#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA5	23461	genome.wustl.edu	37	17	67250503	67250503	+	Silent	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:67250503T>C	ENST00000392676.3	-	32	4261	c.4197A>G	c.(4195-4197)ggA>ggG	p.G1399G	ABCA5_ENST00000392677.2_Silent_p.G1400G|ABCA5_ENST00000588877.1_Silent_p.G1399G			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	1399	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	CTTTGACAGCTCCATAAATTT	0.368																																																	0													142.0	138.0	139.0					17																	67250503		2203	4300	6503	SO:0001819	synonymous_variant	0			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.4197A>G	17.37:g.67250503T>C			Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G1400	ENST00000392676.3	37	c.4200	CCDS11685.1	17																																																																																			ABCA5	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154265		0.368	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCA5	HGNC	protein_coding	OTTHUMT00000450654.1		0.00	33	0	T	NM_018672		67250503	-1			no_errors	ENST00000392677	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	C
ACTL9	284382	genome.wustl.edu	37	19	8807881	8807881	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:8807881G>A	ENST00000324436.3	-	1	1291	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	391						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R391C(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TGGAAGGCGCGCAGGGAGGCC	0.652																																																	1	Substitution - Missense(1)	large_intestine(1)											37.0	39.0	38.0					19																	8807881		2203	4299	6502	SO:0001583	missense	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1171C>T	19.37:g.8807881G>A	ENSP00000316674:p.Arg391Cys		A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R391C	ENST00000324436.3	37	c.1171	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	g	10.61	1.399657	0.25291	.	.	ENSG00000181786	ENST00000324436	T	0.08193	3.12	4.51	2.23	0.28157	.	0.317190	0.22565	N	0.058402	T	0.12220	0.0297	L	0.29908	0.895	0.35755	D	0.81972	D	0.76494	0.999	P	0.60886	0.88	T	0.17684	-1.0361	10	0.87932	D	0	.	6.1475	0.20293	0.0884:0.0:0.5749:0.3367	.	391	Q8TC94	ACTL9_HUMAN	C	391	ENSP00000316674:R391C	ENSP00000316674:R391C	R	-	1	0	ACTL9	8668881	0.013000	0.17824	0.431000	0.26735	0.759000	0.43091	0.742000	0.26216	0.564000	0.29238	0.457000	0.33378	CGC	ACTL9	-	pfam_Actin-related,smart_Actin-related	ENSG00000181786		0.652	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	-	0.00	50	0	G	NM_178525		8807881	-1	tier1	-	no_errors	ENST00000324436	ensembl	human	known	74_37	missense	40.35	34	23	SNP	0.994	A
ADAM18	8749	genome.wustl.edu	37	8	39466580	39466580	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:39466580T>G	ENST00000265707.5	+	4	253	c.208T>G	c.(208-210)Ttt>Gtt	p.F70V	ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000379866.1_Missense_Mutation_p.F70V|ADAM18_ENST00000520772.1_Missense_Mutation_p.F70V	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	70					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			ACCCCAGAACTTTTTGGTTTA	0.229																																																	0													50.0	52.0	51.0					8																	39466580		2199	4287	6486	SO:0001583	missense	0			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.208T>G	8.37:g.39466580T>G	ENSP00000265707:p.Phe70Val		B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.F70V	ENST00000265707.5	37	c.208	CCDS6113.1	8	.	.	.	.	.	.	.	.	.	.	T	9.895	1.205339	0.22205	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000520772;ENST00000522198	T;T;T	0.07444	3.19;3.19;3.19	4.53	3.34	0.38264	Peptidase M12B, propeptide (1);	0.000000	0.46758	D	0.000277	T	0.30854	0.0778	M	0.91717	3.235	0.20563	N	0.999887	D;D;D	0.67145	0.996;0.996;0.983	D;D;D	0.74023	0.969;0.982;0.98	T	0.13045	-1.0524	10	0.87932	D	0	.	7.1563	0.25639	0.0:0.1008:0.0:0.8992	.	70;70;70	Q9Y3Q7-2;Q9Y3Q7;Q6IRW9	.;ADA18_HUMAN;.	V	70;70;70;26	ENSP00000265707:F70V;ENSP00000369195:F70V;ENSP00000429908:F70V	ENSP00000265707:F70V	F	+	1	0	ADAM18	39585737	0.980000	0.34600	0.011000	0.14972	0.046000	0.14306	2.183000	0.42565	1.023000	0.39654	0.533000	0.62120	TTT	ADAM18	-	pfam_Peptidase_M12B_N	ENSG00000168619		0.229	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM18	HGNC	protein_coding	OTTHUMT00000376916.1	-	0.00	55	0	T	NM_014237		39466580	+1	tier1	-	no_errors	ENST00000265707	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.021	G
ADAM21	8747	genome.wustl.edu	37	14	70925692	70925692	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:70925692C>T	ENST00000603540.1	+	2	1734	c.1476C>T	c.(1474-1476)gaC>gaT	p.D492D	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Silent_p.D492D	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	492	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D492E(2)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		ATGTGCAGGACGGGATCCCCT	0.448																																																	2	Substitution - Missense(2)	lung(2)											92.0	86.0	88.0					14																	70925692		2203	4300	6503	SO:0001819	synonymous_variant	0			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.1476C>T	14.37:g.70925692C>T			O43507|Q2VPC6|Q32MR0	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D492	ENST00000603540.1	37	c.1476	CCDS9804.1	14																																																																																			ADAM21	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000139985		0.448	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM21	HGNC	protein_coding	OTTHUMT00000413008.3		0.00	101	0	C			70925692	+1			no_errors	ENST00000267499	ensembl	human	known	74_37	silent	7.46	62	5	SNP	0.997	T
ADAMTS17	170691	genome.wustl.edu	37	15	100516343	100516343	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:100516343G>A	ENST00000268070.4	-	21	3139	c.3034C>T	c.(3034-3036)Ccc>Tcc	p.P1012S	CTD-3076O17.2_ENST00000559400.1_RNA|CTD-3076O17.1_ENST00000528696.3_RNA	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	1012	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GAGAGGGCGGGGCACTCGCTG	0.652																																																	0													51.0	40.0	44.0					15																	100516343		2056	3966	6022	SO:0001583	missense	0			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.3034C>T	15.37:g.100516343G>A	ENSP00000268070:p.Pro1012Ser		Q2I7G4|Q6ZN75	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P1012S	ENST00000268070.4	37	c.3034	CCDS10383.1	15	.	.	.	.	.	.	.	.	.	.	G	2.916	-0.224206	0.06061	.	.	ENSG00000140470	ENST00000268070	T	0.51574	0.7	5.28	4.35	0.52113	.	0.227318	0.37623	N	0.002016	T	0.28433	0.0703	N	0.20328	0.56	0.44807	D	0.997812	B	0.16603	0.018	B	0.15870	0.014	T	0.07195	-1.0785	10	0.07325	T	0.83	.	11.3342	0.49494	0.0:0.1367:0.7213:0.142	.	1012	Q8TE56	ATS17_HUMAN	S	1012	ENSP00000268070:P1012S	ENSP00000268070:P1012S	P	-	1	0	ADAMTS17	98333866	1.000000	0.71417	0.959000	0.39883	0.622000	0.37654	2.719000	0.47244	1.316000	0.45131	0.563000	0.77884	CCC	ADAMTS17	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000140470		0.652	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS17	HGNC	protein_coding	OTTHUMT00000313595.1	-	0.00	59	0	G	NM_139057		100516343	-1	tier1	-	no_errors	ENST00000268070	ensembl	human	known	74_37	missense	10.71	50	6	SNP	0.986	A
ADAMTS20	80070	genome.wustl.edu	37	12	43771277	43771277	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:43771277A>C	ENST00000389420.3	-	32	4885	c.4886T>G	c.(4885-4887)cTt>cGt	p.L1629R		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1629	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TATAGGCCGAAGTCGATGGAG	0.408																																																	0													135.0	124.0	128.0					12																	43771277		2203	4300	6503	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4886T>G	12.37:g.43771277A>C	ENSP00000374071:p.Leu1629Arg		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.L1629R	ENST00000389420.3	37	c.4886	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	A	11.35	1.613954	0.28712	.	.	ENSG00000173157	ENST00000389420	T	0.59906	0.23	5.08	3.93	0.45458	.	0.000000	0.46442	D	0.000295	T	0.66867	0.2833	M	0.61703	1.905	0.80722	D	1	D	0.63046	0.992	P	0.61328	0.887	T	0.63620	-0.6596	10	0.27082	T	0.32	.	11.2151	0.48821	0.9267:0.0:0.0733:0.0	.	1629	P59510	ATS20_HUMAN	R	1629	ENSP00000374071:L1629R	ENSP00000374071:L1629R	L	-	2	0	ADAMTS20	42057544	0.992000	0.36948	0.034000	0.17996	0.037000	0.13140	3.642000	0.54367	1.031000	0.39867	0.533000	0.62120	CTT	ADAMTS20	-	superfamily_Thrombospondin_1_rpt	ENSG00000173157		0.408	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	-	0.00	74	0	A	NM_025003		43771277	-1	tier1	-	no_errors	ENST00000389420	ensembl	human	known	74_37	missense	17.02	39	8	SNP	0.960	C
ADAMTS20	80070	genome.wustl.edu	37	12	43846085	43846085	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:43846085G>T	ENST00000389420.3	-	14	2070	c.2071C>A	c.(2071-2073)Cag>Aag	p.Q691K	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.Q691K	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	691	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACCATACACTGGCCTTGAACA	0.308																																																	0													85.0	79.0	81.0					12																	43846085		2203	4298	6501	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2071C>A	12.37:g.43846085G>T	ENSP00000374071:p.Gln691Lys		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Q691K	ENST00000389420.3	37	c.2071	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	3.927	-0.016875	0.07681	.	.	ENSG00000173157	ENST00000389420;ENST00000553158	T;T	0.65364	-0.15;0.39	4.54	0.374	0.16183	.	1.175160	0.06625	N	0.758057	T	0.41604	0.1166	N	0.17872	0.535	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.46303	-0.9201	10	0.44086	T	0.13	.	0.6252	0.00785	0.1782:0.1822:0.2125:0.4271	.	691	P59510	ATS20_HUMAN	K	691	ENSP00000374071:Q691K;ENSP00000448341:Q691K	ENSP00000374071:Q691K	Q	-	1	0	ADAMTS20	42132352	1.000000	0.71417	0.420000	0.26596	0.148000	0.21650	1.684000	0.37649	0.173000	0.19788	-0.485000	0.04761	CAG	ADAMTS20	-	prints_Peptidase_M12B_ADAM-TS	ENSG00000173157		0.308	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	-	0.00	65	0	G	NM_025003		43846085	-1	tier1	-	no_errors	ENST00000389420	ensembl	human	known	74_37	missense	21.74	36	10	SNP	0.981	T
ADAMTS7	11173	genome.wustl.edu	37	15	79058876	79058876	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:79058876C>A	ENST00000388820.4	-	19	3587	c.3377G>T	c.(3376-3378)gGa>gTa	p.G1126V	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1126					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GGACCAAGGTCCCAGTACCCC	0.682																																																	0													8.0	11.0	10.0					15																	79058876		2139	4235	6374	SO:0001583	missense	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3377G>T	15.37:g.79058876C>A	ENSP00000373472:p.Gly1126Val		Q14F51|Q6P7J9	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G1126V	ENST00000388820.4	37	c.3377	CCDS32303.1	15	.	.	.	.	.	.	.	.	.	.	c	12.57	1.977286	0.34848	.	.	ENSG00000136378	ENST00000388820	T	0.58797	0.31	4.06	3.08	0.35506	.	0.845349	0.10355	N	0.684657	T	0.49201	0.1543	L	0.50333	1.59	0.09310	N	0.999995	P	0.39480	0.675	B	0.33121	0.158	T	0.22730	-1.0208	10	0.34782	T	0.22	.	12.2245	0.54453	0.0:0.8258:0.1742:0.0	.	1126	Q9UKP4	ATS7_HUMAN	V	1126	ENSP00000373472:G1126V	ENSP00000373472:G1126V	G	-	2	0	ADAMTS7	76845931	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.077000	0.11394	0.728000	0.32382	0.574000	0.79327	GGA	ADAMTS7	-	NULL	ENSG00000136378		0.682	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1		0.00	70	0	C	NM_014272		79058876	-1			no_errors	ENST00000388820	ensembl	human	known	74_37	missense	13.73	44	7	SNP	0.005	A
ADGB	79747	genome.wustl.edu	37	6	147109545	147109545	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:147109545G>A	ENST00000397944.3	+	33	4412	c.4336G>A	c.(4336-4338)Gta>Ata	p.V1446I	ADGB_ENST00000367488.1_Missense_Mutation_p.V169I|ADGB_ENST00000367493.3_3'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1446					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						tgCACGTGGCGTAAAAGAACC	0.448																																																	0													188.0	173.0	177.0					6																	147109545		692	1591	2283	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4336G>A	6.37:g.147109545G>A	ENSP00000381036:p.Val1446Ile		Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.V1446I	ENST00000397944.3	37	c.4336		6	.	.	.	.	.	.	.	.	.	.	G	11.60	1.686754	0.29962	.	.	ENSG00000118492	ENST00000397944;ENST00000367490;ENST00000326916;ENST00000470716;ENST00000367488	T;T	0.44482	1.5;0.92	3.2	-0.0347	0.13895	.	.	.	.	.	T	0.05593	0.0147	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.04013	0.001;0.001	T	0.43147	-0.9409	9	0.11794	T	0.64	.	5.7283	0.18024	0.4271:0.0:0.5729:0.0	.	1446;391	Q8N7X0;Q8N7X0-2	CAN7L_HUMAN;.	I	1446;404;169;110;169	ENSP00000381036:V1446I;ENSP00000356460:V404I	ENSP00000323839:V169I	V	+	1	0	C6orf103	147151238	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.420000	0.07062	-0.019000	0.14055	0.655000	0.94253	GTA	ADGB	-	NULL	ENSG00000118492		0.448	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	-	0.00	32	0	G	NM_024694		147109545	+1	tier1	-	no_errors	ENST00000397944	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.000	A
ADRM1	11047	genome.wustl.edu	37	20	60882434	60882434	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:60882434G>A	ENST00000253003.2	+	6	595	c.549G>A	c.(547-549)ctG>ctA	p.L183L	RP11-157P1.4_ENST00000414042.1_RNA|LAMA5_ENST00000492698.1_5'Flank	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1	183	Gly-rich.				positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			CAGGTGGGCTGGGGGCCCTGA	0.667																																																	0													29.0	30.0	30.0					20																	60882434		2197	4297	6494	SO:0001819	synonymous_variant	0			D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904	ENST00000253003.2:c.549G>A	20.37:g.60882434G>A			A0PKB1|Q96FJ7|Q9H1P2	Silent	SNP	pfam_26S_Psome_Ubiquitin-recp_Rpn13	p.L183	ENST00000253003.2	37	c.549	CCDS13496.1	20																																																																																			ADRM1	-	pfam_26S_Psome_Ubiquitin-recp_Rpn13	ENSG00000130706		0.667	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRM1	HGNC	protein_coding	OTTHUMT00000080007.1	-	0.00	76	0	G			60882434	+1	tier1	-	no_errors	ENST00000253003	ensembl	human	known	74_37	silent	26.76	52	19	SNP	0.997	A
AKAP13	11214	genome.wustl.edu	37	15	86207955	86207955	+	Missense_Mutation	SNP	A	A	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:86207955A>T	ENST00000394518.2	+	13	5056	c.4961A>T	c.(4960-4962)gAc>gTc	p.D1654V	RP11-815J21.4_ENST00000558980.1_RNA|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.D1658V	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1654					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CTGGAGTCAGACCAGAGAGAA	0.408																																					Melanoma(94;603 1453 3280 32295 32951)												0													96.0	88.0	91.0					15																	86207955		2202	4299	6501	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.4961A>T	15.37:g.86207955A>T	ENSP00000378026:p.Asp1654Val		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.D1658V	ENST00000394518.2	37	c.4973	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	8.918	0.960435	0.18583	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000452008	T;T	0.12255	2.7;2.82	5.64	-0.727	0.11166	.	.	.	.	.	T	0.11665	0.0284	L	0.40543	1.245	0.29135	N	0.879393	P;P;B	0.40875	0.731;0.612;0.429	B;B;B	0.40329	0.241;0.121;0.326	T	0.17471	-1.0368	9	0.72032	D	0.01	.	7.5176	0.27610	0.6891:0.1422:0.1686:0.0	.	1636;1654;1658	Q12802-4;Q12802;Q12802-2	.;AKP13_HUMAN;.	V	1658;1654;1657;1635;276	ENSP00000354718:D1658V;ENSP00000378026:D1654V	ENSP00000354718:D1658V	D	+	2	0	AKAP13	84008959	1.000000	0.71417	0.045000	0.18777	0.344000	0.29017	1.995000	0.40767	-0.179000	0.10654	-1.922000	0.00515	GAC	AKAP13	-	NULL	ENSG00000170776		0.408	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	-	0.00	30	0	A	NM_007200		86207955	+1	tier1	-	no_errors	ENST00000361243	ensembl	human	known	74_37	missense	11.90	37	5	SNP	0.068	T
AGBL1	123624	genome.wustl.edu	37	15	86697696	86697696	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:86697696G>A	ENST00000441037.2	+	3	255	c.160G>A	c.(160-162)Gca>Aca	p.A54T	AGBL1_ENST00000421325.2_Missense_Mutation_p.A54T	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	54					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						AGAATTGGAAGCACTTGATGT	0.443																																																	0													91.0	93.0	92.0					15																	86697696		1944	4129	6073	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.160G>A	15.37:g.86697696G>A	ENSP00000413001:p.Ala54Thr		A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.A54T	ENST00000441037.2	37	c.160	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783728	0.70222	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T;T	0.68181	0.44;-0.31	5.4	5.4	0.78164	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.80110	0.4563	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.79396	-0.1821	9	0.44086	T	0.13	-9.1229	15.032	0.71713	0.0:0.0:1.0:0.0	.	54	Q96MI9	CBPC4_HUMAN	T	83;54	ENSP00000413001:A83T;ENSP00000397173:A54T	ENSP00000397173:A54T	A	+	1	0	AGBL1	84498700	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	5.401000	0.66326	2.683000	0.91414	0.650000	0.86243	GCA	AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.443	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	-	0.00	51	0	G	NM_152336		86697696	+1	tier1	-	no_errors	ENST00000441037	ensembl	human	known	74_37	missense	14.63	70	12	SNP	1.000	A
ANKRD35	148741	genome.wustl.edu	37	1	145562600	145562600	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:145562600C>T	ENST00000355594.4	+	10	2375	c.2288C>T	c.(2287-2289)cCg>cTg	p.P763L		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	763										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCCTTGTCCCCGTGTAGGGAG	0.657																																					Melanoma(9;127 754 22988 51047)												0													9.0	11.0	10.0					1																	145562600		2194	4288	6482	SO:0001583	missense	0			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.2288C>T	1.37:g.145562600C>T	ENSP00000347802:p.Pro763Leu		A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P763L	ENST00000355594.4	37	c.2288	CCDS919.1	1	.	.	.	.	.	.	.	.	.	.	C	0.957	-0.704535	0.03255	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.54071	0.59	4.64	-2.52	0.06346	.	0.863537	0.09890	N	0.742541	T	0.17831	0.0428	L	0.51422	1.61	0.09310	N	0.999998	B	0.11235	0.004	B	0.04013	0.001	T	0.22871	-1.0204	10	0.42905	T	0.14	-0.3837	1.076	0.01632	0.4169:0.255:0.148:0.1801	.	763	Q8N283	ANR35_HUMAN	L	672;763	ENSP00000347802:P763L	ENSP00000347802:P763L	P	+	2	0	ANKRD35	144273957	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.975000	0.01498	-0.228000	0.09869	0.655000	0.94253	CCG	ANKRD35	-	NULL	ENSG00000198483		0.657	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	HGNC	protein_coding	OTTHUMT00000038515.1	-	0.00	37	0	C	NM_144698		145562600	+1	tier1	-	no_errors	ENST00000355594	ensembl	human	known	74_37	missense	11.76	45	6	SNP	0.000	T
ANKRD36	375248	genome.wustl.edu	37	2	97853088	97853088	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:97853088C>G	ENST00000461153.2	+	32	2337	c.2093C>G	c.(2092-2094)tCt>tGt	p.S698C	ANKRD36_ENST00000420699.2_Missense_Mutation_p.S698C			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	698										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GAGGAAGACTCTGTTTCGAAT	0.308																																																	0													39.0	32.0	34.0					2																	97853088		692	1590	2282	SO:0001583	missense	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2093C>G	2.37:g.97853088C>G	ENSP00000419530:p.Ser698Cys		B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S698C	ENST00000461153.2	37	c.2093	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	10.20	1.285523	0.23478	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.20598	2.06;2.06	1.37	1.37	0.22104	.	.	.	.	.	T	0.32615	0.0835	L	0.43923	1.385	0.18873	N	0.999989	D;D	0.76494	0.996;0.999	D;D	0.87578	0.926;0.998	T	0.06445	-1.0826	9	0.54805	T	0.06	.	6.2063	0.20604	0.0:1.0:0.0:0.0	.	698;165	A6QL64;Q5JPF3-3	AN36A_HUMAN;.	C	698;698;60	ENSP00000419530:S698C;ENSP00000391950:S698C	ENSP00000391950:S698C	S	+	2	0	ANKRD36	97216815	0.016000	0.18221	0.016000	0.15963	0.012000	0.07955	1.937000	0.40193	1.058000	0.40530	0.184000	0.17185	TCT	ANKRD36	-	NULL	ENSG00000135976		0.308	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	-	0.00	207	0	C			97853088	+1	tier1	-	no_errors	ENST00000420699	ensembl	human	known	74_37	missense	17.42	217	46	SNP	0.024	G
