex	ENSG00000118160		0.612	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A2	HGNC	protein_coding	OTTHUMT00000466997.1		0.00	34	0	C			47969259	-1			no_errors	ENST00000236877	ensembl	human	known	74_37	missense	5.41	34	2	SNP	1.000	A
SLFN11	91607	genome.wustl.edu	37	17	33690498	33690498	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:33690498C>A	ENST00000394566.1	-	4	601	c.329G>T	c.(328-330)tGg>tTg	p.W110L	SLFN11_ENST00000308377.4_Missense_Mutation_p.W110L	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	110					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GCCACTGCTCCAAGATTTAAC	0.453																																																	0													65.0	63.0	64.0					17																	33690498		2203	4300	6503	SO:0001583	missense	0			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.329G>T	17.37:g.33690498C>A	ENSP00000378067:p.Trp110Leu		E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075,superfamily_P-loop_NTPase	p.W110L	ENST00000394566.1	37	c.329	CCDS11294.1	17	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030687	0.54790	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	T;T	0.02763	4.17;4.17	4.18	4.18	0.49190	.	0.000000	0.36374	N	0.002635	T	0.15652	0.0377	M	0.85197	2.74	0.32351	N	0.558492	D	0.89917	1.0	D	0.87578	0.998	T	0.04885	-1.0920	10	0.66056	D	0.02	.	11.8833	0.52587	0.0:1.0:0.0:0.0	.	110	Q7Z7L1	SLN11_HUMAN	L	110	ENSP00000312402:W110L;ENSP00000378067:W110L	ENSP00000312402:W110L	W	-	2	0	SLFN11	30714611	1.000000	0.71417	0.863000	0.33907	0.392000	0.30506	4.934000	0.63491	2.170000	0.68504	0.655000	0.94253	TGG	SLFN11	-	NULL	ENSG00000172716		0.453	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN11	HGNC	protein_coding	OTTHUMT00000256480.1	-	0.00	50	0	C	NM_152270		33690498	-1	tier1	-	no_errors	ENST00000308377	ensembl	human	known	74_37	missense	14.29	48	8	SNP	0.995	A
SLITRK4	139065	genome.wustl.edu	37	X	142718475	142718475	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:142718475G>T	ENST00000381779.4	-	2	675	c.450C>A	c.(448-450)gcC>gcA	p.A150A	SLITRK4_ENST00000356928.1_Silent_p.A150A|SLITRK4_ENST00000338017.4_Silent_p.A150A	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	150						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GCTTATTGAAGGCTCCTCGTT	0.383																																																	0													82.0	82.0	82.0					X																	142718475		2203	4300	6503	SO:0001819	synonymous_variant	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.450C>A	X.37:g.142718475G>T			Q5JXG3|Q8TCM8|Q96DL3	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.A150	ENST00000381779.4	37	c.450	CCDS14679.1	X																																																																																			SLITRK4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000179542		0.383	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	-	0.00	65	0	G	NM_173078		142718475	-1	tier1	-	no_errors	ENST00000338017	ensembl	human	known	74_37	silent	11.48	54	7	SNP	1.000	T
SLX4	84464	genome.wustl.edu	37	16	3640930	3640930	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:3640930C>A	ENST00000294008.3	-	12	3349	c.2709G>T	c.(2707-2709)gtG>gtT	p.V903V		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	903	Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CCATCTCCTCCACCTTGTCCC	0.652								Direct reversal of damage																																									0													85.0	85.0	85.0					16																	3640930		2197	4300	6497	SO:0001819	synonymous_variant	0			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2709G>T	16.37:g.3640930C>A			Q69YT8|Q8TF15|Q96JP1	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.V903	ENST00000294008.3	37	c.2709	CCDS10506.2	16																																																																																			SLX4	-	NULL	ENSG00000188827		0.652	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	-	0.00	89	0	C	NM_032444		3640930	-1	tier1	-	no_errors	ENST00000294008	ensembl	human	known	74_37	silent	11.82	97	13	SNP	0.001	A
SOWAHB	345079	genome.wustl.edu	37	4	77816952	77816952	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:77816952C>A	ENST00000334306.2	-	1	2050	c.2051G>T	c.(2050-2052)gGg>gTg	p.G684V		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	684																	TTTGATGACCCCCTGGTGGCC	0.522																																																	0													185.0	192.0	189.0					4																	77816952		2203	4300	6503	SO:0001583	missense	0				CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.2051G>T	4.37:g.77816952C>A	ENSP00000334879:p.Gly684Val		B2RP29	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G684V	ENST00000334306.2	37	c.2051	CCDS34017.1	4	.	.	.	.	.	.	.	.	.	.	C	11.08	1.534065	0.27475	.	.	ENSG00000186212	ENST00000334306	T	0.64438	-0.1	5.5	2.64	0.31445	Ankyrin repeat-containing domain (4);	0.570589	0.16028	U	0.232993	T	0.60077	0.2241	L	0.45137	1.4	0.21184	N	0.999768	D	0.61080	0.989	P	0.54544	0.755	T	0.47824	-0.9087	10	0.33940	T	0.23	-6.777	5.3798	0.16186	0.1549:0.4211:0.3506:0.0735	.	684	A6NEL2	ANR56_HUMAN	V	684	ENSP00000334879:G684V	ENSP00000334879:G684V	G	-	2	0	ANKRD56	78035976	0.000000	0.05858	0.570000	0.28473	0.615000	0.37417	-0.022000	0.12480	0.292000	0.22492	-0.165000	0.13383	GGG	SOWAHB	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000186212		0.522	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOWAHB	HGNC	protein_coding	OTTHUMT00000362762.1		0.00	43	0	C	NM_001029870		77816952	-1			no_errors	ENST00000334306	ensembl	human	known	74_37	missense	11.32	47	6	SNP	0.012	A
SPAG5	10615	genome.wustl.edu	37	17	26925829	26925829	+	Intron	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:26925829C>A	ENST00000321765.5	-	1	384				SPAG5-AS1_ENST00000414744.1_RNA|SPAG5-AS1_ENST00000554154.1_RNA|SPAG5-AS1_ENST00000556050.1_RNA	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5						chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CGGGCTCGACCCAACTTTCCA	0.632																																																	0																																										SO:0001627	intron_variant	0			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.51+84G>T	17.37:g.26925829C>A			O95213|Q9BWE8|Q9NT17|Q9UFE6	RNA	SNP	-	NULL	ENST00000321765.5	37	NULL	CCDS32594.1	17																																																																																			SPAG5-AS1	-	-	ENSG00000227543		0.632	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG5-AS1	HGNC	protein_coding	OTTHUMT00000390564.2	-	0.00	146	0	C	NM_006461		26925829	+1	tier1	-	no_errors	ENST00000414744	ensembl	human	known	74_37	rna	6.98	160	12	SNP	0.002	A
SPATA31D1	389763	genome.wustl.edu	37	9	84609130	84609130	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:84609130A>T	ENST00000344803.2	+	4	3792	c.3745A>T	c.(3745-3747)Atg>Ttg	p.M1249L		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1249					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAGTGGGGACATGGGAACTTC	0.522																																																	0													178.0	171.0	173.0					9																	84609130		1988	4177	6165	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3745A>T	9.37:g.84609130A>T	ENSP00000341988:p.Met1249Leu			Missense_Mutation	SNP	NULL	p.M1249L	ENST00000344803.2	37	c.3745	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	A	11.18	1.563316	0.27915	.	.	ENSG00000214929	ENST00000344803	T	0.06687	3.27	3.26	-3.88	0.04205	.	.	.	.	.	T	0.04861	0.0131	L	0.27053	0.805	0.09310	N	1	B	0.16603	0.018	B	0.10450	0.005	T	0.41395	-0.9511	9	0.31617	T	0.26	-1.075	4.9734	0.14127	0.2645:0.3835:0.352:0.0	.	1249	Q6ZQQ2	F75D1_HUMAN	L	1249	ENSP00000341988:M1249L	ENSP00000341988:M1249L	M	+	1	0	FAM75D1	83798950	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.035000	0.13797	-0.822000	0.04306	-0.331000	0.08364	ATG	SPATA31D1	-	NULL	ENSG00000214929		0.522	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	97	0	A	NM_001001670		84609130	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	5.08	112	6	SNP	0.000	T
SPATA31D1	389763	genome.wustl.edu	37	9	84610013	84610013	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:84610013C>A	ENST00000344803.2	+	4	4675	c.4628C>A	c.(4627-4629)cCa>cAa	p.P1543Q		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1543					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCAGCCGTCCCAACCAGTGCT	0.527																																																	0													21.0	23.0	22.0					9																	84610013		2101	4234	6335	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.4628C>A	9.37:g.84610013C>A	ENSP00000341988:p.Pro1543Gln			Missense_Mutation	SNP	NULL	p.P1543Q	ENST00000344803.2	37	c.4628	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	10.17	1.276950	0.23307	.	.	ENSG00000214929	ENST00000344803	T	0.08282	3.11	1.97	-3.95	0.04118	.	.	.	.	.	T	0.07773	0.0195	N	0.14661	0.345	0.09310	N	1	P	0.41041	0.736	P	0.50708	0.648	T	0.31641	-0.9936	9	0.54805	T	0.06	-0.5881	7.4109	0.27017	0.0:0.3308:0.0:0.6692	.	1543	Q6ZQQ2	F75D1_HUMAN	Q	1543	ENSP00000341988:P1543Q	ENSP00000341988:P1543Q	P	+	2	0	FAM75D1	83799833	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.235000	0.02928	-1.208000	0.02634	-0.755000	0.03482	CCA	SPATA31D1	-	NULL	ENSG00000214929		0.527	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	75	0	C	NM_001001670		84610013	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	12.99	67	10	SNP	0.000	A
SPESP1	246777	genome.wustl.edu	37	15	69238242	69238242	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:69238242G>T	ENST00000310673.3	+	2	523	c.369G>T	c.(367-369)tcG>tcT	p.S123S	NOX5_ENST00000448182.3_Intron|NOX5_ENST00000455873.3_Intron|NOX5_ENST00000260364.5_Intron|RP11-809H16.2_ENST00000557966.1_RNA|SPESP1_ENST00000560188.1_3'UTR	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	123					acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						CATTCTGGTCGATCAAACCAA	0.433																																																	0													56.0	57.0	56.0					15																	69238242		2200	4298	6498	SO:0001819	synonymous_variant	0			AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.369G>T	15.37:g.69238242G>T			Q8NG22|Q8WVH8	Silent	SNP	NULL	p.S123	ENST00000310673.3	37	c.369	CCDS10230.1	15																																																																																			SPESP1	-	NULL	ENSG00000258484		0.433	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPESP1	HGNC	protein_coding	OTTHUMT00000257125.1		0.00	24	0	G	NM_145658		69238242	+1			no_errors	ENST00000310673	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.007	T
SPTBN1	6711	genome.wustl.edu	37	2	54880793	54880793	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:54880793G>T	ENST00000356805.4	+	27	5906	c.5625G>T	c.(5623-5625)gcG>gcT	p.A1875A	SPTBN1_ENST00000333896.5_Silent_p.A1862A	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1875	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CGGCCTATGCGGGTGACAAGG	0.662																																																	0													38.0	42.0	40.0					2																	54880793		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.5625G>T	2.37:g.54880793G>T			B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.A1875	ENST00000356805.4	37	c.5625	CCDS33198.1	2																																																																																			SPTBN1	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000115306		0.662	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	HGNC	protein_coding	OTTHUMT00000258115.3		0.00	64	0	G			54880793	+1			no_errors	ENST00000356805	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.001	T
SPHKAP	80309	genome.wustl.edu	37	2	228883671	228883671	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:228883671G>T	ENST00000392056.3	-	7	1945	c.1899C>A	c.(1897-1899)taC>taA	p.Y633*	SPHKAP_ENST00000344657.5_Nonsense_Mutation_p.Y633*	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	633						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CAATGCTGCTGTAGGTATTAG	0.483																																																	0													70.0	68.0	69.0					2																	228883671		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1899C>A	2.37:g.228883671G>T	ENSP00000375909:p.Tyr633*		Q68DA3|Q68DR8|Q9C0I5	Nonsense_Mutation	SNP	pfam_AKAP_110_C	p.Y633*	ENST00000392056.3	37	c.1899	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	17.72	3.460185	0.63401	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	.	.	.	5.54	0.586	0.17434	.	0.238578	0.44285	D	0.000478	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6325	0.45545	0.3333:0.0:0.6667:0.0	.	.	.	.	X	633	.	ENSP00000339886:Y633X	Y	-	3	2	SPHKAP	228591915	1.000000	0.71417	0.005000	0.12908	0.061000	0.15899	2.430000	0.44766	0.105000	0.17753	0.655000	0.94253	TAC	SPHKAP	-	NULL	ENSG00000153820		0.483	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	-	0.00	53	0	G	NM_030623		228883671	-1	tier1	-	no_errors	ENST00000392056	ensembl	human	known	74_37	nonsense	9.09	50	5	SNP	0.928	T
SSH2	85464	genome.wustl.edu	37	17	28003885	28003885	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:28003885C>T	ENST00000269033.3	-	7	637	c.486G>A	c.(484-486)acG>acA	p.T162T	SSH2_ENST00000540801.1_Silent_p.T189T|SSH2_ENST00000324677.7_5'UTR|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	162					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTCTGTTATCCGTCGATACAC	0.363																																																	0													112.0	107.0	109.0					17																	28003885		2203	4300	6503	SO:0001819	synonymous_variant	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.486G>A	17.37:g.28003885C>T			Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.T162	ENST00000269033.3	37	c.486	CCDS11253.1	17																																																																																			SSH2	-	NULL	ENSG00000141298		0.363	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	-	0.00	26	0	C	NM_033389		28003885	-1	tier1	-	no_errors	ENST00000269033	ensembl	human	known	74_37	silent	13.43	58	9	SNP	0.918	T
SSPO	23145	genome.wustl.edu	37	7	149500089	149500089	+	RNA	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:149500089G>C	ENST00000378016.2	+	0	7715							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTCTCCTGCGGGGGTGGCCAT	0.697																																																	0													10.0	14.0	13.0					7																	149500089		2159	4260	6419			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149500089G>C			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.697	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	27	0	G			149500089	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	14.71	29	5	SNP	1.000	C
SSPO	23145	genome.wustl.edu	37	7	149500813	149500813	+	RNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:149500813G>T	ENST00000378016.2	+	0	8131							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCAACCAGGGGGCTGCCCCCT	0.692																																																	0													14.0	18.0	17.0					7																	149500813		2069	4191	6260			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149500813G>T			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.692	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	106	0	G			149500813	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	6.30	119	8	SNP	0.295	T
SSPO	23145	genome.wustl.edu	37	7	149511966	149511966	+	RNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:149511966G>T	ENST00000378016.2	+	0	10516							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCCTGAGGGAGGGAGGCCCTG	0.692																																																	0													7.0	10.0	9.0					7																	149511966		2066	4120	6186			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149511966G>T			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.692	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	34	0	G			149511966	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	11.11	48	6	SNP	1.000	T
ST3GAL2	6483	genome.wustl.edu	37	16	70428966	70428966	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:70428966C>G	ENST00000393640.4	-	2	2559	c.452G>C	c.(451-453)cGc>cCc	p.R151P	RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000342907.2_Missense_Mutation_p.R151P			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	151					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				CACGGCACAGCGCCGGCACTG	0.632																																																	0													93.0	102.0	99.0					16																	70428966		2198	4300	6498	SO:0001583	missense	0			U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.452G>C	16.37:g.70428966C>G	ENSP00000377257:p.Arg151Pro		O00654	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.R151P	ENST00000393640.4	37	c.452	CCDS10890.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.604681	0.96626	.	.	ENSG00000157350	ENST00000342907;ENST00000393640	T;T	0.35973	1.28;1.28	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.65954	0.2741	M	0.85299	2.745	0.80722	D	1	D	0.71674	0.998	D	0.65874	0.939	T	0.68697	-0.5340	10	0.72032	D	0.01	0.0222	20.1896	0.98226	0.0:1.0:0.0:0.0	.	151	Q16842	SIA4B_HUMAN	P	151	ENSP00000345477:R151P;ENSP00000377257:R151P	ENSP00000345477:R151P	R	-	2	0	ST3GAL2	68986467	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.001000	0.70685	2.873000	0.98535	0.561000	0.74099	CGC	ST3GAL2	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000157350		0.632	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL2	HGNC	protein_coding	OTTHUMT00000268968.1	-	0.00	56	0	C	NM_006927		70428966	-1	tier1	-	no_errors	ENST00000342907	ensembl	human	known	74_37	missense	7.59	73	6	SNP	1.000	G
STAG3	10734	genome.wustl.edu	37	7	99811735	99811735	+	3'UTR	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:99811735C>A	ENST00000426455.1	+	0	4182				GATS_ENST00000543273.1_RNA|STAG3_ENST00000394018.2_3'UTR|STAG3_ENST00000317296.5_3'UTR|GATS_ENST00000436886.2_Intron|STAG3_ENST00000440830.1_3'UTR	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGCATTCCCCCAGGCTTCAGC	0.537																																																	0													19.0	16.0	17.0					7																	99811735		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.*97C>A	7.37:g.99811735C>A			A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	RNA	SNP	-	NULL	ENST00000426455.1	37	NULL	CCDS34703.1	7																																																																																			STAG3	-	-	ENSG00000066923		0.537	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	HGNC	protein_coding	OTTHUMT00000338734.2	-	0.00	36	0	C	NM_012447		99811735	+1	tier1	-	no_errors	ENST00000440830	ensembl	human	known	74_37	rna	14.00	43	7	SNP	0.000	A
STK32B	55351	genome.wustl.edu	37	4	5448434	5448434	+	Silent	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:5448434C>G	ENST00000282908.5	+	7	1019	c.597C>G	c.(595-597)ggC>ggG	p.G199G	STK32B_ENST00000508728.1_3'UTR|STK32B_ENST00000510398.1_Silent_p.G152G|STK32B_ENST00000512636.1_Silent_p.G122G	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						TGGACAGAGGCCCCGGATACT	0.567																																																	0													90.0	82.0	85.0					4																	5448434		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.597C>G	4.37:g.5448434C>G				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G199	ENST00000282908.5	37	c.597	CCDS3380.1	4																																																																																			STK32B	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000152953		0.567	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32B	HGNC	protein_coding	OTTHUMT00000206854.4	-	0.00	80	0	C	NM_018401		5448434	+1	tier1	-	no_errors	ENST00000282908	ensembl	human	known	74_37	silent	12.86	61	9	SNP	1.000	G
STOML3	161003	genome.wustl.edu	37	13	39550710	39550710	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:39550710C>A	ENST00000379631.4	-	3	540	c.196G>T	c.(196-198)Gga>Tga	p.G66*	STOML3_ENST00000423210.1_Nonsense_Mutation_p.G57*	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	66					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		TGGATGCGTCCCAGACGGAAT	0.483																																																	0													105.0	93.0	97.0					13																	39550710		2203	4300	6503	SO:0001587	stop_gained	0			BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.196G>T	13.37:g.39550710C>A	ENSP00000368952:p.Gly66*		B4E285|Q5JS35	Nonsense_Mutation	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.G66*	ENST00000379631.4	37	c.196	CCDS9367.1	13	.	.	.	.	.	.	.	.	.	.	C	40	8.501208	0.98838	.	.	ENSG00000133115	ENST00000379631;ENST00000423210	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.2482	18.7652	0.91869	0.0:1.0:0.0:0.0	.	.	.	.	X	66;57	.	ENSP00000368952:G66X	G	-	1	0	STOML3	38448710	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.306000	0.78905	2.763000	0.94921	0.655000	0.94253	GGA	STOML3	-	pfam_Band_7,smart_Band_7,prints_Stomatin	ENSG00000133115		0.483	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STOML3	HGNC	protein_coding	OTTHUMT00000044604.2	-	0.00	107	0	C			39550710	-1	tier1	-	no_errors	ENST00000379631	ensembl	human	known	74_37	nonsense	18.60	105	24	SNP	1.000	A
SULF2	55959	genome.wustl.edu	37	20	46313304	46313304	+	Silent	SNP	C	C	A	rs536732621		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:46313304C>A	ENST00000359930.4	-	6	1610	c.759G>T	c.(757-759)gcG>gcT	p.A253A	CTD-2653D5.1_ENST00000526566.2_RNA|SULF2_ENST00000361612.4_Silent_p.A253A|SULF2_ENST00000484875.1_Silent_p.A253A|SULF2_ENST00000467815.1_Silent_p.A253A	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	253					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						CCGGGTTGGGCGCGTAGTTGT	0.632																																																	0													159.0	109.0	126.0					20																	46313304		2203	4300	6503	SO:0001819	synonymous_variant	0			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.759G>T	20.37:g.46313304C>A			E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Silent	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.A253	ENST00000359930.4	37	c.759	CCDS13408.1	20																																																																																			SULF2	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000196562		0.632	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULF2	HGNC	protein_coding	OTTHUMT00000079606.1	-	0.00	60	0	C	NM_018837		46313304	-1	tier1	-	no_errors	ENST00000359930	ensembl	human	known	74_37	silent	5.43	87	5	SNP	0.961	A
SVEP1	79987	genome.wustl.edu	37	9	113308490	113308490	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:113308490C>T	ENST00000401783.2	-	3	1205	c.869G>A	c.(868-870)cGa>cAa	p.R290Q	SVEP1_ENST00000374469.1_Missense_Mutation_p.R267Q|SVEP1_ENST00000374461.1_Missense_Mutation_p.R267Q|SVEP1_ENST00000302728.8_Missense_Mutation_p.R290Q|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	290					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GCTTCCCATTCGGTCACAGCA	0.443																																																	0													85.0	80.0	82.0					9																	113308490		1968	4152	6120	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.869G>A	9.37:g.113308490C>T	ENSP00000384917:p.Arg290Gln		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Growth_fac_rcpt_N_dom,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.R290Q	ENST00000401783.2	37	c.869	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663121	0.29515	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36	6.04	0.484	0.16825	Growth factor, receptor (1);	0.470071	0.21700	N	0.070425	D	0.90786	0.7107	L	0.29908	0.895	0.24203	N	0.995508	B;B;B	0.13594	0.0;0.0;0.008	B;B;B	0.06405	0.0;0.0;0.002	T	0.79017	-0.1975	10	0.14252	T	0.57	.	4.3987	0.11376	0.301:0.336:0.0:0.363	.	290;290;290	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	Q	290;267;290;267	ENSP00000384917:R290Q;ENSP00000363593:R267Q;ENSP00000304118:R290Q;ENSP00000363585:R267Q	ENSP00000304118:R290Q	R	-	2	0	SVEP1	112348311	0.993000	0.37304	0.989000	0.46669	0.888000	0.51559	0.795000	0.26972	0.135000	0.18707	-0.244000	0.11960	CGA	SVEP1	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000165124		0.443	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		-	0.00	80	0	C			113308490	-1	tier1	-	no_errors	ENST00000401783	ensembl	human	known	74_37	missense	21.84	68	19	SNP	0.993	T
SYNE1	23345	genome.wustl.edu	37	6	152675824	152675824	+	Silent	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:152675824T>C	ENST00000367255.5	-	67	11497	c.10896A>G	c.(10894-10896)gcA>gcG	p.A3632A	SYNE1_ENST00000423061.1_Intron|SYNE1_ENST00000448038.1_Intron|SYNE1_ENST00000265368.4_Silent_p.A3632A|SYNE1_ENST00000341594.5_Silent_p.A3603A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3632					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTCCTTGGTTGCCCTGTTAG	0.403										HNSCC(10;0.0054)																																							0													261.0	229.0	240.0					6																	152675824		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10896A>G	6.37:g.152675824T>C			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A3632	ENST00000367255.5	37	c.10896	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.403	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	65	0	T	NM_182961		152675824	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	silent	6.59	85	6	SNP	0.097	C
SYNJ1	8867	genome.wustl.edu	37	21	34003657	34003657	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr21:34003657G>C	ENST00000322229.7	-	31	4369	c.4370C>G	c.(4369-4371)tCa>tGa	p.S1457*	SYNJ1_ENST00000357345.3_3'UTR|SYNJ1_ENST00000433931.2_Nonsense_Mutation_p.S1496*|SYNJ1_ENST00000382491.3_Nonsense_Mutation_p.S1410*|SYNJ1_ENST00000382499.2_3'UTR			O43426	SYNJ1_HUMAN	synaptojanin 1	1457	Pro-rich.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GCCATCAAGTGAAGATGAAGC	0.443																																																	0													86.0	88.0	88.0					21																	34003657		2203	4300	6503	SO:0001587	stop_gained	0			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.4370C>G	21.37:g.34003657G>C	ENSP00000322234:p.Ser1457*		O43425|O94984|Q4KMR1	Nonsense_Mutation	SNP	pfam_Syja_N,pfam_Endo/exonuclease/phosphatase,pfam_DUF1866,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.S1496*	ENST00000322229.7	37	c.4487	CCDS54484.1	21	.	.	.	.	.	.	.	.	.	.	G	40	8.480515	0.98829	.	.	ENSG00000159082	ENST00000382491;ENST00000433931;ENST00000322229	.	.	.	5.25	4.36	0.52297	.	0.258282	0.27636	N	0.018493	.	.	.	.	.	.	0.50313	D	0.999865	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	14.0016	0.64437	0.0734:0.0:0.9266:0.0	.	.	.	.	X	1410;1496;1457	.	ENSP00000322234:S1457X	S	-	2	0	SYNJ1	32925528	0.659000	0.27411	0.006000	0.13384	0.440000	0.31957	1.883000	0.39658	1.327000	0.45338	0.655000	0.94253	TCA	SYNJ1	-	NULL	ENSG00000159082		0.443	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	HGNC	protein_coding		-	0.00	95	0	G			34003657	-1	tier1	-	no_errors	ENST00000433931	ensembl	human	known	74_37	nonsense	5.26	90	5	SNP	0.021	C
SYT9	143425	genome.wustl.edu	37	11	7324558	7324558	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:7324558A>T	ENST00000318881.6	+	2	671	c.434A>T	c.(433-435)cAg>cTg	p.Q145L	SYT9_ENST00000396716.2_Missense_Mutation_p.Q113L	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	145					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ACGGGGATCCAGGAGAACTGT	0.602																																																	0													61.0	50.0	54.0					11																	7324558		2201	4296	6497	SO:0001583	missense	0			AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.434A>T	11.37:g.7324558A>T	ENSP00000324419:p.Gln145Leu			Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.Q145L	ENST00000318881.6	37	c.434	CCDS7778.1	11	.	.	.	.	.	.	.	.	.	.	A	11.05	1.525830	0.27299	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	T;T	0.56611	0.45;0.51	5.73	2.11	0.27256	.	0.168649	0.41605	D	0.000854	T	0.40423	0.1116	L	0.46157	1.445	0.42947	D	0.994363	B	0.09022	0.002	B	0.09377	0.004	T	0.17349	-1.0372	10	0.46703	T	0.11	.	5.8316	0.18584	0.7074:0.141:0.1516:0.0	.	145	Q86SS6	SYT9_HUMAN	L	113;145	ENSP00000379944:Q113L;ENSP00000324419:Q145L	ENSP00000324419:Q145L	Q	+	2	0	SYT9	7281134	0.989000	0.36119	0.781000	0.31783	0.176000	0.22953	2.249000	0.43169	0.101000	0.17610	0.533000	0.62120	CAG	SYT9	-	NULL	ENSG00000170743		0.602	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT9	HGNC	protein_coding	OTTHUMT00000384483.1	-	0.00	58	0	A	NM_175733		7324558	+1	tier1	-	no_errors	ENST00000318881	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.908	T
TAB1	10454	genome.wustl.edu	37	22	39815583	39815583	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr22:39815583C>T	ENST00000216160.6	+	7	786	c.724C>T	c.(724-726)Cgg>Tgg	p.R242W	TAB1_ENST00000331454.3_Missense_Mutation_p.R242W	NM_006116.2	NP_006107.1	Q15750	TAB1_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 1	242	PP2C-like.				activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart morphogenesis (GO:0003007)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lung development (GO:0030324)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|protein complex (GO:0043234)	catalytic activity (GO:0003824)|enzyme activator activity (GO:0008047)|kinase activator activity (GO:0019209)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|urinary_tract(1)	14						GAGCACCCGGCGGATCGGGGA	0.537																																																	0													132.0	121.0	125.0					22																	39815583		2203	4300	6503	SO:0001583	missense	0			U49928	CCDS13992.1, CCDS13993.1	22q13.1	2010-02-05	2010-02-05	2010-02-05	ENSG00000100324	ENSG00000100324			18157	protein-coding gene	gene with protein product	"""TAK1-binding protein 1"", ""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	602615	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	MAP3K7IP1		8638164, 10187861	Standard	NM_153497		Approved		uc003axt.3	Q15750	OTTHUMG00000151102	ENST00000216160.6:c.724C>T	22.37:g.39815583C>T	ENSP00000216160:p.Arg242Trp		Q2PP09|Q8IZW2	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.R242W	ENST00000216160.6	37	c.724	CCDS13993.1	22	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013465	0.75161	.	.	ENSG00000100324	ENST00000216160;ENST00000331454	T;T	0.17691	2.26;2.26	4.83	4.83	0.62350	Protein phosphatase 2C-like (4);	0.060807	0.64402	D	0.000008	T	0.35278	0.0926	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.986;0.993;0.999	T	0.02942	-1.1091	10	0.87932	D	0	-12.0128	13.4475	0.61148	0.1566:0.8434:0.0:0.0	.	242;242;386	Q15750-2;Q15750;Q59FT7	.;TAB1_HUMAN;.	W	242	ENSP00000216160:R242W;ENSP00000333049:R242W	ENSP00000216160:R242W	R	+	1	2	TAB1	38145529	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.740000	0.47418	2.655000	0.90218	0.655000	0.94253	CGG	TAB1	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000100324		0.537	TAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB1	HGNC	protein_coding	OTTHUMT00000321313.1	-	0.00	82	0	C	NM_153497		39815583	+1	tier1	-	no_errors	ENST00000216160	ensembl	human	known	74_37	missense	10.39	69	8	SNP	1.000	T
TAPBPL	55080	genome.wustl.edu	37	12	6571229	6571229	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:6571229G>A	ENST00000266556.7	+	7	1486	c.1321G>A	c.(1321-1323)Gaa>Aaa	p.E441K	TAPBPL_ENST00000545700.1_3'UTR|VAMP1_ENST00000544432.1_5'Flank	NM_018009.4	NP_060479.3	Q9BX59	TPSNR_HUMAN	TAP binding protein-like	441					negative regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002590)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			endometrium(2)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	6						GCTTCAGGCTGAACGCTGGGA	0.562																																																	0													102.0	83.0	90.0					12																	6571229		2203	4300	6503	SO:0001583	missense	0			AK001005	CCDS8546.1	12p13.31	2013-01-11						"""Immunoglobulin superfamily / C1-set domain containing"""	30683	protein-coding gene	gene with protein product		607081				11920573	Standard	NM_018009		Approved	TAPBP-R, FLJ10143, TAPBPR	uc001qog.4	Q9BX59		ENST00000266556.7:c.1321G>A	12.37:g.6571229G>A	ENSP00000266556:p.Glu441Lys		Q9NWB8	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_C1-set,pfscan_Ig-like_dom	p.E441K	ENST00000266556.7	37	c.1321	CCDS8546.1	12	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056642	0.36277	.	.	ENSG00000139192	ENST00000266556	T	0.09445	2.98	4.35	-0.725	0.11174	.	3.179800	0.00792	N	0.001340	T	0.07638	0.0192	N	0.22421	0.69	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.29119	-1.0022	10	0.25751	T	0.34	5.332	4.2207	0.10556	0.151:0.0:0.5154:0.3336	.	441	Q9BX59	TPSNR_HUMAN	K	441	ENSP00000266556:E441K	ENSP00000266556:E441K	E	+	1	0	TAPBPL	6441490	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.521000	0.02239	-0.270000	0.09285	-0.181000	0.13052	GAA	TAPBPL	-	NULL	ENSG00000139192		0.562	TAPBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAPBPL	HGNC	protein_coding	OTTHUMT00000399263.1	-	0.00	60	0	G	NM_018009		6571229	+1	tier1	-	no_errors	ENST00000266556	ensembl	human	known	74_37	missense	10.94	57	7	SNP	0.000	A
TARBP1	6894	genome.wustl.edu	37	1	234534271	234534271	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:234534271G>A	ENST00000040877.1	-	26	4099	c.4100C>T	c.(4099-4101)tCa>tTa	p.S1367L	TARBP1_ENST00000483404.1_Intron	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1367					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AATAAGGCCTGAAAGGCGTGG	0.323																																																	0													70.0	72.0	71.0					1																	234534271		2203	4300	6503	SO:0001583	missense	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4100C>T	1.37:g.234534271G>A	ENSP00000040877:p.Ser1367Leu		Q9H581	Missense_Mutation	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.S1367L	ENST00000040877.1	37	c.4100	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172919	0.78452	.	.	ENSG00000059588	ENST00000040877	T	0.07908	3.15	5.85	5.85	0.93711	.	0.142516	0.49305	D	0.000151	T	0.18425	0.0442	M	0.75447	2.3	0.58432	D	0.999998	P	0.37015	0.578	B	0.40199	0.322	T	0.00422	-1.1749	10	0.49607	T	0.09	-0.3757	20.1589	0.98128	0.0:0.0:1.0:0.0	.	1367	Q13395	TARB1_HUMAN	L	1367	ENSP00000040877:S1367L	ENSP00000040877:S1367L	S	-	2	0	TARBP1	232600894	1.000000	0.71417	0.033000	0.17914	0.971000	0.66376	8.613000	0.90913	2.769000	0.95229	0.650000	0.86243	TCA	TARBP1	-	NULL	ENSG00000059588		0.323	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	-	0.00	43	0	G	NM_005646		234534271	-1	tier1	-	no_errors	ENST00000040877	ensembl	human	novel	74_37	missense	10.14	62	7	SNP	0.757	A
TARM1	441864	genome.wustl.edu	37	19	54577262	54577262	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:54577262C>T	ENST00000432826.1	-	4	592	c.568G>A	c.(568-570)Gat>Aat	p.D190N	TARM1_ENST00000446034.2_Missense_Mutation_p.D198N	NM_001135686.1	NP_001129158.2	B6A8C7	TARM1_HUMAN	T cell-interacting, activating receptor on myeloid cells 1	190	Ig-like C2-type 2.					integral component of membrane (GO:0016021)				endometrium(1)|stomach(2)	3						TTCCCAGCATCGCCGGCTGTC	0.557																																																	0													114.0	111.0	112.0					19																	54577262		692	1591	2283	SO:0001583	missense	0				CCDS46173.1	19q13.42	2013-01-29			ENSG00000248385	ENSG00000248385		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	37250	protein-coding gene	gene with protein product							Standard	XM_005258952		Approved		uc010yei.1	B6A8C7		ENST00000432826.1:c.568G>A	19.37:g.54577262C>T	ENSP00000439454:p.Asp190Asn		B4DWY4	Missense_Mutation	SNP	smart_Ig_sub	p.D190N	ENST00000432826.1	37	c.568	CCDS46173.1	19	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987364	0.53934	.	.	ENSG00000248385	ENST00000432826;ENST00000446034	T;T	0.01145	5.27;5.27	4.01	2.97	0.34412	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.05090	0.0136	M	0.69823	2.125	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.25950	-1.0117	9	0.52906	T	0.07	.	8.0639	0.30648	0.0:0.8884:0.0:0.1116	.	190	B6A8C7	TARM1_HUMAN	N	190;198	ENSP00000439454:D190N;ENSP00000441055:D198N	ENSP00000439454:D190N	D	-	1	0	TARM1	59269074	0.005000	0.15991	0.005000	0.12908	0.001000	0.01503	0.755000	0.26405	1.059000	0.40554	-0.177000	0.13119	GAT	TARM1	-	smart_Ig_sub	ENSG00000248385		0.557	TARM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TARM1	HGNC	protein_coding	OTTHUMT00000465679.1	-	0.00	77	0	C	NM_001135686		54577262	-1	tier1	-	no_errors	ENST00000432826	ensembl	human	known	74_37	missense	11.43	62	8	SNP	0.007	T
TARSL2	123283	genome.wustl.edu	37	15	102215856	102215856	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:102215856T>C	ENST00000335968.3	-	13	1951	c.1735A>G	c.(1735-1737)Aca>Gca	p.T579A		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	579					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCCGGCCTTGTTGACAGGTTT	0.398																																																	0													145.0	137.0	140.0					15																	102215856		2203	4300	6503	SO:0001583	missense	0			AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1735A>G	15.37:g.102215856T>C	ENSP00000338093:p.Thr579Ala		B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-ligase_IIa,tigrfam_Thr-tRNA-ligase_IIa	p.T579A	ENST00000335968.3	37	c.1735	CCDS10394.1	15	.	.	.	.	.	.	.	.	.	.	T	24.7	4.556504	0.86231	.	.	ENSG00000185418	ENST00000335968;ENST00000333018;ENST00000539112	T;T	0.68479	-0.33;-0.33	5.28	5.28	0.74379	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.89969	0.6869	H	0.99806	4.795	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.971	D	0.93830	0.7127	10	0.87932	D	0	-16.4343	13.1642	0.59560	0.0:0.0:0.0:1.0	.	579;484	A2RTX5;A2RTX5-2	SYTC2_HUMAN;.	A	579;484;579	ENSP00000338093:T579A;ENSP00000439899:T579A	ENSP00000329291:T484A	T	-	1	0	TARSL2	100033379	1.000000	0.71417	0.967000	0.41034	0.977000	0.68977	7.824000	0.86668	1.996000	0.58369	0.482000	0.46254	ACA	TARSL2	-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	ENSG00000185418		0.398	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARSL2	HGNC	protein_coding	OTTHUMT00000313619.3	-	0.00	86	0	T	NM_152334		102215856	-1	tier1	-	no_errors	ENST00000335968	ensembl	human	known	74_37	missense	7.08	105	8	SNP	1.000	C
TBC1D2	55357	genome.wustl.edu	37	9	100975482	100975482	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:100975482G>T	ENST00000375064.1	-	7	1431	c.1393C>A	c.(1393-1395)Cgg>Agg	p.R465R	TBC1D2_ENST00000493589.2_Intron|TBC1D2_ENST00000342112.5_Silent_p.R247R|TBC1D2_ENST00000375066.5_Silent_p.R465R|TBC1D2_ENST00000375063.1_Silent_p.R5R	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	465					positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TTCTGGGTCCGGTAAGCTTCC	0.522																																																	0													109.0	99.0	102.0					9																	100975482		2203	4300	6503	SO:0001819	synonymous_variant	0			AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.1393C>A	9.37:g.100975482G>T			B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.R465	ENST00000375064.1	37	c.1393		9																																																																																			TBC1D2	-	NULL	ENSG00000095383		0.522	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	TBC1D2	HGNC	protein_coding	OTTHUMT00000053366.1	-	0.00	81	0	G	NM_018421		100975482	-1	tier1	-	no_errors	ENST00000375066	ensembl	human	known	74_37	silent	5.56	68	4	SNP	1.000	T
TCL6	27004	genome.wustl.edu	37	14	96134723	96134723	+	RNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:96134723C>A	ENST00000467865.1	+	0	1821				RP11-1070N10.6_ENST00000461160.1_RNA					T-cell leukemia/lymphoma 6 (non-protein coding)											large_intestine(1)|lung(7)	8		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		AAAACAGGCCCTTCTTTTCTC	0.507			T	TRA@	T-ALL																																			Dom	yes		14	14q32.1	27004	T-cell leukemia/lymphoma 6		L	0													76.0	71.0	73.0					14																	96134723		2203	4300	6503			0			AB035338		14q32.1	2012-10-16	2010-06-01		ENSG00000187621	ENSG00000187621		"""Long non-coding RNAs"""	13463	non-coding RNA	RNA, long non-coding		604412	"""T-cell leukemia/lymphoma 6"""			10588720, 10851082	Standard	NR_028288		Approved	TCL6e1, TNG2, TNG1	uc001yev.2		OTTHUMG00000149979		14.37:g.96134723C>A				RNA	SNP	-	NULL	ENST00000467865.1	37	NULL		14																																																																																			TCL6	-	-	ENSG00000187621		0.507	TCL6-009	KNOWN	basic	lincRNA	TCL6	HGNC	processed_transcript	OTTHUMT00000315133.1	-	0.00	27	0	C	NM_012468		96134723	+1	tier1	-	no_errors	ENST00000352367	ensembl	human	known	74_37	rna	12.20	36	5	SNP	0.018	A
TCP1	6950	genome.wustl.edu	37	6	160206497	160206497	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:160206497T>A	ENST00000321394.7	-	5	689	c.409A>T	c.(409-411)Att>Ttt	p.I137F	TCP1_ENST00000546023.1_5'Flank|SNORA29_ENST00000384183.1_RNA|TCP1_ENST00000420894.2_Missense_Mutation_p.I137F|TCP1_ENST00000392168.2_5'UTR|TCP1_ENST00000544255.1_Intron	NM_030752.2	NP_110379.2	P17987	TCPA_HUMAN	t-complex 1	137					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|nuclear heterochromatin (GO:0005720)|pericentriolar material (GO:0000242)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(2)	10		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		GTGTTAACAATTAGGTTTTCA	0.383																																																	0													187.0	164.0	172.0					6																	160206497		2203	4300	6503	SO:0001583	missense	0			X52882	CCDS5269.1, CCDS43522.1	6q25-q27	2012-10-02			ENSG00000120438	ENSG00000120438		"""Heat Shock Proteins / Chaperonins"""	11655	protein-coding gene	gene with protein product		186980				3476253, 3653076	Standard	NM_030752		Approved	D6S230E, CCT1, Ccta	uc003qsr.3	P17987	OTTHUMG00000015937	ENST00000321394.7:c.409A>T	6.37:g.160206497T>A	ENSP00000317334:p.Ile137Phe		E1P5B2|Q15556|Q5TCM3	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_alpha	p.I137F	ENST00000321394.7	37	c.409	CCDS5269.1	6	.	.	.	.	.	.	.	.	.	.	T	17.24	3.338685	0.60963	.	.	ENSG00000120438	ENST00000321394;ENST00000420894;ENST00000538128;ENST00000539948	T;T;T	0.78707	-1.2;-1.2;-1.2	5.76	5.76	0.90799	.	0.045790	0.85682	D	0.000000	T	0.62901	0.2466	L	0.58101	1.795	0.80722	D	1	B;B	0.21520	0.057;0.015	B;B	0.24848	0.056;0.016	T	0.67221	-0.5725	10	0.56958	D	0.05	-31.3247	8.916	0.35581	0.0:0.1094:0.0:0.8906	.	137;137	E7ERF2;P17987	.;TCPA_HUMAN	F	137;137;17;115	ENSP00000317334:I137F;ENSP00000390159:I137F;ENSP00000439671:I115F	ENSP00000317334:I137F	I	-	1	0	TCP1	160126487	1.000000	0.71417	0.019000	0.16419	0.986000	0.74619	4.683000	0.61679	2.324000	0.78689	0.533000	0.62120	ATT	TCP1	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_alpha	ENSG00000120438		0.383	TCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP1	HGNC	protein_coding	OTTHUMT00000042917.2	-	0.00	59	0	T	NM_030752		160206497	-1	tier1	-	no_errors	ENST00000321394	ensembl	human	known	74_37	missense	13.11	53	8	SNP	0.002	A
TDP1	55775	genome.wustl.edu	37	14	90509479	90509479	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:90509479C>T	ENST00000335725.4	+	17	2069	c.1819C>T	c.(1819-1821)Ccc>Tcc	p.P607S	TDP1_ENST00000393454.2_Missense_Mutation_p.P607S|TDP1_ENST00000393452.3_3'UTR|TDP1_ENST00000555880.1_Silent_p.C570C|TDP1_ENST00000357382.3_Missense_Mutation_p.P368S	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	607					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		CATGTGGGTGCCCTCCTGAGA	0.423								Repair of DNA-protein crosslinks																																									0													100.0	87.0	91.0					14																	90509479		2203	4300	6503	SO:0001583	missense	0			AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.1819C>T	14.37:g.90509479C>T	ENSP00000337353:p.Pro607Ser		Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Missense_Mutation	SNP	pfam_Tyr-DNA_phospho	p.P607S	ENST00000335725.4	37	c.1819	CCDS9888.1	14	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617201	0.87359	.	.	ENSG00000042088	ENST00000393454;ENST00000335725;ENST00000357382	T;T;T	0.62788	-0.0;-0.0;-0.0	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.81044	0.4741	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.87578	0.998;0.685	D	0.83635	0.0147	10	0.72032	D	0.01	-1.5918	15.0181	0.71605	0.0:1.0:0.0:0.0	.	368;607	Q86TV8;Q9NUW8	.;TYDP1_HUMAN	S	607;607;368	ENSP00000377099:P607S;ENSP00000337353:P607S;ENSP00000349952:P368S	ENSP00000337353:P607S	P	+	1	0	TDP1	89579232	0.998000	0.40836	1.000000	0.80357	0.967000	0.64934	4.791000	0.62460	2.615000	0.88500	0.650000	0.86243	CCC	TDP1	-	NULL	ENSG00000042088		0.423	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDP1	HGNC	protein_coding	OTTHUMT00000411239.1	-	0.00	51	0	C	NM_018319		90509479	+1	tier1	-	no_errors	ENST00000335725	ensembl	human	known	74_37	missense	17.28	67	14	SNP	1.000	T
TDP2	51567	genome.wustl.edu	37	6	24666976	24666976	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:24666976C>T	ENST00000378198.4	-	1	285	c.115G>A	c.(115-117)Gat>Aat	p.D39N	TDP2_ENST00000341060.3_5'Flank|ACOT13_ENST00000537591.1_5'Flank|ACOT13_ENST00000230048.4_5'Flank|TDP2_ENST00000545995.1_Missense_Mutation_p.D69N			O95551	TYDP2_HUMAN	tyrosyl-DNA phosphodiesterase 2	39					cell surface receptor signaling pathway (GO:0007166)|double-strand break repair (GO:0006302)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|PML body (GO:0016605)	5'-tyrosyl-DNA phosphodiesterase activity (GO:0070260)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)|tyrosyl-RNA phosphodiesterase activity (GO:0036317)			kidney(2)|large_intestine(1)|lung(5)|ovary(1)	9						ACTGCGGCATCGCAGCTTGCG	0.627								Direct reversal of damage																																									0													166.0	180.0	175.0					6																	24666976		2203	4300	6503	SO:0001583	missense	0			AJ269473	CCDS4557.1	6p22.3-p22.1	2010-05-07	2010-05-07	2010-05-07	ENSG00000111802	ENSG00000111802	3.1.4.-		17768	protein-coding gene	gene with protein product		605764	"""TRAF and TNF receptor associated protein"""	TTRAP		11478795	Standard	NM_016614		Approved		uc003nej.3	O95551	OTTHUMG00000014360	ENST00000378198.4:c.115G>A	6.37:g.24666976C>T	ENSP00000367440:p.Asp39Asn		B4DKL8|B4DQ95|Q2TBE2|Q5JYM0|Q7Z6U5|Q9NUK5|Q9NYY9	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,superfamily_UBA-like	p.D69N	ENST00000378198.4	37	c.205	CCDS4557.1	6	.	.	.	.	.	.	.	.	.	.	C	15.33	2.801660	0.50315	.	.	ENSG00000111802	ENST00000378198;ENST00000545995;ENST00000545780	T;T	0.31247	1.61;1.5	5.09	2.36	0.29203	UBA-like (1);	0.144057	0.64402	N	0.000011	T	0.18800	0.0451	M	0.71581	2.175	0.21822	N	0.999524	D;D	0.57571	0.98;0.965	P;B	0.47626	0.552;0.241	T	0.06807	-1.0806	10	0.49607	T	0.09	-30.0107	6.5692	0.22529	0.0:0.6845:0.1493:0.1662	.	69;39	O95551-2;O95551	.;TYDP2_HUMAN	N	39;69;39	ENSP00000367440:D39N;ENSP00000437637:D69N	ENSP00000367440:D39N	D	-	1	0	TDP2	24774955	0.980000	0.34600	0.129000	0.21949	0.061000	0.15899	2.461000	0.45040	0.314000	0.23086	0.655000	0.94253	GAT	TDP2	-	superfamily_UBA-like	ENSG00000111802		0.627	TDP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TDP2	HGNC	protein_coding	OTTHUMT00000040012.1	-	0.00	16	0	C			24666976	-1	tier1	-	no_errors	ENST00000545995	ensembl	human	known	74_37	missense	15.62	27	5	SNP	0.071	T
TET3	200424	genome.wustl.edu	37	2	74275075	74275075	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:74275075G>T	ENST00000409262.3	+	1	1626	c.1626G>T	c.(1624-1626)ctG>ctT	p.L542L		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	542					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ACAGCCTGCTGCCCCCTACTC	0.642																																																	0													24.0	27.0	26.0					2																	74275075		1972	4153	6125	SO:0001819	synonymous_variant	0				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.1626G>T	2.37:g.74275075G>T			A6NEI3|Q86Z24|Q8TBM9	Silent	SNP	NULL	p.L542	ENST00000409262.3	37	c.1626	CCDS46339.1	2																																																																																			TET3	-	NULL	ENSG00000187605		0.642	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TET3	HGNC	protein_coding	OTTHUMT00000328141.4	-	0.00	38	0	G			74275075	+1	tier1	-	no_errors	ENST00000409262	ensembl	human	known	74_37	silent	8.51	43	4	SNP	1.000	T
TG	7038	genome.wustl.edu	37	8	134034380	134034380	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:134034380G>C	ENST00000220616.4	+	40	7061	c.7021G>C	c.(7021-7023)Ggc>Cgc	p.G2341R	TG_ENST00000542445.1_Missense_Mutation_p.G711R|TG_ENST00000377869.1_Missense_Mutation_p.G2284R|TG_ENST00000519543.1_Missense_Mutation_p.G474R	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2341					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GGGTGTCTTCGGCTTCCTGAG	0.617																																																	0													143.0	131.0	135.0					8																	134034380		2203	4300	6503	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.7021G>C	8.37:g.134034380G>C	ENSP00000220616:p.Gly2341Arg		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.G2341R	ENST00000220616.4	37	c.7021	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.880635|4.880635	0.91740|0.91740	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543|ENST00000519178;ENST00000518108	D;D;D;D|.	0.88124|.	-2.34;-2.34;-2.34;-2.34|.	5.93|5.93	5.93|5.93	0.95920|0.95920	Carboxylesterase, type B (1);|.	0.062211|.	0.64402|.	D|.	0.000006|.	D|D	0.90995|0.90995	0.7168|0.7168	H|H	0.99026|0.99026	4.405|4.405	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.94045|0.94045	0.7313|0.7313	10|5	0.87932|.	D|.	0|.	.|.	17.0766|17.0766	0.86588|0.86588	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	474;711;2341|.	E7EVM0;F5GWW5;P01266|.	.;.;THYG_HUMAN|.	R|P	2284;1147;2341;711;474|796;136	ENSP00000367100:G2284R;ENSP00000220616:G2341R;ENSP00000441693:G711R;ENSP00000430430:G474R|.	ENSP00000220616:G2341R|.	G|R	+|+	1|2	0|0	TG|TG	134103562|134103562	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.976000|0.976000	0.68499|0.68499	8.497000|8.497000	0.90488|0.90488	2.815000|2.815000	0.96918|0.96918	0.561000|0.561000	0.74099|0.74099	GGC|CGG	TG	-	pfam_CarbesteraseB,pirsf_Thyroglobulin	ENSG00000042832		0.617	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	64	0	G	NM_003235		134034380	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	15.28	61	11	SNP	1.000	C
THSD1	55901	genome.wustl.edu	37	13	52951643	52951643	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:52951643T>A	ENST00000258613.4	-	5	2640	c.2462A>T	c.(2461-2463)gAg>gTg	p.E821V	THSD1_ENST00000544466.1_Missense_Mutation_p.E442V|THSD1_ENST00000349258.4_Missense_Mutation_p.E768V	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	821					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CTGCTCAGCCTCAGTGAGGCC	0.483																																																	0													27.0	28.0	28.0					13																	52951643		2198	4280	6478	SO:0001583	missense	0			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.2462A>T	13.37:g.52951643T>A	ENSP00000258613:p.Glu821Val		A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E821V	ENST00000258613.4	37	c.2462	CCDS9432.1	13	.	.	.	.	.	.	.	.	.	.	T	13.34	2.208856	0.39003	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.57752	1.0;0.38;1.16	5.67	4.49	0.54785	.	0.098719	0.64402	D	0.000002	T	0.69441	0.3111	M	0.72894	2.215	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.71938	-0.4441	10	0.87932	D	0	-18.6427	11.3307	0.49475	0.0:0.0712:0.0:0.9288	.	768;821	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	V	768;442;821	ENSP00000340650:E768V;ENSP00000438512:E442V;ENSP00000258613:E821V	ENSP00000258613:E821V	E	-	2	0	THSD1	51849644	1.000000	0.71417	0.327000	0.25402	0.144000	0.21451	5.254000	0.65457	1.085000	0.41206	-0.462000	0.05337	GAG	THSD1	-	NULL	ENSG00000136114		0.483	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD1	HGNC	protein_coding	OTTHUMT00000045058.3		0.00	76	0	T			52951643	-1			no_errors	ENST00000258613	ensembl	human	known	74_37	missense	6.60	99	7	SNP	0.997	A