ANKRD7	56311	genome.wustl.edu	37	7	117864981	117864981	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:117864981G>C	ENST00000265224.4	+	1	252	c.97G>C	c.(97-99)Gct>Cct	p.A33P	ANKRD7_ENST00000477532.1_Intron|ANKRD7_ENST00000417525.1_5'UTR|ANKRD7_ENST00000433239.1_5'UTR|ANKRD7_ENST00000357099.4_Missense_Mutation_p.A33P	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	33					male gonad development (GO:0008584)	nucleus (GO:0005634)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						TCACAGAGCTGCTTCAGTCGG	0.433																																																	0													90.0	90.0	90.0					7																	117864981		1830	4087	5917	SO:0001583	missense	0			D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.97G>C	7.37:g.117864981G>C	ENSP00000265224:p.Ala33Pro		B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A33P	ENST00000265224.4	37	c.97	CCDS43638.1	7	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153054	0.78001	.	.	ENSG00000106013	ENST00000357099;ENST00000265224;ENST00000486422	T;T;T	0.73047	-0.71;-0.71;-0.71	4.13	3.24	0.37175	Ankyrin repeat-containing domain (4);	0.000000	0.36482	U	0.002578	D	0.87337	0.6152	H	0.98629	4.285	0.47698	D	0.999495	D	0.64830	0.994	P	0.60012	0.867	D	0.89280	0.3611	10	0.87932	D	0	-0.4589	9.6209	0.39721	0.1038:0.0:0.8962:0.0	.	33	Q92527	ANKR7_HUMAN	P	33	ENSP00000349612:A33P;ENSP00000265224:A33P;ENSP00000417353:A33P	ENSP00000265224:A33P	A	+	1	0	ANKRD7	117652217	0.772000	0.28567	0.166000	0.22797	0.543000	0.35085	1.903000	0.39858	1.115000	0.41800	0.543000	0.68304	GCT	ANKRD7	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000106013		0.433	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD7	HGNC	protein_coding	OTTHUMT00000346826.1	-	0.00	26	0	G	NM_001077708		117864981	+1	tier1	-	no_errors	ENST00000357099	ensembl	human	known	74_37	missense	16.67	35	7	SNP	0.992	C
APEX1	328	genome.wustl.edu	37	14	20925203	20925203	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:20925203T>G	ENST00000216714.3	+	5	761	c.493T>G	c.(493-495)Ttt>Gtt	p.F165V	APEX1_ENST00000398030.4_Missense_Mutation_p.F165V|APEX1_ENST00000555414.1_Missense_Mutation_p.F165V|OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557365.1_3'UTR|APEX1_ENST00000557054.1_Intron|OSGEP_ENST00000206542.4_5'Flank	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1	165					aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)			breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	ATTTGACTCGTTTGTGCTGGT	0.478								Other BER factors																																									0													73.0	74.0	74.0					14																	20925203		2203	4300	6503	SO:0001583	missense	0			X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.493T>G	14.37:g.20925203T>G	ENSP00000216714:p.Phe165Val		Q969L5|Q99775	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_AP_endonuc_1	p.F165V	ENST00000216714.3	37	c.493	CCDS9550.1	14	.	.	.	.	.	.	.	.	.	.	T	20.8	4.049763	0.75846	.	.	ENSG00000100823	ENST00000555414;ENST00000216714;ENST00000553681;ENST00000398030;ENST00000556054;ENST00000557592;ENST00000557150	T;T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;0.01;-1.27;-1.27	5.79	5.79	0.91817	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	D	0.82572	0.5066	L	0.45744	1.44	0.80722	D	1	P	0.49447	0.924	P	0.57720	0.826	D	0.84334	0.0523	10	0.87932	D	0	.	15.118	0.72419	0.0:0.0:0.0:1.0	.	165	P27695	APEX1_HUMAN	V	165;165;165;165;165;148;148	ENSP00000451979:F165V;ENSP00000216714:F165V;ENSP00000451327:F165V;ENSP00000381111:F165V;ENSP00000451170:F165V;ENSP00000451060:F148V;ENSP00000452418:F148V	ENSP00000216714:F165V	F	+	1	0	APEX1	19995043	1.000000	0.71417	0.897000	0.35233	0.882000	0.50991	5.673000	0.68109	2.207000	0.71202	0.533000	0.62120	TTT	APEX1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_AP_endonuc_1	ENSG00000100823		0.478	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX1	HGNC	protein_coding	OTTHUMT00000073641.3	-	0.00	27	0	T	NM_001641		20925203	+1	tier1	-	no_errors	ENST00000216714	ensembl	human	known	74_37	missense	41.67	7	5	SNP	0.998	G
ASTE1	28990	genome.wustl.edu	37	3	130733046	130733047	+	Frame_Shift_Ins	INS	-	-	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:130733046_130733047insT	ENST00000264992.3	-	6	2335_2336	c.1894_1895insA	c.(1894-1896)aggfs	p.R632fs	ASTE1_ENST00000514044.1_Frame_Shift_Ins_p.R657fs|ATP2C1_ENST00000533801.2_Intron|ATP2C1_ENST00000359644.3_Intron|ATP2C1_ENST00000507488.2_Intron|ATP2C1_ENST00000422190.2_Intron|ATP2C1_ENST00000513801.1_Intron|ATP2C1_ENST00000393221.4_Intron|ATP2C1_ENST00000504381.1_Intron|ATP2C1_ENST00000328560.8_Intron	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	632					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R632fs*33(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTTCTTCTGCCTTTTTTTTTTT	0.406																																																	2	Deletion - Frameshift(2)	ovary(2)																																								SO:0001589	frameshift_variant	0			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1895dupA	3.37:g.130733057_130733057dupT	ENSP00000264992:p.Arg632fs		B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Ins	INS	pfam_XPG_DNA_repair_N	p.R632fs	ENST00000264992.3	37	c.1895_1894	CCDS3068.1	3																																																																																			ASTE1	-	NULL	ENSG00000034533		0.406	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1		0.00	18	0	-	NM_014065		130733047	-1	tier1		no_errors	ENST00000264992	ensembl	human	known	74_37	frame_shift_ins	18.18	18	4	INS	0.003:0.014	T
ATM	472	genome.wustl.edu	37	11	108164101	108164101	+	Missense_Mutation	SNP	C	C	T	rs587781712		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:108164101C>T	ENST00000452508.2	+	32	4862	c.4673C>T	c.(4672-4674)aCg>aTg	p.T1558M	ATM_ENST00000278616.4_Missense_Mutation_p.T1558M			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1558					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTCTATATCACGATTAAGCTT	0.299			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													93.0	95.0	94.0					11																	108164101		2200	4294	6494	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4673C>T	11.37:g.108164101C>T	ENSP00000388058:p.Thr1558Met		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.T1558M	ENST00000452508.2	37	c.4673	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264451	0.39995	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.01430	4.9;4.9	5.31	4.4	0.53042	Armadillo-type fold (1);	0.259820	0.45361	N	0.000366	T	0.02047	0.0064	L	0.44542	1.39	0.32123	N	0.587716	B	0.17268	0.021	B	0.13407	0.009	T	0.07558	-1.0766	10	0.44086	T	0.13	.	14.1278	0.65233	0.0:0.9273:0.0:0.0727	.	1558	Q13315	ATM_HUMAN	M	1558	ENSP00000278616:T1558M;ENSP00000388058:T1558M	ENSP00000278616:T1558M	T	+	2	0	ATM	107669311	0.593000	0.26840	0.939000	0.37840	0.982000	0.71751	2.072000	0.41510	1.369000	0.46134	0.655000	0.94253	ACG	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.299	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	66	0	C	NM_000051		108164101	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	22.92	37	11	SNP	0.996	T
PTCD1	26024	genome.wustl.edu	37	7	99032748	99032748	+	Missense_Mutation	SNP	G	G	A	rs375579760		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:99032748G>A	ENST00000292478.4	-	2	368	c.118C>T	c.(118-120)Cgg>Tgg	p.R40W	ATP5J2-PTCD1_ENST00000437572.1_5'UTR|PTCD1_ENST00000555673.1_Missense_Mutation_p.R89W|PTCD1_ENST00000485746.1_5'Flank|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.R89W	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	40					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CACATTGGCCGCATCAGCCCC	0.677																																																	0								G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	30.0	32.0	31.0		265,118	-0.8	0.0	7		31	1,8599		0,1,4299	no	missense,missense	PTCD1,ATP5J2-PTCD1	NM_001198879.1,NM_015545.3	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	89/750,40/701	99032748	1,13005	2203	4300	6503	SO:0001583	missense	0			AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.118C>T	7.37:g.99032748G>A	ENSP00000292478:p.Arg40Trp		Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,pfam_F1F0-ATPsyn_F_prd,tigrfam_Pentatricopeptide_repeat	p.R89W	ENST00000292478.4	37	c.265	CCDS34691.1	7	.	.	.	.	.	.	.	.	.	.	G	12.95	2.091716	0.36952	0.0	1.16E-4	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000555673;ENST00000430982;ENST00000430029;ENST00000419981;ENST00000437572;ENST00000413834	T;T;D;D;D;T;T	0.83837	-0.15;-0.14;-1.74;-1.75;-1.77;-1.43;-0.14	5.1	-0.768	0.11013	.	1.806900	0.03131	N	0.165177	T	0.69486	0.3116	N	0.22421	0.69	0.09310	N	1	B;B	0.17465	0.022;0.013	B;B	0.08055	0.003;0.001	T	0.53236	-0.8467	10	0.36615	T	0.2	0.0513	2.1169	0.03716	0.1764:0.3086:0.3768:0.1383	.	89;40	G3V325;O75127	.;PTCD1_HUMAN	W	40;89;40;40;40;40;89	ENSP00000292478:R40W;ENSP00000450995:R89W;ENSP00000390530:R40W;ENSP00000408059:R40W;ENSP00000401600:R40W;ENSP00000410697:R40W;ENSP00000400168:R89W	ENSP00000400168:R89W	R	-	1	2	ATP5J2-PTCD1;PTCD1	98870684	0.000000	0.05858	0.000000	0.03702	0.149000	0.21700	-0.758000	0.04766	0.160000	0.19432	0.563000	0.77884	CGG	ATP5J2-PTCD1	-	NULL	ENSG00000248919		0.677	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5J2-PTCD1	HGNC	protein_coding	OTTHUMT00000336391.1	-	0.00	45	0	G	NM_015545		99032748	-1	tier1	-	no_errors	ENST00000413834	ensembl	human	known	74_37	missense	58.46	27	38	SNP	0.000	A
BAI3	577	genome.wustl.edu	37	6	69772889	69772889	+	Silent	SNP	C	C	T	rs200795351	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:69772889C>T	ENST00000370598.1	+	16	3218	c.2397C>T	c.(2395-2397)acC>acT	p.T799T		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	799					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CCAAAACAACCGATTCGTTTC	0.368																																																	0													149.0	127.0	135.0					6																	69772889		2203	4300	6503	SO:0001819	synonymous_variant	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2397C>T	6.37:g.69772889C>T			B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.T799	ENST00000370598.1	37	c.2397	CCDS4968.1	6																																																																																			BAI3	-	pfam_DUF3497	ENSG00000135298		0.368	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	69	0	C			69772889	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	silent	13.73	44	7	SNP	0.010	T
BARHL1	56751	genome.wustl.edu	37	9	135462883	135462883	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:135462883G>A	ENST00000263610.2	+	2	1247	c.634G>A	c.(634-636)Gcc>Acc	p.A212T	BARHL1_ENST00000542090.1_Missense_Mutation_p.A212T	NM_020064.3	NP_064448.1	Q9BZE3	BARH1_HUMAN	BarH-like homeobox 1	212					midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(1)|large_intestine(2)|lung(2)|skin(3)	8				OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)		CATGGAGCTCGCCGCCTCGCT	0.657																																																	0													29.0	24.0	25.0					9																	135462883		2202	4300	6502	SO:0001583	missense	0			AJ237816	CCDS6950.1	9q34.13	2011-06-20	2007-07-09		ENSG00000125492	ENSG00000125492		"""Homeoboxes / ANTP class : NKL subclass"""	953	protein-coding gene	gene with protein product		605211	"""BarH (Drosophila)-like 1"""				Standard	NM_020064		Approved		uc004cbp.1	Q9BZE3	OTTHUMG00000020839	ENST00000263610.2:c.634G>A	9.37:g.135462883G>A	ENSP00000263610:p.Ala212Thr		Q5T6V2|Q9NY88	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.A212T	ENST00000263610.2	37	c.634	CCDS6950.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.157790	0.94686	.	.	ENSG00000125492	ENST00000263610;ENST00000542090	D;D	0.98164	-4.76;-4.76	4.9	4.9	0.64082	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99221	0.9729	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99038	1.0823	10	0.87932	D	0	.	15.5939	0.76562	0.0:0.0:1.0:0.0	.	212	Q9BZE3	BARH1_HUMAN	T	212	ENSP00000263610:A212T;ENSP00000444704:A212T	ENSP00000263610:A212T	A	+	1	0	BARHL1	134452704	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	9.860000	0.99555	2.269000	0.75478	0.555000	0.69702	GCC	BARHL1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000125492		0.657	BARHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARHL1	HGNC	protein_coding	OTTHUMT00000054789.2	-	0.00	52	0	G			135462883	+1	tier1	-	no_errors	ENST00000263610	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	A
BARHL2	343472	genome.wustl.edu	37	1	91180220	91180221	+	Frame_Shift_Ins	INS	-	-	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:91180220_91180221insA	ENST00000370445.4	-	2	759_760	c.718_719insT	c.(718-720)tccfs	p.S240fs		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	240					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		CTGGTGGTCGGAAAAAGCTGTC	0.559																																					GBM(199;3561 4100 22440)												0																																										SO:0001589	frameshift_variant	0			AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.719dupT	1.37:g.91180225_91180225dupA	ENSP00000359474:p.Ser240fs		A0AVP2|Q7Z4N7	Frame_Shift_Ins	INS	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.S240fs	ENST00000370445.4	37	c.719_718	CCDS730.1	1																																																																																			BARHL2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000143032		0.559	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARHL2	HGNC	protein_coding	OTTHUMT00000027728.2		0.00	50	0	-			91180221	-1	tier1		no_errors	ENST00000370445	ensembl	human	known	74_37	frame_shift_ins	18.60	35	8	INS	0.998:1.000	A
BCL9	607	genome.wustl.edu	37	1	147091476	147091476	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:147091476C>T	ENST00000234739.3	+	8	2255	c.1515C>T	c.(1513-1515)caC>caT	p.H505H		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	505	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TCCATCAGCACGGGCCTCGGG	0.567			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0													69.0	78.0	75.0					1																	147091476		2203	4300	6503	SO:0001819	synonymous_variant	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.1515C>T	1.37:g.147091476C>T			Q5T489	Silent	SNP	pfam_BCL9_beta-catenin-bd_dom	p.H505	ENST00000234739.3	37	c.1515	CCDS30833.1	1																																																																																			BCL9	-	NULL	ENSG00000116128		0.567	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	-	0.00	28	0	C	NM_004326		147091476	+1	tier1	-	no_errors	ENST00000234739	ensembl	human	known	74_37	silent	15.38	22	4	SNP	0.054	T
BCAN	63827	genome.wustl.edu	37	1	156617318	156617318	+	Missense_Mutation	SNP	G	G	A	rs372404921		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:156617318G>A	ENST00000329117.5	+	4	821	c.485G>A	c.(484-486)cGa>cAa	p.R162Q	RP11-284F21.10_ENST00000605886.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.R162Q|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	162	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTTCTCTACCGAGAGGGCTCT	0.652																																																	0								G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	46.0	48.0	48.0		485,485	4.3	1.0	1		48	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	BCAN	NM_021948.4,NM_198427.1	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	162/912,162/672	156617318	1,13005	2203	4300	6503	SO:0001583	missense	0			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.485G>A	1.37:g.156617318G>A	ENSP00000331210:p.Arg162Gln		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom	p.R162Q	ENST00000329117.5	37	c.485	CCDS1149.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.186459	0.94885	0.0	1.16E-4	ENSG00000132692	ENST00000329117;ENST00000457777;ENST00000424639;ENST00000361588	T;T;T;T	0.10573	2.86;2.86;2.86;2.86	4.26	4.26	0.50523	C-type lectin fold (1);Link (3);C-type lectin-like (1);	0.000000	0.53938	D	0.000060	T	0.16727	0.0402	L	0.39898	1.24	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.01648	-1.1304	10	0.87932	D	0	-13.6486	15.4026	0.74852	0.0:0.0:1.0:0.0	.	162;162	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	Q	162;162;60;162	ENSP00000331210:R162Q;ENSP00000389898:R162Q;ENSP00000401709:R60Q;ENSP00000354925:R162Q	ENSP00000331210:R162Q	R	+	2	0	BCAN	154883942	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	9.555000	0.98123	2.187000	0.69744	0.442000	0.29010	CGA	BCAN	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link	ENSG00000132692		0.652	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	HGNC	protein_coding	OTTHUMT00000081844.2	-	0.00	52	0	G	NM_021948		156617318	+1	tier1	-	no_errors	ENST00000329117	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	A
BTK	695	genome.wustl.edu	37	X	100614296	100614296	+	Silent	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chrX:100614296T>C	ENST00000308731.7	-	10	1042	c.879A>G	c.(877-879)caA>caG	p.Q293Q	BTK_ENST00000372880.1_Silent_p.Q293Q	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	293	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GCTTTAGCAGTTGCTCAGCCT	0.507									Agammaglobulinemia, X-linked																																								0													271.0	198.0	223.0					X																	100614296		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.879A>G	X.37:g.100614296T>C			B2RAW1|Q32ML5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.Q293	ENST00000308731.7	37	c.879	CCDS14482.1	X																																																																																			BTK	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000010671		0.507	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	-	0.00	30	0	T	NM_000061		100614296	-1	tier1	-	no_errors	ENST00000308731	ensembl	human	known	74_37	silent	20.00	16	4	SNP	0.997	C
BVES	11149	genome.wustl.edu	37	6	105573312	105573312	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:105573312C>T	ENST00000314641.5	-	4	709	c.493G>A	c.(493-495)Gat>Aat	p.D165N	BVES_ENST00000336775.5_Missense_Mutation_p.D165N|BVES_ENST00000446408.2_Missense_Mutation_p.D165N	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	165					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)			NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				GAGGTTTTATCCTCTGCAGCA	0.408																																																	0													161.0	162.0	162.0					6																	105573312		2203	4300	6503	SO:0001583	missense	0			AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.493G>A	6.37:g.105573312C>T	ENSP00000313172:p.Asp165Asn		A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.D165N	ENST00000314641.5	37	c.493	CCDS5051.1	6	.	.	.	.	.	.	.	.	.	.	C	18.73	3.687159	0.68157	.	.	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.32023	1.47;1.47;1.47	5.76	5.76	0.90799	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.129652	0.64402	D	0.000001	T	0.20618	0.0496	N	0.25286	0.73	0.80722	D	1	B	0.33841	0.428	P	0.45712	0.491	T	0.09058	-1.0692	10	0.15499	T	0.54	-15.8711	19.9384	0.97150	0.0:1.0:0.0:0.0	.	165	Q8NE79	POPD1_HUMAN	N	165	ENSP00000313172:D165N;ENSP00000337259:D165N;ENSP00000397310:D165N	ENSP00000313172:D165N	D	-	1	0	BVES	105680005	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.388000	0.79795	2.716000	0.92895	0.655000	0.94253	GAT	BVES	-	pfam_Popeye_prot,superfamily_cNMP-bd-like	ENSG00000112276		0.408	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BVES	HGNC	protein_coding	OTTHUMT00000406075.1	-	0.00	67	0	C	NM_147147		105573312	-1	tier1	-	no_errors	ENST00000314641	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
C19orf54	284325	genome.wustl.edu	37	19	41255428	41255428	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:41255428C>T	ENST00000378313.2	-	1	400	c.281G>A	c.(280-282)gGc>gAc	p.G94D	C19orf54_ENST00000598485.2_5'UTR|C19orf54_ENST00000598729.1_5'UTR|SNRPA_ENST00000243563.3_5'Flank|C19orf54_ENST00000470681.1_5'UTR|C19orf54_ENST00000339153.3_5'UTR	NM_198476.3	NP_940878.3	Q5BKX5	CS054_HUMAN	chromosome 19 open reading frame 54	94										breast(1)|lung(1)|urinary_tract(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ATCTTCTCTGCCCTTGGGGAC	0.612																																																	0													27.0	32.0	31.0					19																	41255428		692	1591	2283	SO:0001583	missense	0			AK123126	CCDS12564.2	19q13.2	2012-10-26			ENSG00000188493	ENSG00000188493			24758	protein-coding gene	gene with protein product							Standard	NM_198476		Approved	FLJ41131	uc002oou.1	Q5BKX5	OTTHUMG00000150174	ENST00000378313.2:c.281G>A	19.37:g.41255428C>T	ENSP00000367564:p.Gly94Asp		A8MSZ5|B4DNU7	Missense_Mutation	SNP	NULL	p.G94D	ENST00000378313.2	37	c.281	CCDS12564.2	19	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828631	0.50845	.	.	ENSG00000188493	ENST00000378313	.	.	.	4.59	1.11	0.20524	.	0.520751	0.15099	U	0.280639	T	0.19765	0.0475	N	0.14661	0.345	0.34388	D	0.693907	P	0.44429	0.835	B	0.36922	0.236	T	0.24190	-1.0167	9	0.23891	T	0.37	-3.4246	7.3624	0.26754	0.1795:0.4717:0.3489:0.0	.	94	Q5BKX5	CS054_HUMAN	D	94	.	ENSP00000367564:G94D	G	-	2	0	C19orf54	45947268	0.340000	0.24792	0.930000	0.37139	0.994000	0.84299	0.325000	0.19628	1.113000	0.41760	0.655000	0.94253	GGC	C19orf54	-	NULL	ENSG00000188493		0.612	C19orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf54	HGNC	protein_coding	OTTHUMT00000316701.1	-	0.00	87	0	C	NM_198476		41255428	-1	tier1	-	no_errors	ENST00000378313	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.348	T