TIPRL	261726	genome.wustl.edu	37	1	168154083	168154083	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:168154083G>T	ENST00000367833.2	+	3	496	c.351G>T	c.(349-351)aaG>aaT	p.K117N	TIPRL_ENST00000367830.3_Missense_Mutation_p.K117N	NM_152902.3	NP_690866.1	O75663	TIPRL_HUMAN	TOR signaling pathway regulator	117					DNA damage checkpoint (GO:0000077)|negative regulation of protein phosphatase type 2A activity (GO:0034048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|kidney(1)|large_intestine(1)|ovary(2)|skin(1)	6	all_hematologic(923;0.215)					CAGATTATAAGGGAACCTTAC	0.358																																																	0													72.0	70.0	71.0					1																	168154083		2203	4299	6502	SO:0001583	missense	0			AB097034	CCDS1270.1, CCDS30935.1	1q23.2	2014-03-07	2014-03-07		ENSG00000143155	ENSG00000143155			30231	protein-coding gene	gene with protein product		611807	"""TIP41, TOR signaling pathway regulator-like (S. cerevisiae)"""			12761501	Standard	NM_001031800		Approved	MGC3794, dJ69E11.3, TIP41	uc001gfg.3	O75663	OTTHUMG00000034646	ENST00000367833.2:c.351G>T	1.37:g.168154083G>T	ENSP00000356807:p.Lys117Asn		B2R8V3|Q5HYB2|Q8IZ86	Missense_Mutation	SNP	pfam_TIP41-like	p.K117N	ENST00000367833.2	37	c.351	CCDS1270.1	1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807083	0.50421	.	.	ENSG00000143155	ENST00000367833;ENST00000367830	.	.	.	5.25	1.59	0.23543	.	0.094515	0.64402	D	0.000001	T	0.50137	0.1598	M	0.76002	2.32	0.45318	D	0.998312	D;B	0.69078	0.997;0.225	D;B	0.64877	0.93;0.095	T	0.48703	-0.9012	8	0.24483	T	0.36	-27.4591	7.6927	0.28577	0.4079:0.0:0.5921:0.0	.	117;117	O75663;O75663-2	TIPRL_HUMAN;.	N	117	.	ENSP00000356804:K117N	K	+	3	2	TIPRL	166420707	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.198000	0.42705	0.531000	0.28639	0.563000	0.77884	AAG	TIPRL	-	pfam_TIP41-like	ENSG00000143155		0.358	TIPRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIPRL	HGNC	protein_coding	OTTHUMT00000083822.1	-	0.00	61	0	G	NM_152902		168154083	+1	tier1	-	no_errors	ENST00000367833	ensembl	human	known	74_37	missense	11.11	72	9	SNP	1.000	T
TM7SF3	51768	genome.wustl.edu	37	12	27152716	27152717	+	Intron	INS	-	-	A	rs369163710|rs564843464		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:27152716_27152717insA	ENST00000343028.4	-	3	472				TM7SF3_ENST00000542667.1_Intron	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					AAAACAAATAGAAAAAAAAAAC	0.342																																																	0																																										SO:0001627	intron_variant	0			AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.247-107->T	12.37:g.27152726_27152726dupA			B3KMZ3|Q9NUS4	RNA	INS	-	NULL	ENST00000343028.4	37	NULL	CCDS8710.1	12																																																																																			TM7SF3	-	-	ENSG00000064115		0.342	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM7SF3	HGNC	protein_coding	OTTHUMT00000403033.1		0.00	18	0	-	NM_016551		27152717	-1	tier1		no_errors	ENST00000539399	ensembl	human	known	74_37	rna	14.29	24	4	INS	0.000:0.000	A
TMC2	117532	genome.wustl.edu	37	20	2605001	2605001	+	Silent	SNP	C	C	A	rs555212967		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:2605001C>A	ENST00000358864.1	+	17	2280	c.2265C>A	c.(2263-2265)ctC>ctA	p.L755L		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	755					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTGCTTTCCTCGCCAATCCAG	0.493																																																	0													173.0	129.0	144.0					20																	2605001		2203	4300	6503	SO:0001819	synonymous_variant	0			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.2265C>A	20.37:g.2605001C>A			Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Silent	SNP	pfam_TMC	p.L755	ENST00000358864.1	37	c.2265	CCDS13029.2	20																																																																																			TMC2	-	NULL	ENSG00000149488		0.493	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	-	0.00	71	0	C			2605001	+1	tier1	-	no_errors	ENST00000358864	ensembl	human	known	74_37	silent	6.54	100	7	SNP	0.063	A
TMEM131	23505	genome.wustl.edu	37	2	98435160	98435160	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:98435160C>A	ENST00000186436.5	-	12	1327	c.1099G>T	c.(1099-1101)Gat>Tat	p.D367Y	TMEM131_ENST00000425805.2_Intron	NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	367						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GTTATAGCATCATTTTGTGGT	0.343																																																	0													174.0	155.0	161.0					2																	98435160		1853	4100	5953	SO:0001583	missense	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1099G>T	2.37:g.98435160C>A	ENSP00000186436:p.Asp367Tyr			Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.D367Y	ENST00000186436.5	37	c.1099	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837787	0.91117	.	.	ENSG00000075568	ENST00000186436	T	0.32515	1.45	5.93	5.93	0.95920	PapD-like (1);	0.046823	0.85682	D	0.000000	T	0.42585	0.1209	L	0.29908	0.895	0.80722	D	1	D	0.60575	0.988	P	0.57371	0.819	T	0.22173	-1.0224	10	0.72032	D	0.01	-19.5536	20.3539	0.98825	0.0:1.0:0.0:0.0	.	367	Q92545	TM131_HUMAN	Y	367	ENSP00000186436:D367Y	ENSP00000186436:D367Y	D	-	1	0	TMEM131	97801592	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.469000	0.80959	2.826000	0.97356	0.655000	0.94253	GAT	TMEM131	-	NULL	ENSG00000075568		0.343	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	-	0.00	56	0	C	XM_371542		98435160	-1	tier1	-	no_errors	ENST00000186436	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
TMEM132C	92293	genome.wustl.edu	37	12	129180377	129180377	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:129180377C>A	ENST00000435159.2	+	7	1658	c.1658C>A	c.(1657-1659)cCc>cAc	p.P553H	TMEM132C_ENST00000315208.8_Missense_Mutation_p.P169H|TMEM132C_ENST00000537538.1_5'UTR	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	553						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCCACAAGGCCCACTCGTGAG	0.617																																																	0													12.0	16.0	15.0					12																	129180377		692	1590	2282	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1658C>A	12.37:g.129180377C>A	ENSP00000410852:p.Pro553His		Q69YX8	Missense_Mutation	SNP	NULL	p.P553H	ENST00000435159.2	37	c.1658		12	.	.	.	.	.	.	.	.	.	.	C	15.05	2.719493	0.48728	.	.	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.13420	2.59;2.59	4.82	3.93	0.45458	.	0.091563	0.47093	D	0.000258	T	0.38214	0.1032	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.24154	-1.0168	10	0.51188	T	0.08	.	13.2119	0.59830	0.0:0.9221:0.0:0.0779	.	553	Q8N3T6	T132C_HUMAN	H	553;169	ENSP00000410852:P553H;ENSP00000324458:P169H	ENSP00000324458:P169H	P	+	2	0	TMEM132C	127746330	1.000000	0.71417	0.895000	0.35142	0.014000	0.08584	4.659000	0.61504	1.011000	0.39340	0.655000	0.94253	CCC	TMEM132C	-	NULL	ENSG00000181234		0.617	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		-	0.00	56	0	C	XM_044062		129180377	+1	tier1	-	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	12.90	54	8	SNP	1.000	A
TMEM135	65084	genome.wustl.edu	37	11	87030375	87030375	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:87030375G>T	ENST00000305494.5	+	14	1239	c.1200G>T	c.(1198-1200)ttG>ttT	p.L400F	TMEM135_ENST00000340353.7_Missense_Mutation_p.L378F|TMEM135_ENST00000532959.1_Missense_Mutation_p.L271F|TMEM135_ENST00000535167.1_Missense_Mutation_p.L261F	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	400					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTCAGACTTTGAGACCATCTT	0.323																																																	0													84.0	85.0	85.0					11																	87030375		2201	4298	6499	SO:0001583	missense	0			BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.1200G>T	11.37:g.87030375G>T	ENSP00000306344:p.Leu400Phe		Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	NULL	p.L400F	ENST00000305494.5	37	c.1200	CCDS8280.1	11	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711997	0.68730	.	.	ENSG00000166575	ENST00000340353;ENST00000544294;ENST00000532959;ENST00000305494;ENST00000535167	T;T;T;T	0.69306	-0.11;0.15;-0.39;0.14	5.85	1.67	0.24075	.	0.000000	0.85682	D	0.000000	T	0.79718	0.4494	M	0.82323	2.585	0.54753	D	0.999987	D;D	0.89917	1.0;0.999	D;D	0.76575	0.987;0.988	T	0.78521	-0.2172	9	.	.	.	-29.9045	10.1388	0.42723	0.286:0.0:0.714:0.0	.	378;400	Q86UB9-2;Q86UB9	.;TM135_HUMAN	F	378;237;271;400;261	ENSP00000345513:L378F;ENSP00000436179:L271F;ENSP00000306344:L400F;ENSP00000439525:L261F	.	L	+	3	2	TMEM135	86708023	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	2.017000	0.40981	0.323000	0.23307	0.650000	0.86243	TTG	TMEM135	-	NULL	ENSG00000166575		0.323	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM135	HGNC	protein_coding	OTTHUMT00000393875.1	-	0.00	91	0	G	NM_022918		87030375	+1	tier1	-	no_errors	ENST00000305494	ensembl	human	known	74_37	missense	7.58	122	10	SNP	1.000	T
TMEM176B	28959	genome.wustl.edu	37	7	150490363	150490363	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:150490363G>C	ENST00000447204.2	-	5	785	c.413C>G	c.(412-414)aCa>aGa	p.T138R	TMEM176B_ENST00000450753.2_Missense_Mutation_p.T101R|TMEM176B_ENST00000434545.1_Missense_Mutation_p.T138R|TMEM176B_ENST00000429904.2_Missense_Mutation_p.T138R|TMEM176B_ENST00000326442.5_Missense_Mutation_p.T138R|TMEM176B_ENST00000492607.1_Missense_Mutation_p.T138R	NM_014020.3	NP_054739.3	Q3YBM2	T176B_HUMAN	transmembrane protein 176B	138					cell differentiation (GO:0030154)|negative regulation of dendritic cell differentiation (GO:2001199)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|large_intestine(4)|lung(10)|ovary(1)|skin(3)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCCATAGCTGTAGCAAAGCC	0.507																																																	0													63.0	56.0	58.0					7																	150490363		2203	4300	6503	SO:0001583	missense	0			AF115384	CCDS5908.1, CCDS47746.1	7q36.1	2006-09-04			ENSG00000106565	ENSG00000106565			29596	protein-coding gene	gene with protein product		610385				9922225	Standard	NM_014020		Approved	LR8	uc003whu.4	Q3YBM2	OTTHUMG00000157577	ENST00000447204.2:c.413C>G	7.37:g.150490363G>C	ENSP00000410269:p.Thr138Arg		B2RDK2|D3DWZ7|E9PAV4|Q5BJI2|Q9BT42|Q9Y609	Missense_Mutation	SNP	pfam_CD20-like,superfamily_MFS_dom_general_subst_transpt	p.T138R	ENST00000447204.2	37	c.413	CCDS5908.1	7	.	.	.	.	.	.	.	.	.	.	G	9.995	1.231868	0.22626	.	.	ENSG00000106565	ENST00000492607;ENST00000326442;ENST00000447204;ENST00000434545;ENST00000429904;ENST00000450753;ENST00000528038	T;T;T;T;T;T	0.02737	4.18;4.18;4.18;4.18;4.18;4.18	4.32	3.44	0.39384	.	0.698788	0.13569	N	0.378202	T	0.11965	0.0291	M	0.77103	2.36	0.09310	N	1	D;D	0.58970	0.984;0.984	P;P	0.62184	0.899;0.899	T	0.05971	-1.0853	10	0.87932	D	0	-5.2435	8.6107	0.33800	0.1092:0.0:0.8908:0.0	.	101;138	E9PAV4;Q3YBM2	.;T176B_HUMAN	R	138;138;138;138;138;101;138	ENSP00000419258:T138R;ENSP00000318409:T138R;ENSP00000410269:T138R;ENSP00000413531:T138R;ENSP00000397810:T138R;ENSP00000404831:T101R	ENSP00000318409:T138R	T	-	2	0	TMEM176B	150121296	0.007000	0.16637	0.008000	0.14137	0.019000	0.09904	1.382000	0.34374	0.954000	0.37851	0.448000	0.29417	ACA	TMEM176B	-	pfam_CD20-like,superfamily_MFS_dom_general_subst_transpt	ENSG00000106565		0.507	TMEM176B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM176B	HGNC	protein_coding	OTTHUMT00000349204.1	-	0.00	37	0	G	NM_014020		150490363	-1	tier1	-	no_errors	ENST00000326442	ensembl	human	known	74_37	missense	9.09	39	4	SNP	0.025	C
TMEM182	130827	genome.wustl.edu	37	2	103378716	103378716	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:103378716G>T	ENST00000412401.2	+	1	245	c.40G>T	c.(40-42)Ggt>Tgt	p.G14C	TMEM182_ENST00000409173.1_Intron|TMEM182_ENST00000409528.1_Intron	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	14						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						AGCTCTCTTTGGTGCTTTGGG	0.373																																																	0													145.0	139.0	141.0					2																	103378716		2203	4300	6503	SO:0001583	missense	0			AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.40G>T	2.37:g.103378716G>T	ENSP00000394178:p.Gly14Cys		C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Missense_Mutation	SNP	NULL	p.G14C	ENST00000412401.2	37	c.40	CCDS2064.1	2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140802	0.77775	.	.	ENSG00000170417	ENST00000412401	T	0.56611	0.45	6.02	6.02	0.97574	.	0.044791	0.85682	D	0.000000	T	0.67211	0.2869	L	0.57536	1.79	0.46725	D	0.999177	D	0.71674	0.998	P	0.60789	0.879	T	0.68119	-0.5493	10	0.87932	D	0	-22.3339	16.7888	0.85582	0.0:0.0:0.8707:0.1293	.	14	Q6ZP80	TM182_HUMAN	C	14	ENSP00000394178:G14C	ENSP00000394178:G14C	G	+	1	0	TMEM182	102745148	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.425000	0.80255	2.865000	0.98341	0.655000	0.94253	GGT	TMEM182	-	NULL	ENSG00000170417		0.373	TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM182	HGNC	protein_coding	OTTHUMT00000253293.1		0.00	65	0	G	NM_144632		103378716	+1			no_errors	ENST00000412401	ensembl	human	known	74_37	missense	5.10	93	5	SNP	1.000	T
TMEM182	130827	genome.wustl.edu	37	2	103431207	103431207	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:103431207G>T	ENST00000412401.2	+	5	675	c.470G>T	c.(469-471)gGc>gTc	p.G157V	TMEM182_ENST00000409173.1_Splice_Site_p.G114V|TMEM182_ENST00000409528.1_Splice_Site_p.G61V|TMEM182_ENST00000486293.1_Intron	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	157						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						TCCTTCTCAGGCATCCTATTT	0.443																																																	0													76.0	66.0	69.0					2																	103431207		2203	4300	6503	SO:0001630	splice_region_variant	0			AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.470-1G>T	2.37:g.103431207G>T			C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Missense_Mutation	SNP	NULL	p.G157V	ENST00000412401.2	37	c.470	CCDS2064.1	2	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523363	0.85600	.	.	ENSG00000170417	ENST00000409528;ENST00000409173;ENST00000412401	T;T;T	0.73047	-0.71;-0.71;-0.71	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.83524	0.5273	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81324	-0.0984	9	.	.	.	.	19.0403	0.92995	0.0:0.0:1.0:0.0	.	157;114	Q6ZP80;B8ZZ71	TM182_HUMAN;.	V	61;114;157	ENSP00000387258:G61V;ENSP00000387184:G114V;ENSP00000394178:G157V	.	G	+	2	0	TMEM182	102797639	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	6.727000	0.74764	2.937000	0.99478	0.650000	0.86243	GGC	TMEM182	-	NULL	ENSG00000170417		0.443	TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM182	HGNC	protein_coding	OTTHUMT00000253293.1	-	0.00	50	0	G	NM_144632	Missense_Mutation	103431207	+1	tier1	-	no_errors	ENST00000412401	ensembl	human	known	74_37	missense	10.96	65	8	SNP	1.000	T
TMEM215	401498	genome.wustl.edu	37	9	32784186	32784186	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:32784186G>T	ENST00000342743.5	+	2	370	c.5G>T	c.(4-6)cGg>cTg	p.R2L		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	2						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						TGAAACATGCGGCCTGATGAC	0.527																																																	0													99.0	98.0	98.0					9																	32784186		2203	4300	6503	SO:0001583	missense	0				CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.5G>T	9.37:g.32784186G>T	ENSP00000345468:p.Arg2Leu		Q6ZUU2	Missense_Mutation	SNP	NULL	p.R2L	ENST00000342743.5	37	c.5	CCDS6530.1	9	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577905	0.45902	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.31	5.31	0.75309	.	0.084595	0.49305	D	0.000143	T	0.63522	0.2518	L	0.27053	0.805	0.46499	D	0.999079	D	0.67145	0.996	P	0.62885	0.908	T	0.67821	-0.5571	9	0.87932	D	0	-18.6034	16.4706	0.84111	0.0:0.0:1.0:0.0	.	2	Q68D42	TM215_HUMAN	L	2	.	ENSP00000345468:R2L	R	+	2	0	TMEM215	32774186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.803000	0.69129	2.494000	0.84150	0.462000	0.41574	CGG	TMEM215	-	NULL	ENSG00000188133		0.527	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM215	HGNC	protein_coding	OTTHUMT00000251701.1	-	0.00	56	0	G	NM_212558		32784186	+1	tier1	-	no_errors	ENST00000342743	ensembl	human	known	74_37	missense	8.33	66	6	SNP	1.000	T
TMEM234	56063	genome.wustl.edu	37	1	32682383	32682383	+	Intron	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:32682383C>A	ENST00000344461.3	-	5	403				TMEM234_ENST00000485689.1_5'UTR|TMEM234_ENST00000373593.1_3'UTR|TMEM234_ENST00000545122.1_Intron|TMEM234_ENST00000309777.6_3'UTR			Q8WY98	TM234_HUMAN	transmembrane protein 234							integral component of membrane (GO:0016021)				kidney(2)|lung(3)	5						TAGGTCCATCCGCTCACTGCC	0.552																																																	0																																										SO:0001627	intron_variant	0			AY358586	CCDS356.2	1p36.11-p34.2	2011-02-14	2011-02-14	2011-02-14	ENSG00000160055	ENSG00000160055			28837	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 91"""	C1orf91		12477932	Standard	XM_005271045		Approved	RP4-622L5, dJ622L5.7, FLJ90779	uc001buq.4	Q8WY98	OTTHUMG00000005742	ENST00000344461.3:c.387+106G>T	1.37:g.32682383C>A			B2R535|D3DPP7|Q6UWY9|Q8N2H6|Q9BSR2|Q9NU76	RNA	SNP	-	NULL	ENST00000344461.3	37	NULL		1																																																																																			TMEM234	-	-	ENSG00000160055		0.552	TMEM234-009	PUTATIVE	basic	protein_coding	TMEM234	HGNC	protein_coding	OTTHUMT00000092260.2	-	0.00	22	0	C	NM_019118		32682383	-1	tier1	-	no_errors	ENST00000485689	ensembl	human	putative	74_37	rna	12.90	27	4	SNP	0.000	A
TNNT3	7140	genome.wustl.edu	37	11	1955826	1955826	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:1955826G>A	ENST00000397301.1	+	14	572	c.564G>A	c.(562-564)aaG>aaA	p.K188K	TNNT3_ENST00000381561.4_Silent_p.K180K|TNNT3_ENST00000381589.3_Silent_p.K175K|TNNT3_ENST00000397304.2_Silent_p.K158K|TNNT3_ENST00000381549.3_Silent_p.K169K|TNNT3_ENST00000493234.1_3'UTR|TNNT3_ENST00000381558.1_Silent_p.K169K|TNNT3_ENST00000381579.3_Silent_p.K169K|TNNT3_ENST00000446240.1_Silent_p.K158K|TNNT3_ENST00000278317.6_Silent_p.K177K|TNNT3_ENST00000360603.3_Silent_p.K171K|TNNT3_ENST00000381548.3_Silent_p.K179K			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	188					ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		TGAAGAAGAAGATTCTGGCTG	0.602																																																	0													32.0	31.0	31.0					11																	1955826		2199	4295	6494	SO:0001819	synonymous_variant	0			M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.564G>A	11.37:g.1955826G>A			A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Silent	SNP	pfam_Troponin	p.K188	ENST00000397301.1	37	c.564		11																																																																																			TNNT3	-	pfam_Troponin	ENSG00000130595		0.602	TNNT3-010	KNOWN	basic	protein_coding	TNNT3	HGNC	protein_coding	OTTHUMT00000142920.3		0.00	41	0	G	NM_006757		1955826	+1			no_errors	ENST00000397301	ensembl	human	known	74_37	silent	7.32	37	3	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577058	7577058	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:7577058C>A	ENST00000269305.4	-	8	1069	c.880G>T	c.(880-882)Gag>Tag	p.E294*	TP53_ENST00000445888.2_Nonsense_Mutation_p.E294*|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.E294*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E294*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E294*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	294	Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E294*(46)|p.E294fs*51(9)|p.K291fs*48(8)|p.0?(8)|p.E294K(3)|p.E294fs*12(3)|p.?(2)|p.E294Q(2)|p.L265_K305del41(1)|p.E294>*(1)|p.G293fs*1(1)|p.R290fs*50(1)|p.R290_P295>X(1)|p.E294fs*11(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGAGGCTCCCCTTTCTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	87	Substitution - Nonsense(46)|Deletion - Frameshift(20)|Whole gene deletion(8)|Substitution - Missense(5)|Insertion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Complex - deletion inframe(1)|Complex - compound substitution(1)	upper_aerodigestive_tract(17)|lung(14)|large_intestine(10)|breast(7)|urinary_tract(6)|oesophagus(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|stomach(3)|central_nervous_system(2)|skin(2)|salivary_gland(1)|vulva(1)|soft_tissue(1)|endometrium(1)											109.0	95.0	100.0					17																	7577058		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.880G>T	17.37:g.7577058C>A	ENSP00000269305:p.Glu294*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E294*	ENST00000269305.4	37	c.880	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.130179	0.94473	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	4.29	0.51040	.	0.702099	0.13430	N	0.388474	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-17.6918	13.5106	0.61511	0.0:0.8337:0.1663:0.0	.	.	.	.	X	294;294;294;294;294;283;162	.	ENSP00000269305:E294X	E	-	1	0	TP53	7517783	0.019000	0.18553	0.006000	0.13384	0.253000	0.25986	1.700000	0.37815	1.441000	0.47550	0.561000	0.74099	GAG	TP53	-	NULL	ENSG00000141510		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	64	0	C	NM_000546		7577058	-1			no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	8.00	69	6	SNP	0.015	A
TP53	7157	genome.wustl.edu	37	17	7579312	7579312	+	Splice_Site	SNP	C	C	A	rs55863639		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:7579312C>A	ENST00000269305.4	-	4	564	c.375G>T	c.(373-375)acG>acT	p.T125T	TP53_ENST00000445888.2_Splice_Site_p.T125T|TP53_ENST00000413465.2_Splice_Site_p.T125T|TP53_ENST00000455263.2_Splice_Site_p.T125T|TP53_ENST00000420246.2_Splice_Site_p.T125T|TP53_ENST00000359597.4_Splice_Site_p.T125T|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.0?(8)|p.?(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAACTGACCGTGCAAGTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Substitution - coding silent(51)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Insertion - In frame(1)	lung(21)|haematopoietic_and_lymphoid_tissue(14)|large_intestine(8)|upper_aerodigestive_tract(7)|bone(4)|central_nervous_system(3)|biliary_tract(3)|stomach(1)|liver(1)|urinary_tract(1)|kidney(1)|ovary(1)|pancreas(1)	GRCh37	CS004351|CS011573|CS971913	TP53	S	rs55863639						66.0	61.0	63.0					17																	7579312		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579312C>A			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.T125	ENST00000269305.4	37	c.375	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	118	0	C	NM_000546	Silent	7579312	-1	tier1	rs55863639	no_errors	ENST00000269305	ensembl	human	known	74_37	silent	5.26	90	5	SNP	1.000	A
TP53BP2	7159	genome.wustl.edu	37	1	224001971	224001971	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:224001971C>A	ENST00000343537.7	-	3	551	c.260G>T	c.(259-261)cGt>cTt	p.R87L	TP53BP2_ENST00000391878.2_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	81					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GCGTTCATGACGAAGGAAGAA	0.453																																																	0													111.0	114.0	113.0					1																	224001971		1924	4153	6077	SO:0001583	missense	0			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.260G>T	1.37:g.224001971C>A	ENSP00000341957:p.Arg87Leu		B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.R87L	ENST00000343537.7	37	c.260	CCDS44319.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.555326	0.96514	.	.	ENSG00000143514	ENST00000343537	T	0.54675	0.56	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.75481	0.3855	M	0.81341	2.54	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.78705	-0.2100	10	0.87932	D	0	.	19.266	0.93985	0.0:1.0:0.0:0.0	.	87	B4DG66	.	L	87	ENSP00000341957:R87L	ENSP00000341957:R87L	R	-	2	0	TP53BP2	222068594	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.250000	0.78287	2.572000	0.86782	0.563000	0.77884	CGT	TP53BP2	-	NULL	ENSG00000143514		0.453	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	HGNC	protein_coding	OTTHUMT00000090985.3	-	0.00	79	0	C	NM_001031685, NM_005426		224001971	-1	tier1	-	no_errors	ENST00000343537	ensembl	human	known	74_37	missense	9.59	66	7	SNP	1.000	A
TP53TG3D	729264	genome.wustl.edu	37	16	32266406	32266406	+	IGR	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:32266406G>T	ENST00000354614.3	+	0	412				RP11-56L13.7_ENST00000562604.1_RNA|TP53TG3D_ENST00000569631.1_3'UTR|TP53TG3D_ENST00000398664.3_3'UTR|TP53TG3D_ENST00000564810.1_3'UTR			Q9ULZ0	T53G3_HUMAN	TP53 target 3D							cytoplasm (GO:0005737)|nucleus (GO:0005634)											AGACAAGTCTGGAAAGTCATC	0.338																																																	0																																										SO:0001628	intergenic_variant	0				CCDS58456.1	16p11.2	2012-12-11			ENSG00000205456	ENSG00000205456			44657	protein-coding gene	gene with protein product							Standard	NM_001243722		Approved		uc021tgy.1	Q9ULZ0	OTTHUMG00000132469		16.37:g.32266406G>T			B2R5K6|Q4KN31|Q9ULY9	RNA	SNP	-	NULL	ENST00000354614.3	37	NULL		16																																																																																			TP53TG3D	-	-	ENSG00000205456		0.338	TP53TG3D-201	KNOWN	basic|appris_candidate_longest	protein_coding	TP53TG3D	HGNC	protein_coding		-	0.00	141	0	G	NM_001243722		32266406	+1	tier1	-	no_errors	ENST00000564810	ensembl	human	known	74_37	rna	5.39	158	9	SNP	0.279	T
TP73	7161	genome.wustl.edu	37	1	3644716	3644716	+	Missense_Mutation	SNP	G	G	T	rs202137544		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:3644716G>T	ENST00000378295.4	+	9	1164	c.1009G>T	c.(1009-1011)Gtc>Ttc	p.V337F	TP73_ENST00000603362.1_Missense_Mutation_p.V337F|TP73_ENST00000378288.4_Missense_Mutation_p.V288F|TP73_ENST00000357733.3_Missense_Mutation_p.V337F|TP73_ENST00000346387.4_Missense_Mutation_p.V337F|TP73_ENST00000604074.1_Missense_Mutation_p.V337F|TP73_ENST00000354437.4_Missense_Mutation_p.V337F|TP73_ENST00000604479.1_Missense_Mutation_p.V337F|TP73_ENST00000378290.4_Missense_Mutation_p.V266F|TP73_ENST00000378285.1_Missense_Mutation_p.V288F|TP73_ENST00000378280.1_Missense_Mutation_p.V288F	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	337					activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.V337I(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		CCCCCCTGCCGTCCCCGCCCT	0.682																																																	1	Substitution - Missense(1)	endometrium(1)											69.0	71.0	70.0					1																	3644716		2203	4300	6503	SO:0001583	missense	0			AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.1009G>T	1.37:g.3644716G>T	ENSP00000367545:p.Val337Phe		B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.V337F	ENST00000378295.4	37	c.1009	CCDS49.1	1	.	.	.	.	.	.	.	.	.	.	G	8.212	0.800488	0.16397	.	.	ENSG00000078900	ENST00000378295;ENST00000354437;ENST00000357733;ENST00000346387;ENST00000378288;ENST00000378285;ENST00000378280;ENST00000378290	D;D;D;D;D;D;D;D	0.99436	-5.71;-5.85;-5.61;-5.72;-5.72;-5.86;-5.9;-5.71	4.79	-4.77	0.03219	.	0.363465	0.30879	N	0.008688	D	0.97492	0.9179	L	0.36672	1.1	0.21897	N	0.999482	P;P;P;P;B;P	0.45212	0.834;0.853;0.538;0.538;0.409;0.71	B;P;B;B;B;B	0.48840	0.139;0.592;0.223;0.321;0.296;0.257	D	0.97371	0.9976	10	0.15066	T	0.55	-13.2127	8.8361	0.35113	0.3013:0.1393:0.5594:0.0	.	288;288;288;288;337;337	B7Z8Z1;O15350-10;O15350-9;O15350-8;O15350-2;O15350	.;.;.;.;.;P73_HUMAN	F	337;337;337;337;288;288;288;266	ENSP00000367545:V337F;ENSP00000346423:V337F;ENSP00000350366:V337F;ENSP00000340740:V337F;ENSP00000367537:V288F;ENSP00000367534:V288F;ENSP00000367529:V288F;ENSP00000367539:V266F	ENSP00000340740:V337F	V	+	1	0	TP73	3634576	0.987000	0.35691	0.020000	0.16555	0.083000	0.17756	1.208000	0.32345	-0.953000	0.03645	0.549000	0.68633	GTC	TP73	-	NULL	ENSG00000078900		0.682	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP73	HGNC	protein_coding	OTTHUMT00000001468.4	-	0.00	198	0	G	NM_005427		3644716	+1	tier1	-	no_errors	ENST00000378295	ensembl	human	known	74_37	missense	6.03	187	12	SNP	0.006	T
TPD52L1	7164	genome.wustl.edu	37	6	125574899	125574899	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:125574899G>T	ENST00000534000.1	+	5	719	c.423G>T	c.(421-423)atG>atT	p.M141I	TPD52L1_ENST00000532429.1_Missense_Mutation_p.M112I|TPD52L1_ENST00000368402.5_Missense_Mutation_p.M141I|TPD52L1_ENST00000304877.13_Missense_Mutation_p.M146I|TPD52L1_ENST00000527711.1_Intron|TPD52L1_ENST00000534199.1_Intron|TPD52L1_ENST00000368388.2_Intron|HDDC2_ENST00000608456.1_Intron|TPD52L1_ENST00000524679.1_Intron|TPD52L1_ENST00000392482.2_Intron|TPD52L1_ENST00000530868.1_3'UTR|TPD52L1_ENST00000528193.1_Missense_Mutation_p.M141I	NM_003287.2	NP_003278.1	Q16890	TPD53_HUMAN	tumor protein D52-like 1	141					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|prostate(1)	5			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		TGCCTGCTATGAGGTAATGTG	0.313																																																	0													87.0	90.0	89.0					6																	125574899		2203	4300	6503	SO:0001583	missense	0			U44427	CCDS5130.1, CCDS34527.1, CCDS34528.1, CCDS43502.1, CCDS75513.1, CCDS75514.1	6q22-q23	2008-07-29			ENSG00000111907	ENSG00000111907			12006	protein-coding gene	gene with protein product		604069				8812487, 16112108	Standard	NM_003287		Approved	D53, hD53	uc003pzu.1	Q16890	OTTHUMG00000015505	ENST00000534000.1:c.423G>T	6.37:g.125574899G>T	ENSP00000434142:p.Met141Ile		A8K757|A8K772|A8MUD2|A8MUJ7|A8MW70|F6V707|O43397|Q5TC99|Q5TDQ0|Q9BUQ6|Q9C054	Missense_Mutation	SNP	pfam_TPD52	p.M141I	ENST00000534000.1	37	c.423	CCDS5130.1	6	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227958	0.79576	.	.	ENSG00000111907	ENST00000304877;ENST00000534000;ENST00000368402;ENST00000528193;ENST00000532429;ENST00000392484	T;T;T;T;T	0.44083	1.92;1.92;0.93;1.92;1.92	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.51092	0.1654	L	0.52126	1.63	0.80722	D	1	P;D	0.54964	0.908;0.969	P;D	0.70227	0.888;0.968	T	0.35943	-0.9768	10	0.36615	T	0.2	-20.5447	18.1962	0.89822	0.0:0.0:1.0:0.0	.	141;141	Q16890-2;Q16890	.;TPD53_HUMAN	I	146;141;141;141;112;141	ENSP00000306285:M146I;ENSP00000434142:M141I;ENSP00000357387:M141I;ENSP00000434743:M141I;ENSP00000435447:M112I	ENSP00000306285:M146I	M	+	3	0	TPD52L1	125616598	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.543000	0.82106	2.674000	0.91012	0.655000	0.94253	ATG	TPD52L1	-	pfam_TPD52	ENSG00000111907		0.313	TPD52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPD52L1	HGNC	protein_coding	OTTHUMT00000042065.2	-	0.00	54	0	G			125574899	+1	tier1	-	no_errors	ENST00000534000	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
TPSAB1	7177	genome.wustl.edu	37	16	1291473	1291473	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:1291473G>T	ENST00000338844.3	+	4	305	c.272G>T	c.(271-273)cGg>cTg	p.R91L	TPSAB1_ENST00000461509.2_Missense_Mutation_p.R98L	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	91	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				GTGCAACTGCGGGAGCAGCAC	0.677																																																	0													6.0	7.0	7.0					16																	1291473		2067	4073	6140	SO:0001583	missense	0			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.272G>T	16.37:g.1291473G>T	ENSP00000343577:p.Arg91Leu		D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R91L	ENST00000338844.3	37	c.272	CCDS10431.1	16	.	.	.	.	.	.	.	.	.	.	g	9.929	1.214375	0.22289	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.81579	-1.51;-1.51	3.38	1.37	0.22104	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.549745	0.15084	N	0.281496	T	0.76990	0.4065	N	0.14661	0.345	0.09310	N	1	D;D	0.76494	0.998;0.999	D;D	0.73708	0.968;0.981	T	0.64542	-0.6383	10	0.62326	D	0.03	.	5.7408	0.18092	0.2585:0.0:0.7415:0.0	.	82;91	Q15661-2;Q15661	.;TRYB1_HUMAN	L	91;98	ENSP00000343577:R91L;ENSP00000418247:R98L	ENSP00000343577:R91L	R	+	2	0	TPSAB1	1231474	0.000000	0.05858	0.488000	0.27440	0.388000	0.30384	0.188000	0.17018	0.271000	0.22005	-0.346000	0.07831	CGG	TPSAB1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000172236		0.677	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TPSAB1	HGNC	protein_coding	OTTHUMT00000206914.1		0.00	53	0	G	NM_003294		1291473	+1			no_errors	ENST00000338844	ensembl	human	known	74_37	missense	8.82	62	6	SNP	0.005	T
TRHDE	29953	genome.wustl.edu	37	12	72866848	72866848	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:72866848G>T	ENST00000261180.4	+	5	1433	c.1337G>T	c.(1336-1338)tGg>tTg	p.W446L		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	446					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TTACTGCAGTGGTTTGGTGAC	0.363																																																	0													258.0	243.0	248.0					12																	72866848		2203	4300	6503	SO:0001630	splice_region_variant	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1336-1G>T	12.37:g.72866848G>T			A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.W446L	ENST00000261180.4	37	c.1337	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.129253	0.94473	.	.	ENSG00000072657	ENST00000261180	T	0.47177	0.85	5.15	5.15	0.70609	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.76414	0.3984	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82703	-0.0326	10	0.87932	D	0	.	18.629	0.91352	0.0:0.0:1.0:0.0	.	446	Q9UKU6	TRHDE_HUMAN	L	446	ENSP00000261180:W446L	ENSP00000261180:W446L	W	+	2	0	TRHDE	71153115	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.800000	0.99124	2.400000	0.81607	0.650000	0.86243	TGG	TRHDE	-	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	ENSG00000072657		0.363	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	82	0	G	NM_013381	Missense_Mutation	72866848	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	9.80	92	10	SNP	1.000	T
TRIM24	8805	genome.wustl.edu	37	7	138255646	138255646	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:138255646G>C	ENST00000343526.4	+	11	1991	c.1776G>C	c.(1774-1776)acG>acC	p.T592T	TRIM24_ENST00000415680.2_Silent_p.T558T			O15164	TIF1A_HUMAN	tripartite motif containing 24	592					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						CCAGCCCCACGATTACTAGTG	0.488																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)												0													202.0	187.0	192.0					7																	138255646		2203	4300	6503	SO:0001819	synonymous_variant	0			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.1776G>C	7.37:g.138255646G>C			A4D1R7|A4D1R8|O95854	Silent	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain,prints_Bromodomain	p.T592	ENST00000343526.4	37	c.1776	CCDS5847.1	7																																																																																			TRIM24	-	NULL	ENSG00000122779		0.488	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM24	HGNC	protein_coding	OTTHUMT00000341814.1	-	0.00	165	0	G	NM_015905		138255646	+1	tier1	-	no_errors	ENST00000343526	ensembl	human	known	74_37	silent	8.30	209	19	SNP	0.999	C
TRIM3	10612	genome.wustl.edu	37	11	6477889	6477889	+	Missense_Mutation	SNP	C	C	G	rs373824947		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:6477889C>G	ENST00000525074.1	-	6	1461	c.1067G>C	c.(1066-1068)cGc>cCc	p.R356P	TRIM3_ENST00000345851.3_Missense_Mutation_p.R356P|TRIM3_ENST00000537602.1_Missense_Mutation_p.R278P|TRIM3_ENST00000529058.1_5'UTR|TRIM3_ENST00000536344.1_Missense_Mutation_p.R237P|TRIM3_ENST00000359518.3_Missense_Mutation_p.R356P	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	356					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTGCCTGTGCGCACCAACCG	0.657																																					Melanoma(6;5 510 1540 25169 29084)												0													39.0	41.0	40.0					11																	6477889		2200	4293	6493	SO:0001583	missense	0			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.1067G>C	11.37:g.6477889C>G	ENSP00000433102:p.Arg356Pro		B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.R356P	ENST00000525074.1	37	c.1067	CCDS7764.1	11	.	.	.	.	.	.	.	.	.	.	C	16.74	3.205946	0.58234	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344	D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74	5.27	5.27	0.74061	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.102948	0.64402	D	0.000004	D	0.85588	0.5731	L	0.49778	1.585	0.38026	D	0.935016	P;P;P	0.50617	0.863;0.937;0.888	P;P;P	0.60609	0.805;0.826;0.877	D	0.84381	0.0549	10	0.28530	T	0.3	-19.3503	11.0334	0.47787	0.0:0.9136:0.0:0.0864	.	237;237;356	F5H2Q8;D3DQT4;O75382	.;.;TRIM3_HUMAN	P	356;356;356;356;345;278;356;237	ENSP00000433102:R356P;ENSP00000340797:R356P;ENSP00000441091:R278P;ENSP00000352508:R356P;ENSP00000445460:R237P	ENSP00000337094:R345P	R	-	2	0	TRIM3	6434465	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	0.981000	0.29526	2.472000	0.83506	0.563000	0.77884	CGC	TRIM3	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000110171		0.657	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM3	HGNC	protein_coding	OTTHUMT00000384224.2	-	0.00	45	0	C	NM_006458		6477889	-1	tier1	-	no_errors	ENST00000345851	ensembl	human	known	74_37	missense	18.97	47	11	SNP	1.000	G
TRIM69	140691	genome.wustl.edu	37	15	45047271	45047271	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:45047271C>T	ENST00000559390.1	+	3	1108	c.180C>T	c.(178-180)ttC>ttT	p.F60F	TRIM69_ENST00000560442.1_Intron|TRIM69_ENST00000338264.4_Intron|TRIM69_ENST00000558173.1_5'UTR|TRIM69_ENST00000558329.1_Intron|TRIM69_ENST00000561043.1_Intron|TRIM69_ENST00000329464.4_Silent_p.F60F			Q86WT6	TRI69_HUMAN	tripartite motif containing 69	60	Necessary for nuclear localization. {ECO:0000250}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(9)|skin(1)	20		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		GCCACAACTTCTGTGAAGCCT	0.448																																					Pancreas(84;519 1450 1802 20427 34706)												0													163.0	135.0	145.0					15																	45047271		2198	4298	6496	SO:0001819	synonymous_variant	0			AF302088	CCDS10114.1, CCDS32220.1, CCDS73719.1	15q15-q21	2013-01-09	2011-01-25	2006-09-26	ENSG00000185880	ENSG00000185880		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	17857	protein-coding gene	gene with protein product			"""ring finger protein 36"", ""tripartite motif-containing 69"""	RNF36			Standard	XM_005254162		Approved	Trif, TRIMLESS	uc001zug.1	Q86WT6	OTTHUMG00000131246	ENST00000559390.1:c.180C>T	15.37:g.45047271C>T			A8MX03|Q309B0|Q4G1A5|Q6W897|Q8IYY3|Q8WY16|Q8WY17	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.F60	ENST00000559390.1	37	c.180	CCDS32220.1	15																																																																																			TRIM69	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000185880		0.448	TRIM69-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM69	HGNC	protein_coding	OTTHUMT00000416171.1	-	0.00	51	0	C			45047271	+1	tier1	-	no_errors	ENST00000329464	ensembl	human	known	74_37	silent	5.19	73	4	SNP	1.000	T
TRIP11	9321	genome.wustl.edu	37	14	92470434	92470434	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:92470434C>G	ENST00000267622.4	-	11	4259	c.3886G>C	c.(3886-3888)Ggg>Cgg	p.G1296R		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1296					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CAAAGCTGCCCAATGCTGTGC	0.418			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)			Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													49.0	51.0	50.0					14																	92470434		2202	4300	6502	SO:0001583	missense	0			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.3886G>C	14.37:g.92470434C>G	ENSP00000267622:p.Gly1296Arg		B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	superfamily_Ribosomal_L29,pfscan_GRIP	p.G1296R	ENST00000267622.4	37	c.3886	CCDS9899.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.48|10.48	1.361651|1.361651	0.24684|0.24684	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.04809|.	3.55|.	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.122706|.	0.56097|.	D|.	0.000031|.	T|T	0.57007|0.57007	0.2024|0.2024	L|L	0.27053|0.27053	0.805|0.805	0.48696|0.48696	D|D	0.999694|0.999694	D;D|.	0.76494|.	0.999;0.976|.	D;P|.	0.69142|.	0.962;0.793|.	T|T	0.52388|0.52388	-0.8582|-0.8582	10|5	0.18710|.	T|.	0.47|.	.|.	18.8153|18.8153	0.92075|0.92075	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1032;1296|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	R|S	1296;1032|1011	ENSP00000267622:G1296R|.	ENSP00000267622:G1296R|.	G|W	-|-	1|2	0|0	TRIP11|TRIP11	91540187|91540187	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.463000|0.463000	0.32649|0.32649	4.222000|4.222000	0.58580|0.58580	2.432000|2.432000	0.82394|0.82394	0.455000|0.455000	0.32223|0.32223	GGG|TGG	TRIP11	-	NULL	ENSG00000100815		0.418	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	-	0.00	53	0	C			92470434	-1	tier1	-	no_errors	ENST00000267622	ensembl	human	known	74_37	missense	12.05	73	10	SNP	1.000	G
TRPC4	7223	genome.wustl.edu	37	13	38357272	38357272	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:38357272C>T	ENST00000379705.3	-	2	1056	c.199G>A	c.(199-201)Gat>Aat	p.D67N	TRPC4_ENST00000355779.2_Missense_Mutation_p.D67N|TRPC4_ENST00000358477.2_Missense_Mutation_p.D67N|TRPC4_ENST00000338947.5_Missense_Mutation_p.D67N|TRPC4_ENST00000379681.3_Missense_Mutation_p.D67N|TRPC4_ENST00000447043.1_Missense_Mutation_p.D67N|TRPC4_ENST00000379679.1_Missense_Mutation_p.D67N|TRPC4_ENST00000426868.2_Missense_Mutation_p.D67N|TRPC4_ENST00000379673.2_Missense_Mutation_p.D67N			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	67					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		ccgagaggatcaatgcaatta	0.373																																																	0													94.0	98.0	97.0					13																	38357272		2203	4300	6503	SO:0001583	missense	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.199G>A	13.37:g.38357272C>T	ENSP00000369027:p.Asp67Asn		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC4_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.D67N	ENST00000379705.3	37	c.199	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	C	34	5.335793	0.95758	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	T;T;T;T;T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46	6.01	6.01	0.97437	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.66167	0.2762	L	0.39020	1.185	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.996;0.996;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;0.993;0.993;0.999;1.0	T	0.60439	-0.7263	10	0.36615	T	0.2	-33.756	20.5211	0.99222	0.0:1.0:0.0:0.0	.	67;67;67;67;67;67	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	N	67	ENSP00000369027:D67N;ENSP00000369003:D67N;ENSP00000342580:D67N;ENSP00000369001:D67N;ENSP00000410133:D67N;ENSP00000348025:D67N;ENSP00000351264:D67N;ENSP00000368995:D67N;ENSP00000414316:D67N	ENSP00000342580:D67N	D	-	1	0	TRPC4	37255272	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.818000	0.86416	2.861000	0.98227	0.650000	0.86243	GAT	TRPC4	-	superfamily_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	ENSG00000133107		0.373	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	-	0.00	65	0	C	NM_003306		38357272	-1	tier1	-	no_errors	ENST00000379681	ensembl	human	known	74_37	missense	9.52	57	6	SNP	1.000	T
TRPM3	80036	genome.wustl.edu	37	9	73477993	73477993	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:73477993C>A	ENST00000377111.2	-	3	536	c.293G>T	c.(292-294)gGc>gTc	p.G98V	TRPM3_ENST00000396292.4_5'Flank|TRPM3_ENST00000377105.1_5'UTR|TRPM3_ENST00000377101.1_5'UTR|TRPM3_ENST00000408909.2_5'Flank|TRPM3_ENST00000377097.3_5'Flank|TRPM3_ENST00000361823.5_5'UTR|TRPM3_ENST00000358082.3_5'Flank|TRPM3_ENST00000396283.1_5'UTR|TRPM3_ENST00000377110.3_Missense_Mutation_p.G98V|TRPM3_ENST00000377106.1_5'UTR|TRPM3_ENST00000437699.3_5'UTR|TRPM3_ENST00000396280.5_5'Flank|TRPM3_ENST00000357533.2_Missense_Mutation_p.G100V|TRPM3_ENST00000423814.3_Missense_Mutation_p.G100V|TRPM3_ENST00000360823.2_5'UTR|TRPM3_ENST00000396285.1_5'Flank	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	98					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GGGGGTGAGGCCAACATGCTG	0.473																																																	0													91.0	99.0	96.0					9																	73477993		2203	4299	6502	SO:0001583	missense	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.293G>T	9.37:g.73477993C>A	ENSP00000366315:p.Gly98Val		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.G100V	ENST00000377111.2	37	c.299		9	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771456	0.90108	.	.	ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000357533;ENST00000423814	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.61413	0.2345	L	0.38953	1.18	0.80722	D	1	P;P;D;B	0.57571	0.885;0.778;0.98;0.185	B;B;P;B	0.59825	0.244;0.312;0.864;0.132	T	0.51116	-0.8746	10	0.23302	T	0.38	2.5484	20.3854	0.98941	0.0:1.0:0.0:0.0	.	98;100;98;98	Q9HCF6;Q4VXD2;Q9HCF6-2;Q9HCF6-10	TRPM3_HUMAN;.;.;.	V	98;98;100;100	ENSP00000366315:G98V;ENSP00000366314:G98V;ENSP00000350140:G100V;ENSP00000389542:G100V	ENSP00000350140:G100V	G	-	2	0	TRPM3	72667813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.772000	0.68889	2.825000	0.97269	0.655000	0.94253	GGC	TRPM3	-	NULL	ENSG00000083067		0.473	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	-	0.00	52	0	C	NM_206945		73477993	-1	tier1	-	no_errors	ENST00000423814	ensembl	human	known	74_37	missense	20.83	57	15	SNP	1.000	A
TRPM6	140803	genome.wustl.edu	37	9	77377185	77377185	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:77377185T>C	ENST00000360774.1	-	26	4639	c.4402A>G	c.(4402-4404)Atc>Gtc	p.I1468V	TRPM6_ENST00000449912.2_Missense_Mutation_p.I1463V|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.I1468V|TRPM6_ENST00000451710.3_Missense_Mutation_p.I1468V|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.I1463V	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1468					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TTTTTCTTGATGCTAAACACA	0.493																																																	0													126.0	122.0	124.0					9																	77377185		2203	4300	6503	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4402A>G	9.37:g.77377185T>C	ENSP00000354006:p.Ile1468Val		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.I1468V	ENST00000360774.1	37	c.4402	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	T	0.465	-0.887242	0.02511	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T	0.52526	0.76;0.76;0.76;0.76;0.66	5.54	-1.65	0.08291	.	0.606749	0.16116	N	0.228867	T	0.17619	0.0423	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.13361	-1.0512	10	0.14656	T	0.56	.	1.696	0.02862	0.4242:0.0768:0.2113:0.2877	.	1468;1463;1463	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	V	1468;1468;1463;1463;1468	ENSP00000354006:I1468V;ENSP00000407341:I1468V;ENSP00000396672:I1463V;ENSP00000354962:I1463V;ENSP00000366060:I1468V	ENSP00000354006:I1468V	I	-	1	0	TRPM6	76567005	0.000000	0.05858	0.009000	0.14445	0.099000	0.18886	-0.562000	0.05950	-0.183000	0.10585	0.533000	0.62120	ATC	TRPM6	-	NULL	ENSG00000119121		0.493	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1		0.00	53	0	T	NM_017662		77377185	-1			no_errors	ENST00000451710	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.005	C
TRRAP	8295	genome.wustl.edu	37	7	98608682	98608682	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:98608682G>A	ENST00000359863.4	+	70	11113	c.10904G>A	c.(10903-10905)cGc>cAc	p.R3635H	TRRAP_ENST00000355540.3_Missense_Mutation_p.R3606H|AC004893.11_ENST00000360902.1_RNA|TRRAP_ENST00000446306.3_Missense_Mutation_p.R3624H	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3635	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CAGGTCCTCCGCGACATCCTC	0.502																																																	0													53.0	49.0	51.0					7																	98608682		2203	4300	6503	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10904G>A	7.37:g.98608682G>A	ENSP00000352925:p.Arg3635His		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R3635H	ENST00000359863.4	37	c.10904	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.085549|5.085549	0.94100|0.94100	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.03441	.|3.93;3.93	5.53|5.53	5.53|5.53	0.82687|0.82687	.|Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.21227|0.21227	0.0511|0.0511	M|M	0.83118|0.83118	2.625|2.625	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.74023	.|0.982;0.98;0.973	T|T	0.00444|0.00444	-1.1735|-1.1735	5|10	.|0.38643	.|T	.|0.18	.|.	19.4728|19.4728	0.94969|0.94969	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|3606;3363;3635	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	T|H	3364|3635;3606;3623	.|ENSP00000352925:R3635H;ENSP00000347733:R3606H	.|ENSP00000347733:R3606H	A|R	+|+	1|2	0|0	TRRAP|TRRAP	98446618|98446618	1.000000|1.000000	0.71417|0.71417	0.290000|0.290000	0.24890|0.24890	0.838000|0.838000	0.47535|0.47535	9.869000|9.869000	0.99810|0.99810	2.608000|2.608000	0.88229|0.88229	0.561000|0.561000	0.74099|0.74099	GCG|CGC	TRRAP	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000196367		0.502	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	25	0	G	NM_003496		98608682	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.995	A
TSHZ2	128553	genome.wustl.edu	37	20	51872528	51872528	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:51872528G>T	ENST00000371497.5	+	2	3418	c.2531G>T	c.(2530-2532)cGg>cTg	p.R844L	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.R841L|TSHZ2_ENST00000603338.2_Missense_Mutation_p.R841L	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	844					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AGAAAAGGCCGGCAGTCCAAC	0.522																																																	0													51.0	53.0	52.0					20																	51872528		2203	4300	6503	SO:0001583	missense	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2531G>T	20.37:g.51872528G>T	ENSP00000360552:p.Arg844Leu		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.R844L	ENST00000371497.5	37	c.2531	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461494	0.84317	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.30714	1.53;1.52	5.52	5.52	0.82312	Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.52725	0.1752	L	0.49126	1.545	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.52749	-0.8534	10	0.87932	D	0	-5.6145	19.4542	0.94880	0.0:0.0:1.0:0.0	.	844	Q9NRE2	TSH2_HUMAN	L	844;841;370	ENSP00000360552:R844L;ENSP00000333114:R841L	ENSP00000333114:R841L	R	+	2	0	TSHZ2	51305935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.470000	0.97683	2.592000	0.87571	0.643000	0.83706	CGG	TSHZ2	-	superfamily_Homeodomain-like,smart_Homeobox_dom	ENSG00000182463		0.522	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	-	0.00	67	0	G	NM_173485		51872528	+1	tier1	-	no_errors	ENST00000371497	ensembl	human	known	74_37	missense	14.49	59	10	SNP	1.000	T
TSR2	90121	genome.wustl.edu	37	X	54467182	54467182	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chrX:54467182G>T	ENST00000375151.4	+	2	162	c.141G>T	c.(139-141)ggG>ggT	p.G47G		NM_058163.1	NP_477511.1	Q969E8	TSR2_HUMAN	TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)	47					rRNA processing (GO:0006364)					breast(1)|endometrium(3)|lung(2)	6						AGTGGCTGGGGGGTGCAGTGG	0.617																																																	0													52.0	49.0	50.0					X																	54467182		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007699	CCDS14358.1	Xp11.22	2008-10-01			ENSG00000158526	ENSG00000158526			25455	protein-coding gene	gene with protein product	"""WGG motif containing 1"""					9417904	Standard	NM_058163		Approved	DT1P1A10, RP1-112K5.2, WGG1	uc004dte.3	Q969E8	OTTHUMG00000021628	ENST00000375151.4:c.141G>T	X.37:g.54467182G>T				Silent	SNP	pfam_Pre-rRNA_process_TSR2	p.G47	ENST00000375151.4	37	c.141	CCDS14358.1	X																																																																																			TSR2	-	pfam_Pre-rRNA_process_TSR2	ENSG00000158526		0.617	TSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR2	HGNC	protein_coding	OTTHUMT00000056802.1	-	0.00	183	0	G	NM_058163		54467182	+1	tier1	-	no_errors	ENST00000375151	ensembl	human	known	74_37	silent	5.83	210	13	SNP	1.000	T
TSSC1	7260	genome.wustl.edu	37	2	3193279	3193279	+	Splice_Site	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:3193279C>A	ENST00000382125.4	-	9	1182	c.990G>T	c.(988-990)aaG>aaT	p.K330N	TSSC1_ENST00000398659.4_Splice_Site_p.K357N|TSSC1_ENST00000478754.1_5'UTR	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	330										breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		GCTCCTTGCTCCTGCAATGCA	0.667																																					Colon(140;1261 1762 4183 34270 49743)												0													33.0	27.0	29.0					2																	3193279		2184	4277	6461	SO:0001630	splice_region_variant	0			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.990-1G>T	2.37:g.3193279C>A			D6W4Y1|O43179|Q53S19|Q53SG2	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K330N	ENST00000382125.4	37	c.990	CCDS1651.1	2	.	.	.	.	.	.	.	.	.	.	C	16.23	3.063209	0.55432	.	.	ENSG00000032389	ENST00000382125;ENST00000398659	D;D	0.83506	-1.66;-1.73	5.11	3.27	0.37495	WD40/YVTN repeat-like-containing domain (1);	0.045524	0.85682	D	0.000000	T	0.74749	0.3757	L	0.60455	1.87	0.80722	D	1	P	0.41475	0.751	B	0.34590	0.186	T	0.72246	-0.4349	10	0.21014	T	0.42	.	10.9277	0.47199	0.0:0.859:0.0:0.141	.	330	Q53HC9	TSSC1_HUMAN	N	330;357	ENSP00000371559:K330N;ENSP00000381652:K357N	ENSP00000371559:K330N	K	-	3	2	TSSC1	3172286	1.000000	0.71417	0.867000	0.34043	0.876000	0.50452	3.928000	0.56506	2.369000	0.80426	0.591000	0.81541	AAG	TSSC1	-	NULL	ENSG00000032389		0.667	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC1	HGNC	protein_coding	OTTHUMT00000206694.2	-	0.00	61	0	C	NM_003310	Missense_Mutation	3193279	-1	tier1	-	no_errors	ENST00000382125	ensembl	human	known	74_37	missense	28.30	38	15	SNP	1.000	A