C1orf27	54953	genome.wustl.edu	37	1	186368089	186368089	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:186368089G>A	ENST00000287859.6	+	11	1038	c.913G>A	c.(913-915)Gta>Ata	p.V305I	C1orf27_ENST00000432021.3_Missense_Mutation_p.V282I|C1orf27_ENST00000419367.3_Missense_Mutation_p.V273I|C1orf27_ENST00000367470.3_Missense_Mutation_p.V282I|AL596220.1_ENST00000598663.1_5'Flank|OCLM_ENST00000574641.1_5'Flank	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	305						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						CCTGTAGGCAGTAAAGAGGGA	0.284																																																	0													96.0	86.0	89.0					1																	186368089		1801	4073	5874	SO:0001583	missense	0			BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.913G>A	1.37:g.186368089G>A	ENSP00000287859:p.Val305Ile		B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Missense_Mutation	SNP	NULL	p.V305I	ENST00000287859.6	37	c.913	CCDS53448.1	1	.	.	.	.	.	.	.	.	.	.	G	0.227	-1.024358	0.02061	.	.	ENSG00000157181	ENST00000367470;ENST00000419367;ENST00000432021;ENST00000287859	T;T;T	0.35973	1.28;1.28;1.28	4.92	-5.1	0.02911	.	0.826170	0.11199	N	0.588998	T	0.13670	0.0331	N	0.24115	0.695	0.27865	N	0.94025	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.39035	-0.9633	10	0.02654	T	1	-6.8635	2.7621	0.05310	0.4889:0.0896:0.2783:0.1432	.	273;282;305	E9PFR7;Q5SWX8-2;Q5SWX8	.;.;ODR4_HUMAN	I	282;273;305;305	ENSP00000356440:V282I;ENSP00000395084:V273I;ENSP00000287859:V305I	ENSP00000287859:V305I	V	+	1	0	C1orf27	184634712	0.906000	0.30813	0.719000	0.30619	0.583000	0.36354	0.024000	0.13555	-0.464000	0.06963	-0.345000	0.07892	GTA	C1orf27	-	NULL	ENSG00000157181		0.284	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C1orf27	HGNC	protein_coding	OTTHUMT00000086352.2	-	0.00	72	0	G	NM_017847		186368089	+1	tier1	-	no_errors	ENST00000287859	ensembl	human	known	74_37	missense	7.32	76	6	SNP	0.497	A
C20orf166-AS1	253868	genome.wustl.edu	37	20	61143764	61143764	+	RNA	SNP	G	G	C	rs375083248		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:61143764G>C	ENST00000475015.1	-	0	574				C20orf166-AS1_ENST00000412495.1_RNA|C20orf166-AS1_ENST00000436101.1_RNA			Q96NR2	C2AS1_HUMAN	C20orf166 antisense RNA 1																		CCGAGAAACCGCTGCTCTCCT	0.667																																																	0													96.0	87.0	90.0					20																	61143764		2203	4300	6503			0			AK054875		20q13.33	2012-10-12	2012-08-15	2011-08-10	ENSG00000174403	ENSG00000174403		"""Long non-coding RNAs"""	26393	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 200"", ""non-protein coding RNA 335"", ""C20orf166 antisense RNA 1 (non-protein coding)"""	C20orf200, NCRNA00335			Standard	NR_033263		Approved	FLJ30313	uc002ycz.3	Q96NR2	OTTHUMG00000048002		20.37:g.61143764G>C			Q52LN1	RNA	SNP	-	NULL	ENST00000475015.1	37	NULL		20																																																																																			C20orf166-AS1	-	-	ENSG00000174403		0.667	C20orf166-AS1-002	KNOWN	basic	antisense	C20orf166-AS1	HGNC	antisense	OTTHUMT00000109266.2	-	0.00	106	0	G	NR_033263		61143764	-1	tier1	-	no_errors	ENST00000412495	ensembl	human	known	74_37	rna	6.50	114	8	SNP	0.000	C
MRPL30	51263	genome.wustl.edu	37	2	99802708	99802708	+	Silent	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:99802708C>A	ENST00000338148.3	+	2	240	c.42C>A	c.(40-42)ggC>ggA	p.G14G	MRPL30_ENST00000409145.1_Silent_p.G14G|MRPL30_ENST00000410042.1_Silent_p.G14G|C2orf15_ENST00000512183.2_Silent_p.G14G|MRPL30_ENST00000465432.1_Intron	NM_145212.3	NP_660213.1	Q8TCC3	RM30_HUMAN	mitochondrial ribosomal protein L30	14						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						GGCCCCCAGGCAGACTACAGG	0.383																																																	0													115.0	106.0	109.0					2																	99802708		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051342	CCDS2041.1	2q11.2	2012-09-13			ENSG00000185414	ENSG00000185414		"""Mitochondrial ribosomal proteins / large subunits"""	14036	protein-coding gene	gene with protein product		611838					Standard	NM_145212		Approved	MRP-L28, RPML28	uc002szv.3	Q8TCC3	OTTHUMG00000130642	ENST00000338148.3:c.42C>A	2.37:g.99802708C>A			A6NIC6|D3DVI0|D3DVI3|Q0D2Q7|Q6ZTP4|Q96Q69|Q9P0N0	Silent	SNP	pfam_Ribosomal_L30_ferredoxin-like,superfamily_Ribosomal_L30_ferredoxin-like	p.G44	ENST00000338148.3	37	c.132	CCDS2041.1	2																																																																																			C2orf15	-	NULL	ENSG00000241962		0.383	MRPL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf15	HGNC	protein_coding	OTTHUMT00000253130.2	-	0.00	63	0	C			99802708	+1	tier1	-	no_errors	ENST00000424491	ensembl	human	known	74_37	silent	19.23	63	15	SNP	0.000	A
C4orf22	255119	genome.wustl.edu	37	4	81504394	81504395	+	Intron	INS	-	-	A	rs569124238		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:81504394_81504395insA	ENST00000358105.3	+	3	382				C4orf22_ENST00000512931.1_Intron|C4orf22_ENST00000508675.1_Intron	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22											NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						CAATTAATATTAAAAAATGTAA	0.257																																																	0																																										SO:0001627	intron_variant	0			BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.333+57->A	4.37:g.81504400_81504400dupA			E7EQ13|Q6ZQY4|Q8N4G9	RNA	INS	-	NULL	ENST00000358105.3	37	NULL	CCDS3587.1	4																																																																																			C4orf22	-	-	ENSG00000197826		0.257	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf22	HGNC	protein_coding	OTTHUMT00000252629.2		0.00	20	0	-	NM_152770		81504395	+1	tier1		no_errors	ENST00000503883	ensembl	human	known	74_37	rna	15.79	16	3	INS	0.000:0.001	A
C8orf34	116328	genome.wustl.edu	37	8	69243487	69243487	+	5'UTR	SNP	G	G	A	rs558544244		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:69243487G>A	ENST00000539993.1	+	0	531				C8orf34_ENST00000518698.1_Silent_p.S80S|C8orf34_ENST00000523686.1_5'UTR|RP11-664D7.4_ENST00000512294.3_Intron|C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000348340.2_5'UTR			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34											NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			CACTCTCTTCGCGGTCCCATC	0.637																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.-19G>A	8.37:g.69243487G>A			A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Silent	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.S80	ENST00000539993.1	37	c.240		8																																																																																			C8orf34	-	NULL	ENSG00000165084		0.637	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	HGNC	protein_coding		-	0.00	42	0	G	NM_052958		69243487	+1	tier1	-	no_errors	ENST00000518698	ensembl	human	known	74_37	silent	33.33	20	10	SNP	0.000	A
CACNA1S	779	genome.wustl.edu	37	1	201063084	201063084	+	Silent	SNP	G	G	A	rs200487405		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:201063084G>A	ENST00000362061.3	-	3	550	c.324C>T	c.(322-324)taC>taT	p.Y108Y	CACNA1S_ENST00000367338.3_Silent_p.Y108Y	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	108					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATAAGAAGCCGTAGGCAATGA	0.532																																																	0								G		4,4402	8.1+/-20.4	0,4,2199	97.0	94.0	95.0		324	-2.2	1.0	1		95	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	CACNA1S	NM_000069.2		0,9,6494	AA,AG,GG		0.0581,0.0908,0.0692		108/1874	201063084	9,12997	2203	4300	6503	SO:0001819	synonymous_variant	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.324C>T	1.37:g.201063084G>A			A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.Y108	ENST00000362061.3	37	c.324	CCDS1407.1	1																																																																																			CACNA1S	-	pfam_Ion_trans_dom	ENSG00000081248		0.532	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	-	0.00	34	0	G	NM_000069		201063084	-1	tier1	rs200487405	no_errors	ENST00000362061	ensembl	human	known	74_37	silent	13.16	33	5	SNP	0.984	A
CACNA2D1	781	genome.wustl.edu	37	7	81765972	81765972	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:81765972G>A	ENST00000356253.5	-	5	630	c.375C>T	c.(373-375)taC>taT	p.Y125Y	CACNA2D1_ENST00000423588.1_Silent_p.Y125Y|CACNA2D1_ENST00000356860.3_Silent_p.Y125Y			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	125					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CCTTTGCATTGTAGTAGACAA	0.254																																																	0													49.0	50.0	49.0					7																	81765972		2194	4288	6482	SO:0001819	synonymous_variant	0			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.375C>T	7.37:g.81765972G>A			Q17R45|Q9UD80|Q9UD81|Q9UD82	Silent	SNP	pfam_VDCC_a2/dsu,pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.Y125	ENST00000356253.5	37	c.375		7																																																																																			CACNA2D1	-	pfam_VWA_N	ENSG00000153956		0.254	CACNA2D1-201	KNOWN	basic	protein_coding	CACNA2D1	HGNC	protein_coding		-	0.00	112	0	G			81765972	-1	tier1	-	no_errors	ENST00000356253	ensembl	human	known	74_37	silent	10.00	81	9	SNP	1.000	A
CALR3	125972	genome.wustl.edu	37	19	16606868	16606868	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:16606868C>G	ENST00000269881.3	-	1	135	c.73G>C	c.(73-75)Gag>Cag	p.E25Q	C19orf44_ENST00000594035.1_5'Flank|CTD-3222D19.2_ENST00000409035.1_Intron|C19orf44_ENST00000221671.3_5'Flank	NM_145046.4	NP_659483.2	Q96L12	CALR3_HUMAN	calreticulin 3	25	N-domain.				cell differentiation (GO:0030154)|protein folding (GO:0006457)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|prostate(1)|skin(1)	15						AGAAATTCCTCTTGGAAATAG	0.652																																																	0													17.0	19.0	18.0					19																	16606868		2202	4296	6498	SO:0001583	missense	0			AK058084	CCDS12344.1	19p13.11	2014-09-17				ENSG00000269058			20407	protein-coding gene	gene with protein product	"""cancer/testis antigen 93"", ""calsperin"""	611414				12384296	Standard	NM_145046		Approved	CRT2, FLJ25355, MGC26577, CT93	uc002ned.3	Q96L12		ENST00000269881.3:c.73G>C	19.37:g.16606868C>G	ENSP00000269881:p.Glu25Gln		D9N574|Q96LN3	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,superfamily_Calreticulin/calnexin_P_dom,pirsf_Calreticulin,prints_Calret/calnex	p.E25Q	ENST00000269881.3	37	c.73	CCDS12344.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.219545	0.95139	.	.	ENSG00000141979	ENST00000269881	T	0.60171	0.21	5.39	5.39	0.77823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.83004	0.5160	H	0.95114	3.625	0.51012	D	0.999908	D	0.89917	1.0	D	0.97110	1.0	D	0.87864	0.2666	10	0.72032	D	0.01	-18.4243	15.8758	0.79159	0.0:1.0:0.0:0.0	.	25	Q96L12	CALR3_HUMAN	Q	25	ENSP00000269881:E25Q	ENSP00000269881:E25Q	E	-	1	0	CALR3	16467868	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.591000	0.67536	2.527000	0.85204	0.549000	0.68633	GAG	CALR3	-	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,pirsf_Calreticulin	ENSG00000269058		0.652	CALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR3	HGNC	protein_coding	OTTHUMT00000461089.1	-	0.00	87	0	C	NM_145046		16606868	-1	tier1	-	no_errors	ENST00000269881	ensembl	human	known	74_37	missense	19.15	76	18	SNP	1.000	G
CAND1	55832	genome.wustl.edu	37	12	67688905	67688905	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:67688905G>T	ENST00000545606.1	+	4	897	c.460G>T	c.(460-462)Gcc>Tcc	p.A154S		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	154					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TCAGCTAGAAGCCTTGGATAT	0.378																																																	0													161.0	143.0	149.0					12																	67688905		2203	4300	6503	SO:0001583	missense	0				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.460G>T	12.37:g.67688905G>T	ENSP00000442318:p.Ala154Ser		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.A154S	ENST00000545606.1	37	c.460	CCDS8977.1	12	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718876	0.89205	.	.	ENSG00000111530	ENST00000545606;ENST00000299218	T	0.72505	-0.66	5.15	5.15	0.70609	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80428	0.4621	L	0.53729	1.69	0.80722	D	1	D	0.71674	0.998	D	0.65233	0.933	T	0.79286	-0.1866	9	.	.	.	-0.696	18.6231	0.91328	0.0:0.0:1.0:0.0	.	154	Q86VP6	CAND1_HUMAN	S	154	ENSP00000442318:A154S	.	A	+	1	0	CAND1	65975172	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.813000	0.99286	2.409000	0.81822	0.460000	0.39030	GCC	CAND1	-	superfamily_ARM-type_fold	ENSG00000111530		0.378	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	HGNC	protein_coding	OTTHUMT00000402105.1		0.00	70	0	G	NM_018448		67688905	+1			no_errors	ENST00000545606	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
CAPRIN1	4076	genome.wustl.edu	37	11	34098007	34098007	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:34098007G>A	ENST00000341394.4	+	5	780	c.591G>A	c.(589-591)cgG>cgA	p.R197R	CAPRIN1_ENST00000389645.3_Silent_p.R197R|CAPRIN1_ENST00000532820.1_Silent_p.R197R|CAPRIN1_ENST00000530820.1_Silent_p.R197R|CAPRIN1_ENST00000529307.1_Silent_p.R116R	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	197					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				ACCCTGAACGGGACATGAGCT	0.368																																																	0													91.0	97.0	95.0					11																	34098007		2202	4298	6500	SO:0001819	synonymous_variant	0			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.591G>A	11.37:g.34098007G>A			A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Silent	SNP	pfam_Caprin-1_C	p.R197	ENST00000341394.4	37	c.591	CCDS31453.1	11																																																																																			CAPRIN1	-	NULL	ENSG00000135387		0.368	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2	-	0.00	46	0	G	NM_005898		34098007	+1	tier1	-	no_errors	ENST00000341394	ensembl	human	known	74_37	silent	12.50	49	7	SNP	0.946	A
CASP7	840	genome.wustl.edu	37	10	115481450	115481450	+	Silent	SNP	G	G	T	rs114786731	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:115481450G>T	ENST00000345633.4	+	5	672	c.288G>T	c.(286-288)gcG>gcT	p.A96A	RP11-211N11.5_ENST00000448834.1_RNA|CASP7_ENST00000369321.2_Silent_p.A129A|CASP7_ENST00000369331.4_Silent_p.A96A|CASP7_ENST00000369315.1_Silent_p.A96A|CASP7_ENST00000369318.3_Silent_p.A96A|CASP7_ENST00000452490.2_Silent_p.A71A	NM_033339.4	NP_203125.1	P55210	CASP7_HUMAN	caspase 7, apoptosis-related cysteine peptidase	96					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway (GO:0097193)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)		ATGCCGAGGCGCTCTTCAAGT	0.498																																																	0													221.0	188.0	199.0					10																	115481450		2203	4300	6503	SO:0001819	synonymous_variant	0			U37448	CCDS7580.1, CCDS7581.1, CCDS7582.1, CCDS58096.1, CCDS73200.1	10q25	2006-02-17	2005-08-17		ENSG00000165806	ENSG00000165806		"""Caspases"""	1508	protein-coding gene	gene with protein product		601761	"""caspase 7, apoptosis-related cysteine protease"""			8521391, 8576161	Standard	NM_033338		Approved	MCH3, CMH-1, ICE-LAP3	uc010qsa.3	P55210	OTTHUMG00000019076	ENST00000345633.4:c.288G>T	10.37:g.115481450G>T			B4DQU7|B5BU45|D3DRB8|Q13364|Q53YD5|Q5SVL0|Q5SVL3|Q96BA0	Silent	SNP	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.A129	ENST00000345633.4	37	c.387	CCDS7581.1	10																																																																																			CASP7	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	ENSG00000165806		0.498	CASP7-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP7	HGNC	protein_coding	OTTHUMT00000050439.1	-	0.00	77	0	G	NM_033338		115481450	+1	tier1	-	no_errors	ENST00000369321	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.828	T
CCL28	56477	genome.wustl.edu	37	5	43381990	43381990	+	Missense_Mutation	SNP	T	T	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:43381990T>A	ENST00000361115.4	-	3	430	c.356A>T	c.(355-357)gAa>gTa	p.E119V	CCL28_ENST00000513525.1_Missense_Mutation_p.E72V	NM_148672.2	NP_683513.1	Q9NRJ3	CCL28_HUMAN	chemokine (C-C motif) ligand 28	119					cell chemotaxis (GO:0060326)|chemotaxis (GO:0006935)|immune response (GO:0006955)|negative regulation of leukocyte tethering or rolling (GO:1903237)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	chemokine activity (GO:0008009)			kidney(3)|lung(3)|ovary(1)	7						GCCGTATGTTTCGTGTTTCCC	0.413																																					Esophageal Squamous(178;1549 1997 2043 22794 27051)												0													323.0	287.0	299.0					5																	43381990		2203	4300	6503	SO:0001583	missense	0			AF110384	CCDS3944.1	5p12	2013-02-25			ENSG00000151882	ENSG00000151882		"""Chemokine ligands"", ""Endogenous ligands"""	17700	protein-coding gene	gene with protein product	"""CC chemokine CCL28"", ""mucosae-associated epithelial chemokine"", ""small inducible cytokine subfamily A (Cys-Cys), member 28"", ""small inducible cytokine A28"""	605240				10781587, 11295038	Standard	XR_241707		Approved	SCYA28, MEC, CCK1	uc003jnu.3	Q9NRJ3	OTTHUMG00000094811	ENST00000361115.4:c.356A>T	5.37:g.43381990T>A	ENSP00000354416:p.Glu119Val		D7RIE7	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom	p.E119V	ENST00000361115.4	37	c.356	CCDS3944.1	5	.	.	.	.	.	.	.	.	.	.	T	11.13	1.548765	0.27652	.	.	ENSG00000151882	ENST00000361115;ENST00000513525	T;T	0.33216	1.84;1.42	5.44	-4.48	0.03515	.	1.350030	0.05206	N	0.505913	T	0.19725	0.0474	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35773	-0.9775	10	0.59425	D	0.04	0.0	5.1683	0.15098	0.2797:0.4149:0.0:0.3054	.	119	Q9NRJ3	CCL28_HUMAN	V	119;72	ENSP00000354416:E119V;ENSP00000422369:E72V	ENSP00000354416:E119V	E	-	2	0	CCL28	43417747	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.026000	0.13599	-0.644000	0.05465	-1.140000	0.01884	GAA	CCL28	-	NULL	ENSG00000151882		0.413	CCL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL28	HGNC	protein_coding	OTTHUMT00000211631.2	-	0.00	161	0	T	NM_148672		43381990	-1	tier1	-	no_errors	ENST00000361115	ensembl	human	known	74_37	missense	5.05	188	10	SNP	0.000	A
CCNJ	54619	genome.wustl.edu	37	10	97816949	97816949	+	Missense_Mutation	SNP	C	C	A	rs201944303	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:97816949C>A	ENST00000265992.5	+	5	1019	c.652C>A	c.(652-654)Cgt>Agt	p.R218S	ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|CCNJ_ENST00000465148.2_Missense_Mutation_p.R229S|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|CCNJ_ENST00000534974.1_Missense_Mutation_p.R218S|ENTPD1-AS1_ENST00000427846.1_RNA|CCNJ_ENST00000403870.3_Missense_Mutation_p.R217S|ENTPD1-AS1_ENST00000458228.1_RNA	NM_001134375.1|NM_001134376.1|NM_019084.4	NP_001127847.1|NP_001127848.1|NP_061957.2	Q5T5M9	CCNJ_HUMAN	cyclin J	218						nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	11				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		AAGACTACATCGTCTTACTGC	0.398													C|||	2	0.000399361	0.0	0.0	5008	,	,		23843	0.0		0.0	False		,,,				2504	0.002																0													219.0	186.0	197.0					10																	97816949		2203	4300	6503	SO:0001583	missense	0			AK001757	CCDS7445.1, CCDS44462.1, CCDS44463.1	10q23.33	2008-05-14			ENSG00000107443	ENSG00000107443			23434	protein-coding gene	gene with protein product						12477932	Standard	NM_019084		Approved	FLJ10895, bA690P14.1	uc010qoq.2	Q5T5M9	OTTHUMG00000018823	ENST00000265992.5:c.652C>A	10.37:g.97816949C>A	ENSP00000265992:p.Arg218Ser		B7Z4E7|Q86XL1|Q9NV69	Missense_Mutation	SNP	pfam_Cyclin_C-dom,pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R229S	ENST00000265992.5	37	c.685	CCDS7445.1	10	.	.	.	.	.	.	.	.	.	.	C	19.29	3.800131	0.70567	.	.	ENSG00000107443	ENST00000265992;ENST00000419934;ENST00000403870;ENST00000534974	T;T;T	0.22134	1.97;1.97;1.97	5.42	5.42	0.78866	Cyclin, C-terminal (1);Cyclin-like (2);	0.139775	0.64402	D	0.000003	T	0.26268	0.0641	L	0.48642	1.525	0.58432	D	0.999999	P;P;P	0.40302	0.712;0.491;0.546	B;B;B	0.42851	0.363;0.278;0.4	T	0.00832	-1.1548	10	0.31617	T	0.26	-19.3231	18.3571	0.90361	0.0:1.0:0.0:0.0	.	229;217;218	Q5T5M9-3;Q5T5M9-2;Q5T5M9	.;.;CCNJ_HUMAN	S	218;229;217;218	ENSP00000265992:R218S;ENSP00000384498:R217S;ENSP00000441415:R218S	ENSP00000265992:R218S	R	+	1	0	CCNJ	97806939	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.814000	0.86154	2.694000	0.91930	0.655000	0.94253	CGT	CCNJ	-	pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000107443		0.398	CCNJ-003	KNOWN	basic|CCDS	protein_coding	CCNJ	HGNC	protein_coding	OTTHUMT00000090166.3	-	0.00	143	0	C	NM_019084		97816949	+1	tier1	-	no_errors	ENST00000465148	ensembl	human	known	74_37	missense	9.09	100	10	SNP	1.000	A