TTC24	164118	genome.wustl.edu	37	1	156554758	156554758	+	Silent	SNP	C	C	A	rs551186311	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:156554758C>A	ENST00000368237.3	+	6	1341	c.1341C>A	c.(1339-1341)gtC>gtA	p.V447V	TTC24_ENST00000478081.1_3'UTR|AL365181.1_ENST00000581084.1_RNA|TTC24_ENST00000368236.3_Silent_p.V447V			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	447										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGCAGGTGTCCAGCACAGGT	0.642													C|||	9	0.00179712	0.0	0.0	5008	,	,		16349	0.0		0.0	False		,,,				2504	0.0092																0													22.0	26.0	24.0					1																	156554758		2095	4230	6325	SO:0001819	synonymous_variant	0				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.1341C>A	1.37:g.156554758C>A			Q5T3H7	Silent	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V447	ENST00000368237.3	37	c.1341	CCDS53379.1	1	.	.	.	.	.	.	.	.	.	.	C	6.961	0.547286	0.13312	.	.	ENSG00000187862	ENST00000340086	.	.	.	3.61	-2.45	0.06481	.	.	.	.	.	T	0.06645	0.0170	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35549	-0.9784	4	.	.	.	-3.0E-4	1.8213	0.03111	0.2978:0.2277:0.3605:0.114	.	.	.	.	Y	220	.	.	S	+	2	0	TTC24	154821382	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.524000	0.22940	-0.464000	0.06963	-0.310000	0.09108	TCC	TTC24	-	NULL	ENSG00000187862		0.642	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1	-	0.00	51	0	C	XM_089384		156554758	+1	tier1	-	no_errors	ENST00000368236	ensembl	human	known	74_37	silent	13.64	38	6	SNP	0.000	A
CFAP46	54777	genome.wustl.edu	37	10	134623983	134623983	+	Missense_Mutation	SNP	G	G	T	rs374013049	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:134623983G>T	ENST00000368586.5	-	57	7694	c.7594C>A	c.(7594-7596)Cgt>Agt	p.R2532S	TTC40_ENST00000263170.5_Missense_Mutation_p.R693S	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GCTTCCCAACGGCCAACAGAT	0.642																																																	0													73.0	61.0	65.0					10																	134623983		2203	4300	6503	SO:0001583	missense	0																														ENST00000368586.5:c.7594C>A	10.37:g.134623983G>T	ENSP00000357575:p.Arg2532Ser			Missense_Mutation	SNP	NULL	p.R693S	ENST00000368586.5	37	c.2077	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	G	0.213	-1.034968	0.02029	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.11821	2.98;2.74	2.98	-5.63	0.02474	.	10.401100	0.00166	N	0.000000	T	0.06280	0.0162	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28267	-1.0049	10	0.54805	T	0.06	.	2.5502	0.04747	0.1275:0.3971:0.2546:0.2208	.	693	Q8IYW2	CJ092_HUMAN	S	2532;693	ENSP00000357575:R2532S;ENSP00000263170:R693S	ENSP00000263170:R693S	R	-	1	0	C10orf93	134473973	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.355000	0.01088	-1.398000	0.02066	-0.282000	0.10007	CGT	TTC40	-	NULL	ENSG00000171811		0.642	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	-	0.00	55	0	G			134623983	-1	tier1	-	no_errors	ENST00000263170	ensembl	human	known	74_37	missense	6.82	81	6	SNP	0.000	T
CFAP46	54777	genome.wustl.edu	37	10	134682826	134682826	+	Missense_Mutation	SNP	T	T	A	rs559618044	byFrequency	TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:134682826T>A	ENST00000368586.5	-	33	4662	c.4562A>T	c.(4561-4563)cAt>cTt	p.H1521L		NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CGCCTCTTCATGGCGCGCGGC	0.682																																																	0																																										SO:0001583	missense	0																														ENST00000368586.5:c.4562A>T	10.37:g.134682826T>A	ENSP00000357575:p.His1521Leu			Missense_Mutation	SNP	NULL	p.H1521L	ENST00000368586.5	37	c.4562	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	T	8.774	0.926648	0.18056	.	.	ENSG00000171811	ENST00000368586	T	0.15256	2.44	4.81	4.81	0.61882	.	.	.	.	.	T	0.30885	0.0779	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.02498	-1.1150	6	0.56958	D	0.05	.	11.8825	0.52583	0.0:0.0:0.0:1.0	.	.	.	.	L	1521	ENSP00000357575:H1521L	ENSP00000357575:H1521L	H	-	2	0	C10orf93	134532816	0.735000	0.28153	0.536000	0.28039	0.037000	0.13140	1.378000	0.34328	1.795000	0.52594	0.482000	0.46254	CAT	TTC40	-	NULL	ENSG00000171811		0.682	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	-	0.00	32	0	T			134682826	-1	tier1	-	no_errors	ENST00000368586	ensembl	human	putative	74_37	missense	10.00	36	4	SNP	0.956	A
CFAP46	54777	genome.wustl.edu	37	10	134694436	134694436	+	Missense_Mutation	SNP	C	C	G	rs201792620		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:134694436C>G	ENST00000368586.5	-	28	3828	c.3728G>C	c.(3727-3729)cGc>cCc	p.R1243P	TTC40_ENST00000368582.2_Missense_Mutation_p.R1243P	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GACAGCCCAGCGGAGGTGGAA	0.642																																																	0																																										SO:0001583	missense	0																														ENST00000368586.5:c.3728G>C	10.37:g.134694436C>G	ENSP00000357575:p.Arg1243Pro			Missense_Mutation	SNP	NULL	p.R1243P	ENST00000368586.5	37	c.3728	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	0.783	-0.761586	0.02996	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.43688	2.93;0.94	3.63	-7.26	0.01466	.	.	.	.	.	T	0.34366	0.0895	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.45071	-0.9286	6	0.59425	D	0.04	.	6.5703	0.22535	0.0:0.2262:0.2902:0.4836	.	.	.	.	P	1243	ENSP00000357575:R1243P;ENSP00000357571:R1243P	ENSP00000357571:R1243P	R	-	2	0	C10orf93	134544426	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.172000	0.09868	-3.067000	0.00255	-1.169000	0.01745	CGC	TTC40	-	NULL	ENSG00000171811		0.642	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	-	0.00	47	0	C			134694436	-1	tier1	-	no_errors	ENST00000368582	ensembl	human	known	74_37	missense	8.47	53	5	SNP	0.000	G
TTC7A	57217	genome.wustl.edu	37	2	47185691	47185691	+	Intron	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:47185691G>T	ENST00000319190.5	+	3	885				RP11-15I20.1_ENST00000607950.1_RNA|TTC7A_ENST00000409245.1_Intron|TTC7A_ENST00000461601.1_3'UTR|TTC7A_ENST00000263737.6_Intron|TTC7A_ENST00000394850.2_Intron	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A						cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			CTGCAGGGGAGGTAAGGAGAC	0.647																																																	0																																										SO:0001627	intron_variant	0			AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.517+1545G>T	2.37:g.47185691G>T			Q6PIX4|Q8ND67|Q9BUS3	RNA	SNP	-	NULL	ENST00000319190.5	37	NULL	CCDS33193.1	2																																																																																			TTC7A	-	-	ENSG00000068724		0.647	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC7A	HGNC	protein_coding	OTTHUMT00000329667.2	-	0.00	51	0	G	XM_372927		47185691	+1	tier1	-	no_errors	ENST00000461601	ensembl	human	known	74_37	rna	6.78	55	4	SNP	1.000	T
TTLL9	164395	genome.wustl.edu	37	20	30497560	30497560	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:30497560G>T	ENST00000375938.4	+	6	592	c.339G>T	c.(337-339)atG>atT	p.M113I	TTLL9_ENST00000375921.2_Missense_Mutation_p.M63I|TTLL9_ENST00000375934.4_Missense_Mutation_p.M95I|TTLL9_ENST00000535842.1_Missense_Mutation_p.M113I|TTLL9_ENST00000310998.4_Missense_Mutation_p.M63I|TTLL9_ENST00000375922.4_Missense_Mutation_p.M63I			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	113	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGAACTACATGGTGAAGAACC	0.607																																																	0													34.0	38.0	37.0					20																	30497560		2081	4225	6306	SO:0001583	missense	0			AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.339G>T	20.37:g.30497560G>T	ENSP00000365105:p.Met113Ile		A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.M113I	ENST00000375938.4	37	c.339	CCDS42863.1	20	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058061	0.55325	.	.	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000310998;ENST00000375921;ENST00000375934;ENST00000375922	T;T;T;T;T;T	0.05513	3.43;3.43;3.43;3.43;3.43;3.43	5.21	5.21	0.72293	.	0.168917	0.64402	D	0.000005	T	0.13586	0.0329	M	0.84773	2.715	0.48236	D	0.999616	B	0.17465	0.022	B	0.28991	0.097	T	0.01925	-1.1246	10	0.66056	D	0.02	.	9.5875	0.39526	0.101:0.0:0.899:0.0	.	113	Q3SXZ7	TTLL9_HUMAN	I	113;113;63;63;95;63	ENSP00000365105:M113I;ENSP00000442515:M113I;ENSP00000308980:M63I;ENSP00000365086:M63I;ENSP00000365100:M95I;ENSP00000365088:M63I	ENSP00000308980:M63I	M	+	3	0	TTLL9	29961221	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	4.643000	0.61390	2.592000	0.87571	0.561000	0.74099	ATG	TTLL9	-	pfam_TTL/TTLL_fam	ENSG00000131044		0.607	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL9	HGNC	protein_coding		-	0.00	51	0	G	NM_001008409		30497560	+1	tier1	-	no_errors	ENST00000375938	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179479481	179479481	+	Splice_Site	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:179479481C>G	ENST00000591111.1	-	211	44062		c.e211-1		TTN_ENST00000342175.6_Splice_Site|TTN_ENST00000589042.1_Splice_Site|TTN_ENST00000342992.6_Splice_Site|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Splice_Site|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Splice_Site|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGGGGCCTCTGAATTGGAA	0.408																																																	0													50.0	44.0	46.0					2																	179479481		1820	4080	5900	SO:0001630	splice_region_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.43838-1G>C	2.37:g.179479481C>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	-	e209-1	ENST00000591111.1	37	c.41057-1		2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961831	0.74016	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0401	0.97581	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTN	179187726	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.704000	0.84595	2.805000	0.96524	0.655000	0.94253	.	TTN	-	-	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	29	0	C	NM_133378	Intron	179479481	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	splice_site	5.45	52	3	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179614278	179614278	+	Intron	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:179614278C>A	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.R4283S|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAAATGTGCCCTTACAGATT	0.368																																																	0													63.0	64.0	64.0					2																	179614278		2203	4299	6502	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3572G>T	2.37:g.179614278C>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R4283S	ENST00000591111.1	37	c.12849		2	.	.	.	.	.	.	.	.	.	.	C	13.27	2.187971	0.38609	.	.	ENSG00000155657	ENST00000360870	T	0.56444	0.46	6.17	2.02	0.26589	.	.	.	.	.	T	0.31420	0.0796	N	0.19112	0.55	0.09310	N	0.999993	B	0.23249	0.082	B	0.21708	0.036	T	0.24799	-1.0150	9	0.09590	T	0.72	.	7.4195	0.27063	0.0:0.4425:0.0:0.5575	.	4283	Q8WZ42-6	.	S	4283	ENSP00000354117:R4283S	ENSP00000354117:R4283S	R	-	3	2	TTN	179322523	0.003000	0.15002	0.062000	0.19696	0.597000	0.36814	0.358000	0.20216	0.143000	0.18926	-0.150000	0.13652	AGG	TTN	-	NULL	ENSG00000155657		0.368	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	71	0	C	NM_133378		179614278	-1			no_errors	ENST00000360870	ensembl	human	known	74_37	missense	5.56	85	5	SNP	0.118	A
TTYH3	80727	genome.wustl.edu	37	7	2687177	2687177	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:2687177G>C	ENST00000258796.7	+	4	736	c.531G>C	c.(529-531)acG>acC	p.T177T	TTYH3_ENST00000403167.1_5'Flank|TTYH3_ENST00000407643.1_Silent_p.T177T	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	177					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		TGCTGGAGACGCTGCTGGGCT	0.701																																																	0													15.0	15.0	15.0					7																	2687177		2128	4209	6337	SO:0001819	synonymous_variant	0				CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.531G>C	7.37:g.2687177G>C			A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Silent	SNP	pfam_Tweety	p.T177	ENST00000258796.7	37	c.531	CCDS34588.1	7																																																																																			TTYH3	-	pfam_Tweety	ENSG00000136295		0.701	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTYH3	HGNC	protein_coding	OTTHUMT00000325082.2		0.00	60	0	G	XM_166523		2687177	+1			no_errors	ENST00000258796	ensembl	human	known	74_37	silent	9.80	46	5	SNP	0.000	C
TUBA3D	113457	genome.wustl.edu	37	2	132235781	132235781	+	Silent	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:132235781C>T	ENST00000321253.6	+	2	155	c.48C>T	c.(46-48)atC>atT	p.I16I		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	16					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		GTGTCCAGATCGGCAATGCCT	0.502																																					Ovarian(137;2059 2432 35543 39401)												0													85.0	83.0	84.0					2																	132235781		2203	4297	6500	SO:0001819	synonymous_variant	0			K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.48C>T	2.37:g.132235781C>T			A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.I16	ENST00000321253.6	37	c.48	CCDS33290.1	2																																																																																			TUBA3D	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,prints_Tubulin	ENSG00000075886		0.502	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3D	HGNC	protein_coding	OTTHUMT00000331800.2	-	0.00	134	0	C	NM_080386		132235781	+1	tier1	-	no_errors	ENST00000321253	ensembl	human	known	74_37	silent	7.36	151	12	SNP	0.998	T
TVP23A	780776	genome.wustl.edu	37	16	10864159	10864159	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:10864159G>C	ENST00000299866.8	-	7	903	c.612C>G	c.(610-612)ggC>ggG	p.G204G	TVP23A_ENST00000572980.1_5'UTR	NM_001079512.2	NP_001072980.1	A6NH52	TV23A_HUMAN	trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)	204						integral component of membrane (GO:0016021)											GCCCCTCGAGGCCAGGCTTCT	0.552																																																	0													32.0	34.0	33.0					16																	10864159		1778	3851	5629	SO:0001819	synonymous_variant	0				CCDS45408.1	16p13.3	2012-11-29	2012-11-29	2012-11-29	ENSG00000166676	ENSG00000166676			20398	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member A"""	FAM18A			Standard	NM_001079512		Approved	YDR084C	uc010buo.1	A6NH52	OTTHUMG00000177389	ENST00000299866.8:c.612C>G	16.37:g.10864159G>C			B2RUV4|B7ZW18	Silent	SNP	pfam_DUF846_euk	p.G204	ENST00000299866.8	37	c.612	CCDS45408.1	16																																																																																			TVP23A	-	NULL	ENSG00000166676		0.552	TVP23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TVP23A	HGNC	protein_coding	OTTHUMT00000436680.1	-	0.00	40	0	G	NM_001079512		10864159	-1	tier1	-	no_errors	ENST00000299866	ensembl	human	known	74_37	silent	20.63	50	13	SNP	0.008	C
TXLNB	167838	genome.wustl.edu	37	6	139564250	139564250	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:139564250C>T	ENST00000358430.3	-	10	1700	c.1468G>A	c.(1468-1470)Gca>Aca	p.A490T	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	490						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		ACCTCCTCTGCGTCAATCTCT	0.458																																																	0													119.0	122.0	121.0					6																	139564250		2203	4300	6503	SO:0001583	missense	0				CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1468G>A	6.37:g.139564250C>T	ENSP00000351206:p.Ala490Thr		Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	pfam_Taxilin_fam	p.A490T	ENST00000358430.3	37	c.1468	CCDS34545.1	6	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880748	0.33255	.	.	ENSG00000164440	ENST00000358430	T	0.15718	2.4	6.06	1.15	0.20763	.	0.869260	0.10439	N	0.674536	T	0.02230	0.0069	N	0.19112	0.55	0.09310	N	1	B	0.25312	0.123	B	0.12837	0.008	T	0.47209	-0.9135	9	.	.	.	-1.4245	2.1403	0.03772	0.1204:0.4386:0.1171:0.3239	.	490	Q8N3L3	TXLNB_HUMAN	T	490	ENSP00000351206:A490T	.	A	-	1	0	TXLNB	139605943	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.913000	0.04042	-0.071000	0.12886	-0.176000	0.13171	GCA	TXLNB	-	NULL	ENSG00000164440		0.458	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNB	HGNC	protein_coding	OTTHUMT00000042458.1	-	0.00	80	0	C	NM_153235		139564250	-1	tier1	-	no_errors	ENST00000358430	ensembl	human	known	74_37	missense	11.22	87	11	SNP	0.000	T
TYK2	7297	genome.wustl.edu	37	19	10461829	10461829	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:10461829C>G	ENST00000525621.1	-	24	3809	c.3328G>C	c.(3328-3330)Gag>Cag	p.E1110Q	TYK2_ENST00000524462.1_Missense_Mutation_p.E925Q|TYK2_ENST00000264818.6_Missense_Mutation_p.E1110Q|TYK2_ENST00000529422.1_5'UTR	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	1110	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CCTATGAGCTCAAGGAATTTC	0.512																																																	0													52.0	47.0	48.0					19																	10461829		2203	4300	6503	SO:0001583	missense	0				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.3328G>C	19.37:g.10461829C>G	ENSP00000431885:p.Glu1110Gln		Q6QB10|Q96CH0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.E1110Q	ENST00000525621.1	37	c.3328	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169889	0.78452	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792	T;T;T	0.76968	-1.06;-1.05;-1.05	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000070	T	0.77103	0.4081	N	0.12637	0.245	0.80722	D	1	D	0.65815	0.995	D	0.63033	0.91	T	0.78086	-0.2341	10	0.37606	T	0.19	-43.5793	17.2702	0.87099	0.0:1.0:0.0:0.0	.	1110	P29597	TYK2_HUMAN	Q	925;1110;1110;857	ENSP00000433203:E925Q;ENSP00000431885:E1110Q;ENSP00000264818:E1110Q	ENSP00000264818:E1110Q	E	-	1	0	TYK2	10322829	0.965000	0.33210	0.960000	0.40013	0.597000	0.36814	2.272000	0.43373	2.676000	0.91093	0.591000	0.81541	GAG	TYK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_dom	ENSG00000105397		0.512	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1		0.00	32	0	C			10461829	-1			no_errors	ENST00000264818	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.999	G
TYK2	7297	genome.wustl.edu	37	19	10463209	10463209	+	Silent	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:10463209C>G	ENST00000525621.1	-	23	3700	c.3219G>C	c.(3217-3219)ctG>ctC	p.L1073L	TYK2_ENST00000524462.1_Silent_p.L888L|TYK2_ENST00000264818.6_Silent_p.L1073L|TYK2_ENST00000529422.1_Intron	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	1073	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TATACTCCTTCAGGCACTCTG	0.622																																																	0													69.0	70.0	70.0					19																	10463209		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.3219G>C	19.37:g.10463209C>G			Q6QB10|Q96CH0	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.L1073	ENST00000525621.1	37	c.3219	CCDS12236.1	19																																																																																			TYK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000105397		0.622	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	-	0.00	52	0	C			10463209	-1	tier1	-	no_errors	ENST00000264818	ensembl	human	known	74_37	silent	7.95	81	7	SNP	0.998	G
TYR	7299	genome.wustl.edu	37	11	89028425	89028425	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr11:89028425G>T	ENST00000263321.5	+	5	1983	c.1481G>T	c.(1480-1482)gGg>gTg	p.G494V		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	494					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CTGCTGGCAGGGCTTGTGAGC	0.537																																																	0													37.0	39.0	39.0					11																	89028425		2200	4299	6499	SO:0001583	missense	0			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1481G>T	11.37:g.89028425G>T	ENSP00000263321:p.Gly494Val		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.G494V	ENST00000263321.5	37	c.1481	CCDS8284.1	11	.	.	.	.	.	.	.	.	.	.	G	2.167	-0.390873	0.04932	.	.	ENSG00000077498	ENST00000263321	D	0.99080	-5.4	5.02	3.06	0.35304	.	0.408058	0.26991	N	0.021474	D	0.95611	0.8573	N	0.13098	0.295	0.23464	N	0.997629	B	0.14012	0.009	B	0.09377	0.004	D	0.87017	0.2126	9	.	.	.	.	14.0848	0.64949	0.0:0.4381:0.5618:0.0	.	494	P14679	TYRO_HUMAN	V	494	ENSP00000263321:G494V	.	G	+	2	0	TYR	88668073	0.009000	0.17119	0.000000	0.03702	0.170000	0.22686	0.707000	0.25704	0.578000	0.29487	0.455000	0.32223	GGG	TYR	-	NULL	ENSG00000077498		0.537	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	-	0.00	75	0	G	NM_000372		89028425	+1	tier1	-	no_errors	ENST00000263321	ensembl	human	known	74_37	missense	15.38	66	12	SNP	0.001	T
UAP1L1	91373	genome.wustl.edu	37	9	139975304	139975304	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr9:139975304G>T	ENST00000409858.3	+	7	1374	c.1342G>T	c.(1342-1344)Gcc>Tcc	p.A448S	UAP1L1_ENST00000360271.3_Missense_Mutation_p.A325S	NM_207309.2	NP_997192.2	Q3KQV9	UAP1L_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1 like 1	448							uridylyltransferase activity (GO:0070569)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		TGCCCATGGGGCCTGGCTCCC	0.692																																																	0													15.0	19.0	17.0					9																	139975304		2193	4285	6478	SO:0001583	missense	0			AK022632	CCDS7028.2	9q34.3	2014-07-31	2014-07-31		ENSG00000197355	ENSG00000197355			28082	protein-coding gene	gene with protein product							Standard	NM_207309		Approved		uc010ncb.3	Q3KQV9	OTTHUMG00000020962	ENST00000409858.3:c.1342G>T	9.37:g.139975304G>T	ENSP00000386935:p.Ala448Ser		A2AMJ8|Q5SPZ2|Q69YQ3|Q6ZR38	Missense_Mutation	SNP	pfam_UDPGP_trans	p.A448S	ENST00000409858.3	37	c.1342	CCDS7028.2	9	.	.	.	.	.	.	.	.	.	.	G	0.772	-0.765527	0.02996	.	.	ENSG00000197355	ENST00000409858;ENST00000360271	T;T	0.16597	2.33;2.33	4.03	2.12	0.27331	.	1.161700	0.06172	N	0.677815	T	0.08492	0.0211	N	0.14661	0.345	0.09310	N	1	B;B	0.13594	0.008;0.006	B;B	0.15052	0.012;0.012	T	0.34079	-0.9843	10	0.02654	T	1	.	5.1291	0.14899	0.1041:0.0:0.5076:0.3883	.	448;325	Q3KQV9;Q3KQV9-2	UAP1L_HUMAN;.	S	448;325	ENSP00000386935:A448S;ENSP00000353409:A325S	ENSP00000353409:A325S	A	+	1	0	UAP1L1	139095125	0.000000	0.05858	0.022000	0.16811	0.124000	0.20399	0.438000	0.21559	0.181000	0.19994	-0.311000	0.09066	GCC	UAP1L1	-	pfam_UDPGP_trans	ENSG00000197355		0.692	UAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UAP1L1	HGNC	protein_coding	OTTHUMT00000055216.2	-	0.00	65	0	G	XM_038063		139975304	+1	tier1	-	no_errors	ENST00000409858	ensembl	human	known	74_37	missense	11.27	63	8	SNP	0.012	T
UBE2O	63893	genome.wustl.edu	37	17	74392719	74392719	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:74392719C>A	ENST00000319380.7	-	14	2363	c.2299G>T	c.(2299-2301)Gtg>Ttg	p.V767L	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	767					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						TCAGGGGCCACCGGCTGCTCC	0.647																																																	0													49.0	57.0	54.0					17																	74392719		2203	4298	6501	SO:0001583	missense	0			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.2299G>T	17.37:g.74392719C>A	ENSP00000323687:p.Val767Leu		A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.V767L	ENST00000319380.7	37	c.2299	CCDS32742.1	17	.	.	.	.	.	.	.	.	.	.	C	1.786	-0.480784	0.04383	.	.	ENSG00000175931	ENST00000319380	T	0.71934	-0.61	4.42	-1.64	0.08318	.	1.138540	0.06446	N	0.726847	T	0.41880	0.1178	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16808	-1.0390	10	0.14656	T	0.56	0.0226	1.421	0.02312	0.1216:0.351:0.238:0.2894	.	767	Q9C0C9	UBE2O_HUMAN	L	767	ENSP00000323687:V767L	ENSP00000323687:V767L	V	-	1	0	UBE2O	71904314	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.079000	0.14782	-0.127000	0.11661	-0.502000	0.04539	GTG	UBE2O	-	NULL	ENSG00000175931		0.647	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	HGNC	protein_coding	OTTHUMT00000450123.1	-	0.00	45	0	C	NM_022066		74392719	-1	tier1	-	no_errors	ENST00000319380	ensembl	human	known	74_37	missense	9.80	46	5	SNP	0.000	A
UGDH	7358	genome.wustl.edu	37	4	39512441	39512441	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:39512441C>A	ENST00000316423.6	-	4	647	c.305G>T	c.(304-306)cGg>cTg	p.R102L	UGDH_ENST00000506179.1_Missense_Mutation_p.R102L|UGDH_ENST00000501493.2_Intron|UGDH_ENST00000515398.1_5'UTR|UGDH_ENST00000507089.1_Missense_Mutation_p.R5L	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	102					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)			breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						ATCTGCTGCCCGGCCTTTCCC	0.423																																																	0													113.0	105.0	108.0					4																	39512441		2203	4300	6503	SO:0001583	missense	0			AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.305G>T	4.37:g.39512441C>A	ENSP00000319501:p.Arg102Leu		B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	pfam_UDP-Glc/GDP-Man_DH_N,pfam_UDP-Glc/GDP-Man_DH_C,pfam_UDP-Glc/GDP-Man_DH_dimer,superfamily_UDP-Glc/GDP-Man_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_UDP-Glc/GDP-Man	p.R102L	ENST00000316423.6	37	c.305	CCDS3455.1	4	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412642	0.83340	.	.	ENSG00000109814	ENST00000316423;ENST00000506179;ENST00000507089;ENST00000515021;ENST00000514106;ENST00000509391	T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.95	5.12	0.69794	UDP-glucose/GDP-mannose dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.76681	0.4021	M	0.72118	2.19	0.80722	D	1	P	0.47545	0.897	B	0.42214	0.38	T	0.75972	-0.3129	10	0.29301	T	0.29	2.3829	14.1156	0.65151	0.0:0.9287:0.0:0.0713	.	102	O60701	UGDH_HUMAN	L	102;102;5;115;102;102	ENSP00000319501:R102L;ENSP00000421757:R102L;ENSP00000426560:R5L;ENSP00000421954:R115L;ENSP00000425834:R102L;ENSP00000422603:R102L	ENSP00000319501:R102L	R	-	2	0	UGDH	39188836	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	7.221000	0.78016	1.535000	0.49220	0.650000	0.86243	CGG	UGDH	-	pfam_UDP-Glc/GDP-Man_DH_N,tigrfam_UDP-Glc/GDP-Man	ENSG00000109814		0.423	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGDH	HGNC	protein_coding	OTTHUMT00000216818.3	-	0.00	47	0	C	NM_003359		39512441	-1	tier1	-	no_errors	ENST00000316423	ensembl	human	known	74_37	missense	9.52	76	8	SNP	1.000	A