CCR1	1230	genome.wustl.edu	37	3	46245394	46245394	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:46245394G>A	ENST00000296140.3	-	2	536	c.411C>T	c.(409-411)caC>caT	p.H137H	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	137					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)			autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CAAACACGGCGTGGACGATGG	0.517																																																	0													81.0	77.0	78.0					3																	46245394		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.411C>T	3.37:g.46245394G>A			Q86VA9	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR5,prints_NPY_rcpt,prints_ATII_rcpt	p.H137	ENST00000296140.3	37	c.411	CCDS2737.1	3																																																																																			CCR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_rcpt	ENSG00000163823		0.517	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR1	HGNC	protein_coding	OTTHUMT00000257325.2	-	0.00	40	0	G	NM_001295		46245394	-1	tier1	-	no_errors	ENST00000296140	ensembl	human	known	74_37	silent	24.24	25	8	SNP	0.104	A
CD244	51744	genome.wustl.edu	37	1	160811182	160811182	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:160811182C>T	ENST00000368033.3	-	3	570	c.488G>A	c.(487-489)gGc>gAc	p.G163D	CD244_ENST00000481677.1_5'Flank|CD244_ENST00000368032.2_Missense_Mutation_p.G158D|CD244_ENST00000322302.7_Intron|CD244_ENST00000368034.4_Missense_Mutation_p.G158D			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	163	Ig-like 2.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GGACACATTGCCATCCCTGGA	0.542																																																	0													185.0	159.0	168.0					1																	160811182		2203	4300	6503	SO:0001583	missense	0			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.488G>A	1.37:g.160811182C>T	ENSP00000357012:p.Gly163Asp		Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like_dom	p.G163D	ENST00000368033.3	37	c.488	CCDS53399.1	1	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.377993	0.01204	.	.	ENSG00000122223	ENST00000368034;ENST00000368033;ENST00000368032	T;T;T	0.21543	2.0;2.0;2.0	4.73	-6.35	0.01975	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.317030	0.05296	N	0.522042	T	0.02156	0.0067	N	0.16098	0.37	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.13407	0.009;0.004	T	0.33752	-0.9856	10	0.07325	T	0.83	-15.4049	7.878	0.29605	0.1027:0.3802:0.0:0.5172	.	163;158	Q9BZW8;Q9BZW8-2	CD244_HUMAN;.	D	158;163;158	ENSP00000357013:G158D;ENSP00000357012:G163D;ENSP00000357011:G158D	ENSP00000357011:G158D	G	-	2	0	CD244	159077806	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-2.371000	0.01074	-2.195000	0.00752	-1.731000	0.00696	GGC	CD244	-	pfscan_Ig-like_dom	ENSG00000122223		0.542	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1	-	0.00	74	0	C	NM_016382		160811182	-1	tier1	-	no_errors	ENST00000368033	ensembl	human	known	74_37	missense	19.44	58	14	SNP	0.000	T
CDH5	1003	genome.wustl.edu	37	16	66420990	66420990	+	Silent	SNP	G	G	A	rs370305306		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:66420990G>A	ENST00000341529.3	+	3	637	c.489G>A	c.(487-489)tcG>tcA	p.S163S	CDH5_ENST00000563425.2_Silent_p.S163S	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	TGCCTGAGTCGTCGGCTGTGG	0.587																																																	0								G		1,4403	2.1+/-5.4	0,1,2201	114.0	86.0	96.0		489	3.5	1.0	16		96	0,8600		0,0,4300	no	coding-synonymous	CDH5	NM_001795.3		0,1,6501	AA,AG,GG		0.0,0.0227,0.0077		163/785	66420990	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	0			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.489G>A	16.37:g.66420990G>A			Q4VAI5|Q4VAI6	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S163	ENST00000341529.3	37	c.489	CCDS10804.1	16																																																																																			CDH5	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000179776		0.587	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH5	HGNC	protein_coding	OTTHUMT00000268767.1	-	0.00	51	0	G	NM_001795		66420990	+1	tier1	-	no_errors	ENST00000341529	ensembl	human	known	74_37	silent	12.73	48	7	SNP	1.000	A
CEACAM4	1089	genome.wustl.edu	37	19	42126967	42126967	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:42126967C>T	ENST00000221954.2	-	4	686	c.576G>A	c.(574-576)ccG>ccA	p.P192P	CEACAM4_ENST00000600925.1_Silent_p.P190P	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	192						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						AGGCTGGGGGCGGCTGCTCCC	0.627																																																	0													30.0	31.0	31.0					19																	42126967		2203	4299	6502	SO:0001819	synonymous_variant	0			D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.576G>A	19.37:g.42126967C>T			Q03715|Q7LDZ7	Silent	SNP	pfam_Ig_V-set,pfscan_Ig-like_dom	p.P192	ENST00000221954.2	37	c.576	CCDS33033.1	19																																																																																			CEACAM4	-	NULL	ENSG00000105352		0.627	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM4	HGNC	protein_coding	OTTHUMT00000321148.1	-	0.00	65	0	C	NM_001817		42126967	-1	tier1	-	no_errors	ENST00000221954	ensembl	human	known	74_37	silent	26.42	39	14	SNP	0.000	T
CELA3A	10136	genome.wustl.edu	37	1	22333904	22333904	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:22333904C>G	ENST00000290122.3	+	6	557	c.538C>G	c.(538-540)Ctg>Gtg	p.L180V		NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	180	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GCAGGCCCGGCTGCCCGTGGT	0.617																																																	0													49.0	50.0	50.0					1																	22333904		2197	4300	6497	SO:0001583	missense	0			D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.538C>G	1.37:g.22333904C>G	ENSP00000290122:p.Leu180Val		B1AQ53|Q9BRW4	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L180V	ENST00000290122.3	37	c.538	CCDS220.1	1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.519449	0.44866	.	.	ENSG00000142789	ENST00000290122	D	0.87966	-2.32	3.59	2.64	0.31445	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.87661	0.6233	L	0.31845	0.965	0.80722	D	1	D	0.57899	0.981	D	0.64687	0.928	D	0.86552	0.1835	9	0.87932	D	0	-12.687	9.7519	0.40481	0.208:0.792:0.0:0.0	.	180	P09093	CEL3A_HUMAN	V	180	ENSP00000290122:L180V	ENSP00000290122:L180V	L	+	1	2	CELA3A	22206491	0.273000	0.24181	0.993000	0.49108	0.932000	0.56968	0.866000	0.27954	0.671000	0.31185	0.400000	0.26472	CTG	CELA3A	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000142789		0.617	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA3A	HGNC	protein_coding	OTTHUMT00000007791.1	-	0.00	61	0	C	NM_005747		22333904	+1	tier1	-	no_errors	ENST00000290122	ensembl	human	known	74_37	missense	30.00	35	15	SNP	0.625	G
CENPF	1063	genome.wustl.edu	37	1	214825215	214825215	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:214825215G>A	ENST00000366955.3	+	15	8314	c.8146G>A	c.(8146-8148)Gac>Aac	p.D2716N	CENPF_ENST00000467765.1_3'UTR	NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2812	Sufficient for centromere localization.|Sufficient for self-association.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TTTGCTTTTGGACACAAACAA	0.408																																					Colon(80;575 1284 11000 14801 43496)												0													82.0	88.0	86.0					1																	214825215		2203	4300	6503	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.8146G>A	1.37:g.214825215G>A	ENSP00000355922:p.Asp2716Asn		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_CenpF/LEK1_Rb-prot-bd	p.D2716N	ENST00000366955.3	37	c.8146	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.001868	0.35320	.	.	ENSG00000117724	ENST00000366955;ENST00000391896	T	0.03212	4.01	3.67	2.72	0.32119	.	.	.	.	.	T	0.06096	0.0158	L	0.57536	1.79	0.09310	N	1	P	0.51791	0.948	P	0.46362	0.514	T	0.33214	-0.9877	9	0.33141	T	0.24	.	7.5465	0.27770	0.1336:0.0:0.8664:0.0	.	2812	P49454	CENPF_HUMAN	N	2716;115	ENSP00000355922:D2716N	ENSP00000355922:D2716N	D	+	1	0	CENPF	212891838	0.991000	0.36638	0.023000	0.16930	0.687000	0.40016	2.491000	0.45303	1.771000	0.52183	0.609000	0.83330	GAC	CENPF	-	NULL	ENSG00000117724		0.408	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	-	0.00	55	0	G	NM_016343		214825215	+1	tier1	-	no_errors	ENST00000366955	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.004	A
CEP135	9662	genome.wustl.edu	37	4	56831979	56831981	+	In_Frame_Del	DEL	AAG	AAG	-	rs376310237|rs537009435|rs374626758	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:56831979_56831981delAAG	ENST00000257287.4	+	8	1122_1124	c.998_1000delAAG	c.(997-1002)aaagaa>aaa	p.E335del		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	335					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GAAAGACATAAAGAAGAAGTGCT	0.369														5	0.000998403	0.0008	0.0	5008	,	,		17263	0.0		0.003	False		,,,				2504	0.001																0										0,4266		0,0,2133						5.7	1.0			96	22,8232		0,22,4105	no	coding	CEP135	NM_025009.3		0,22,6238	A1A1,A1R,RR		0.2665,0.0,0.1757				22,12498				SO:0001651	inframe_deletion	0			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.998_1000delAAG	4.37:g.56831985_56831987delAAG	ENSP00000257287:p.Glu335del		B2RMY0|O75130|Q58F25|Q9H8H7	In_Frame_Del	DEL	superfamily_Prefoldin,superfamily_EB1_C	p.E335in_frame_del	ENST00000257287.4	37	c.998_1000	CCDS33986.1	4																																																																																			CEP135	-	NULL	ENSG00000174799		0.369	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP135	HGNC	protein_coding	OTTHUMT00000362092.2		0.00	29	0	AAG	NM_025009		56831981	+1	tier1		no_errors	ENST00000257287	ensembl	human	known	74_37	in_frame_del	22.22	14	4	DEL	1.000:1.000:1.000	-
CEP85L	387119	genome.wustl.edu	37	6	118887415	118887415	+	Silent	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:118887415A>C	ENST00000368491.3	-	3	918	c.297T>G	c.(295-297)acT>acG	p.T99T	CEP85L_ENST00000419517.2_Silent_p.T99T|CEP85L_ENST00000368488.5_Silent_p.T102T|CEP85L_ENST00000472713.1_5'UTR|CEP85L_ENST00000360290.3_5'UTR|CEP85L_ENST00000392500.3_Silent_p.T102T	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	99						centrosome (GO:0005813)|cytoplasm (GO:0005737)											TCACATGGGCAGTAGGAAGAG	0.383																																																	0													47.0	47.0	47.0					6																	118887415		2203	4299	6502	SO:0001819	synonymous_variant	0			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.297T>G	6.37:g.118887415A>C			A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Silent	SNP	NULL	p.T102	ENST00000368491.3	37	c.306	CCDS43498.1	6																																																																																			CEP85L	-	NULL	ENSG00000111860		0.383	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP85L	HGNC	protein_coding	OTTHUMT00000041996.2	-	0.00	46	0	A	NM_001042475		118887415	-1	tier1	-	no_errors	ENST00000368488	ensembl	human	known	74_37	silent	12.82	34	5	SNP	1.000	C
CHIA	27159	genome.wustl.edu	37	1	111862019	111862019	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:111862019G>A	ENST00000369740.1	+	11	1209	c.1106G>A	c.(1105-1107)gGc>gAc	p.G369D	CHIA_ENST00000430615.1_Missense_Mutation_p.G261D|CHIA_ENST00000451398.2_Missense_Mutation_p.G208D|CHIA_ENST00000343320.6_Missense_Mutation_p.G369D|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000353665.6_Missense_Mutation_p.G208D|CHIA_ENST00000483391.1_Missense_Mutation_p.G208D	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	369					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		GACTTCACTGGCACTTTCTGC	0.512																																																	0													94.0	85.0	88.0					1																	111862019		2203	4300	6503	SO:0001583	missense	0			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.1106G>A	1.37:g.111862019G>A	ENSP00000358755:p.Gly369Asp		Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.G369D	ENST00000369740.1	37	c.1106	CCDS41368.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074285	0.76415	.	.	ENSG00000134216	ENST00000422815;ENST00000483391;ENST00000369740;ENST00000343320;ENST00000451398;ENST00000353665;ENST00000489524;ENST00000430615	T;T;T;T;T;T;T;T	0.05786	3.39;3.39;3.39;3.39;3.39;3.39;3.39;3.39	5.18	3.32	0.38043	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.64402	U	0.000007	T	0.15219	0.0367	M	0.85099	2.735	0.53688	D	0.999974	D	0.76494	0.999	D	0.72075	0.976	T	0.00865	-1.1535	10	0.87932	D	0	-25.7668	9.7132	0.40258	0.1704:0.0:0.8296:0.0	.	369	Q9BZP6	CHIA_HUMAN	D	313;208;369;369;208;208;208;261	ENSP00000387671:G313D;ENSP00000436946:G208D;ENSP00000358755:G369D;ENSP00000341828:G369D;ENSP00000390476:G208D;ENSP00000338970:G208D;ENSP00000433309:G208D;ENSP00000391132:G261D	ENSP00000341828:G369D	G	+	2	0	CHIA	111663542	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.079000	0.64431	0.686000	0.31488	0.655000	0.94253	GGC	CHIA	-	superfamily_Glycoside_hydrolase_SF	ENSG00000134216		0.512	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	HGNC	protein_coding	OTTHUMT00000030710.1		0.00	34	0	G			111862019	+1			no_errors	ENST00000343320	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	A
CHRNB1	1140	genome.wustl.edu	37	17	7359954	7359954	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:7359954G>A	ENST00000306071.2	+	11	1485	c.1418G>A	c.(1417-1419)tGg>tAg	p.W473*	CHRNB1_ENST00000576360.1_Nonsense_Mutation_p.W352*|CHRNB1_ENST00000536404.2_Nonsense_Mutation_p.W401*|CHRNB1_ENST00000575379.1_Nonsense_Mutation_p.W9*	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	473					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	CTCTTCCTGTGGACTTTCATC	0.577																																																	0													194.0	150.0	165.0					17																	7359954		2203	4300	6503	SO:0001587	stop_gained	0			X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.1418G>A	17.37:g.7359954G>A	ENSP00000304290:p.Trp473*		B7Z5H1|Q8IZ46|Q96FB8	Nonsense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.W473*	ENST00000306071.2	37	c.1418	CCDS11106.1	17	.	.	.	.	.	.	.	.	.	.	g	36	5.715544	0.96830	.	.	ENSG00000170175	ENST00000306071;ENST00000536404	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.9227	0.86168	0.0:0.0:1.0:0.0	.	.	.	.	X	473;401	.	ENSP00000304290:W473X	W	+	2	0	CHRNB1	7300678	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.528000	0.73807	2.589000	0.87451	0.550000	0.68814	TGG	CHRNB1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000170175		0.577	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB1	HGNC	protein_coding	OTTHUMT00000226942.3	-	0.00	100	0	G			7359954	+1	tier1	-	no_errors	ENST00000306071	ensembl	human	known	74_37	nonsense	10.91	49	6	SNP	1.000	A
CLDN8	9073	genome.wustl.edu	37	21	31587909	31587909	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr21:31587909T>C	ENST00000399899.1	-	1	482	c.335A>G	c.(334-336)gAg>gGg	p.E112G	CLDN8_ENST00000286809.1_Missense_Mutation_p.E112G	NM_199328.2	NP_955360.1	P56748	CLD8_HUMAN	claudin 8	112					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)	15						CTTCACCTTCTCATTGTCCCC	0.542																																																	0													110.0	93.0	99.0					21																	31587909		2203	4300	6503	SO:0001583	missense	0			AJ250711	CCDS13587.1	21q22.1	2008-07-31			ENSG00000156284	ENSG00000156284		"""Claudins"""	2050	protein-coding gene	gene with protein product		611231				9892664	Standard	NM_199328		Approved		uc002ynu.2	P56748	OTTHUMG00000081872	ENST00000399899.1:c.335A>G	21.37:g.31587909T>C	ENSP00000382783:p.Glu112Gly		D3DSE3|Q53EX7	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin8,prints_Claudin14	p.E112G	ENST00000399899.1	37	c.335	CCDS13587.1	21	.	.	.	.	.	.	.	.	.	.	T	9.434	1.086235	0.20390	.	.	ENSG00000156284	ENST00000399899;ENST00000286809;ENST00000536721	D;D	0.89123	-2.47;-2.47	4.78	4.78	0.61160	.	0.343803	0.28889	N	0.013802	D	0.87301	0.6143	M	0.68952	2.095	0.09310	N	1	B	0.27765	0.188	B	0.36186	0.219	T	0.79664	-0.1709	10	0.49607	T	0.09	.	6.2605	0.20897	0.0:0.0841:0.163:0.7529	.	112	P56748	CLD8_HUMAN	G	112	ENSP00000382783:E112G;ENSP00000286809:E112G	ENSP00000286809:E112G	E	-	2	0	CLDN8	30509780	0.001000	0.12720	0.040000	0.18447	0.652000	0.38707	1.177000	0.31969	2.141000	0.66446	0.491000	0.48974	GAG	CLDN8	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000156284		0.542	CLDN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN8	HGNC	protein_coding	OTTHUMT00000182260.1		0.00	61	0	T	NM_199328		31587909	-1			no_errors	ENST00000286809	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.041	C
CLEC4D	338339	genome.wustl.edu	37	12	8672900	8672900	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:8672900C>T	ENST00000299665.2	+	5	656	c.463C>T	c.(463-465)Cgt>Tgt	p.R155C		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	155	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R155C(1)		large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					AGGTCAGTGGCGTTGGGTGGA	0.403																																																	1	Substitution - Missense(1)	lung(1)											97.0	98.0	98.0					12																	8672900		2203	4300	6503	SO:0001583	missense	0			AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.463C>T	12.37:g.8672900C>T	ENSP00000299665:p.Arg155Cys		Q8N5J5	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.R155C	ENST00000299665.2	37	c.463	CCDS8593.1	12	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983050	0.53827	.	.	ENSG00000166527	ENST00000299665	T	0.18502	2.21	4.67	1.48	0.22813	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.17238	0.0414	M	0.76727	2.345	0.27413	N	0.954503	B	0.10296	0.003	B	0.09377	0.004	T	0.23976	-1.0173	8	.	.	.	.	3.4237	0.07402	0.1972:0.5788:0.0:0.224	.	155	Q8WXI8	CLC4D_HUMAN	C	155	ENSP00000299665:R155C	.	R	+	1	0	CLEC4D	8564167	0.099000	0.21834	0.689000	0.30133	0.721000	0.41392	0.074000	0.14662	0.606000	0.29965	-0.135000	0.14842	CGT	CLEC4D	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	ENSG00000166527		0.403	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4D	HGNC	protein_coding	OTTHUMT00000400565.1		0.00	34	0	C	NM_080387		8672900	+1			no_errors	ENST00000299665	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.422	T
CLIP4	79745	genome.wustl.edu	37	2	29366762	29366762	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:29366762C>T	ENST00000320081.5	+	7	1091	c.836C>T	c.(835-837)aCg>aTg	p.T279M	CLIP4_ENST00000401605.1_Missense_Mutation_p.T279M|CLIP4_ENST00000401617.2_Missense_Mutation_p.T172M|CLIP4_ENST00000404424.1_Missense_Mutation_p.T279M	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	279										endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					GCAATGCTTACGTCACTTGGC	0.468																																																	0													249.0	220.0	230.0					2																	29366762		2203	4300	6503	SO:0001583	missense	0			AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.836C>T	2.37:g.29366762C>T	ENSP00000327009:p.Thr279Met		A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Missense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.T279M	ENST00000320081.5	37	c.836	CCDS1770.1	2	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671728	0.29693	.	.	ENSG00000115295	ENST00000401605;ENST00000401617;ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000530644	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	5.64	5.64	0.86602	Cytoskeleton-associated protein, Gly-rich domain (2);	0.296137	0.37669	N	0.001988	T	0.59211	0.2177	L	0.44542	1.39	0.09310	N	1	P;P	0.45011	0.848;0.713	B;B	0.34093	0.162;0.175	T	0.63519	-0.6619	10	0.59425	D	0.04	.	5.9855	0.19432	0.0:0.6761:0.1699:0.154	.	279;279	A8K6D0;Q8N3C7	.;CLIP4_HUMAN	M	279;172;279;279;279;280;261	ENSP00000384242:T279M;ENSP00000385148:T172M;ENSP00000385594:T279M;ENSP00000327009:T279M	ENSP00000327009:T279M	T	+	2	0	CLIP4	29220266	0.004000	0.15560	0.008000	0.14137	0.529000	0.34654	1.278000	0.33179	2.654000	0.90174	0.650000	0.86243	ACG	CLIP4	-	superfamily_CAP-Gly_domain	ENSG00000115295		0.468	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP4	HGNC	protein_coding	OTTHUMT00000215123.2	-	0.00	40	0	C	NM_024692		29366762	+1	tier1	-	no_errors	ENST00000320081	ensembl	human	known	74_37	missense	28.95	27	11	SNP	0.009	T
CNOT10	25904	genome.wustl.edu	37	3	32737174	32737174	+	Intron	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:32737174C>G	ENST00000328834.5	+	2	338				CNOT10_ENST00000538368.1_Intron|CNOT10_ENST00000331889.6_Intron|CNOT10_ENST00000454516.2_Silent_p.R19R	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						GCTCTGTACGCATAGAAGGTC	0.403																																																	0																																										SO:0001627	intron_variant	0			BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.23-8186C>G	3.37:g.32737174C>G			B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Silent	SNP	pfam_TPR_1,smart_TPR_repeat	p.R19	ENST00000328834.5	37	c.57	CCDS2655.1	3																																																																																			CNOT10	-	NULL	ENSG00000182973		0.403	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT10	HGNC	protein_coding	OTTHUMT00000253248.2	-	0.00	94	0	C	NM_015442		32737174	+1	tier1	-	no_errors	ENST00000454516	ensembl	human	known	74_37	silent	11.73	143	19	SNP	0.004	G
COL14A1	7373	genome.wustl.edu	37	8	121302004	121302004	+	Splice_Site	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:121302004C>T	ENST00000297848.3	+	34	4505	c.4235C>T	c.(4234-4236)cCg>cTg	p.P1412L	COL14A1_ENST00000247781.3_Splice_Site_p.P1317L|COL14A1_ENST00000309791.4_Splice_Site_p.P1412L	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AACTCTGCACCGGTAAGTGAA	0.408																																																	0													114.0	105.0	108.0					8																	121302004		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4236+1C>T	8.37:g.121302004C>T				Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.P1412L	ENST00000297848.3	37	c.4235	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360594	0.61403	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	T;T;T	0.02158	4.42;4.42;4.42	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.098392	0.64402	D	0.000001	T	0.06962	0.0177	M	0.73598	2.24	0.80722	D	1	D	0.60160	0.987	P	0.44772	0.46	T	0.03086	-1.1074	10	0.66056	D	0.02	.	20.3754	0.98918	0.0:1.0:0.0:0.0	.	1412	Q05707	COEA1_HUMAN	L	1412;1412;1317	ENSP00000311809:P1412L;ENSP00000297848:P1412L;ENSP00000247781:P1317L	ENSP00000247781:P1317L	P	+	2	0	COL14A1	121371185	1.000000	0.71417	1.000000	0.80357	0.057000	0.15508	7.213000	0.77950	2.894000	0.99253	0.591000	0.81541	CCG	COL14A1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000187955		0.408	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2		0.00	56	0	C	NM_021110	Missense_Mutation	121302004	+1			no_errors	ENST00000297848	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
COL19A1	1310	genome.wustl.edu	37	6	70669905	70669905	+	Missense_Mutation	SNP	T	T	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:70669905T>A	ENST00000322773.4	+	10	1056	c.954T>A	c.(952-954)caT>caA	p.H318Q		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	318	Collagen-like 1.|Triple-helical region 1 (COL1).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						ATGGTTTACATGGTGCTCCAG	0.313																																																	0													128.0	121.0	124.0					6																	70669905		2203	4300	6503	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.954T>A	6.37:g.70669905T>A	ENSP00000316030:p.His318Gln		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.H318Q	ENST00000322773.4	37	c.954	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	T	9.549	1.115443	0.20795	.	.	ENSG00000082293	ENST00000322773	D	0.93426	-3.22	5.06	3.88	0.44766	.	1.023660	0.07766	N	0.950901	T	0.59362	0.2188	N	0.00327	-1.64	0.58432	D	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.46373	-0.9196	10	0.12430	T	0.62	.	8.8366	0.35115	0.0:0.0:0.1898:0.8102	.	318	Q14993	COJA1_HUMAN	Q	318	ENSP00000316030:H318Q	ENSP00000316030:H318Q	H	+	3	2	COL19A1	70726626	0.973000	0.33851	0.319000	0.25293	0.901000	0.52897	1.972000	0.40540	0.930000	0.37217	-0.323000	0.08544	CAT	COL19A1	-	pfam_Collagen	ENSG00000082293		0.313	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	-	0.00	54	0	T			70669905	+1	tier1	-	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.651	A
COL22A1	169044	genome.wustl.edu	37	8	139601476	139601476	+	3'UTR	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:139601476T>C	ENST00000303045.6	-	0	5347				COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_3'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CACTGCAGTCTTCTGGCTTTC	0.512										HNSCC(7;0.00092)																																							0													19.0	21.0	20.0					8																	139601476		2199	4300	6499	SO:0001624	3_prime_UTR_variant	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.*20A>G	8.37:g.139601476T>C			B7ZMH0|C9K0G4|Q8IVT9	RNA	SNP	-	NULL	ENST00000303045.6	37	NULL	CCDS6376.1	8																																																																																			COL22A1	-	-	ENSG00000169436		0.512	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	-	0.00	56	0	T	XM_291257		139601476	-1	tier1	-	no_errors	ENST00000341807	ensembl	human	known	74_37	rna	12.20	36	5	SNP	0.013	C
COL6A5	256076	genome.wustl.edu	37	3	130098739	130098739	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:130098739A>C	ENST00000432398.2	+	4	1640	c.1146A>C	c.(1144-1146)gaA>gaC	p.E382D	COL6A5_ENST00000265379.6_Missense_Mutation_p.E382D	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	382	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CCCAGTTAGAAGAAATAGTGT	0.443																																																	0													89.0	74.0	79.0					3																	130098739		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.1146A>C	3.37:g.130098739A>C	ENSP00000390895:p.Glu382Asp		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.E382D	ENST00000432398.2	37	c.1146		3	.	.	.	.	.	.	.	.	.	.	A	14.89	2.669877	0.47677	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.83837	-1.77;-1.77	5.34	2.8	0.32819	.	.	.	.	.	T	0.74688	0.3749	L	0.43598	1.365	0.20489	N	0.999892	B	0.24483	0.104	B	0.32928	0.155	T	0.63193	-0.6692	9	0.39692	T	0.17	.	1.5363	0.02546	0.5121:0.1451:0.0866:0.2562	.	382	A8TX70-2	.	D	382	ENSP00000390895:E382D;ENSP00000265379:E382D	ENSP00000265379:E382D	E	+	3	2	COL6A5	131581429	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	-0.455000	0.06762	0.868000	0.35678	0.374000	0.22700	GAA	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.443	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	32	0	A	NM_153264		130098739	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.987	C
CPEB4	80315	genome.wustl.edu	37	5	173378899	173378899	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:173378899A>G	ENST00000265085.5	+	8	3192	c.1738A>G	c.(1738-1740)Aaa>Gaa	p.K580E	CPEB4_ENST00000520867.1_Missense_Mutation_p.K555E|CPEB4_ENST00000334035.5_Missense_Mutation_p.K563E|CPEB4_ENST00000522336.1_Missense_Mutation_p.K190E|CPEB4_ENST00000519467.1_3'UTR|CPEB4_ENST00000517880.1_Missense_Mutation_p.K173E|CPEB4_ENST00000519835.1_Missense_Mutation_p.K555E	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	580	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGACCCACGAAAAACTATATT	0.428																																																	0													167.0	143.0	151.0					5																	173378899		2203	4300	6503	SO:0001583	missense	0			BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.1738A>G	5.37:g.173378899A>G	ENSP00000265085:p.Lys580Glu		B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K580E	ENST00000265085.5	37	c.1738	CCDS4390.1	5	.	.	.	.	.	.	.	.	.	.	A	27.9	4.876795	0.91664	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835;ENST00000522336;ENST00000517880	T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84	5.55	4.39	0.52855	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.040740	0.85682	N	0.000000	T	0.43545	0.1252	L	0.52905	1.665	0.53688	D	0.999971	D;D;D;P;D	0.71674	0.998;0.989;0.991;0.946;0.981	D;D;D;P;D	0.70935	0.97;0.971;0.936;0.829;0.936	T	0.34378	-0.9831	10	0.87932	D	0	-16.4703	11.3965	0.49845	0.9292:0.0:0.0708:0.0	.	555;563;555;190;580	B7ZLQ8;Q17RY0-2;E5RJM0;E5RFP2;Q17RY0	.;.;.;.;CPEB4_HUMAN	E	580;555;563;555;190;173	ENSP00000265085:K580E;ENSP00000429092:K555E;ENSP00000334533:K563E;ENSP00000429048:K555E;ENSP00000430345:K190E;ENSP00000427990:K173E	ENSP00000265085:K580E	K	+	1	0	CPEB4	173311505	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.287000	0.95975	1.049000	0.40321	0.528000	0.53228	AAA	CPEB4	-	pfscan_RRM_dom	ENSG00000113742		0.428	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPEB4	HGNC	protein_coding	OTTHUMT00000252964.2		0.00	125	0	A	NM_030627		173378899	+1			no_errors	ENST00000265085	ensembl	human	known	74_37	missense	6.15	122	8	SNP	1.000	G
CUL9	23113	genome.wustl.edu	37	6	43189490	43189490	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:43189490A>G	ENST00000252050.4	+	35	6904	c.6820A>G	c.(6820-6822)Aaa>Gaa	p.K2274E	RP3-330M21.5_ENST00000500590.1_RNA|CUL9_ENST00000354495.3_Missense_Mutation_p.K2164E|CUL9_ENST00000372647.2_Missense_Mutation_p.K2246E	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	2274					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GCCAAATCACAAAGACTATTA	0.592																																																	0													66.0	54.0	58.0					6																	43189490		2203	4300	6503	SO:0001583	missense	0			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.6820A>G	6.37:g.43189490A>G	ENSP00000252050:p.Lys2274Glu		O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_Znf_C6HC,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,superfamily_UBA-like,smart_Cullin_neddylation_domain,smart_Znf_C6HC,pfscan_Znf_RING,pfscan_Cullin_homology	p.K2274E	ENST00000252050.4	37	c.6820	CCDS4890.1	6	.	.	.	.	.	.	.	.	.	.	A	28.9	4.959064	0.92726	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.61510	0.1;0.1;0.1	5.63	5.63	0.86233	Zinc finger, C6HC-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	N	0.26042	0.785	0.52099	D	0.99994	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.72338	0.942;0.977;0.977	T	0.64732	-0.6338	10	0.66056	D	0.02	-15.5832	15.8307	0.78749	1.0:0.0:0.0:0.0	.	2164;2246;2274	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	E	2274;2164;2246	ENSP00000252050:K2274E;ENSP00000346490:K2164E;ENSP00000361730:K2246E	ENSP00000252050:K2274E	K	+	1	0	CUL9	43297468	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.924000	0.92827	2.148000	0.66965	0.459000	0.35465	AAA	CUL9	-	smart_Znf_C6HC,pfscan_Znf_RING	ENSG00000112659		0.592	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL9	HGNC	protein_coding	OTTHUMT00000040582.2		0.00	35	0	A	NM_015089		43189490	+1			no_errors	ENST00000252050	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	G
CYP27C1	339761	genome.wustl.edu	37	2	127950791	127950791	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:127950791C>T	ENST00000335247.7	-	7	1011	c.881G>A	c.(880-882)tGg>tAg	p.W294*	CYP27C1_ENST00000409327.1_Nonsense_Mutation_p.W294*	NM_001001665.3	NP_001001665.3	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C, polypeptide 1	294						membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	16	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		TTTCCGCAGCCAGCGCTCAGG	0.552																																																	0													105.0	101.0	102.0					2																	127950791		2203	4300	6503	SO:0001587	stop_gained	0			AC027142	CCDS33285.1	2q14.3	2008-05-14	2007-05-18		ENSG00000186684	ENSG00000186684		"""Cytochrome P450s"""	33480	protein-coding gene	gene with protein product							Standard	NM_001001665		Approved	FLJ16008	uc002tod.2	Q4G0S4	OTTHUMG00000153400	ENST00000335247.7:c.881G>A	2.37:g.127950791C>T	ENSP00000334128:p.Trp294*		Q6ZNI7	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.W294*	ENST00000335247.7	37	c.881	CCDS33285.1	2	.	.	.	.	.	.	.	.	.	.	C	16.93	3.257526	0.59321	.	.	ENSG00000186684	ENST00000335247;ENST00000409327	.	.	.	4.11	3.22	0.36961	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7064	11.9879	0.53157	0.0:0.9133:0.0:0.0867	.	.	.	.	X	294	.	ENSP00000334128:W294X	W	-	2	0	CYP27C1	127667261	1.000000	0.71417	0.990000	0.47175	0.016000	0.09150	5.174000	0.65015	0.832000	0.34804	0.484000	0.47621	TGG	CYP27C1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000186684		0.552	CYP27C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP27C1	HGNC	protein_coding	OTTHUMT00000331046.1	-	0.00	21	0	C	NM_001001665		127950791	-1	tier1	-	no_errors	ENST00000335247	ensembl	human	known	74_37	nonsense	24.32	28	9	SNP	1.000	T
DAOA	267012	genome.wustl.edu	37	13	106124928	106124928	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr13:106124928G>T	ENST00000375936.3	+	3	221	c.175G>T	c.(175-177)Gaa>Taa	p.E59*	DAOA-AS1_ENST00000448407.1_RNA|DAOA_ENST00000329625.5_5'UTR	NM_001161812.1|NM_172370.3	NP_001155284.1|NP_758958.3	P59103	DAOA_HUMAN	D-amino acid oxidase activator	59					negative regulation of D-amino-acid oxidase activity (GO:1900758)|positive regulation of catalytic activity (GO:0043085)	Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	13	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					AACAAGGAAAGAAGGATGGAA	0.403																																																	0													167.0	164.0	165.0					13																	106124928		1927	4120	6047	SO:0001587	stop_gained	0			AY138547	CCDS41905.1, CCDS53880.1, CCDS59242.1	13q33.2	2011-08-01			ENSG00000182346	ENSG00000182346			21191	protein-coding gene	gene with protein product	"""G72 transcript"""	607408				12364586, 15057823	Standard	NM_001161814		Approved	G72	uc010tjg.2	P59103	OTTHUMG00000041333	ENST00000375936.3:c.175G>T	13.37:g.106124928G>T	ENSP00000365103:p.Glu59*		A6NKG7|Q0VAE6|Q5VX59|Q86Y17|Q8IWM4	Nonsense_Mutation	SNP	NULL	p.E59*	ENST00000375936.3	37	c.175	CCDS41905.1	13	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915534	0.52546	.	.	ENSG00000182346	ENST00000375936	.	.	.	3.39	1.65	0.23941	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.579	0.17238	0.2563:0.0:0.7437:0.0	.	.	.	.	X	59	.	ENSP00000365103:E59X	E	+	1	0	DAOA	104922929	0.000000	0.05858	0.000000	0.03702	0.144000	0.21451	-0.515000	0.06290	0.442000	0.26555	0.555000	0.69702	GAA	DAOA	-	NULL	ENSG00000182346		0.403	DAOA-005	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DAOA	HGNC	protein_coding	OTTHUMT00000099040.2		0.00	47	0	G	NM_172370		106124928	+1			no_errors	ENST00000375936	ensembl	human	known	74_37	nonsense	9.52	57	6	SNP	0.000	T
DCC	1630	genome.wustl.edu	37	18	50976903	50976903	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr18:50976903G>A	ENST00000442544.2	+	23	3879	c.3263G>A	c.(3262-3264)gGc>gAc	p.G1088D	DCC_ENST00000581580.1_Missense_Mutation_p.G723D	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1088					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCCCCGCATGGCAGTGTCACT	0.502																																																	0													117.0	96.0	103.0					18																	50976903		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3263G>A	18.37:g.50976903G>A	ENSP00000389140:p.Gly1088Asp			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G1088D	ENST00000442544.2	37	c.3263	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382306	0.24944	.	.	ENSG00000187323	ENST00000442544	T	0.51325	0.71	5.35	5.35	0.76521	.	0.065999	0.64402	D	0.000015	T	0.58438	0.2122	L	0.59436	1.845	0.52099	D	0.99994	D	0.59357	0.985	P	0.53518	0.728	T	0.56848	-0.7911	10	0.39692	T	0.17	-9.4362	17.8642	0.88791	0.0:0.0:1.0:0.0	.	1088	P43146	DCC_HUMAN	D	1088	ENSP00000389140:G1088D	ENSP00000389140:G1088D	G	+	2	0	DCC	49230901	1.000000	0.71417	0.998000	0.56505	0.123000	0.20343	9.070000	0.93974	2.512000	0.84698	0.650000	0.86243	GGC	DCC	-	pfam_Neogenin_C	ENSG00000187323		0.502	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	83	0	G	NM_005215		50976903	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	9.52	56	6	SNP	1.000	A
DERL1	79139	genome.wustl.edu	37	8	124054254	124054254	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:124054254C>T	ENST00000259512.4	-	1	409	c.109G>A	c.(109-111)Gcc>Acc	p.A37T	DERL1_ENST00000419562.2_Missense_Mutation_p.A37T|RNY4P5_ENST00000362808.1_RNA|DERL1_ENST00000405944.3_Missense_Mutation_p.A37T	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	37					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AAGAGGTAGGCCGGGCTGATG	0.652																																																	0													64.0	55.0	58.0					8																	124054254		2203	4300	6503	SO:0001583	missense	0			BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.109G>A	8.37:g.124054254C>T	ENSP00000259512:p.Ala37Thr		B3KW41|E9PH19	Missense_Mutation	SNP	pfam_DER1	p.A37T	ENST00000259512.4	37	c.109	CCDS6337.1	8	.	.	.	.	.	.	.	.	.	.	C	9.289	1.050114	0.19827	.	.	ENSG00000136986	ENST00000259512;ENST00000405944;ENST00000419562	T;T;T	0.29655	2.79;1.57;1.56	5.27	3.34	0.38264	.	0.468764	0.25657	N	0.029165	T	0.16557	0.0398	N	0.08118	0	0.80722	D	1	B;B;B	0.16396	0.017;0.0;0.0	B;B;B	0.22880	0.042;0.001;0.003	T	0.05903	-1.0857	10	0.30078	T	0.28	.	12.4087	0.55455	0.0:0.8431:0.0:0.1569	.	37;37;37	B4E1G1;Q9BUN8-2;Q9BUN8	.;.;DERL1_HUMAN	T	37	ENSP00000259512:A37T;ENSP00000384289:A37T;ENSP00000389965:A37T	ENSP00000259512:A37T	A	-	1	0	DERL1	124123435	1.000000	0.71417	1.000000	0.80357	0.005000	0.04900	3.022000	0.49659	1.467000	0.48044	0.453000	0.30009	GCC	DERL1	-	pfam_DER1	ENSG00000136986		0.652	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERL1	HGNC	protein_coding	OTTHUMT00000381714.2		0.00	75	0	C	NM_024295		124054254	-1			no_errors	ENST00000259512	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.994	T
DGUOK	1716	genome.wustl.edu	37	2	74154136	74154136	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:74154136C>T	ENST00000264093.4	+	1	184	c.99C>T	c.(97-99)caC>caT	p.H33H	DGUOK_ENST00000348222.1_Silent_p.H33H|DGUOK_ENST00000462685.1_3'UTR|DGUOK_ENST00000356837.6_Silent_p.H33H	NM_080916.2	NP_550438.1	Q16854	DGUOK_HUMAN	deoxyguanosine kinase	33					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|dGTP metabolic process (GO:0046070)|guanosine metabolic process (GO:0008617)|negative regulation of neuron projection development (GO:0010977)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|protein phosphorylation (GO:0006468)|purine deoxyribonucleoside metabolic process (GO:0046122)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxyguanosine kinase activity (GO:0004138)|nucleoside kinase activity (GO:0019206)			endometrium(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	8					Nelarabine(DB01280)	GAGGCCTGCACGCGGGGCGCG	0.672																																																	0													36.0	39.0	38.0					2																	74154136		2203	4300	6503	SO:0001819	synonymous_variant	0			U41668	CCDS1931.1, CCDS1932.1	2p13	2008-02-05			ENSG00000114956	ENSG00000114956	2.7.1.113		2858	protein-coding gene	gene with protein product		601465					Standard	NM_080916		Approved	dGK	uc002sjx.3	Q16854	OTTHUMG00000129819	ENST00000264093.4:c.99C>T	2.37:g.74154136C>T			P78532|Q16759|Q4ZG09|Q7L1W9|Q96BC1	Silent	SNP	pfam_Deoxynucleoside_kinase,superfamily_P-loop_NTPase	p.H33	ENST00000264093.4	37	c.99	CCDS1931.1	2																																																																																			DGUOK	-	NULL	ENSG00000114956		0.672	DGUOK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGUOK	HGNC	protein_coding	OTTHUMT00000252050.1	-	0.00	40	0	C			74154136	+1	tier1	-	no_errors	ENST00000264093	ensembl	human	known	74_37	silent	18.03	50	11	SNP	0.930	T
DHTKD1	55526	genome.wustl.edu	37	10	12131151	12131151	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:12131151C>T	ENST00000263035.4	+	5	946	c.884C>T	c.(883-885)cCc>cTc	p.P295L	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	295					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GCCGTCAACCCCGTGGCCGTG	0.612																																																	0													91.0	80.0	84.0					10																	12131151		2203	4300	6503	SO:0001583	missense	0			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.884C>T	10.37:g.12131151C>T	ENSP00000263035:p.Pro295Leu		Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	pfam_Transketolase-like_Pyr-bd,pfam_DH_E1,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.P295L	ENST00000263035.4	37	c.884	CCDS7087.1	10	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118218	0.56505	.	.	ENSG00000181192	ENST00000263035;ENST00000437298	D;D	0.96940	-4.18;-4.18	5.43	4.52	0.55395	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98826	0.9604	H	0.98089	4.145	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99184	1.0868	10	0.87932	D	0	-9.4168	13.954	0.64135	0.0:0.9269:0.0:0.0731	.	295	Q96HY7	DHTK1_HUMAN	L	295;230	ENSP00000263035:P295L;ENSP00000388163:P230L	ENSP00000263035:P295L	P	+	2	0	DHTKD1	12171157	1.000000	0.71417	0.274000	0.24659	0.049000	0.14656	7.656000	0.83736	1.290000	0.44636	0.563000	0.77884	CCC	DHTKD1	-	pfam_DH_E1,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000181192		0.612	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHTKD1	HGNC	protein_coding	OTTHUMT00000046777.1	-	0.00	39	0	C	NM_018706		12131151	+1	tier1	-	no_errors	ENST00000263035	ensembl	human	known	74_37	missense	20.83	19	5	SNP	0.999	T