UHRF1	29128	genome.wustl.edu	37	19	4961536	4961536	+	RNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:4961536G>T	ENST00000592666.1	+	0	3679							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		GACGCTGTCCGACGAAGGCGG	0.582																																																	0																																												0			AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4961536G>T			A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	SNP	-	NULL	ENST00000592666.1	37	NULL		19																																																																																			UHRF1	-	-	ENSG00000034063		0.582	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	HGNC	processed_transcript	OTTHUMT00000450444.1	-	0.00	9	0	G	NM_001048201		4961536	+1	tier1	-	no_errors	ENST00000262952	ensembl	human	known	74_37	rna	20.00	16	4	SNP	0.000	T
UNC5C	8633	genome.wustl.edu	37	4	96123921	96123921	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:96123921G>C	ENST00000453304.1	-	12	2445	c.2097C>G	c.(2095-2097)atC>atG	p.I699M		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	699	Interaction with DCC. {ECO:0000250}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		AGTAGACTCGGATGCTGTACT	0.602																																																	0													91.0	83.0	86.0					4																	96123921		2203	4300	6503	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2097C>G	4.37:g.96123921G>C	ENSP00000406022:p.Ile699Met		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.I699M	ENST00000453304.1	37	c.2097	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663651	0.47572	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796	T;T	0.59224	0.62;0.28	5.61	1.84	0.25277	.	0.285399	0.38005	N	0.001860	T	0.63070	0.2480	M	0.69823	2.125	0.80722	D	1	P;P	0.43477	0.76;0.808	P;P	0.50537	0.643;0.523	T	0.61098	-0.7131	10	0.54805	T	0.06	.	9.446	0.38697	0.3473:0.0:0.6527:0.0	.	699;699	A8K385;O95185	.;UNC5C_HUMAN	M	699;658;718	ENSP00000406022:I699M;ENSP00000426924:I718M	ENSP00000328673:I658M	I	-	3	3	UNC5C	96342944	1.000000	0.71417	0.856000	0.33681	0.972000	0.66771	1.532000	0.36029	0.085000	0.17107	-0.137000	0.14449	ATC	UNC5C	-	NULL	ENSG00000182168		0.602	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	-	0.00	50	0	G	NM_003728		96123921	-1	tier1	-	no_errors	ENST00000453304	ensembl	human	known	74_37	missense	8.82	62	6	SNP	1.000	C
UPB1	51733	genome.wustl.edu	37	22	24919603	24919603	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr22:24919603C>A	ENST00000326010.5	+	9	1277	c.933C>A	c.(931-933)ggC>ggA	p.G311G	UPB1_ENST00000498140.1_3'UTR|UPB1_ENST00000413389.2_Silent_p.G243G	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	311	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					AGGACTTTGGCTACTTTTATG	0.552																																																	0													102.0	96.0	98.0					22																	24919603		2203	4300	6503	SO:0001819	synonymous_variant	0			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.933C>A	22.37:g.24919603C>A			A3KMF8|Q9UIR3	Silent	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.G311	ENST00000326010.5	37	c.933	CCDS13827.1	22																																																																																			UPB1	-	superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	ENSG00000100024		0.552	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPB1	HGNC	protein_coding	OTTHUMT00000319869.1		0.00	72	0	C			24919603	+1			no_errors	ENST00000326010	ensembl	human	known	74_37	silent	7.04	66	5	SNP	1.000	A
USH2A	7399	genome.wustl.edu	37	1	216595578	216595578	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:216595578C>T	ENST00000307340.3	-	2	487	c.101G>A	c.(100-102)cGa>cAa	p.R34Q	USH2A_ENST00000366943.2_Missense_Mutation_p.R34Q|USH2A_ENST00000366942.3_Missense_Mutation_p.R34Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	34					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GAAAAGACCTCGTGACTCAGT	0.453										HNSCC(13;0.011)																																							0													79.0	83.0	81.0					1																	216595578		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.101G>A	1.37:g.216595578C>T	ENSP00000305941:p.Arg34Gln		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.R34Q	ENST00000307340.3	37	c.101	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	2.914	-0.224648	0.06061	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.17528	2.78;2.77;2.27	5.27	-3.48	0.04739	.	0.193128	0.25052	N	0.033512	T	0.03263	0.0095	N	0.00677	-1.265	0.20307	N	0.999915	B;B	0.10296	0.001;0.003	B;B	0.04013	0.001;0.0	T	0.37572	-0.9700	10	0.02654	T	1	.	11.6537	0.51304	0.0:0.3941:0.0:0.6059	.	34;34	O75445-2;O75445	.;USH2A_HUMAN	Q	34	ENSP00000305941:R34Q;ENSP00000355910:R34Q;ENSP00000355909:R34Q	ENSP00000305941:R34Q	R	-	2	0	USH2A	214662201	0.995000	0.38212	0.023000	0.16930	0.584000	0.36387	0.357000	0.20199	-0.699000	0.05077	0.591000	0.81541	CGA	USH2A	-	NULL	ENSG00000042781		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	45	0	C	NM_007123		216595578	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	14.29	54	9	SNP	0.671	T
USP40	55230	genome.wustl.edu	37	2	234429744	234429744	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:234429744C>T	ENST00000427112.2	-	16	2250	c.2215G>A	c.(2215-2217)Gag>Aag	p.E739K	USP40_ENST00000251722.6_Missense_Mutation_p.E739K|USP40_ENST00000450966.1_Missense_Mutation_p.E751K			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	739					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		ACCCATTTCTCTTCCTTGGTC	0.368																																																	0													84.0	77.0	79.0					2																	234429744		1842	4083	5925	SO:0001583	missense	0			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.2215G>A	2.37:g.234429744C>T	ENSP00000387898:p.Glu739Lys		Q6NX38|Q70EL0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.E751K	ENST00000427112.2	37	c.2251	CCDS46547.1	2	.	.	.	.	.	.	.	.	.	.	C	8.295	0.818600	0.16607	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112;ENST00000452724	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	4.75	2.88	0.33553	.	2.303910	0.01545	N	0.019397	T	0.37376	0.1001	L	0.29908	0.895	0.09310	N	1	B;B	0.28055	0.126;0.199	B;B	0.26770	0.033;0.073	T	0.22836	-1.0205	10	0.12430	T	0.62	.	9.1947	0.37220	0.0:0.8191:0.0:0.1809	.	739;751	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	K	751;739;739;34	ENSP00000415434:E751K;ENSP00000251722:E739K;ENSP00000387898:E739K;ENSP00000408853:E34K	ENSP00000251722:E739K	E	-	1	0	USP40	234094483	0.026000	0.19158	0.801000	0.32222	0.504000	0.33889	1.443000	0.35057	1.208000	0.43306	0.585000	0.79938	GAG	USP40	-	NULL	ENSG00000085982		0.368	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	USP40	HGNC	protein_coding	OTTHUMT00000397235.1		0.00	42	0	C	XM_114294		234429744	-1			no_errors	ENST00000450966	ensembl	human	known	74_37	missense	6.06	61	4	SNP	0.226	T
USP5	8078	genome.wustl.edu	37	12	6973255	6973255	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr12:6973255G>T	ENST00000229268.8	+	17	2192	c.2140G>T	c.(2140-2142)Ggc>Tgc	p.G714C	USP5_ENST00000389231.5_Missense_Mutation_p.G691C	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	714	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						TAGTGGGCCGGGCTCCACAAG	0.637																																																	0													100.0	111.0	107.0					12																	6973255		2203	4300	6503	SO:0001583	missense	0			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.2140G>T	12.37:g.6973255G>T	ENSP00000229268:p.Gly714Cys		D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.G714C	ENST00000229268.8	37	c.2140	CCDS41743.1	12	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354769	0.41700	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.25579	1.79;1.79	4.58	4.58	0.56647	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);UBA-like (1);	0.168194	0.52532	D	0.000064	T	0.46073	0.1374	M	0.64997	1.995	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.73708	0.981;0.919	T	0.41716	-0.9493	10	0.62326	D	0.03	-7.2535	12.6583	0.56799	0.0:0.0:0.835:0.165	.	714;691	P45974;P45974-2	UBP5_HUMAN;.	C	714;691	ENSP00000229268:G714C;ENSP00000373883:G691C	ENSP00000229268:G714C	G	+	1	0	USP5	6843516	1.000000	0.71417	1.000000	0.80357	0.029000	0.11900	4.909000	0.63314	2.388000	0.81334	0.555000	0.69702	GGC	USP5	-	pfam_Peptidase_C19/C67,superfamily_UBA-like,pirsf_Ubiquitinyl_hydrolase,pfscan_Peptidase_C19/C67	ENSG00000111667		0.637	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP5	HGNC	protein_coding	OTTHUMT00000402982.1	-	0.00	47	0	G			6973255	+1	tier1	-	no_errors	ENST00000229268	ensembl	human	known	74_37	missense	9.38	58	6	SNP	1.000	T
UVSSA	57654	genome.wustl.edu	37	4	1343540	1343540	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:1343540G>T	ENST00000389851.4	+	3	774	c.327G>T	c.(325-327)ctG>ctT	p.L109L	UVSSA_ENST00000507531.1_Silent_p.L109L|UVSSA_ENST00000511216.1_Silent_p.L109L	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	109	VHS-like.				protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										CACAGAGGCTGAGGCAGGCGA	0.607																																																	0													25.0	30.0	29.0					4																	1343540		2203	4300	6503	SO:0001819	synonymous_variant	0			BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.327G>T	4.37:g.1343540G>T			A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Silent	SNP	pfam_DUF2043,superfamily_ENTH_VHS	p.L109	ENST00000389851.4	37	c.327	CCDS33938.1	4																																																																																			UVSSA	-	superfamily_ENTH_VHS	ENSG00000163945		0.607	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVSSA	HGNC	protein_coding	OTTHUMT00000359480.1	-	0.00	45	0	G	NM_020894		1343540	+1	tier1	-	no_errors	ENST00000389851	ensembl	human	known	74_37	silent	20.34	46	12	SNP	1.000	T
UVSSA	57654	genome.wustl.edu	37	4	1343542	1343542	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:1343542G>T	ENST00000389851.4	+	3	776	c.329G>T	c.(328-330)aGg>aTg	p.R110M	UVSSA_ENST00000507531.1_Missense_Mutation_p.R110M|UVSSA_ENST00000511216.1_Missense_Mutation_p.R110M	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	110	VHS-like.				protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										CAGAGGCTGAGGCAGGCGACC	0.602																																																	0													25.0	31.0	29.0					4																	1343542		2203	4300	6503	SO:0001583	missense	0			BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.329G>T	4.37:g.1343542G>T	ENSP00000374501:p.Arg110Met		A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	pfam_DUF2043,superfamily_ENTH_VHS	p.R110M	ENST00000389851.4	37	c.329	CCDS33938.1	4	.	.	.	.	.	.	.	.	.	.	G	16.56	3.157509	0.57368	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531	T;T;T	0.24908	1.83;1.83;1.83	4.89	1.7	0.24286	.	0.198102	0.51477	D	0.000091	T	0.45296	0.1335	M	0.81239	2.535	0.80722	D	1	D	0.76494	0.999	D	0.65443	0.935	T	0.40175	-0.9577	10	0.87932	D	0	.	7.4309	0.27126	0.4867:0.0:0.5133:0.0	.	110	Q2YD98	K1530_HUMAN	M	110	ENSP00000425130:R110M;ENSP00000374501:R110M;ENSP00000421741:R110M	ENSP00000374501:R110M	R	+	2	0	KIAA1530	1333542	1.000000	0.71417	0.998000	0.56505	0.763000	0.43281	2.082000	0.41605	0.489000	0.27749	0.591000	0.81541	AGG	UVSSA	-	superfamily_ENTH_VHS	ENSG00000163945		0.602	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVSSA	HGNC	protein_coding	OTTHUMT00000359480.1	-	0.00	47	0	G	NM_020894		1343542	+1	tier1	-	no_errors	ENST00000389851	ensembl	human	known	74_37	missense	20.00	48	12	SNP	1.000	T
VANGL2	57216	genome.wustl.edu	37	1	160389362	160389362	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:160389362G>T	ENST00000368061.2	+	4	1237	c.763G>T	c.(763-765)Gac>Tac	p.D255Y	VANGL2_ENST00000483408.1_3'UTR	NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	255					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCGCTCCACCGACGGCGCCAG	0.632																																																	0													23.0	26.0	25.0					1																	160389362		2202	4298	6500	SO:0001583	missense	0			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.763G>T	1.37:g.160389362G>T	ENSP00000357040:p.Asp255Tyr		D3DVE9|Q5T212	Missense_Mutation	SNP	pfam_Strabismus,pirsf_Strabismus	p.D255Y	ENST00000368061.2	37	c.763	CCDS30915.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567597	0.86439	.	.	ENSG00000162738	ENST00000368061	D	0.87729	-2.29	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.94305	0.8170	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95026	0.8165	10	0.87932	D	0	-29.4243	17.7935	0.88562	0.0:0.0:1.0:0.0	.	255	Q9ULK5	VANG2_HUMAN	Y	255	ENSP00000357040:D255Y	ENSP00000357040:D255Y	D	+	1	0	VANGL2	158655986	1.000000	0.71417	0.938000	0.37757	0.994000	0.84299	9.269000	0.95684	2.606000	0.88127	0.563000	0.77884	GAC	VANGL2	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000162738		0.632	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VANGL2	HGNC	protein_coding	OTTHUMT00000080677.1		0.00	27	0	G	NM_020335		160389362	+1			no_errors	ENST00000368061	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.997	T
VSX2	338917	genome.wustl.edu	37	14	74706337	74706337	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr14:74706337G>C	ENST00000261980.2	+	1	163	c.73G>C	c.(73-75)Gcc>Ccc	p.A25P		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	25	Pro-rich.				cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		CTCGGGGGGCGCCCCGGCCAG	0.682																																																	0													14.0	19.0	17.0					14																	74706337		1856	3522	5378	SO:0001583	missense	0			AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.73G>C	14.37:g.74706337G>C	ENSP00000261980:p.Ala25Pro		A1A4X6	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.A25P	ENST00000261980.2	37	c.73	CCDS9827.1	14	.	.	.	.	.	.	.	.	.	.	G	6.610	0.480969	0.12581	.	.	ENSG00000119614	ENST00000261980	D	0.90563	-2.69	5.14	2.15	0.27550	.	0.720211	0.13661	N	0.371609	T	0.78375	0.4273	N	0.12182	0.205	0.23533	N	0.997472	B	0.06786	0.001	B	0.06405	0.002	T	0.63625	-0.6595	10	0.23302	T	0.38	.	6.0758	0.19915	0.2605:0.1788:0.5607:0.0	.	25	P58304	VSX2_HUMAN	P	25	ENSP00000261980:A25P	ENSP00000261980:A25P	A	+	1	0	VSX2	73776090	0.987000	0.35691	0.994000	0.49952	0.545000	0.35147	0.461000	0.21940	0.773000	0.33404	-0.251000	0.11542	GCC	VSX2	-	NULL	ENSG00000119614		0.682	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX2	HGNC	protein_coding	OTTHUMT00000412323.1	-	0.00	66	0	G	NM_182894		74706337	+1	tier1	-	no_errors	ENST00000261980	ensembl	human	known	74_37	missense	10.81	66	8	SNP	0.980	C
WASF3	10810	genome.wustl.edu	37	13	27256798	27256798	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:27256798G>T	ENST00000335327.5	+	9	1216	c.1038G>T	c.(1036-1038)ccG>ccT	p.P346P	WASF3_ENST00000361042.4_Silent_p.P343P	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	346	Poly-Pro.				actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CACCTCCTCCGCCACCTCCTC	0.577																																																	0													185.0	170.0	175.0					13																	27256798		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.1038G>T	13.37:g.27256798G>T			O94974|Q86VQ2	Silent	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.P346	ENST00000335327.5	37	c.1038	CCDS9318.1	13																																																																																			WASF3	-	NULL	ENSG00000132970		0.577	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF3	HGNC	protein_coding	OTTHUMT00000044258.1	-	0.00	99	0	G			27256798	+1	tier1	-	no_errors	ENST00000335327	ensembl	human	known	74_37	silent	8.73	115	11	SNP	0.001	T
WDFY4	57705	genome.wustl.edu	37	10	50165273	50165273	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:50165273C>A	ENST00000325239.5	+	51	8104	c.8077C>A	c.(8077-8079)Cca>Aca	p.P2693T	WDFY4_ENST00000413659.2_3'UTR|WDFY4_ENST00000465910.1_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2693	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GGAGCTGACCCCAGAGTTCTT	0.587																																																	0													88.0	94.0	92.0					10																	50165273		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.8077C>A	10.37:g.50165273C>A	ENSP00000320563:p.Pro2693Thr		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P2693T	ENST00000325239.5	37	c.8077	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	25.2|25.2	4.610290|4.610290	0.87258|0.87258	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002|ENST00000426033;ENST00000325239;ENST00000544136	.|D	.|0.86769	.|-2.17	5.57|5.57	5.57|5.57	0.84162|0.84162	.|BEACH domain (4);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.96358|0.96358	0.8812|0.8812	H|H	0.97829|0.97829	4.085|4.085	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.97729|0.97729	1.0201|1.0201	6|9	.|.	.|.	.|.	.|.	18.5788|18.5788	0.91164|0.91164	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|156;2693	.|B4DWY9;Q6ZS81	.|.;WDFY4_HUMAN	H|T	1783|2693;2693;156	.|ENSP00000320563:P2693T	.|.	P|P	+|+	2|1	0|0	WDFY4|WDFY4	49835279|49835279	1.000000|1.000000	0.71417|0.71417	0.360000|0.360000	0.25837|0.25837	0.920000|0.920000	0.55202|0.55202	7.741000|7.741000	0.84997|0.84997	2.628000|2.628000	0.89032|0.89032	0.645000|0.645000	0.84053|0.84053	CCC|CCA	WDFY4	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000128815		0.587	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	63	0	C	XM_033379		50165273	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	12.33	64	9	SNP	1.000	A
WDR27	253769	genome.wustl.edu	37	6	170068164	170068164	+	Missense_Mutation	SNP	C	C	G	rs201924195		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:170068164C>G	ENST00000448612.1	-	5	683	c.574G>C	c.(574-576)Ggc>Cgc	p.G192R	WDR27_ENST00000546525.1_5'Flank|WDR27_ENST00000333572.6_Missense_Mutation_p.G192R|WDR27_ENST00000423258.1_Intron|WDR27_ENST00000420344.2_Intron	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	162						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		CCCAGGTGGCCCTGCAGCTCG	0.592																																																	0													74.0	90.0	85.0					6																	170068164		2060	4191	6251	SO:0001583	missense	0			AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.574G>C	6.37:g.170068164C>G	ENSP00000416289:p.Gly192Arg		A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G192R	ENST00000448612.1	37	c.574	CCDS47520.2	6	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066614	0.76301	.	.	ENSG00000184465	ENST00000448612;ENST00000333572	T;T	0.70749	-0.51;-0.51	5.25	5.25	0.73442	.	0.156624	0.39834	N	0.001256	T	0.82268	0.5000	M	0.89840	3.065	0.80722	D	1	D;P	0.53462	0.96;0.951	P;P	0.56865	0.808;0.616	D	0.85560	0.1227	10	0.59425	D	0.04	-26.2831	17.6115	0.88055	0.0:1.0:0.0:0.0	.	192;192	F2Z2U5;C9JGV0	.;.	R	192	ENSP00000416289:G192R;ENSP00000330265:G192R	ENSP00000330265:G192R	G	-	1	0	WDR27	169810089	0.973000	0.33851	0.416000	0.26546	0.445000	0.32107	3.637000	0.54324	2.457000	0.83068	0.655000	0.94253	GGC	WDR27	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000184465		0.592	WDR27-010	KNOWN	basic|CCDS	protein_coding	WDR27	HGNC	protein_coding	OTTHUMT00000407334.1		0.00	63	0	C	NM_182552		170068164	-1			no_errors	ENST00000448612	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.979	G
WDR6	11180	genome.wustl.edu	37	3	49051447	49051447	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr3:49051447G>T	ENST00000608424.1	+	2	2519	c.2480G>T	c.(2479-2481)cGc>cTc	p.R827L	WDR6_ENST00000448293.1_Missense_Mutation_p.R776L|WDR6_ENST00000415265.2_Missense_Mutation_p.R275L|WDR6_ENST00000395474.3_Missense_Mutation_p.R857L			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	827					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		ACCCCAAGCCGCCTCGCCTGC	0.622											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													52.0	48.0	49.0					3																	49051447		2203	4300	6503	SO:0001583	missense	0			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.2480G>T	3.37:g.49051447G>T	ENSP00000477389:p.Arg827Leu	959	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R857L	ENST00000608424.1	37	c.2570		3	.	.	.	.	.	.	.	.	.	.	G	9.800	1.180395	0.21787	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	T;T;T	0.72942	0.2;-0.7;-0.7	5.24	3.32	0.38043	WD40 repeat-like-containing domain (1);	0.466636	0.24429	N	0.038607	T	0.53514	0.1801	N	0.22421	0.69	0.09310	N	1	B;B;B	0.17667	0.007;0.023;0.023	B;B;B	0.19148	0.008;0.018;0.024	T	0.37865	-0.9687	10	0.23891	T	0.37	-9.6317	10.7612	0.46266	0.0771:0.2071:0.7158:0.0	.	275;827;776	E9PBK6;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	L	857;275;776	ENSP00000378857:R857L;ENSP00000412195:R275L;ENSP00000413432:R776L	ENSP00000378857:R857L	R	+	2	0	WDR6	49026451	0.001000	0.12720	0.983000	0.44433	0.896000	0.52359	1.115000	0.31209	1.346000	0.45694	0.561000	0.74099	CGC	WDR6	-	superfamily_WD40_repeat_dom	ENSG00000178252		0.622	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	HGNC	protein_coding	OTTHUMT00000471652.1		0.00	49	0	G			49051447	+1			no_errors	ENST00000395474	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.008	T
WDR62	284403	genome.wustl.edu	37	19	36573985	36573985	+	Nonsense_Mutation	SNP	C	C	G	rs151063285		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:36573985C>G	ENST00000270301.7	+	11	1392	c.1392C>G	c.(1390-1392)taC>taG	p.Y464*	WDR62_ENST00000401500.2_Nonsense_Mutation_p.Y464*			O43379	WDR62_HUMAN	WD repeat domain 62	464					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AGGTCGTGTACGTGGAGAATG	0.592																																																	0													56.0	43.0	47.0					19																	36573985		2203	4300	6503	SO:0001587	stop_gained	0			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.1392C>G	19.37:g.36573985C>G	ENSP00000270301:p.Tyr464*		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y464*	ENST00000270301.7	37	c.1392	CCDS33001.1	19	.	.	.	.	.	.	.	.	.	.	C	34	5.347307	0.95807	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	.	.	.	5.71	-2.61	0.06171	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.7688	9.5611	0.39369	0.0:0.5313:0.1311:0.3376	.	.	.	.	X	464	.	ENSP00000270301:Y464X	Y	+	3	2	WDR62	41265825	0.014000	0.17966	0.882000	0.34594	0.990000	0.78478	-1.169000	0.03120	-0.712000	0.04988	-0.294000	0.09567	TAC	WDR62	-	NULL	ENSG00000075702		0.592	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR62	HGNC	protein_coding	OTTHUMT00000457436.1	-	0.00	37	0	C	NM_015671		36573985	+1	tier1	-	no_errors	ENST00000401500	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	0.673	G
WDR87	83889	genome.wustl.edu	37	19	38383272	38383272	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:38383272G>C	ENST00000303868.5	-	4	3178	c.2954C>G	c.(2953-2955)tCt>tGt	p.S985C	WDR87_ENST00000447313.2_Missense_Mutation_p.S1024C	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	985										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TGAGGTCCTAGAGTGGATTCC	0.458																																																	0													236.0	195.0	208.0					19																	38383272		692	1591	2283	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.2954C>G	19.37:g.38383272G>C	ENSP00000368025:p.Ser985Cys		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1024C	ENST00000303868.5	37	c.3071	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	G	3.974	-0.007778	0.07773	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.65916	-0.18;-0.18	5.12	-0.353	0.12594	.	1.251680	0.05668	N	0.588205	T	0.58409	0.2120	L	0.60455	1.87	0.09310	N	1	B;B	0.18863	0.031;0.031	B;B	0.14578	0.011;0.011	T	0.55749	-0.8092	10	0.87932	D	0	-4.6902	9.332	0.38027	0.0:0.458:0.3975:0.1445	.	985;1024	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	C	1024;985	ENSP00000405012:S1024C;ENSP00000368025:S985C	ENSP00000368025:S985C	S	-	2	0	WDR87	43075112	0.000000	0.05858	0.003000	0.11579	0.013000	0.08279	0.270000	0.18607	0.516000	0.28340	0.549000	0.68633	TCT	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.458	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	75	0	G	XM_940478		38383272	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	missense	9.88	73	8	SNP	0.000	C
WDR87	83889	genome.wustl.edu	37	19	38385259	38385259	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:38385259C>A	ENST00000303868.5	-	4	1191	c.967G>T	c.(967-969)Ggc>Tgc	p.G323C	WDR87_ENST00000447313.2_Missense_Mutation_p.G362C	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	323										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GGAGCAGAGCCACAGACATTG	0.532																																																	0													44.0	43.0	43.0					19																	38385259		692	1591	2283	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.967G>T	19.37:g.38385259C>A	ENSP00000368025:p.Gly323Cys		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G362C	ENST00000303868.5	37	c.1084	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136101	0.37728	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.14144	2.53;2.53	6.06	5.03	0.67393	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.095637	0.46145	D	0.000302	T	0.35098	0.0920	M	0.72894	2.215	0.31883	N	0.618161	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.48647	-0.9017	10	0.87932	D	0	-22.9411	11.4655	0.50237	0.0:0.9174:0.0:0.0826	.	323;362	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	C	362;323	ENSP00000405012:G362C;ENSP00000368025:G323C	ENSP00000368025:G323C	G	-	1	0	WDR87	43077099	0.262000	0.24073	0.777000	0.31699	0.894000	0.52154	1.486000	0.35530	1.574000	0.49760	0.643000	0.83706	GGC	WDR87	-	superfamily_WD40_repeat_dom	ENSG00000171804		0.532	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2		0.00	37	0	C	XM_940478		38385259	-1			no_errors	ENST00000447313	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.857	A