DHX29	54505	genome.wustl.edu	37	5	54567972	54567972	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:54567972C>T	ENST00000251636.5	-	18	2955	c.2807G>A	c.(2806-2808)gGt>gAt	p.G936D	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	936	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				AATAGTGATACCCGTCTCTGC	0.264																																																	0													48.0	51.0	50.0					5																	54567972		2200	4294	6494	SO:0001583	missense	0			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.2807G>A	5.37:g.54567972C>T	ENSP00000251636:p.Gly936Asp		O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G936D	ENST00000251636.5	37	c.2807	CCDS34158.1	5	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490363	0.84962	.	.	ENSG00000067248	ENST00000251636	D	0.93307	-3.2	5.02	5.02	0.67125	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.96294	0.8791	M	0.79011	2.435	0.80722	D	1	D	0.55800	0.973	P	0.61275	0.886	D	0.96702	0.9519	10	0.72032	D	0.01	.	18.6981	0.91610	0.0:1.0:0.0:0.0	.	936	Q7Z478	DHX29_HUMAN	D	936	ENSP00000251636:G936D	ENSP00000251636:G936D	G	-	2	0	DHX29	54603729	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.383000	0.79741	2.479000	0.83701	0.655000	0.94253	GGT	DHX29	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000067248		0.264	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX29	HGNC	protein_coding	OTTHUMT00000368532.1		0.00	74	0	C	NM_019030		54567972	-1			no_errors	ENST00000251636	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
DIP2A	23181	genome.wustl.edu	37	21	47987287	47987287	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr21:47987287G>A	ENST00000417564.2	+	38	4489	c.4468G>A	c.(4468-4470)Gta>Ata	p.V1490I	DIP2A_ENST00000318711.7_Missense_Mutation_p.V1491I|DIP2A_ENST00000479654.1_3'UTR|DIP2A_ENST00000400274.1_Missense_Mutation_p.V1486I			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1490					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CTGCAGTGCCGTATTCACCTG	0.582																																																	0													86.0	91.0	90.0					21																	47987287		2203	4300	6503	SO:0001583	missense	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.4468G>A	21.37:g.47987287G>A	ENSP00000392066:p.Val1490Ile		A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.V1491I	ENST00000417564.2	37	c.4471	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	G	33	5.228460	0.95173	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.20738	2.05;2.05;2.05	5.8	5.8	0.92144	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.51160	0.1658	M	0.81179	2.53	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76575	0.986;0.988	T	0.48305	-0.9047	10	0.49607	T	0.09	-26.1953	19.0426	0.93006	0.0:0.0:1.0:0.0	.	1491;1490	E9PER1;Q14689	.;DIP2A_HUMAN	I	1486;1491;1490	ENSP00000383133:V1486I;ENSP00000323633:V1491I;ENSP00000392066:V1490I	ENSP00000323633:V1491I	V	+	1	0	DIP2A	46811715	1.000000	0.71417	0.912000	0.35992	0.924000	0.55760	9.627000	0.98412	2.748000	0.94277	0.655000	0.94253	GTA	DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.582	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1		0.00	37	0	G	NM_015151		47987287	+1			no_errors	ENST00000318711	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	A
DLAT	1737	genome.wustl.edu	37	11	111897025	111897026	+	Splice_Site	INS	-	-	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:111897025_111897026insA	ENST00000280346.6	+	2	1040		c.e2+2		DLAT_ENST00000393051.1_Splice_Site|DLAT_ENST00000537636.1_Intron	NM_001931.4	NP_001922.2	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase						cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue acetyltransferase activity (GO:0004742)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)	22		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)		ATTGCAGAGGTAAGtttttttt	0.391																																																	0																																										SO:0001630	splice_region_variant	0			Y00978	CCDS8354.1	11q23.1	2008-02-05	2008-02-04		ENSG00000150768	ENSG00000150768	2.3.1.12		2896	protein-coding gene	gene with protein product	"""E2 component of pyruvate dehydrogenase complex"""	608770		DLTA		8102256	Standard	NM_001931		Approved	PDC-E2	uc001pmo.3	P10515	OTTHUMG00000133751	ENST00000280346.6:c.381+2->A	11.37:g.111897027_111897027dupA			Q16783|Q53EP3	Splice_Site	INS	-	e2+2	ENST00000280346.6	37	c.381+2_381+1	CCDS8354.1	11																																																																																			DLAT	-	-	ENSG00000150768		0.391	DLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLAT	HGNC	protein_coding	OTTHUMT00000258167.1		0.00	53	0	-	NM_001931	Intron	111897026	+1	tier1		no_errors	ENST00000280346	ensembl	human	known	74_37	splice_site_ins	6.82	41	3	INS	1.000:0.997	A
DMXL1	1657	genome.wustl.edu	37	5	118454598	118454598	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:118454598C>T	ENST00000311085.8	+	8	912	c.832C>T	c.(832-834)Cta>Tta	p.L278L	DMXL1_ENST00000539542.1_Silent_p.L278L	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	278										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TGATTGTTTGCTATACGGAGG	0.363																																																	0													158.0	152.0	154.0					5																	118454598		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.832C>T	5.37:g.118454598C>T				Silent	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L278	ENST00000311085.8	37	c.832	CCDS4125.1	5																																																																																			DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.363	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	-	0.00	78	0	C	NM_005509		118454598	+1	tier1	-	no_errors	ENST00000539542	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.239	T
DNAH1	25981	genome.wustl.edu	37	3	52418830	52418830	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:52418830C>T	ENST00000420323.2	+	53	8612	c.8351C>T	c.(8350-8352)tCg>tTg	p.S2784L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2784	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATCCACCAGTCGGTGTCCAAG	0.577											OREG0015612	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													43.0	47.0	46.0					3																	52418830		2069	4191	6260	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.8351C>T	3.37:g.52418830C>T	ENSP00000401514:p.Ser2784Leu	984	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	p.S2784L	ENST00000420323.2	37	c.8351	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756763	0.49362	.	.	ENSG00000114841	ENST00000420323	T	0.40225	1.04	4.38	4.38	0.52667	.	0.357177	0.20582	N	0.089505	T	0.65396	0.2687	M	0.85197	2.74	0.42178	D	0.991675	D	0.76494	0.999	D	0.66351	0.943	T	0.71866	-0.4463	10	0.72032	D	0.01	.	13.1979	0.59749	0.0:0.7886:0.2114:0.0	.	2784	C9JXH6	.	L	2784	ENSP00000401514:S2784L	ENSP00000401514:S2784L	S	+	2	0	DNAH1	52393870	0.942000	0.31987	0.951000	0.38953	0.034000	0.12701	1.824000	0.39072	2.287000	0.76781	0.561000	0.74099	TCG	DNAH1	-	superfamily_P-loop_NTPase	ENSG00000114841		0.577	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	-	0.00	35	0	C	NM_015512		52418830	+1	tier1	-	no_errors	ENST00000420323	ensembl	human	known	74_37	missense	17.14	29	6	SNP	0.972	T
DNAH14	127602	genome.wustl.edu	37	1	225230538	225230538	+	Splice_Site	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:225230538T>G	ENST00000445597.2	+	11	1547	c.1547T>G	c.(1546-1548)aTt>aGt	p.I516S	DNAH14_ENST00000439375.2_Splice_Site_p.I497S|DNAH14_ENST00000430092.1_Splice_Site_p.I497S			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	516					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TTAAATTAGATTTTGAATAGT	0.318																																																	0													54.0	43.0	47.0					1																	225230538		692	1591	2283	SO:0001630	splice_region_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.1546-1T>G	1.37:g.225230538T>G			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.I497S	ENST00000445597.2	37	c.1490		1	.	.	.	.	.	.	.	.	.	.	T	10.78	1.447778	0.26074	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.36340	2.21;1.26;1.26	5.12	1.39	0.22231	.	1.072040	0.07368	N	0.885250	T	0.20088	0.0483	N	0.14661	0.345	0.22911	N	0.998577	B	0.32829	0.386	B	0.31101	0.124	T	0.23084	-1.0198	10	0.56958	D	0.05	.	3.7234	0.08465	0.0:0.2075:0.1938:0.5987	.	497	Q0VDD8-4	.	S	516;497;497	ENSP00000409472:I516S;ENSP00000414402:I497S;ENSP00000392061:I497S	ENSP00000414402:I497S	I	+	2	0	DNAH14	223297161	0.999000	0.42202	0.163000	0.22734	0.591000	0.36615	0.983000	0.29552	0.043000	0.15746	0.496000	0.49642	ATT	DNAH14	-	NULL	ENSG00000185842		0.318	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	75	0	T	XM_059166	Missense_Mutation	225230538	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	29.87	54	23	SNP	0.442	G
DOCK2	1794	genome.wustl.edu	37	5	169097551	169097551	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:169097551T>G	ENST00000256935.8	+	4	254	c.174T>G	c.(172-174)atT>atG	p.I58M		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	58	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACAGGGCATTTTTCCTAAGT	0.348																																																	0													81.0	79.0	80.0					5																	169097551		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.174T>G	5.37:g.169097551T>G	ENSP00000256935:p.Ile58Met		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.I58M	ENST00000256935.8	37	c.174	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	T	17.70	3.454788	0.63290	.	.	ENSG00000134516	ENST00000256935	T	0.08458	3.09	5.49	2.98	0.34508	Src homology-3 domain (3);Variant SH3 (1);	0.295180	0.37761	N	0.001957	T	0.12561	0.0305	M	0.68952	2.095	0.80722	D	1	P	0.45283	0.855	P	0.47705	0.555	T	0.02064	-1.1220	10	0.87932	D	0	.	3.6104	0.08058	0.2759:0.1934:0.0:0.5307	.	58	Q92608	DOCK2_HUMAN	M	58	ENSP00000256935:I58M	ENSP00000256935:I58M	I	+	3	3	DOCK2	169030129	0.997000	0.39634	0.999000	0.59377	0.983000	0.72400	0.364000	0.20325	0.926000	0.37118	0.460000	0.39030	ATT	DOCK2	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000134516		0.348	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	60	0	T	NM_004946		169097551	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.998	G
DOCK4	9732	genome.wustl.edu	37	7	111509629	111509629	+	Splice_Site	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:111509629C>G	ENST00000437633.1	-	21	2366		c.e21+1		DOCK4_ENST00000476846.1_Splice_Site|DOCK4_ENST00000428084.1_Splice_Site	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CATGTTATCACCTTCAGCACC	0.443																																																	0													144.0	134.0	138.0					7																	111509629		2045	4197	6242	SO:0001630	splice_region_variant	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.2109+1G>C	7.37:g.111509629C>G			O14584|O94824|Q8NB45	Splice_Site	SNP	-	e21+1	ENST00000437633.1	37	c.2109+1	CCDS47688.1	7	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512009	0.85389	.	.	ENSG00000128512	ENST00000352877;ENST00000423057;ENST00000428084;ENST00000437633;ENST00000445943;ENST00000342288;ENST00000544250	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1979	0.89829	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK4	111296865	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.608000	0.82898	2.781000	0.95711	0.650000	0.86243	.	DOCK4	-	-	ENSG00000128512		0.443	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	-	0.00	35	0	C	NM_014705	Intron	111509629	-1	tier1	-	no_errors	ENST00000428084	ensembl	human	known	74_37	splice_site	9.80	46	5	SNP	1.000	G
DPP10	57628	genome.wustl.edu	37	2	116572395	116572395	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:116572395T>G	ENST00000410059.1	+	20	2207	c.1727T>G	c.(1726-1728)gTt>gGt	p.V576G	DPP10_ENST00000310323.8_Missense_Mutation_p.V569G|DPP10_ENST00000409163.1_Missense_Mutation_p.V526G|DPP10_ENST00000393147.2_Missense_Mutation_p.V580G	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	576						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GGCCAGCTGGTTACAGATAAG	0.418																																																	0													130.0	124.0	126.0					2																	116572395		2203	4300	6503	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1727T>G	2.37:g.116572395T>G	ENSP00000386565:p.Val576Gly		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.V580G	ENST00000410059.1	37	c.1739	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	T	17.18	3.322770	0.60634	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.67841	0.2936	M	0.84948	2.725	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	T	0.74041	-0.3792	10	0.87932	D	0	-4.9933	14.3232	0.66502	0.0:0.0:0.0:1.0	.	569;580;572;576	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	G	576;526;580;569;526	ENSP00000386565:V576G;ENSP00000387038:V526G;ENSP00000376855:V580G;ENSP00000309066:V569G	ENSP00000309066:V569G	V	+	2	0	DPP10	116288865	1.000000	0.71417	1.000000	0.80357	0.374000	0.29953	7.326000	0.79133	2.182000	0.69389	0.533000	0.62120	GTT	DPP10	-	NULL	ENSG00000175497		0.418	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	-	0.00	49	0	T	NM_020868		116572395	+1	tier1	-	no_errors	ENST00000393147	ensembl	human	known	74_37	missense	10.96	65	8	SNP	1.000	G
DPYD	1806	genome.wustl.edu	37	1	98164964	98164964	+	Missense_Mutation	SNP	C	C	A	rs376073289		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:98164964C>A	ENST00000370192.3	-	6	723	c.623G>T	c.(622-624)cGa>cTa	p.R208L	DPYD_ENST00000423006.2_3'UTR|DPYD_ENST00000474241.1_5'UTR	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	208					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	GTACCCCAATCGAGCCAAAAA	0.393																																																	0													148.0	147.0	147.0					1																	98164964		2203	4300	6503	SO:0001583	missense	0			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.623G>T	1.37:g.98164964C>A	ENSP00000359211:p.Arg208Leu		A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	pfam_Dihydroorotate_DH_1_2,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_tRNA_hU_synthase,superfamily_Helical_ferredxn,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Dihydroorotate_DH	p.R208L	ENST00000370192.3	37	c.623	CCDS30777.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934398	0.92458	.	.	ENSG00000188641	ENST00000370192	D	0.82255	-1.59	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.87958	0.6309	L	0.52759	1.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88710	0.3222	10	0.87932	D	0	-9.6467	19.4065	0.94649	0.0:1.0:0.0:0.0	.	208	Q12882	DPYD_HUMAN	L	208	ENSP00000359211:R208L	ENSP00000359211:R208L	R	-	2	0	DPYD	97937552	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.454000	0.80714	2.595000	0.87683	0.591000	0.81541	CGA	DPYD	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase	ENSG00000188641		0.393	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	HGNC	protein_coding	OTTHUMT00000095698.3	-	0.00	26	0	C	NM_000110		98164964	-1	tier1	-	no_errors	ENST00000370192	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	A
DRD5	1816	genome.wustl.edu	37	4	9784785	9784785	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:9784785T>G	ENST00000304374.2	+	1	1528	c.1132T>G	c.(1132-1134)Ttc>Gtc	p.F378V		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	378					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.F378V(4)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GTGCAGCCACTTCTGCTCCCG	0.562																																																	4	Substitution - Missense(4)	skin(2)|NS(1)|endometrium(1)											63.0	55.0	57.0					4																	9784785		2203	4300	6503	SO:0001583	missense	0			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1132T>G	4.37:g.9784785T>G	ENSP00000306129:p.Phe378Val		B2R9S3|Q8NEQ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Dopamine_D5_rcpt,prints_Dopamine_rcpt	p.F378V	ENST00000304374.2	37	c.1132	CCDS3405.1	4	.	.	.	.	.	.	.	.	.	.	t	1.422	-0.572511	0.03882	.	.	ENSG00000169676	ENST00000304374	T	0.36878	1.23	4.73	-0.492	0.12041	.	1.972870	0.02341	N	0.074845	T	0.21103	0.0508	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10109	-1.0644	10	0.16420	T	0.52	.	4.5978	0.12338	0.0:0.3044:0.1738:0.5218	.	378	P21918	DRD5_HUMAN	V	378	ENSP00000306129:F378V	ENSP00000306129:F378V	F	+	1	0	DRD5	9393883	0.067000	0.21026	0.022000	0.16811	0.197000	0.23852	0.558000	0.23469	-0.022000	0.13986	-2.216000	0.00297	TTC	DRD5	-	NULL	ENSG00000169676		0.562	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD5	HGNC	protein_coding	OTTHUMT00000250293.1		0.00	52	0	T			9784785	+1			no_errors	ENST00000304374	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.043	G
DSCAM	1826	genome.wustl.edu	37	21	41446994	41446994	+	Silent	SNP	G	G	T	rs201077680	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr21:41446994G>T	ENST00000400454.1	-	27	5335	c.4858C>A	c.(4858-4860)Cgg>Agg	p.R1620R		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1620					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGCTCCCGCCGCCTCCTCCGC	0.627													G|||	2	0.000399361	0.0	0.0	5008	,	,		16671	0.0		0.0	False		,,,				2504	0.002				Melanoma(134;970 1778 1785 21664 32388)												0								G		0,4224		0,0,2112	67.0	83.0	78.0		4858	-0.5	0.3	21		78	7,8423		0,7,4208	no	coding-synonymous	DSCAM	NM_001389.3		0,7,6320	TT,TG,GG		0.083,0.0,0.0553		1620/2013	41446994	7,12647	2112	4215	6327	SO:0001819	synonymous_variant	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4858C>A	21.37:g.41446994G>T			O60468	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1620	ENST00000400454.1	37	c.4858	CCDS42929.1	21																																																																																			DSCAM	-	NULL	ENSG00000171587		0.627	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	-	0.00	67	0	G	NM_001389		41446994	-1	tier1	rs201077680	no_errors	ENST00000400454	ensembl	human	known	74_37	silent	13.79	50	8	SNP	0.998	T
DUSP10	11221	genome.wustl.edu	37	1	221875157	221875158	+	3'UTR	DEL	AA	AA	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:221875157_221875158delAA	ENST00000366899.3	-	0	2283_2284				DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000323825.3_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCAGAGAAGGAAAAAAAAAAAA	0.356																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*597TT>-	1.37:g.221875167_221875168delAA			D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-	ENSG00000143507		0.356	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1		0.00	25	0	AA	NM_007207		221875158	-1	tier1		no_errors	ENST00000468085	ensembl	human	known	74_37	rna	23.08	10	3	DEL	0.000:0.000	-
DYNC1LI2	1783	genome.wustl.edu	37	16	66776398	66776398	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:66776398C>A	ENST00000258198.2	-	4	678	c.472G>T	c.(472-474)Gag>Tag	p.E158*	DYNC1LI2_ENST00000440564.2_Nonsense_Mutation_p.E119*|DYNC1LI2_ENST00000379482.2_Nonsense_Mutation_p.E158*|DYNC1LI2_ENST00000443351.2_Intron	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	158					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		TCAATGTGCTCACGTAAAACA	0.408																																																	0													125.0	126.0	126.0					16																	66776398		2200	4300	6500	SO:0001587	stop_gained	0			AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.472G>T	16.37:g.66776398C>A	ENSP00000258198:p.Glu158*		A8K6V1|B4DZP4|Q8TAT3	Nonsense_Mutation	SNP	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	p.E158*	ENST00000258198.2	37	c.472	CCDS10818.1	16	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983089	0.93044	.	.	ENSG00000135720	ENST00000258198;ENST00000379482;ENST00000440564	.	.	.	5.07	5.07	0.68467	.	0.047638	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-0.2472	19.0071	0.92856	0.0:1.0:0.0:0.0	.	.	.	.	X	158;158;119	.	ENSP00000258198:E158X	E	-	1	0	DYNC1LI2	65333899	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.757000	0.68766	2.793000	0.96121	0.563000	0.77884	GAG	DYNC1LI2	-	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	ENSG00000135720		0.408	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1LI2	HGNC	protein_coding	OTTHUMT00000268846.1	-	0.00	65	0	C	NM_006141		66776398	-1	tier1	-	no_errors	ENST00000258198	ensembl	human	known	74_37	nonsense	33.33	36	18	SNP	1.000	A
EIF5B	9669	genome.wustl.edu	37	2	100006829	100006829	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:100006829G>C	ENST00000289371.6	+	16	2753	c.2551G>C	c.(2551-2553)Gca>Cca	p.A851P		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	851					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CAAGAGACTTGCACACTGTGA	0.403																																					Colon(162;2388 2567 2705 3444)												0													136.0	125.0	128.0					2																	100006829		1951	4161	6112	SO:0001583	missense	0			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.2551G>C	2.37:g.100006829G>C	ENSP00000289371:p.Ala851Pro		O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_TIF_IF2_dom3,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.A851P	ENST00000289371.6	37	c.2551	CCDS42721.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.397737	0.96009	.	.	ENSG00000158417	ENST00000289371	T	0.76578	-1.03	5.51	5.51	0.81932	.	.	.	.	.	D	0.85622	0.5739	M	0.66506	2.035	0.80722	D	1	D	0.65815	0.995	P	0.59221	0.854	D	0.84470	0.0599	8	.	.	.	-26.0307	19.7779	0.96402	0.0:0.0:1.0:0.0	.	851	O60841	IF2P_HUMAN	P	851	ENSP00000289371:A851P	.	A	+	1	0	EIF5B	99373261	1.000000	0.71417	0.947000	0.38551	0.948000	0.59901	9.705000	0.98719	2.748000	0.94277	0.462000	0.41574	GCA	EIF5B	-	superfamily_P-loop_NTPase	ENSG00000158417		0.403	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	HGNC	protein_coding	OTTHUMT00000330364.2	-	0.00	57	0	G	NM_015904		100006829	+1	tier1	-	no_errors	ENST00000289371	ensembl	human	known	74_37	missense	18.75	39	9	SNP	1.000	C
LOC101927209	101927209	genome.wustl.edu	37	1	142713591	142713591	+	lincRNA	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:142713591T>G	ENST00000610091.1	-	0	2067																											TGTTGCTTTCTTCTTCCTTCA	0.373																																																	0																																												0																															1.37:g.142713591T>G				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.373	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	147	0	T			142713591	-1	tier1	-	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	14.07	116	19	SNP	0.081	G
EMC3	55831	genome.wustl.edu	37	3	10048911	10048911	+	lincRNA	SNP	T	T	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:10048911T>A	ENST00000383808.2	-	0	1087				AC034193.5_ENST00000326237.3_RNA																							GCTGAGGCTCTGAGCAGGTGC	0.517																																																	0																																												0																															3.37:g.10048911T>A				RNA	SNP	-	NULL	ENST00000383808.2	37	NULL		3																																																																																			AC022007.5	-	-	ENSG00000206567		0.517	AC022007.5-001	KNOWN	basic	lincRNA	ENSG00000206567	Clone_based_vega_gene	lincRNA	OTTHUMT00000339469.1		0.00	24	0	T			10048911	-1			no_errors	ENST00000383808	ensembl	human	known	74_37	rna	6.98	40	3	SNP	0.075	A
ZNF971P	100419895	genome.wustl.edu	37	16	34681585	34681585	+	RNA	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:34681585T>G	ENST00000568619.1	-	0	894																											ACTCATAGGGTTTCTCTCCAG	0.383																																																	0																																												0																															16.37:g.34681585T>G				RNA	SNP	-	NULL	ENST00000568619.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	t	5.687	0.311391	0.10789	.	.	ENSG00000214581	ENST00000398617	.	.	.	0.245	0.245	0.15512	.	.	.	.	.	T	0.30417	0.0764	.	.	.	.	.	.	.	.	.	.	.	.	T	0.36016	-0.9765	3	.	.	.	.	4.9563	0.14041	0.0:2.0E-4:0.0:0.9998	.	.	.	.	T	87	.	.	N	-	2	0	AC018558.1	34539086	0.598000	0.26882	0.183000	0.23137	0.181000	0.23173	0.138000	0.16016	0.317000	0.23160	0.311000	0.20440	AAC	RP11-80F22.10	-	-	ENSG00000214581		0.383	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	-	0.00	54	0	T			34681585	-1	tier1	-	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	25.81	46	16	SNP	1.000	G
TENM2	57451	genome.wustl.edu	37	5	167297560	167297561	+	Intron	DEL	AT	AT	-	rs371549205		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:167297560_167297561delAT	ENST00000518659.1	+	3	541				TENM2_ENST00000519204.1_Intron|TENM2_ENST00000520393.1_Intron|TENM2_ENST00000520394.1_Intron|TENM2_ENST00000545108.1_Intron|AC093304.1_ENST00000408814.1_RNA	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2						axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										atgtgtatacatatatatatat	0.252																																																	0																																										SO:0001627	intron_variant	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.503-5430AT>-	5.37:g.167297570_167297571delAT			Q9ULU2	RNA	DEL	-	NULL	ENST00000518659.1	37	NULL		5																																																																																			AC093304.1	-	-	ENSG00000221741		0.252	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ENSG00000221741	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000376096.1		0.00	28	0	AT	NM_001122679		167297561	-1	tier1		no_errors	ENST00000408814	ensembl	human	novel	74_37	rna	21.05	30	8	DEL	0.001:0.001	-
ANKRD19P	138649	genome.wustl.edu	37	9	95648272	95648272	+	RNA	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:95648272C>A	ENST00000446878.1	+	0	1551				ANKRD19P_ENST00000473204.1_RNA																							GCCTGAGTCCCAACCCTTTAT	0.532																																																	0																																												0																															9.37:g.95648272C>A				RNA	SNP	-	NULL	ENST00000446878.1	37	NULL		9																																																																																			RP11-526D8.7	-	-	ENSG00000226668		0.532	RP11-526D8.7-006	PUTATIVE	basic	processed_transcript	ENSG00000226668	Clone_based_vega_gene	pseudogene	OTTHUMT00000316907.1	-	0.00	205	0	C			95648272	+1	tier1	-	no_errors	ENST00000446878	ensembl	human	putative	74_37	rna	14.84	154	27	SNP	0.587	A
CTD-2277K2.1	0	genome.wustl.edu	37	14	62331619	62331619	+	lincRNA	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:62331619C>T	ENST00000554436.1	+	0	22																											GCGCGGATGGCGGGATGCTCC	0.592																																																	0																																												0																															14.37:g.62331619C>T				RNA	SNP	-	NULL	ENST00000554436.1	37	NULL		14																																																																																			CTD-2277K2.1	-	-	ENSG00000258882		0.592	CTD-2277K2.1-002	KNOWN	basic	lincRNA	ENSG00000258882	Clone_based_vega_gene	lincRNA	OTTHUMT00000411882.1	-	0.00	46	0	C			62331619	+1	tier1	-	no_errors	ENST00000554436	ensembl	human	known	74_37	rna	28.57	20	8	SNP	0.045	T
RP11-26F2.1	0	genome.wustl.edu	37	15	23128461	23128461	+	RNA	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:23128461G>A	ENST00000560053.1	-	0	305																											CGCTGCATTTGTTCTGGAACC	0.313																																																	0																																												0																															15.37:g.23128461G>A				RNA	SNP	-	NULL	ENST00000560053.1	37	NULL		15																																																																																			RP11-26F2.1	-	-	ENSG00000259480		0.313	RP11-26F2.1-002	KNOWN	basic	processed_transcript	ENSG00000259480	Clone_based_vega_gene	pseudogene	OTTHUMT00000415904.1	-	0.00	85	0	G			23128461	-1	tier1	-	no_errors	ENST00000560053	ensembl	human	known	74_37	rna	23.53	52	16	SNP	1.000	A
RP11-33B1.4	0	genome.wustl.edu	37	4	120330507	120330507	+	lincRNA	SNP	C	C	T	rs375808748		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:120330507C>T	ENST00000567343.1	+	0	20																											GGCCTGTAGACGCTGACAGGA	0.587																																																	0																																												0																															4.37:g.120330507C>T				RNA	SNP	-	NULL	ENST00000567343.1	37	NULL		4																																																																																			RP11-33B1.4	-	-	ENSG00000260091		0.587	RP11-33B1.4-001	KNOWN	basic	lincRNA	ENSG00000260091	Clone_based_vega_gene	lincRNA	OTTHUMT00000431484.1	-	0.00	30	0	C			120330507	+1	tier1	-	no_errors	ENST00000567343	ensembl	human	known	74_37	rna	17.86	23	5	SNP	0.046	T
LINC01105	150622	genome.wustl.edu	37	2	6112468	6112468	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:6112468A>G	ENST00000391666.2	+	1	757	c.412A>G	c.(412-414)Ata>Gta	p.I138V	AC073479.1_ENST00000431188.1_RNA																							ccaaaagtccataggttctaa	0.448																																																	0																																										SO:0001583	missense	0																														ENST00000391666.2:c.412A>G	2.37:g.6112468A>G	ENSP00000475464:p.Ile138Val			Missense_Mutation	SNP	NULL	p.I138V	ENST00000391666.2	37	c.412		2																																																																																			FLJ30594	-	NULL	ENSG00000272268		0.448	FLJ30594-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000272268	Uniprot_gn	protein_coding		-	0.00	30	0	A			6112468	+1	tier1	-	no_errors	ENST00000391666	ensembl	human	known	74_37	missense	43.48	13	10	SNP	0.000	G
ENTHD1	150350	genome.wustl.edu	37	22	40139790	40139790	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr22:40139790A>C	ENST00000325157.6	-	7	1968	c.1718T>G	c.(1717-1719)cTt>cGt	p.L573R		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	573										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					GATGACATTAAGTTCTTGGAT	0.433																																																	0													146.0	123.0	131.0					22																	40139790		2203	4300	6503	SO:0001583	missense	0			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.1718T>G	22.37:g.40139790A>C	ENSP00000317431:p.Leu573Arg		B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.L573R	ENST00000325157.6	37	c.1718	CCDS13998.1	22	.	.	.	.	.	.	.	.	.	.	A	12.61	1.990693	0.35131	.	.	ENSG00000176177	ENST00000325157	T	0.37235	1.21	5.76	5.76	0.90799	.	0.175047	0.31427	N	0.007677	T	0.57489	0.2057	M	0.66939	2.045	0.29782	N	0.833959	D	0.89917	1.0	D	0.87578	0.998	T	0.61272	-0.7096	10	0.87932	D	0	-18.7054	12.4834	0.55856	1.0:0.0:0.0:0.0	.	573	Q8IYW4	ENTD1_HUMAN	R	573	ENSP00000317431:L573R	ENSP00000317431:L573R	L	-	2	0	ENTHD1	38469736	0.994000	0.37717	0.091000	0.20842	0.011000	0.07611	4.491000	0.60326	2.186000	0.69663	0.533000	0.62120	CTT	ENTHD1	-	NULL	ENSG00000176177		0.433	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD1	HGNC	protein_coding	OTTHUMT00000321302.1	-	0.00	55	0	A	NM_152512		40139790	-1	tier1	-	no_errors	ENST00000325157	ensembl	human	known	74_37	missense	15.38	44	8	SNP	0.502	C
EPB41L1	2036	genome.wustl.edu	37	20	34776395	34776395	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:34776395T>G	ENST00000338074.2	+	9	1161	c.1000T>G	c.(1000-1002)Ttc>Gtc	p.F334V	EPB41L1_ENST00000373946.3_Missense_Mutation_p.F303V|EPB41L1_ENST00000373950.2_Missense_Mutation_p.F237V|EPB41L1_ENST00000441639.1_Missense_Mutation_p.F272V|EPB41L1_ENST00000202028.5_Missense_Mutation_p.F272V|EPB41L1_ENST00000373941.1_Missense_Mutation_p.F334V	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	334	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					GAGGAGTAACTTCTATATCAA	0.557																																																	0													73.0	64.0	67.0					20																	34776395		2203	4300	6503	SO:0001583	missense	0			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1000T>G	20.37:g.34776395T>G	ENSP00000337168:p.Phe334Val		O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB_dom,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.F334V	ENST00000338074.2	37	c.1000	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	T	31	5.080152	0.94050	.	.	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	D;D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42	5.45	5.45	0.79879	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	.	.	.	.	D	0.96068	0.8719	H	0.95470	3.675	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.991;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.996;0.982;1.0	D	0.97196	0.9861	9	0.87932	D	0	.	14.3295	0.66545	0.0:0.0:0.0:1.0	.	334;334;303;237;237;272	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	V	272;237;334;237;272;303;334;334	ENSP00000202028:F272V;ENSP00000363061:F237V;ENSP00000399214:F272V;ENSP00000363057:F303V;ENSP00000337168:F334V;ENSP00000363052:F334V	ENSP00000202028:F272V	F	+	1	0	EPB41L1	34239809	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.040000	0.89188	2.073000	0.62155	0.459000	0.35465	TTC	EPB41L1	-	pfam_FERM_PH-like_C,pirsf_Band_41_protein,pfscan_FERM_domain	ENSG00000088367		0.557	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3	-	0.00	36	0	T	NM_012156		34776395	+1	tier1	-	no_errors	ENST00000338074	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	G
EPB41L3	23136	genome.wustl.edu	37	18	5406797	5406797	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr18:5406797G>A	ENST00000341928.2	-	16	2668	c.2328C>T	c.(2326-2328)atC>atT	p.I776I	EPB41L3_ENST00000342933.3_Silent_p.I776I|EPB41L3_ENST00000400111.3_Silent_p.I595I|EPB41L3_ENST00000427684.2_Silent_p.I48I|EPB41L3_ENST00000544123.1_Silent_p.I607I|EPB41L3_ENST00000540638.2_Silent_p.I595I|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000542146.1_Silent_p.I48I	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	776	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CAAGTGGTTCGATCATGGGGG	0.532																																																	0													105.0	88.0	94.0					18																	5406797		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2328C>T	18.37:g.5406797G>A			B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.I776	ENST00000341928.2	37	c.2328	CCDS11838.1	18																																																																																			EPB41L3	-	pirsf_Band_41_protein	ENSG00000082397		0.532	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1		0.00	77	0	G	NM_012307		5406797	-1			no_errors	ENST00000341928	ensembl	human	known	74_37	silent	7.69	71	6	SNP	0.615	A
EPPK1	83481	genome.wustl.edu	37	8	144941802	144941802	+	Missense_Mutation	SNP	G	G	A	rs372213876		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:144941802G>A	ENST00000525985.1	-	2	5691	c.5620C>T	c.(5620-5622)Cgt>Tgt	p.R1874C				P58107	EPIPL_HUMAN	epiplakin 1	1874						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTCCCCACACGAAGTGTGTGC	0.607													g|||	1	0.000199681	0.0	0.0	5008	,	,		18897	0.0		0.001	False		,,,				2504	0.0																0								A	CYS/ARG	0,4166		0,0,2083	90.0	89.0	89.0		5620	1.4	0.0	8		89	1,8415		0,1,4207	no	missense	EPPK1	NM_031308.1	180	0,1,6290	AA,AG,GG		0.0119,0.0,0.0079	benign	1874/2420	144941802	1,12581	2083	4208	6291	SO:0001583	missense	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.5620C>T	8.37:g.144941802G>A	ENSP00000436337:p.Arg1874Cys		Q76E58|Q9NSU9	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.R1874C	ENST00000525985.1	37	c.5620		8	.	.	.	.	.	.	.	.	.	.	g	10.56	1.383718	0.25031	0.0	1.19E-4	ENSG00000227184	ENST00000525985	T	0.69561	-0.41	5.1	1.38	0.22167	.	.	.	.	.	T	0.50103	0.1596	L	0.27053	0.805	0.09310	N	1	B	0.16603	0.018	B	0.06405	0.002	T	0.39702	-0.9601	9	0.52906	T	0.07	.	7.4902	0.27458	0.4336:0.0:0.5664:0.0	.	1874	E9PPU0	.	C	1874	ENSP00000436337:R1874C	ENSP00000436337:R1874C	R	-	1	0	EPPK1	145013790	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.125000	0.10579	0.076000	0.16826	-0.924000	0.02725	CGT	EPPK1	-	NULL	ENSG00000227184		0.607	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	-	0.00	50	0	G	NM_031308		144941802	-1	tier1	-	no_errors	ENST00000525985	ensembl	human	known	74_37	missense	27.03	27	10	SNP	0.000	A
EQTN	54586	genome.wustl.edu	37	9	27284831	27284831	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:27284831C>G	ENST00000380032.3	-	8	858	c.775G>C	c.(775-777)Gat>Cat	p.D259H	EQTN_ENST00000537675.1_Missense_Mutation_p.D230H|LINC00032_ENST00000425633.1_lincRNA	NM_020641.2	NP_065692.2	Q9NQ60	EQTN_HUMAN	equatorin, sperm acrosome associated	259					acrosomal vesicle exocytosis (GO:0060478)|endocytosis (GO:0006897)|fusion of sperm to egg plasma membrane (GO:0007342)	early endosome (GO:0005769)|inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|outer acrosomal membrane (GO:0002081)|plasma membrane (GO:0005886)											CTTCTCATATCTGAAGAAGTG	0.418																																																	0													151.0	135.0	140.0					9																	27284831		2203	4300	6503	SO:0001583	missense	0			AJ278482	CCDS35001.1, CCDS55300.1	9p21	2012-09-20	2012-09-20	2012-09-20	ENSG00000120160	ENSG00000120160			1359	protein-coding gene	gene with protein product	"""Acr formation associated factor"", ""Acrosome formation associated factor"", ""sperm acrosome associated 8"""		"""chromosome 9 open reading frame 11"", ""equatorin"""	C9orf11			Standard	NM_020641		Approved	AFAF, SPACA8, equatorin	uc003zql.3	Q9NQ60	OTTHUMG00000021033	ENST00000380032.3:c.775G>C	9.37:g.27284831C>G	ENSP00000369371:p.Asp259His		B2RPB3|B7ZMK1|Q5TCU1|Q96L22	Missense_Mutation	SNP	NULL	p.D259H	ENST00000380032.3	37	c.775	CCDS35001.1	9	.	.	.	.	.	.	.	.	.	.	.	17.68	3.450149	0.63290	.	.	ENSG00000120160	ENST00000537675;ENST00000380032	T;T	0.36699	1.24;1.65	5.32	5.32	0.75619	.	0.354181	0.24678	N	0.036490	T	0.44498	0.1296	N	0.22421	0.69	0.26626	N	0.972551	D;D	0.76494	0.999;0.995	D;P	0.65443	0.935;0.855	T	0.35450	-0.9788	10	0.72032	D	0.01	.	14.357	0.66745	0.0:1.0:0.0:0.0	.	230;259	B7ZMK1;Q9NQ60	.;AFAF_HUMAN	H	230;259	ENSP00000441630:D230H;ENSP00000369371:D259H	ENSP00000369371:D259H	D	-	1	0	C9orf11	27274831	0.994000	0.37717	0.951000	0.38953	0.009000	0.06853	3.210000	0.51129	2.760000	0.94817	0.591000	0.81541	GAT	EQTN	-	NULL	ENSG00000120160		0.418	EQTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EQTN	HGNC	protein_coding	OTTHUMT00000055499.1	-	0.00	95	0	C	NM_020641		27284831	-1	tier1	-	no_errors	ENST00000380032	ensembl	human	known	74_37	missense	42.11	55	40	SNP	0.736	G
ETV3L	440695	genome.wustl.edu	37	1	157067666	157067666	+	Missense_Mutation	SNP	C	C	T	rs202076672		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:157067666C>T	ENST00000454449.2	-	4	885	c.601G>A	c.(601-603)Gtc>Atc	p.V201I		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	201					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.V201I(3)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				TCACGGTAGACGCTGCTGCTG	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17793	0.0		0.0	False		,,,				2504	0.0																3	Substitution - Missense(3)	prostate(2)|endometrium(1)						C	ILE/VAL	0,4406		0,0,2203	104.0	106.0	105.0		601	-4.1	0.0	1		105	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ETV3L	NM_001004341.2	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	201/362	157067666	2,13004	2203	4300	6503	SO:0001583	missense	0			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.601G>A	1.37:g.157067666C>T	ENSP00000430271:p.Val201Ile			Missense_Mutation	SNP	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.V201I	ENST00000454449.2	37	c.601	CCDS30893.1	1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.576990	0.00887	0.0	2.33E-4	ENSG00000253831	ENST00000454449	T	0.08896	3.04	3.16	-4.05	0.03998	.	.	.	.	.	T	0.00875	0.0029	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48269	-0.9050	9	0.09590	T	0.72	.	5.5942	0.17317	0.0:0.5051:0.1466:0.3483	.	201	Q6ZN32	ETV3L_HUMAN	I	201	ENSP00000430271:V201I	ENSP00000430271:V201I	V	-	1	0	ETV3L	155334290	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-1.754000	0.01816	-0.971000	0.03564	-1.528000	0.00924	GTC	ETV3L	-	NULL	ENSG00000253831		0.632	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	HGNC	protein_coding	OTTHUMT00000099024.2		0.00	24	0	C	NM_001004341		157067666	-1			no_errors	ENST00000454449	ensembl	human	known	74_37	missense	22.22	21	6	SNP	0.000	T
EYS	346007	genome.wustl.edu	37	6	65622444	65622444	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:65622444G>T	ENST00000370621.3	-	16	3100	c.2574C>A	c.(2572-2574)aaC>aaA	p.N858K	EYS_ENST00000370616.2_Missense_Mutation_p.N858K|EYS_ENST00000503581.1_Missense_Mutation_p.N858K			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	858	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTCTGCAAGGGTTATGAAGTA	0.383																																																	0													170.0	143.0	151.0					6																	65622444		692	1591	2283	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2574C>A	6.37:g.65622444G>T	ENSP00000359655:p.Asn858Lys		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.N858K	ENST00000370621.3	37	c.2574		6	.	.	.	.	.	.	.	.	.	.	G	13.00	2.105756	0.37145	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.87412	-2.25;-2.25;-2.25	5.0	-5.58	0.02512	.	1.428560	0.05133	N	0.492965	T	0.66963	0.2843	L	0.52759	1.655	0.54753	D	0.999987	B	0.16802	0.019	B	0.14578	0.011	T	0.53816	-0.8385	10	0.48119	T	0.1	.	3.5196	0.07737	0.5142:0.2303:0.1604:0.0951	.	858	Q5T1H1-1	.	K	858	ENSP00000424243:N858K;ENSP00000359655:N858K;ENSP00000359650:N858K	ENSP00000359650:N858K	N	-	3	2	EYS	65679165	0.994000	0.37717	0.000000	0.03702	0.452000	0.32318	0.296000	0.19083	-1.234000	0.02548	0.561000	0.74099	AAC	EYS	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000188107		0.383	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	75	0	G	XM_294050		65622444	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	14.04	49	8	SNP	0.527	T
F11	2160	genome.wustl.edu	37	4	187197501	187197501	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:187197501T>C	ENST00000403665.2	+	7	1064	c.712T>C	c.(712-714)Ttt>Ctt	p.F238L	F11_ENST00000264692.4_Missense_Mutation_p.F186L	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	238	Apple 3. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	CGGTTGCTTGTTTTTTACCTT	0.413																																																	0													161.0	145.0	151.0					4																	187197501		2203	4300	6503	SO:0001583	missense	0			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.712T>C	4.37:g.187197501T>C	ENSP00000384957:p.Phe238Leu		D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,smart_Apple,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Peptidase_S1,prints_Apple,prints_Peptidase_S1A	p.F238L	ENST00000403665.2	37	c.712	CCDS3847.1	4	.	.	.	.	.	.	.	.	.	.	T	27.1	4.796155	0.90453	.	.	ENSG00000088926	ENST00000403665;ENST00000264692	D;D	0.88664	-2.41;-2.41	5.81	5.81	0.92471	Apple domain (3);PAN-1 domain (1);Apple-like (1);	0.000000	0.85682	D	0.000000	D	0.91710	0.7379	L	0.37850	1.14	0.50171	D	0.999852	D	0.89917	1.0	D	0.87578	0.998	D	0.92308	0.5855	10	0.56958	D	0.05	.	16.167	0.81768	0.0:0.0:0.0:1.0	.	238	P03951	FA11_HUMAN	L	238;186	ENSP00000384957:F238L;ENSP00000264692:F186L	ENSP00000264692:F186L	F	+	1	0	F11	187434495	1.000000	0.71417	0.869000	0.34112	0.765000	0.43378	5.159000	0.64923	2.210000	0.71456	0.533000	0.62120	TTT	F11	-	pfam_PAN-1_domain,smart_Apple,pfscan_Pan_app,prints_Apple	ENSG00000088926		0.413	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11	HGNC	protein_coding	OTTHUMT00000317519.4	-	0.00	90	0	T			187197501	+1	tier1	-	no_errors	ENST00000403665	ensembl	human	known	74_37	missense	15.00	51	9	SNP	0.998	C