WRN	7486	genome.wustl.edu	37	8	31004645	31004645	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr8:31004645G>T	ENST00000298139.5	+	29	3708		c.e29+1			NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like						aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GGAGACTCAGGTAAGGCTTTT	0.313			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													73.0	74.0	74.0					8																	31004645		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3459+1G>T	8.37:g.31004645G>T			A1KYY9	Splice_Site	SNP	-	e28+1	ENST00000298139.5	37	c.3459+1	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	G	15.20	2.763270	0.49574	.	.	ENSG00000165392	ENST00000298139	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1875	0.81962	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WRN	31124187	1.000000	0.71417	0.995000	0.50966	0.549000	0.35272	4.997000	0.63921	2.489000	0.83994	0.655000	0.94253	.	WRN	-	-	ENSG00000165392		0.313	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	-	0.00	61	0	G		Intron	31004645	+1	tier1	-	no_errors	ENST00000298139	ensembl	human	known	74_37	splice_site	5.26	90	5	SNP	1.000	T
XIRP2	129446	genome.wustl.edu	37	2	168102950	168102950	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr2:168102950A>T	ENST00000409195.1	+	9	5137	c.5048A>T	c.(5047-5049)gAa>gTa	p.E1683V	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.E1461V|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.E1683V|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1508					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CAGGAAGATGAAAAAGGAGAT	0.353																																																	0													105.0	100.0	102.0					2																	168102950		1861	4088	5949	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5048A>T	2.37:g.168102950A>T	ENSP00000386840:p.Glu1683Val		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.E1683V	ENST00000409195.1	37	c.5048	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	A	18.29	3.590491	0.66219	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.03496	3.91;3.91;3.91	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.17238	0.0414	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	T	0.00121	-1.2028	10	0.59425	D	0.04	-23.1808	14.7546	0.69554	1.0:0.0:0.0:0.0	.	1508;1508;1461	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	V	1683;1683;1461	ENSP00000386840:E1683V;ENSP00000295237:E1683V;ENSP00000387255:E1461V	ENSP00000295237:E1683V	E	+	2	0	XIRP2	167811196	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.133000	0.77259	2.134000	0.65973	0.528000	0.53228	GAA	XIRP2	-	NULL	ENSG00000163092		0.353	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	-	0.00	34	0	A	NM_152381		168102950	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
XKR7	343702	genome.wustl.edu	37	20	30585020	30585020	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr20:30585020C>A	ENST00000562532.2	+	3	1674	c.1500C>A	c.(1498-1500)gtC>gtA	p.V500V		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	500						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCCCACCTGTCTTCCAGGTGC	0.677																																																	0													30.0	35.0	33.0					20																	30585020		2203	4299	6502	SO:0001819	synonymous_variant	0			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1500C>A	20.37:g.30585020C>A			Q9NUG5	Silent	SNP	pfam_Transport_prot_XK	p.V500	ENST00000562532.2	37	c.1500	CCDS33459.1	20																																																																																			XKR7	-	NULL	ENSG00000260903		0.677	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	HGNC	protein_coding	OTTHUMT00000078597.3	-	0.00	43	0	C	NM_001011718		30585020	+1	tier1	-	no_errors	ENST00000562532	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	A
XKR8	55113	genome.wustl.edu	37	1	28293102	28293102	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:28293102G>A	ENST00000373884.5	+	3	1187	c.579G>A	c.(577-579)ccG>ccA	p.P193P	XKR8_ENST00000481387.1_3'UTR	NM_018053.2	NP_060523.2	Q9H6D3	XKR8_HUMAN	XK, Kell blood group complex subunit-related family, member 8	193					engulfment of apoptotic cell (GO:0043652)|phosphatidylserine exposure on apoptotic cell surface (GO:0070782)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(1)	4		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;4.72e-24)|Colorectal(126;1.52e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00572)|READ - Rectum adenocarcinoma(331;0.0526)		CCTCCAAGCCGCTCCTGGGCC	0.642																																																	0													75.0	77.0	76.0					1																	28293102		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091615	CCDS315.1	1p35.3	2008-02-05	2006-01-12		ENSG00000158156	ENSG00000158156			25508	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 8"""			12477932	Standard	NM_018053		Approved	FLJ10307	uc001bph.1	Q9H6D3	OTTHUMG00000003912	ENST00000373884.5:c.579G>A	1.37:g.28293102G>A				Silent	SNP	pfam_Transport_prot_XK	p.P193	ENST00000373884.5	37	c.579	CCDS315.1	1																																																																																			XKR8	-	pfam_Transport_prot_XK	ENSG00000158156		0.642	XKR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR8	HGNC	protein_coding	OTTHUMT00000011175.1	-	0.00	68	0	G	NM_018053		28293102	+1	tier1	-	no_errors	ENST00000373884	ensembl	human	known	74_37	silent	7.79	71	6	SNP	0.000	A
XPO6	23214	genome.wustl.edu	37	16	28146539	28146539	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:28146539C>A	ENST00000304658.5	-	10	1941	c.1441G>T	c.(1441-1443)Gat>Tat	p.D481Y	XPO6_ENST00000565698.1_Missense_Mutation_p.D467Y	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	481					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						CCGCTTACATCGTCATCCAGA	0.512																																																	0													130.0	129.0	129.0					16																	28146539		2036	4179	6215	SO:0001583	missense	0			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1441G>T	16.37:g.28146539C>A	ENSP00000302790:p.Asp481Tyr		A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.D481Y	ENST00000304658.5	37	c.1441	CCDS42135.1	16	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063292	0.76187	.	.	ENSG00000169180	ENST00000304658	T	0.69685	-0.42	5.31	5.31	0.75309	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78868	0.4351	L	0.59436	1.845	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70227	0.968;0.964	T	0.80450	-0.1377	10	0.66056	D	0.02	-12.7871	16.4733	0.84124	0.0:1.0:0.0:0.0	.	481;481	B7ZM10;Q96QU8	.;XPO6_HUMAN	Y	481	ENSP00000302790:D481Y	ENSP00000302790:D481Y	D	-	1	0	XPO6	28054040	1.000000	0.71417	0.998000	0.56505	0.536000	0.34869	7.818000	0.86416	2.470000	0.83445	0.655000	0.94253	GAT	XPO6	-	superfamily_ARM-type_fold	ENSG00000169180		0.512	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1	-	0.00	59	0	C	XM_055195		28146539	-1	tier1	-	no_errors	ENST00000304658	ensembl	human	known	74_37	missense	12.50	70	10	SNP	1.000	A
XRCC6	2547	genome.wustl.edu	37	22	42032580	42032580	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr22:42032580A>G	ENST00000359308.4	+	4	1050	c.395A>G	c.(394-396)cAa>cGa	p.Q132R	XRCC6_ENST00000405878.1_Missense_Mutation_p.Q132R|XRCC6_ENST00000405506.1_Missense_Mutation_p.Q82R|XRCC6_ENST00000428575.2_5'UTR|XRCC6_ENST00000360079.3_Missense_Mutation_p.Q132R|XRCC6_ENST00000402580.3_Missense_Mutation_p.Q91R			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	132					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						AAACGTTTCCAAGACATGATG	0.463								Non-homologous end-joining																																									0													75.0	66.0	69.0					22																	42032580		2203	4300	6503	SO:0001583	missense	0			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.395A>G	22.37:g.42032580A>G	ENSP00000352257:p.Gln132Arg		B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	pirsf_Ku70,pfam_Ku_N,pfam_Ku70/Ku80_beta-barrel_dom,pfam_Ku_C,pfam_SAP_dom,superfamily_SPOC_like_C_dom,smart_Ku70/Ku80_beta-barrel_dom,smart_SAP_dom,pfscan_SAP_dom,tigrfam_Ku70	p.Q132R	ENST00000359308.4	37	c.395	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	A	4.262	0.047625	0.08243	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	5.71	1.28	0.21552	Ku70/Ku80, N-terminal alpha/beta (1);	0.464144	0.24752	N	0.035885	T	0.27866	0.0686	N	0.12569	0.235	0.50171	D	0.999856	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.12156	0.007;0.003;0.003;0.007	T	0.04400	-1.0954	9	0.15499	T	0.54	-3.0482	7.8648	0.29530	0.4697:0.0:0.5303:0.0	rs11557351;rs11557351	82;132;91;132	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	R	132;91;132;132;132;82	.	ENSP00000352257:Q132R	Q	+	2	0	XRCC6	40362526	0.154000	0.22792	0.803000	0.32268	0.557000	0.35523	0.310000	0.19356	0.458000	0.26988	0.533000	0.62120	CAA	XRCC6	-	pirsf_Ku70,pfam_Ku_N,tigrfam_Ku70	ENSG00000196419		0.463	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	HGNC	protein_coding	OTTHUMT00000321688.1		0.00	107	0	A	NM_001469		42032580	+1			no_errors	ENST00000359308	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.251	G
YIPF2	78992	genome.wustl.edu	37	19	11038537	11038537	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:11038537C>T	ENST00000586748.1	-	3	302	c.130G>A	c.(130-132)Gtg>Atg	p.V44M	C19orf52_ENST00000270502.6_5'Flank|YIPF2_ENST00000253031.2_Missense_Mutation_p.V44M|YIPF2_ENST00000590329.1_Missense_Mutation_p.V44M			Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	44						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				cervix(1)|endometrium(1)|lung(3)|ovary(2)	7						CCTGAGCCCACGGCCACAGCC	0.627																																																	0													80.0	78.0	79.0					19																	11038537		2203	4300	6503	SO:0001583	missense	0			BC013014	CCDS12251.1	19p13.2	2008-02-05				ENSG00000130733		"""Yip1 domain family"""	28476	protein-coding gene	gene with protein product						12477932	Standard	NM_024029		Approved	MGC3262, FinGER2	uc002mqc.3	Q9BWQ6		ENST00000586748.1:c.130G>A	19.37:g.11038537C>T	ENSP00000466055:p.Val44Met			Missense_Mutation	SNP	pfam_Yip1	p.V44M	ENST00000586748.1	37	c.130	CCDS12251.1	19	.	.	.	.	.	.	.	.	.	.	C	12.21	1.871028	0.33069	.	.	ENSG00000130733	ENST00000253031	.	.	.	4.78	-4.67	0.03319	.	0.709223	0.12997	N	0.421995	T	0.20088	0.0483	N	0.15975	0.35	0.09310	N	0.999998	B	0.16802	0.019	B	0.11329	0.006	T	0.10245	-1.0638	9	0.46703	T	0.11	.	6.9225	0.24395	0.1167:0.3553:0.0:0.528	.	44	Q9BWQ6	YIPF2_HUMAN	M	44	.	ENSP00000253031:V44M	V	-	1	0	YIPF2	10899537	0.000000	0.05858	0.003000	0.11579	0.660000	0.38997	-0.404000	0.07205	-0.957000	0.03627	0.655000	0.94253	GTG	YIPF2	-	NULL	ENSG00000130733		0.627	YIPF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YIPF2	HGNC	protein_coding	OTTHUMT00000453045.1	-	0.00	62	0	C	NM_024029		11038537	-1	tier1	-	no_errors	ENST00000253031	ensembl	human	known	74_37	missense	7.81	59	5	SNP	0.001	T
ZAN	7455	genome.wustl.edu	37	7	100358086	100358086	+	RNA	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:100358086G>T	ENST00000348028.3	+	0	3934				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CGGGCGGTTTGTGGAGCTGCA	0.587																																																	0													108.0	119.0	115.0					7																	100358086		2123	4217	6340			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100358086G>T			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.V1257L	ENST00000348028.3	37	c.3769		7	.	.	.	.	.	.	.	.	.	.	G	17.27	3.345895	0.61073	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.58797	0.31;0.31;0.31	4.72	3.84	0.44239	von Willebrand factor, type D domain (3);	0.000000	0.41294	D	0.000909	T	0.63010	0.2475	L	0.41573	1.285	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.66716	0.911;0.946	T	0.62186	-0.6907	10	0.46703	T	0.11	.	9.3699	0.38248	0.1028:0.0:0.8972:0.0	.	1257;1257	F5H0T8;Q9Y493	.;ZAN_HUMAN	L	1257	ENSP00000445943:V1257L;ENSP00000445091:V1257L;ENSP00000444427:V1257L	ENSP00000423579:V1257L	V	+	1	0	ZAN	100196022	1.000000	0.71417	0.965000	0.40720	0.431000	0.31685	2.784000	0.47774	1.302000	0.44855	0.555000	0.69702	GTG	ZAN	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000146839		0.587	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	-	0.00	143	0	G	NM_003386		100358086	+1	tier1	-	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	5.49	171	10	SNP	1.000	T
ZAN	7455	genome.wustl.edu	37	7	100358114	100358114	+	RNA	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:100358114G>C	ENST00000348028.3	+	0	3962				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TTCGGTTTGCGGGTGAGATGG	0.587																																																	0													94.0	105.0	102.0					7																	100358114		2170	4259	6429			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100358114G>C			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.R1266P	ENST00000348028.3	37	c.3797		7	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910050	0.52439	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.60299	0.2;0.2;0.2	4.72	1.78	0.24846	von Willebrand factor, type D domain (3);	0.750907	0.11485	N	0.559330	T	0.73938	0.3651	M	0.88775	2.98	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.68943	0.935;0.961	T	0.68663	-0.5349	10	0.62326	D	0.03	.	3.7279	0.08481	0.0939:0.1641:0.5728:0.1693	.	1266;1266	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	1266	ENSP00000445943:R1266P;ENSP00000445091:R1266P;ENSP00000444427:R1266P	ENSP00000423579:R1266P	R	+	2	0	ZAN	100196050	0.835000	0.29415	0.052000	0.19188	0.714000	0.41099	0.864000	0.27926	0.244000	0.21351	0.555000	0.69702	CGG	ZAN	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000146839		0.587	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	-	0.00	145	0	G	NM_003386		100358114	+1	tier1	-	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	5.43	174	10	SNP	0.959	C
ZBTB22	9278	genome.wustl.edu	37	6	33283128	33283128	+	Silent	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:33283128G>A	ENST00000431845.2	-	2	1717	c.1566C>T	c.(1564-1566)ttC>ttT	p.F522F	TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000456592.2_5'Flank|ZBTB22_ENST00000418724.1_Silent_p.F522F|TAPBP_ENST00000489157.1_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						GCTTCATCTTGAACTTTTTGT	0.552																																																	0													129.0	125.0	126.0					6																	33283128		2203	4300	6503	SO:0001819	synonymous_variant	0			Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.1566C>T	6.37:g.33283128G>A			B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.F522	ENST00000431845.2	37	c.1566	CCDS4775.1	6																																																																																			ZBTB22	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000236104		0.552	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB22	HGNC	protein_coding	OTTHUMT00000076183.2	-	0.00	56	0	G			33283128	-1	tier1	-	no_errors	ENST00000418724	ensembl	human	known	74_37	silent	14.75	52	9	SNP	1.000	A
ZBTB40	9923	genome.wustl.edu	37	1	22839481	22839481	+	Silent	SNP	G	G	T	rs200947242		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:22839481G>T	ENST00000375647.4	+	12	2733	c.2526G>T	c.(2524-2526)ggG>ggT	p.G842G	ZBTB40_ENST00000404138.1_Silent_p.G842G|ZBTB40_ENST00000374651.4_Silent_p.G730G	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	842					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		AAGAGTGTGGGGCGAAGTTTG	0.557																																																	0													120.0	90.0	100.0					1																	22839481		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.2526G>T	1.37:g.22839481G>T			O75066|Q5TFU5|Q8N1R1	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G842	ENST00000375647.4	37	c.2526	CCDS224.1	1																																																																																			ZBTB40	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000184677		0.557	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1	-	0.00	53	0	G	NM_014870		22839481	+1	tier1	-	no_errors	ENST00000375647	ensembl	human	known	74_37	silent	8.33	66	6	SNP	0.241	T
ZBTB41	360023	genome.wustl.edu	37	1	197169221	197169221	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:197169221A>G	ENST00000367405.4	-	1	451	c.383T>C	c.(382-384)cTg>cCg	p.L128P	CRB1_ENST00000535699.1_5'Flank|ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	128	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						TACGTGATCCAGGGTGACAAC	0.363																																																	0													67.0	65.0	66.0					1																	197169221		2203	4300	6503	SO:0001583	missense	0				CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.383T>C	1.37:g.197169221A>G	ENSP00000356375:p.Leu128Pro		A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L128P	ENST00000367405.4	37	c.383	CCDS30960.1	1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588452	0.66105	.	.	ENSG00000177888	ENST00000367405	T	0.72282	-0.64	4.77	4.77	0.60923	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.33691	N	0.004645	T	0.79358	0.4432	L	0.60957	1.885	0.80722	D	1	D	0.59767	0.986	P	0.61477	0.889	T	0.82008	-0.0670	10	0.87932	D	0	.	14.2994	0.66336	1.0:0.0:0.0:0.0	.	128	Q5SVQ8	ZBT41_HUMAN	P	128	ENSP00000356375:L128P	ENSP00000356375:L128P	L	-	2	0	ZBTB41	195435844	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	8.957000	0.93082	1.755000	0.51935	0.254000	0.18369	CTG	ZBTB41	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000177888		0.363	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	HGNC	protein_coding	OTTHUMT00000088249.2		0.00	49	0	A	NM_194314		197169221	-1			no_errors	ENST00000367405	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	G
ZBTB9	221504	genome.wustl.edu	37	6	33424232	33424232	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:33424232G>T	ENST00000395064.2	+	2	1623	c.1355G>T	c.(1354-1356)tGt>tTt	p.C452F		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						GTCCATGCCTGTTTTCTCCGC	0.582																																																	0													70.0	74.0	72.0					6																	33424232		2203	4300	6503	SO:0001583	missense	0			AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.1355G>T	6.37:g.33424232G>T	ENSP00000378503:p.Cys452Phe		A2AB19	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C452F	ENST00000395064.2	37	c.1355	CCDS4780.1	6	.	.	.	.	.	.	.	.	.	.	G	1.069	-0.670546	0.03403	.	.	ENSG00000213588	ENST00000395064	T	0.06449	3.3	5.28	2.48	0.30137	Zinc finger, C2H2-like (1);	0.609538	0.14339	N	0.325834	T	0.01222	0.0040	L	0.31804	0.96	0.35252	D	0.778811	B	0.09022	0.002	B	0.08055	0.003	T	0.41680	-0.9495	10	0.09590	T	0.72	.	6.114	0.20116	0.1643:0.0:0.68:0.1557	.	452	Q96C00	ZBTB9_HUMAN	F	452	ENSP00000378503:C452F	ENSP00000378503:C452F	C	+	2	0	ZBTB9	33532210	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	5.091000	0.64505	0.351000	0.24027	0.655000	0.94253	TGT	ZBTB9	-	smart_Znf_C2H2-like	ENSG00000213588		0.582	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB9	HGNC	protein_coding	OTTHUMT00000276533.1	-	0.00	49	0	G	NM_152735		33424232	+1	tier1	-	no_errors	ENST00000395064	ensembl	human	known	74_37	missense	7.46	62	5	SNP	1.000	T
ZC3H12D	340152	genome.wustl.edu	37	6	149771832	149771832	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:149771832A>T	ENST00000409806.3	-	6	1889	c.1571T>A	c.(1570-1572)cTg>cAg	p.L524Q	ZC3H12D_ENST00000498662.1_5'Flank|ZC3H12D_ENST00000389942.5_Missense_Mutation_p.L524Q|ZC3H12D_ENST00000416573.2_3'UTR			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	524					negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		GGGCTTGCCCAGGGGCGCCCC	0.667																																																	0													10.0	12.0	11.0					6																	149771832		692	1588	2280	SO:0001583	missense	0					6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.1571T>A	6.37:g.149771832A>T	ENSP00000386616:p.Leu524Gln		A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.L524Q	ENST00000409806.3	37	c.1571		6	.	.	.	.	.	.	.	.	.	.	A	12.48	1.949656	0.34377	.	.	ENSG00000178199	ENST00000389942;ENST00000409806	T;T	0.37915	1.17;1.17	3.49	-1.64	0.08318	.	.	.	.	.	T	0.07728	0.0194	N	0.24115	0.695	0.09310	N	0.999997	B	0.18461	0.028	B	0.12156	0.007	T	0.35400	-0.9790	9	0.72032	D	0.01	0.317	3.6217	0.08099	0.3301:0.0:0.4574:0.2125	.	524	A2A288	ZC12D_HUMAN	Q	524	ENSP00000374592:L524Q;ENSP00000386616:L524Q	ENSP00000374592:L524Q	L	-	2	0	ZC3H12D	149813525	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.664000	0.05292	-0.179000	0.10654	-0.496000	0.04628	CTG	ZC3H12D	-	NULL	ENSG00000178199		0.667	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	ZC3H12D	HGNC	protein_coding	OTTHUMT00000286400.2	-	0.00	50	0	A	NM_207360		149771832	-1	tier1	-	no_errors	ENST00000389942	ensembl	human	known	74_37	missense	8.64	74	7	SNP	0.000	T
ZC3H13	23091	genome.wustl.edu	37	13	46549674	46549674	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr13:46549674C>A	ENST00000242848.4	-	12	2560	c.2212G>T	c.(2212-2214)Gaa>Taa	p.E738*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.E738*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	738	Arg/Glu-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ctctctctttcccgctctcGA	0.522																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												0													146.0	124.0	131.0					13																	46549674		2203	4296	6499	SO:0001587	stop_gained	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.2212G>T	13.37:g.46549674C>A	ENSP00000242848:p.Glu738*		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.E738*	ENST00000242848.4	37	c.2212		13	.	.	.	.	.	.	.	.	.	.	C	40	8.496715	0.98836	.	.	ENSG00000123200	ENST00000242848;ENST00000282007	.	.	.	5.19	5.19	0.71726	.	0.000000	0.56097	D	0.000031	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	18.6794	0.91541	0.0:1.0:0.0:0.0	.	.	.	.	X	738	.	ENSP00000242848:E738X	E	-	1	0	ZC3H13	45447675	1.000000	0.71417	0.873000	0.34254	0.584000	0.36387	6.109000	0.71528	2.567000	0.86603	0.557000	0.71058	GAA	ZC3H13	-	NULL	ENSG00000123200		0.522	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1	-	0.00	68	0	C	NM_015070		46549674	-1	tier1	-	no_errors	ENST00000242848	ensembl	human	known	74_37	nonsense	13.19	79	12	SNP	1.000	A
ZCCHC11	23318	genome.wustl.edu	37	1	52956462	52956462	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr1:52956462C>A	ENST00000371544.3	-	8	1592	c.1330G>T	c.(1330-1332)Gat>Tat	p.D444Y	ZCCHC11_ENST00000371541.1_5'UTR|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.D444Y	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	444					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						GATTCCACATCTACATATAAT	0.308																																																	0													46.0	48.0	47.0					1																	52956462		2203	4299	6502	SO:0001583	missense	0			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.1330G>T	1.37:g.52956462C>A	ENSP00000360599:p.Asp444Tyr		A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,pfam_Nucleotidyltransferase,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.D444Y	ENST00000371544.3	37	c.1330	CCDS30716.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011457	0.75046	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	6.08	6.08	0.98989	.	0.153838	0.56097	D	0.000026	T	0.58061	0.2096	L	0.45352	1.415	0.80722	D	1	D;P;D	0.76494	0.999;0.859;0.999	P;P;D	0.63033	0.903;0.492;0.91	T	0.55982	-0.8054	10	0.72032	D	0.01	.	20.2585	0.98435	0.0:1.0:0.0:0.0	.	203;444;444	E9PKX1;Q5TAX3-2;Q5TAX3	.;.;TUT4_HUMAN	Y	444;444;444;203	ENSP00000257177:D444Y;ENSP00000360599:D444Y;ENSP00000433486:D444Y;ENSP00000435256:D203Y	ENSP00000257177:D444Y	D	-	1	0	ZCCHC11	52729050	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.677000	0.74503	2.894000	0.99253	0.655000	0.94253	GAT	ZCCHC11	-	NULL	ENSG00000134744		0.308	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZCCHC11	HGNC	protein_coding	OTTHUMT00000022462.1	-	0.00	79	0	C	XM_038288		52956462	-1	tier1	-	no_errors	ENST00000257177	ensembl	human	known	74_37	missense	9.90	91	10	SNP	1.000	A
ZDHHC11B	653082	genome.wustl.edu	37	5	751285	751285	+	Silent	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr5:751285C>A	ENST00000382776.4	-	4	590	c.591G>T	c.(589-591)gtG>gtT	p.V197V	ZDHHC11B_ENST00000508859.2_Silent_p.V208V|ZDHHC11_ENST00000424784.2_Intron			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	197						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						CCCTGGGGTTCACGAGGTACT	0.637																																																	0																																										SO:0001819	synonymous_variant	0					5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.591G>T	5.37:g.751285C>A			A6NHR3	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.V197	ENST00000382776.4	37	c.591		5																																																																																			ZDHHC11B	-	NULL	ENSG00000206077		0.637	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	HGNC	protein_coding		-	0.00	174	0	C	XM_926053		751285	-1	tier1	-	no_errors	ENST00000382776	ensembl	human	known	74_37	silent	5.80	195	12	SNP	0.010	A
ZKSCAN3	80317	genome.wustl.edu	37	6	28331149	28331149	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:28331149C>T	ENST00000377255.3	+	5	917	c.620C>T	c.(619-621)aCt>aTt	p.T207I	ZKSCAN3_ENST00000341464.5_Missense_Mutation_p.T59I|ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.T207I	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	207				LT -> IP (in Ref. 6; AAB16813). {ECO:0000305}.	autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						TCTAGGCTTACTCCAGAGTCC	0.542																																																	0													90.0	77.0	81.0					6																	28331149		2203	4300	6503	SO:0001583	missense	0			U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.620C>T	6.37:g.28331149C>T	ENSP00000366465:p.Thr207Ile		B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.T207I	ENST00000377255.3	37	c.620	CCDS4650.1	6	.	.	.	.	.	.	.	.	.	.	.	5.841	0.339468	0.11069	.	.	ENSG00000189298	ENST00000252211;ENST00000341464;ENST00000377255	T;T;T	0.20463	2.07;2.07;2.07	2.99	2.05	0.26809	Krueppel-associated box (1);	.	.	.	.	T	0.04634	0.0126	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.39143	-0.9628	9	0.56958	D	0.05	.	7.5146	0.27593	0.0:0.8529:0.0:0.1471	.	207	Q9BRR0	ZKSC3_HUMAN	I	207;59;207	ENSP00000252211:T207I;ENSP00000341883:T59I;ENSP00000366465:T207I	ENSP00000252211:T207I	T	+	2	0	ZKSCAN3	28439128	0.000000	0.05858	0.171000	0.22900	0.310000	0.27922	0.741000	0.26202	0.754000	0.32968	0.563000	0.77884	ACT	ZKSCAN3	-	superfamily_Krueppel-associated_box	ENSG00000189298		0.542	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN3	HGNC	protein_coding	OTTHUMT00000040189.3	-	0.00	57	0	C	NM_024493		28331149	+1	tier1	-	no_errors	ENST00000252211	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.162	T
MOG	4340	genome.wustl.edu	37	6	29641135	29641135	+	IGR	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr6:29641135G>C	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376881.3_Silent_p.R231R|ZFP57_ENST00000376883.1_Silent_p.R231R|ZFP57_ENST00000488757.1_Silent_p.R251R	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						CCAGATGGACGCGGCGGTGAC	0.557																																																	0													81.0	89.0	86.0					6																	29641135		1347	2608	3955	SO:0001628	intergenic_variant	0				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29641135G>C			A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R251	ENST00000376917.3	37	c.753	CCDS34370.1	6																																																																																			ZFP57	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204644		0.557	MOG-001	KNOWN	basic|CCDS	protein_coding	ZFP57	HGNC	protein_coding	OTTHUMT00000076160.3	-	0.00	63	0	G	NM_002433		29641135	-1	tier1	-	no_errors	ENST00000488757	ensembl	human	known	74_37	silent	17.44	71	15	SNP	0.024	C
ZNF138	7697	genome.wustl.edu	37	7	64291962	64291962	+	Silent	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:64291962G>C	ENST00000359735.3	+	4	518	c.171G>C	c.(169-171)gtG>gtC	p.V57V	ZNF138_ENST00000494380.1_3'UTR|ZNF138_ENST00000440155.2_Silent_p.V88V|ZNF138_ENST00000440598.1_3'UTR|ZNF138_ENST00000437743.1_Silent_p.V82V|ZNF138_ENST00000397136.2_Silent_p.V57V|ZNF138_ENST00000430838.2_3'UTR|ZNF138_ENST00000307355.7_Silent_p.V114V	NM_001271637.1|NM_001271639.1	NP_001258566.1|NP_001258568.1	P52744	ZN138_HUMAN	zinc finger protein 138	57					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(2)|stomach(1)	7		Lung NSC(55;0.0795)|all_lung(88;0.18)				GTAAAAGTGTGGATGAGTGTA	0.318																																																	0													76.0	76.0	76.0					7																	64291962		2203	4300	6503	SO:0001819	synonymous_variant	0			U09847	CCDS34645.1, CCDS34645.2, CCDS55115.1, CCDS64659.1, CCDS64660.1, CCDS64661.1, CCDS75607.1	7q11.21	2013-01-08	2005-07-11		ENSG00000197008	ENSG00000197008		"""Zinc fingers, C2H2-type"", ""-"""	12922	protein-coding gene	gene with protein product		604080	"""zinc finger protein 138 (clone pHZ-32)"""				Standard	NM_006524		Approved	pHZ-32	uc031sxl.1	P52744	OTTHUMG00000156603	ENST00000359735.3:c.171G>C	7.37:g.64291962G>C			B4DFX2|B4DP87|E9PHI7|E9PHK7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V57	ENST00000359735.3	37	c.171		7																																																																																			ZNF138	-	NULL	ENSG00000197008		0.318	ZNF138-201	KNOWN	basic	protein_coding	ZNF138	HGNC	protein_coding		-	0.00	68	0	G	NM_006524		64291962	+1	tier1	-	no_errors	ENST00000359735	ensembl	human	known	74_37	silent	8.11	102	9	SNP	0.075	C
ZNF117	51351	genome.wustl.edu	37	7	64438934	64438934	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr7:64438934C>A	ENST00000282869.6	-	4	2299	c.1015G>T	c.(1015-1017)Ggc>Tgc	p.G339C		NM_015852.3	NP_056936.2	Q03924	ZN117_HUMAN	zinc finger protein 117	339					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(1)|skin(1)	22		Lung NSC(55;0.0295)|all_lung(88;0.0691)				AAAGCTTTGCCACATTCCTCA	0.358																																																	0													48.0	51.0	50.0					7																	64438934		2149	4266	6415	SO:0001583	missense	0			M27879	CCDS43593.1	7q11.2	2013-01-08	2006-06-12		ENSG00000152926	ENSG00000152926		"""Zinc fingers, C2H2-type"""	12897	protein-coding gene	gene with protein product		194624	"""zinc finger protein 117 (HPF9)"""			1427907	Standard	NM_015852		Approved	HPF9, H-plk	uc003ttr.2	Q03924	OTTHUMG00000156631	ENST00000282869.6:c.1015G>T	7.37:g.64438934C>A	ENSP00000282869:p.Gly339Cys		Q02313|Q7Z7Q7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G339C	ENST00000282869.6	37	c.1015	CCDS43593.1	7	.	.	.	.	.	.	.	.	.	.	.	14.40	2.525364	0.44969	.	.	ENSG00000152926	ENST00000398695;ENST00000282869	T	0.07800	3.16	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21921	0.0528	H	0.96175	3.78	0.39247	D	0.963966	P	0.45594	0.862	P	0.44772	0.46	T	0.21484	-1.0244	9	0.66056	D	0.02	.	7.6354	0.28264	0.0:1.0:0.0:0.0	.	339	Q03924	ZN117_HUMAN	C	339	ENSP00000282869:G339C	ENSP00000282869:G339C	G	-	1	0	ZNF117	64076369	0.636000	0.27207	0.036000	0.18154	0.014000	0.08584	1.076000	0.30729	0.518000	0.28383	0.313000	0.20887	GGC	ZNF117	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152926		0.358	ZNF117-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF117	HGNC	protein_coding	OTTHUMT00000344863.3	-	0.00	42	0	C	NM_024498		64438934	-1	tier1	-	no_errors	ENST00000282869	ensembl	human	known	74_37	missense	9.59	66	7	SNP	1.000	A
ZNF17	7565	genome.wustl.edu	37	19	57932722	57932722	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:57932722A>G	ENST00000601808.1	+	3	2075	c.1862A>G	c.(1861-1863)tAc>tGc	p.Y621C	AC004076.7_ENST00000597410.1_Intron|ZNF17_ENST00000307658.7_Missense_Mutation_p.Y623C	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	621					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		GTCTTTAGATACAACTCCAGC	0.403																																					Melanoma(149;1637 1853 29914 42869 44988)												0													51.0	55.0	53.0					19																	57932722		2198	4298	6496	SO:0001583	missense	0			X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.1862A>G	19.37:g.57932722A>G	ENSP00000471905:p.Tyr621Cys		B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y621C	ENST00000601808.1	37	c.1862	CCDS42636.1	19	.	.	.	.	.	.	.	.	.	.	A	9.112	1.006807	0.19199	.	.	ENSG00000186272	ENST00000307658	.	.	.	2.57	-1.03	0.10102	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18087	0.0434	N	0.12853	0.265	0.09310	N	1	B;B	0.20052	0.041;0.002	B;B	0.20384	0.029;0.003	T	0.19353	-1.0308	8	0.44086	T	0.13	.	5.3477	0.16018	0.3436:0.184:0.4724:0.0	.	623;621	P17021-2;P17021	.;ZNF17_HUMAN	C	621	.	ENSP00000302455:Y621C	Y	+	2	0	ZNF17	62624534	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.481000	0.06552	-0.527000	0.06374	0.460000	0.39030	TAC	ZNF17	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186272		0.403	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF17	HGNC	protein_coding	OTTHUMT00000466384.1	-	0.00	78	0	A	NM_006959		57932722	+1	tier1	-	no_errors	ENST00000601808	ensembl	human	known	74_37	missense	7.48	99	8	SNP	0.000	G
ZNF33A	7581	genome.wustl.edu	37	10	38343809	38343809	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr10:38343809G>C	ENST00000458705.2	+	5	912	c.754G>C	c.(754-756)Ggg>Cgg	p.G252R	ZNF33A_ENST00000307441.9_Missense_Mutation_p.G252R|ZNF33A_ENST00000432900.2_Missense_Mutation_p.G259R|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Missense_Mutation_p.G253R			Q06730	ZN33A_HUMAN	zinc finger protein 33A	252					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						TAATGAATTTGGGAGAACTTT	0.373																																																	0													75.0	70.0	72.0					10																	38343809		2203	4300	6503	SO:0001583	missense	0			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.754G>C	10.37:g.38343809G>C	ENSP00000387713:p.Gly252Arg		A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G259R	ENST00000458705.2	37	c.775	CCDS31182.1	10	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960407	0.34565	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.05258	3.48;3.48;3.47;3.47	2.26	0.0779	0.14410	.	2.335370	0.01958	N	0.043126	T	0.08670	0.0215	L	0.46157	1.445	0.22354	N	0.999173	P;P;B	0.49358	0.923;0.87;0.255	B;B;B	0.43103	0.408;0.36;0.119	T	0.26189	-1.0110	10	0.66056	D	0.02	.	4.8087	0.13333	0.1461:0.2205:0.6334:0.0	.	259;252;253	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	R	253;259;252;252	ENSP00000363747:G253R;ENSP00000402467:G259R;ENSP00000387713:G252R;ENSP00000304268:G252R	ENSP00000304268:G252R	G	+	1	0	ZNF33A	38383815	0.931000	0.31567	0.000000	0.03702	0.179000	0.23085	2.327000	0.43858	-0.134000	0.11516	0.460000	0.39030	GGG	ZNF33A	-	NULL	ENSG00000189180		0.373	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1	-	0.00	39	0	G	NM_006974		38343809	+1	tier1	-	no_errors	ENST00000432900	ensembl	human	known	74_37	missense	15.79	64	12	SNP	0.681	C
ZNF519	162655	genome.wustl.edu	37	18	14105606	14105606	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr18:14105606C>G	ENST00000590202.1	-	3	1085	c.933G>C	c.(931-933)caG>caC	p.Q311H	ZNF519_ENST00000589498.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	311					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						TATGGATTCTCTGATGTTGAG	0.388																																																	0													74.0	76.0	76.0					18																	14105606		2203	4300	6503	SO:0001583	missense	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.933G>C	18.37:g.14105606C>G	ENSP00000464872:p.Gln311His			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q311H	ENST00000590202.1	37	c.933	CCDS32797.1	18	.	.	.	.	.	.	.	.	.	.	C	10.99	1.508678	0.27036	.	.	ENSG00000175322	ENST00000309305	.	.	.	0.646	0.646	0.17789	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21022	0.0506	L	0.28556	0.865	0.27550	N	0.950519	B	0.27559	0.181	B	0.21151	0.033	T	0.19451	-1.0305	8	0.49607	T	0.09	.	3.0733	0.06237	0.0:0.6613:0.0:0.3387	.	311	Q8TB69	ZN519_HUMAN	H	311	.	ENSP00000307908:Q311H	Q	-	3	2	ZNF519	14095606	0.000000	0.05858	0.824000	0.32777	0.541000	0.35023	0.155000	0.16362	0.661000	0.30985	0.089000	0.15464	CAG	ZNF519	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175322		0.388	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1	-	0.00	58	0	C	NM_145287		14105606	-1	tier1	-	no_errors	ENST00000590202	ensembl	human	known	74_37	missense	7.89	70	6	SNP	0.986	G
ZNF563	147837	genome.wustl.edu	37	19	12430083	12430083	+	Silent	SNP	C	C	A	rs187827621		TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:12430083C>A	ENST00000293725.5	-	4	961	c.756G>T	c.(754-756)ccG>ccT	p.P252P	ZNF563_ENST00000595977.1_Missense_Mutation_p.R213L	NM_145276.2	NP_660319.1	Q8TA94	ZN563_HUMAN	zinc finger protein 563	252					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						TACATTCATACGGTTTCTCCC	0.403																																					GBM(39;623 795 5132 29510 31476)												0													144.0	146.0	145.0					19																	12430083		2203	4300	6503	SO:0001819	synonymous_variant	0			BC022523	CCDS12270.1	19p13.2	2013-09-20			ENSG00000188868	ENSG00000188868		"""Zinc fingers, C2H2-type"", ""-"""	30498	protein-coding gene	gene with protein product							Standard	NM_145276		Approved	FLJ34797	uc002mtp.3	Q8TA94	OTTHUMG00000156413	ENST00000293725.5:c.756G>T	19.37:g.12430083C>A			B2R9E7|Q8NAT7	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R213L	ENST00000293725.5	37	c.638	CCDS12270.1	19	.	.	.	.	.	.	.	.	.	.	C	2.518	-0.311340	0.05422	.	.	ENSG00000188868	ENST00000318168	.	.	.	1.0	-2.0	0.07433	.	.	.	.	.	T	0.19604	0.0471	.	.	.	0.09310	N	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.20207	-1.0282	7	0.45353	T	0.12	.	0.0555	0.00013	0.3046:0.1696:0.2033:0.3225	.	213	Q8TA94-2	.	L	213	.	ENSP00000313712:R213L	R	-	2	0	ZNF563	12291083	0.000000	0.05858	0.197000	0.23402	0.137000	0.21094	-2.471000	0.00990	-1.615000	0.01573	-0.657000	0.03884	CGT	ZNF563	-	NULL	ENSG00000188868		0.403	ZNF563-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF563	HGNC	protein_coding	OTTHUMT00000344114.1	-	0.00	134	0	C	NM_145276		12430083	-1	tier1	-	no_errors	ENST00000595977	ensembl	human	known	74_37	missense	7.81	177	15	SNP	0.008	A
ZNF529	57711	genome.wustl.edu	37	19	37038208	37038208	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:37038208C>T	ENST00000591340.1	-	5	1410	c.1252G>A	c.(1252-1254)Ggt>Agt	p.G418S	ZNF529_ENST00000334116.7_Missense_Mutation_p.G313S	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	Esophageal squamous(110;0.198)					GGTTTTTCACCAGTATGAATC	0.368																																																	0													102.0	113.0	110.0					19																	37038208		2144	4281	6425	SO:0001583	missense	0			AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.1252G>A	19.37:g.37038208C>T	ENSP00000465578:p.Gly418Ser		K7EKE1|Q9H731|Q9HCF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G418S	ENST00000591340.1	37	c.1252	CCDS54256.1	19	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516134	0.85495	.	.	ENSG00000186020	ENST00000334116	.	.	.	3.19	3.19	0.36642	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.69043	0.3067	L	0.52364	1.645	0.36122	D	0.845515	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.77360	-0.2617	8	0.87932	D	0	.	13.2329	0.59953	0.0:1.0:0.0:0.0	.	313;385	Q6P280-2;Q6P280	.;ZN529_HUMAN	S	418	.	ENSP00000334695:G418S	G	-	1	0	ZNF529	41730048	0.060000	0.20803	1.000000	0.80357	0.991000	0.79684	3.301000	0.51842	1.606000	0.50161	0.591000	0.81541	GGT	ZNF529	-	pfscan_Znf_C2H2	ENSG00000186020		0.368	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF529	HGNC	protein_coding	OTTHUMT00000452730.1		0.00	54	0	C	NM_020951		37038208	-1			no_errors	ENST00000591340	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
ZNF592	9640	genome.wustl.edu	37	15	85326476	85326476	+	Silent	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr15:85326476G>T	ENST00000560079.2	+	4	858	c.570G>T	c.(568-570)ccG>ccT	p.P190P	ZNF592_ENST00000299927.3_Silent_p.P190P	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	190					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTAAGTTTCCGGTTCCAGAGC	0.542																																																	0													69.0	83.0	79.0					15																	85326476		2202	4298	6500	SO:0001819	synonymous_variant	0			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.570G>T	15.37:g.85326476G>T			Q2M1T2|Q504Y9	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P190	ENST00000560079.2	37	c.570	CCDS32317.1	15																																																																																			ZNF592	-	NULL	ENSG00000166716		0.542	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	-	0.00	43	0	G	NM_014630		85326476	+1	tier1	-	no_errors	ENST00000299927	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.054	T
ZNF594	84622	genome.wustl.edu	37	17	5085724	5085724	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:5085724C>T	ENST00000399604.4	-	1	1968	c.1828G>A	c.(1828-1830)Gac>Aac	p.D610N	ZNF594_ENST00000575779.1_Missense_Mutation_p.D610N			Q96JF6	ZN594_HUMAN	zinc finger protein 594	610					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CTCAGAAGGTCTGAGCTCTGA	0.398																																																	0													164.0	167.0	166.0					17																	5085724		2012	4197	6209	SO:0001583	missense	0			AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.1828G>A	17.37:g.5085724C>T	ENSP00000382513:p.Asp610Asn		Q6RFS0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D610N	ENST00000399604.4	37	c.1828	CCDS42241.1	17	.	.	.	.	.	.	.	.	.	.	c	3.544	-0.093175	0.07053	.	.	ENSG00000180626	ENST00000399604;ENST00000389222	T	0.07444	3.19	1.26	0.0525	0.14302	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04952	0.0133	N	0.00738	-1.235	0.09310	N	1	D	0.61080	0.989	D	0.68353	0.957	T	0.35425	-0.9789	9	0.11794	T	0.64	.	6.9991	0.24799	0.0:0.7144:0.2855:0.0	.	610	Q96JF6	ZN594_HUMAN	N	610;205	ENSP00000382513:D610N	ENSP00000373874:D205N	D	-	1	0	ZNF594	5026448	0.000000	0.05858	0.001000	0.08648	0.308000	0.27856	-3.251000	0.00540	-0.186000	0.10533	0.184000	0.17185	GAC	ZNF594	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180626		0.398	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF594	HGNC	protein_coding	OTTHUMT00000438996.1	-	0.00	120	0	C	XM_290737		5085724	-1	tier1	-	no_errors	ENST00000399604	ensembl	human	known	74_37	missense	11.61	137	18	SNP	0.002	T
ZNF646	9726	genome.wustl.edu	37	16	31087847	31087847	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr16:31087847C>T	ENST00000394979.2	+	1	625	c.202C>T	c.(202-204)Cgg>Tgg	p.R68W	ZNF668_ENST00000300849.4_5'Flank|ZNF646_ENST00000300850.5_Missense_Mutation_p.R68W|ZNF668_ENST00000564456.1_5'Flank			O15015	ZN646_HUMAN	zinc finger protein 646	68					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						TAACCATCGTCGGACCCACGA	0.607																																																	0													109.0	68.0	82.0					16																	31087847		2197	4300	6497	SO:0001583	missense	0			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.202C>T	16.37:g.31087847C>T	ENSP00000378429:p.Arg68Trp		Q8IVD8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R68W	ENST00000394979.2	37	c.202		16	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129681	0.56721	.	.	ENSG00000167395	ENST00000428260;ENST00000300850;ENST00000394979	T;T;T	0.58652	0.32;0.32;0.32	5.9	3.94	0.45596	.	.	.	.	.	T	0.69628	0.3132	M	0.71206	2.165	0.25993	N	0.982224	D	0.89917	1.0	P	0.62014	0.897	T	0.60520	-0.7247	9	0.87932	D	0	-9.0592	8.3223	0.32136	0.2756:0.6523:0.0:0.0721	.	68	O15015-2	.	W	68	ENSP00000391271:R68W;ENSP00000300850:R68W;ENSP00000378429:R68W	ENSP00000300850:R68W	R	+	1	2	ZNF646	30995348	0.007000	0.16637	0.993000	0.49108	0.975000	0.68041	1.062000	0.30555	0.815000	0.34398	0.563000	0.77884	CGG	ZNF646	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167395		0.607	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	-	0.00	51	0	C	NM_014699		31087847	+1	tier1	-	no_errors	ENST00000300850	ensembl	human	known	74_37	missense	8.45	65	6	SNP	0.551	T
ZNF676	163223	genome.wustl.edu	37	19	22364172	22364173	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:22364172_22364173insA	ENST00000397121.2	-	3	663_664	c.346_347insT	c.(346-348)ggcfs	p.G116fs		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TGCATATTTGCCACATTGAAAT	0.327																																																	0																																										SO:0001589	frameshift_variant	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.346_347insT	19.37:g.22364172_22364173insA	ENSP00000380310:p.Gly116fs		A8MVX5	Frame_Shift_Ins	INS	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G116fs	ENST00000397121.2	37	c.347_346	CCDS42539.1	19																																																																																			ZNF676	-	NULL	ENSG00000196109		0.327	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1		0.00	126	0	0	NM_001001411		22364173	-1			no_errors	ENST00000397121	ensembl	human	known	74_37	frame_shift_ins	6.50	115	8	INS	0.000:0.003	A
ZNF750	79755	genome.wustl.edu	37	17	80790122	80790122	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr17:80790122G>T	ENST00000269394.3	-	2	1042	c.209C>A	c.(208-210)tCa>tAa	p.S70*	ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron|TBCD_ENST00000355528.4_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	70					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GGGGTCTAGTGAGTTAGATTT	0.468																																																	0													141.0	117.0	125.0					17																	80790122		2203	4300	6503	SO:0001587	stop_gained	0			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.209C>A	17.37:g.80790122G>T	ENSP00000269394:p.Ser70*		Q9H899	Nonsense_Mutation	SNP	NULL	p.S70*	ENST00000269394.3	37	c.209	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	G	40	8.037065	0.98621	.	.	ENSG00000141579	ENST00000269394	.	.	.	5.86	5.86	0.93980	.	0.274240	0.31347	N	0.007809	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.8232	19.1589	0.93524	0.0:0.0:1.0:0.0	.	.	.	.	X	70	.	.	S	-	2	0	ZNF750	78383411	0.793000	0.28825	0.007000	0.13788	0.014000	0.08584	5.269000	0.65542	2.773000	0.95371	0.655000	0.94253	TCA	ZNF750	-	NULL	ENSG00000141579		0.468	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	-	0.00	71	0	G	NM_024702		80790122	-1	tier1	-	no_errors	ENST00000269394	ensembl	human	known	74_37	nonsense	29.27	58	24	SNP	0.201	T
ZNF765	91661	genome.wustl.edu	37	19	53912375	53912375	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:53912375G>A	ENST00000396408.3	+	4	1684	c.1567G>A	c.(1567-1569)Gtg>Atg	p.V523M	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		GAAACTACACGTGTAATGAGT	0.378																																																	0													28.0	29.0	29.0					19																	53912375		2171	4290	6461	SO:0001583	missense	0			BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.1567G>A	19.37:g.53912375G>A	ENSP00000379689:p.Val523Met		A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V523M	ENST00000396408.3	37	c.1567	CCDS46171.1	19	.	.	.	.	.	.	.	.	.	.	-	5.151	0.213398	0.09757	.	.	ENSG00000196417	ENST00000396408	T	0.09255	3.0	1.27	-0.176	0.13311	.	.	.	.	.	T	0.06188	0.0160	L	0.27053	0.805	0.09310	N	1	B	0.25007	0.116	B	0.18561	0.022	T	0.42361	-0.9456	8	.	.	.	.	4.9749	0.14135	0.7897:0.0:0.2103:0.0	.	523	Q7L2R6	ZN765_HUMAN	M	523	ENSP00000379689:V523M	.	V	+	1	0	ZNF765	58604187	0.000000	0.05858	0.004000	0.12327	0.012000	0.07955	-1.442000	0.02407	-0.344000	0.08338	0.297000	0.19635	GTG	ZNF765	-	NULL	ENSG00000196417		0.378	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF765	HGNC	protein_coding	OTTHUMT00000371603.1	-	0.00	79	0	G	NM_138372		53912375	+1	tier1	-	no_errors	ENST00000396408	ensembl	human	known	74_37	missense	5.66	100	6	SNP	0.004	A
ZNF761	388561	genome.wustl.edu	37	19	53959386	53959386	+	RNA	SNP	G	G	C			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:53959386G>C	ENST00000454407.1	+	0	2078							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R488T(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TGCCATCGTAGACTTCATTCT	0.448																																																	1	Substitution - Missense(1)	lung(1)											101.0	100.0	100.0					19																	53959386		2203	4300	6503			0			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959386G>C			Q6ZNB9	RNA	SNP	-	NULL	ENST00000454407.1	37	NULL		19																																																																																			ZNF761	-	-	ENSG00000160336		0.448	ZNF761-203	KNOWN	basic	processed_transcript	ZNF761	HGNC	processed_transcript		-	0.00	144	0	G	NM_001008401		53959386	+1	tier1	-	no_errors	ENST00000334095	ensembl	human	known	74_37	rna	5.13	148	8	SNP	0.204	C
ZNF876P	642280	genome.wustl.edu	37	4	248385	248385	+	RNA	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr4:248385C>A	ENST00000356347.3	+	0	1209					NR_027481.1		Q49A33	Z876P_HUMAN	zinc finger protein 876, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GGCAAAAACCCTACAAATGTG	0.368																																																	0																																												0			BC028359		4p16.3	2011-04-20	2010-08-03	2009-07-22	ENSG00000198155	ENSG00000198155			32472	pseudogene	pseudogene							Standard	NR_027481		Approved		uc010iba.4	Q49A33	OTTHUMG00000159874		4.37:g.248385C>A				RNA	SNP	-	NULL	ENST00000356347.3	37	NULL		4																																																																																			ZNF876P	-	-	ENSG00000198155		0.368	ZNF876P-001	KNOWN	basic	processed_transcript	ZNF876P	HGNC	pseudogene	OTTHUMT00000357870.2	-	0.00	26	0	C	NR_027481		248385	+1	tier1	-	no_errors	ENST00000356347	ensembl	human	known	74_37	rna	10.94	57	7	SNP	0.061	A
ZNF98	148198	genome.wustl.edu	37	19	22574497	22574497	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:22574497C>A	ENST00000357774.5	-	4	1661	c.1540G>T	c.(1540-1542)Gga>Tga	p.G514*		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				GGTTTCTCTCCAGTATGAATC	0.388																																																	0													58.0	51.0	53.0					19																	22574497		2177	4273	6450	SO:0001587	stop_gained	0				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1540G>T	19.37:g.22574497C>A	ENSP00000350418:p.Gly514*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G514*	ENST00000357774.5	37	c.1540	CCDS46031.1	19	.	.	.	.	.	.	.	.	.	.	.	15.10	2.731978	0.48939	.	.	ENSG00000197360	ENST00000357774	.	.	.	1.26	-0.0737	0.13734	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	5.3184	0.15868	0.0:0.6229:0.0:0.3771	.	.	.	.	X	514	.	ENSP00000350418:G514X	G	-	1	0	ZNF98	22366337	0.001000	0.12720	0.001000	0.08648	0.012000	0.07955	0.663000	0.25053	-0.157000	0.11059	0.289000	0.19496	GGA	ZNF98	-	pfscan_Znf_C2H2	ENSG00000197360		0.388	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF98	HGNC	protein_coding	OTTHUMT00000464398.1	-	0.00	59	0	C	NM_001098626		22574497	-1	tier1	-	no_errors	ENST00000357774	ensembl	human	known	74_37	nonsense	11.00	89	11	SNP	0.053	A
ZSCAN5C	649137	genome.wustl.edu	37	19	56720301	56720301	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FP-01A-31D-A387-09	TCGA-LN-A9FP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b4e74934-f10d-4f7c-aacb-dc3e8f75ba95	27379346-c896-4ae6-8780-020cac2513ef	g.chr19:56720301G>T	ENST00000534327.1	+	5	1372	c.1223G>T	c.(1222-1224)gGc>gTc	p.G408V	ZSCAN5C_ENST00000376267.1_Missense_Mutation_p.G408V			A6NGD5	ZSA5C_HUMAN	zinc finger and SCAN domain containing 5C	408					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|lung(6)|stomach(1)	8						ACCCACACTGGCGAGAGGCCC	0.542																																																	0																																										SO:0001583	missense	0					19q13.43	2013-01-08			ENSG00000204532	ENSG00000204532		"""-"", ""Zinc fingers, C2H2-type"""	34294	protein-coding gene	gene with protein product							Standard	NG_012782		Approved	ZNF495C		A6NGD5	OTTHUMG00000167475	ENST00000534327.1:c.1223G>T	19.37:g.56720301G>T	ENSP00000435234:p.Gly408Val			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.G408V	ENST00000534327.1	37	c.1223		19	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176309	0.38413	.	.	ENSG00000204532	ENST00000534327;ENST00000376267	T;T	0.23552	1.9;1.9	1.38	1.38	0.22167	.	.	.	.	.	T	0.35828	0.0945	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29640	-1.0005	6	0.87932	D	0	.	8.6938	0.34282	0.0:0.0:1.0:0.0	.	.	.	.	V	408	ENSP00000435234:G408V;ENSP00000365443:G408V	ENSP00000365443:G408V	G	+	2	0	ZSCAN5C	61412113	1.000000	0.71417	0.023000	0.16930	0.021000	0.10359	5.943000	0.70211	1.098000	0.41479	0.195000	0.17529	GGC	ZSCAN5C	-	pfscan_Znf_C2H2	ENSG00000204532		0.542	ZSCAN5C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ZSCAN5C	HGNC	protein_coding	OTTHUMT00000394739.1	-	0.00	71	0	G	XM_001131980		56720301	+1	tier1	-	no_errors	ENST00000376267	ensembl	human	known	74_37	missense	5.88	80	5	SNP	0.768	T