FAM154B	283726	genome.wustl.edu	37	15	82575073	82575073	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:82575073T>G	ENST00000339465.5	+	3	936	c.867T>G	c.(865-867)ttT>ttG	p.F289L	FAM154B_ENST00000565501.1_3'UTR|FAM154B_ENST00000427381.2_Missense_Mutation_p.F274L	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	289										autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						AAGAAGATTTTCCAGCATGGG	0.403																																																	0													63.0	63.0	63.0					15																	82575073		2203	4300	6503	SO:0001583	missense	0			AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.867T>G	15.37:g.82575073T>G	ENSP00000340445:p.Phe289Leu		B4E2M2	Missense_Mutation	SNP	NULL	p.F289L	ENST00000339465.5	37	c.867	CCDS32310.1	15	.	.	.	.	.	.	.	.	.	.	T	19.06	3.753418	0.69648	.	.	ENSG00000188659	ENST00000339465;ENST00000427381	T;T	0.30714	1.52;1.52	4.46	-3.88	0.04205	.	0.000000	0.64402	D	0.000001	T	0.48114	0.1482	M	0.82517	2.595	0.36376	D	0.861595	D;D	0.58970	0.984;0.984	P;P	0.60012	0.867;0.867	T	0.60530	-0.7245	10	0.72032	D	0.01	-17.6924	12.6166	0.56580	0.0:0.5111:0.0:0.4889	.	274;289	B4E2M2;Q658L1	.;F154B_HUMAN	L	289;274	ENSP00000340445:F289L;ENSP00000403743:F274L	ENSP00000340445:F289L	F	+	3	2	FAM154B	80362128	0.941000	0.31946	0.958000	0.39756	0.636000	0.38137	-0.097000	0.11042	-0.720000	0.04935	0.332000	0.21555	TTT	FAM154B	-	NULL	ENSG00000188659		0.403	FAM154B-001	KNOWN	basic|CCDS	protein_coding	FAM154B	HGNC	protein_coding	OTTHUMT00000419644.1	-	0.00	33	0	T	NM_001008226		82575073	+1	tier1	-	no_errors	ENST00000339465	ensembl	human	known	74_37	missense	16.28	36	7	SNP	0.913	G
FAM160A2	84067	genome.wustl.edu	37	11	6239171	6239171	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:6239171C>T	ENST00000449352.2	-	9	1908	c.1645G>A	c.(1645-1647)Gac>Aac	p.D549N	FAM160A2_ENST00000265978.4_Missense_Mutation_p.D563N|FAM160A2_ENST00000524416.1_Missense_Mutation_p.D549N|FAM160A2_ENST00000529360.1_5'Flank			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	549					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AGGTAATTGTCTTCCAGCTCT	0.662																																																	0													63.0	60.0	61.0					11																	6239171		2201	4296	6497	SO:0001583	missense	0				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1645G>A	11.37:g.6239171C>T	ENSP00000416918:p.Asp549Asn		Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.D563N	ENST00000449352.2	37	c.1687	CCDS44530.1	11	.	.	.	.	.	.	.	.	.	.	C	9.283	1.048652	0.19827	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.14516	3.11;3.12;2.5	4.97	4.97	0.65823	.	0.392001	0.29730	N	0.011360	T	0.11495	0.0280	L	0.36672	1.1	0.24841	N	0.992468	P;B;P	0.42649	0.786;0.364;0.628	B;B;B	0.40009	0.316;0.077;0.236	T	0.20273	-1.0280	10	0.25106	T	0.35	-23.8525	11.3342	0.49494	0.0:0.9124:0.0:0.0876	.	549;549;563	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	N	549;474;563;549	ENSP00000416918:D549N;ENSP00000265978:D563N;ENSP00000431773:D549N	ENSP00000265978:D563N	D	-	1	0	FAM160A2	6195747	0.953000	0.32496	1.000000	0.80357	0.998000	0.95712	0.329000	0.19698	2.590000	0.87494	0.561000	0.74099	GAC	FAM160A2	-	NULL	ENSG00000051009		0.662	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	HGNC	protein_coding	OTTHUMT00000383759.1	-	0.00	78	0	C	NM_032127		6239171	-1	tier1	-	no_errors	ENST00000265978	ensembl	human	known	74_37	missense	15.38	77	14	SNP	1.000	T
FAM171B	165215	genome.wustl.edu	37	2	187627401	187627401	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:187627401G>T	ENST00000304698.5	+	8	2535	c.2332G>T	c.(2332-2334)Gag>Tag	p.E778*		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	778						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.E778K(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						CCCTGGAGAAGAGTCGCCAGG	0.512																																																	1	Substitution - Missense(1)	skin(1)											60.0	60.0	60.0					2																	187627401		2203	4299	6502	SO:0001587	stop_gained	0			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2332G>T	2.37:g.187627401G>T	ENSP00000304108:p.Glu778*		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Nonsense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.E778*	ENST00000304698.5	37	c.2332	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	G	38	6.749551	0.97809	.	.	ENSG00000144369	ENST00000304698	.	.	.	6.02	6.02	0.97574	.	0.109041	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-23.0115	15.2844	0.73816	0.0:0.0:0.8599:0.14	.	.	.	.	X	778	.	ENSP00000304108:E778X	E	+	1	0	FAM171B	187335646	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	4.909000	0.63314	2.850000	0.98022	0.650000	0.86243	GAG	FAM171B	-	pfam_Uncharacterised_FAM171	ENSG00000144369		0.512	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	HGNC	protein_coding	OTTHUMT00000334679.1		0.00	34	0	G	NM_177454		187627401	+1			no_errors	ENST00000304698	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	T
FAM182A	284800	genome.wustl.edu	37	20	26061957	26061957	+	RNA	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:26061957G>A	ENST00000376398.2	+	0	977					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GGGTCTCTGCGCCTCAGTCGG	0.577																																																	0													19.0	16.0	17.0					20																	26061957		690	1572	2262			0			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061957G>A			A2RRD0|Q8N947	RNA	SNP	-	NULL	ENST00000376398.2	37	NULL		20																																																																																			FAM182A	-	-	ENSG00000125804		0.577	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	HGNC	processed_transcript	OTTHUMT00000078473.2	-	0.00	60	0	G			26061957	+1	tier1	-	no_errors	ENST00000376398	ensembl	human	known	74_37	rna	18.52	44	10	SNP	0.104	A
FANCD2	2177	genome.wustl.edu	37	3	10107133	10107133	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:10107133G>T	ENST00000419585.1	+	24	2385	c.2224G>T	c.(2224-2226)Gag>Tag	p.E742*	FANCD2_ENST00000383806.1_Nonsense_Mutation_p.E742*|FANCD2_ENST00000383807.1_Nonsense_Mutation_p.E742*|FANCD2_ENST00000287647.3_Nonsense_Mutation_p.E742*			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	742					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		ACTTTGTGTGGAGAGACAGCA	0.428			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													179.0	177.0	178.0					3																	10107133		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2224G>T	3.37:g.10107133G>T	ENSP00000398754:p.Glu742*		Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E742*	ENST00000419585.1	37	c.2224	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	G	41	8.670855	0.98908	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	.	.	.	5.29	3.33	0.38152	.	0.329659	0.34362	N	0.004029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	13.0869	0.59146	0.0:0.3079:0.6921:0.0	.	.	.	.	X	742	.	ENSP00000287647:E742X	E	+	1	0	FANCD2	10082133	1.000000	0.71417	0.988000	0.46212	0.921000	0.55340	2.237000	0.43061	1.212000	0.43366	0.585000	0.79938	GAG	FANCD2	-	NULL	ENSG00000144554		0.428	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	-	0.00	66	0	G			10107133	+1	tier1	-	no_errors	ENST00000287647	ensembl	human	known	74_37	nonsense	7.75	119	10	SNP	0.996	T
FAR2	55711	genome.wustl.edu	37	12	29474775	29474775	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:29474775A>G	ENST00000536681.3	+	10	1421	c.1175A>G	c.(1174-1176)gAg>gGg	p.E392G	FAR2_ENST00000182377.4_Missense_Mutation_p.E392G|FAR2_ENST00000547116.1_Missense_Mutation_p.E295G	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	392					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						TCCATGTTGGAGTATTTCATC	0.443																																																	0													170.0	153.0	159.0					12																	29474775		2203	4300	6503	SO:0001583	missense	0			AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.1175A>G	12.37:g.29474775A>G	ENSP00000443291:p.Glu392Gly		F8VV73|Q9H0D5|Q9NVW8	Missense_Mutation	SNP	pfam_Male_sterile_NAD-bd,pfam_FAR,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_Polysac_CapD-like	p.E392G	ENST00000536681.3	37	c.1175	CCDS8717.1	12	.	.	.	.	.	.	.	.	.	.	A	16.78	3.216702	0.58452	.	.	ENSG00000064763	ENST00000536681;ENST00000182377;ENST00000547116	T;T;T	0.33654	1.82;1.82;1.4	4.49	4.49	0.54785	.	0.183723	0.45867	D	0.000323	T	0.50137	0.1598	M	0.70108	2.13	0.58432	D	0.999991	D	0.57571	0.98	P	0.57009	0.811	T	0.51795	-0.8660	10	0.49607	T	0.09	-9.8745	10.1268	0.42654	1.0:0.0:0.0:0.0	.	392	Q96K12	FACR2_HUMAN	G	392;392;295	ENSP00000443291:E392G;ENSP00000182377:E392G;ENSP00000449349:E295G	ENSP00000182377:E392G	E	+	2	0	FAR2	29366042	1.000000	0.71417	0.998000	0.56505	0.161000	0.22273	8.045000	0.89436	1.878000	0.54408	0.379000	0.24179	GAG	FAR2	-	pfam_FAR	ENSG00000064763		0.443	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAR2	HGNC	protein_coding	OTTHUMT00000403479.2	-	0.00	63	0	A	NM_018099		29474775	+1	tier1	-	no_errors	ENST00000182377	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	G
FAT3	120114	genome.wustl.edu	37	11	92532369	92532369	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:92532369C>T	ENST00000298047.6	+	9	6207	c.6190C>T	c.(6190-6192)Cgt>Tgt	p.R2064C	FAT3_ENST00000525166.1_Missense_Mutation_p.R1914C|FAT3_ENST00000409404.2_Missense_Mutation_p.R2064C			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2064	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R2064C(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGACCATCTGCGTGTGGCCAG	0.507										TCGA Ovarian(4;0.039)																																							2	Substitution - Missense(2)	endometrium(2)											65.0	70.0	68.0					11																	92532369		1991	4177	6168	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6190C>T	11.37:g.92532369C>T	ENSP00000298047:p.Arg2064Cys		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R2064C	ENST00000298047.6	37	c.6190		11	.	.	.	.	.	.	.	.	.	.	C	17.22	3.335022	0.60853	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.01767	4.65;4.65;4.65	5.9	5.9	0.94986	.	.	.	.	.	T	0.17195	0.0413	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.01149	-1.1436	9	0.66056	D	0.02	.	20.2822	0.98520	0.0:1.0:0.0:0.0	.	2064	Q8TDW7-3	.	C	2064;2064;1914	ENSP00000298047:R2064C;ENSP00000387040:R2064C;ENSP00000432586:R1914C	ENSP00000298047:R2064C	R	+	1	0	FAT3	92172017	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.788000	0.55446	2.806000	0.96561	0.655000	0.94253	CGT	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.507	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	45	0	C	NM_001008781		92532369	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	15.38	33	6	SNP	1.000	T
FBN1	2200	genome.wustl.edu	37	15	48707779	48707779	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:48707779C>T	ENST00000316623.5	-	64	8460	c.8005G>A	c.(8005-8007)Ggt>Agt	p.G2669S	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2669	EGF-like 47; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CACAGGTAACCGCCCTCGGTA	0.517																																																	0													86.0	75.0	79.0					15																	48707779		2198	4296	6494	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8005G>A	15.37:g.48707779C>T	ENSP00000325527:p.Gly2669Ser		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.G2669S	ENST00000316623.5	37	c.8005	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.358537	0.95854	.	.	ENSG00000166147	ENST00000316623	D	0.89196	-2.48	5.81	5.81	0.92471	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.047666	0.85682	D	0.000000	D	0.86393	0.5922	N	0.12961	0.28	0.80722	D	1	D	0.53745	0.962	P	0.51895	0.683	D	0.86271	0.1661	10	0.36615	T	0.2	.	18.8343	0.92155	0.0:1.0:0.0:0.0	.	2669	P35555	FBN1_HUMAN	S	2669	ENSP00000325527:G2669S	ENSP00000325527:G2669S	G	-	1	0	FBN1	46495071	1.000000	0.71417	0.973000	0.42090	0.763000	0.43281	7.818000	0.86416	2.745000	0.94114	0.655000	0.94253	GGT	FBN1	-	pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN	ENSG00000166147		0.517	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	41	0	C			48707779	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	12.24	43	6	SNP	1.000	T
FGGY	55277	genome.wustl.edu	37	1	60139734	60139734	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:60139734G>T	ENST00000303721.7	+	14	1615	c.1441G>T	c.(1441-1443)Gag>Tag	p.E481*	FGGY_ENST00000371212.1_Nonsense_Mutation_p.E393*|FGGY_ENST00000371218.4_Nonsense_Mutation_p.E505*|FGGY_ENST00000371210.1_Nonsense_Mutation_p.E182*	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	481					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					CCTGTCGCAAGAGGTGGAGTC	0.612																																																	0													219.0	140.0	167.0					1																	60139734		2203	4300	6503	SO:0001587	stop_gained	0				CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.1441G>T	1.37:g.60139734G>T	ENSP00000305922:p.Glu481*		B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Nonsense_Mutation	SNP	pfam_Carb_kinase_FGGY_C,pfam_Carb_kinase_FGGY_N,tigrfam_Carb_kinase_FGGY-rel	p.E481*	ENST00000303721.7	37	c.1441	CCDS611.2	1	.	.	.	.	.	.	.	.	.	.	G	37	6.552370	0.97658	.	.	ENSG00000172456	ENST00000371218;ENST00000303721;ENST00000371212;ENST00000371210	.	.	.	5.55	4.64	0.57946	.	0.238654	0.43260	D	0.000594	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-25.9304	14.4355	0.67277	0.07:0.0:0.93:0.0	.	.	.	.	X	505;481;393;182	.	.	E	+	1	0	FGGY	59912322	1.000000	0.71417	0.995000	0.50966	0.934000	0.57294	6.422000	0.73357	1.590000	0.49995	-0.225000	0.12378	GAG	FGGY	-	pfam_Carb_kinase_FGGY_C,tigrfam_Carb_kinase_FGGY-rel	ENSG00000172456		0.612	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGGY	HGNC	protein_coding	OTTHUMT00000023210.2	-	0.00	98	0	G	NM_001113411		60139734	+1	tier1	-	no_errors	ENST00000303721	ensembl	human	known	74_37	nonsense	17.14	87	18	SNP	1.000	T
FICD	11153	genome.wustl.edu	37	12	108912645	108912645	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:108912645G>C	ENST00000552695.1	+	3	1005	c.770G>C	c.(769-771)aGc>aCc	p.S257T	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	257					negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)			NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						CCCGGGAAGAGCCTGGAGGAG	0.587																																																	0													89.0	66.0	73.0					12																	108912645		2203	4300	6503	SO:0001583	missense	0			AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.770G>C	12.37:g.108912645G>C	ENSP00000446479:p.Ser257Thr		O75406	Missense_Mutation	SNP	pfam_Fido,superfamily_Fido,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S257T	ENST00000552695.1	37	c.770	CCDS9116.1	12	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524434	0.85600	.	.	ENSG00000198855	ENST00000552695	.	.	.	6.07	6.07	0.98685	Filamentation induced by cAMP/death on curing-related (1);	0.000000	0.85682	D	0.000000	T	0.75708	0.3886	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71938	-0.4441	9	0.42905	T	0.14	-0.2088	20.6439	0.99570	0.0:0.0:1.0:0.0	.	257	Q9BVA6	FICD_HUMAN	T	257	.	ENSP00000446479:S257T	S	+	2	0	FICD	107436775	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	AGC	FICD	-	NULL	ENSG00000198855		0.587	FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FICD	HGNC	protein_coding	OTTHUMT00000404842.1		0.00	16	0	G	NM_007076		108912645	+1			no_errors	ENST00000552695	ensembl	human	known	74_37	missense	25.00	12	4	SNP	1.000	C
FLNA	2316	genome.wustl.edu	37	X	153588526	153588526	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chrX:153588526C>T	ENST00000369850.3	-	22	3873	c.3637G>A	c.(3637-3639)Ggt>Agt	p.G1213S	FLNA_ENST00000369856.3_5'Flank|FLNA_ENST00000360319.4_Missense_Mutation_p.G1213S|FLNA_ENST00000422373.1_Missense_Mutation_p.G1213S|FLNA_ENST00000344736.4_Missense_Mutation_p.G1213S	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1213					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTGCCATCACCGTGGTCCTGG	0.642																																																	0													43.0	51.0	48.0					X																	153588526		2106	4195	6301	SO:0001583	missense	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3637G>A	X.37:g.153588526C>T	ENSP00000358866:p.Gly1213Ser		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.G1213S	ENST00000369850.3	37	c.3637	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906078	0.33628	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.92752	-3.1;-3.1;-3.1;-1.89	4.79	4.79	0.61399	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.90181	0.6931	L	0.47190	1.495	0.80722	D	1	D;B	0.54772	0.968;0.094	P;B	0.48270	0.572;0.053	D	0.89307	0.3630	10	0.41790	T	0.15	.	11.0924	0.48123	0.0:0.8989:0.0:0.1011	.	1213;1213	P21333-2;P21333	.;FLNA_HUMAN	S	1213;1186;1213;1213;1213	ENSP00000353467:G1213S;ENSP00000416926:G1213S;ENSP00000358866:G1213S;ENSP00000358863:G1213S	ENSP00000358863:G1213S	G	-	1	0	FLNA	153241720	0.001000	0.12720	0.992000	0.48379	0.315000	0.28087	1.157000	0.31724	1.978000	0.57642	0.431000	0.28591	GGT	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.642	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	-	0.00	33	0	C			153588526	-1	tier1	-	no_errors	ENST00000369850	ensembl	human	known	74_37	missense	34.48	19	10	SNP	1.000	T
FRMD4A	55691	genome.wustl.edu	37	10	13699153	13699153	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:13699153G>A	ENST00000357447.2	-	22	2804	c.2436C>T	c.(2434-2436)ggC>ggT	p.G812G	FRMD4A_ENST00000378503.1_Silent_p.G812G|FRMD4A_ENST00000358621.4_Silent_p.G797G	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	812					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						cgccccccgcgccccccgcac	0.761																																																	0													2.0	2.0	2.0					10																	13699153		1468	2791	4259	SO:0001819	synonymous_variant	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.2436C>T	10.37:g.13699153G>A			A7E2Y3|Q5T377	Silent	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.G812	ENST00000357447.2	37	c.2436	CCDS7101.1	10																																																																																			FRMD4A	-	NULL	ENSG00000151474		0.761	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	-	0.00	24	0	G	NM_018027		13699153	-1	tier1	-	no_errors	ENST00000357447	ensembl	human	known	74_37	silent	23.53	12	4	SNP	0.078	A
FOXI2	399823	genome.wustl.edu	37	10	129535908	129535908	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:129535908C>T	ENST00000388920.4	+	1	410	c.371C>T	c.(370-372)aCg>aTg	p.T124M		NM_207426.2	NP_997309.2	Q6ZQN5	FOXI2_HUMAN	forkhead box I2	124					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(3)	4		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)				CGGAAGCTGACGCTCAGCCAG	0.642																																					Esophageal Squamous(54;1038 1280 2528 31583)												0													24.0	31.0	29.0					10																	129535908		692	1591	2283	SO:0001583	missense	0			AK128865	CCDS7655.2	10q26.2	2008-04-10			ENSG00000186766	ENSG00000186766		"""Forkhead boxes"""	32448	protein-coding gene	gene with protein product							Standard	NM_207426		Approved	FLJ46831	uc009yas.2	Q6ZQN5	OTTHUMG00000019250	ENST00000388920.4:c.371C>T	10.37:g.129535908C>T	ENSP00000373572:p.Thr124Met			Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.T124M	ENST00000388920.4	37	c.371	CCDS7655.2	10	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697145	0.68386	.	.	ENSG00000186766	ENST00000388920	D	0.96300	-3.97	4.52	3.58	0.41010	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	U	0.000000	D	0.98632	0.9542	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98826	1.0749	10	0.87932	D	0	.	12.2901	0.54812	0.1711:0.8289:0.0:0.0	.	124	Q6ZQN5	FOXI2_HUMAN	M	124	ENSP00000373572:T124M	ENSP00000373572:T124M	T	+	2	0	FOXI2	129425898	1.000000	0.71417	0.992000	0.48379	0.498000	0.33706	7.385000	0.79763	0.836000	0.34901	0.462000	0.41574	ACG	FOXI2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000186766		0.642	FOXI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXI2	HGNC	protein_coding	OTTHUMT00000050984.2	-	0.00	40	0	C	NM_207426		129535908	+1	tier1	-	no_errors	ENST00000388920	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
GABRB1	2560	genome.wustl.edu	37	4	47163405	47163405	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:47163405A>C	ENST00000295454.3	+	4	672	c.380A>C	c.(379-381)aAg>aCg	p.K127T	GABRB1_ENST00000538619.1_Missense_Mutation_p.K57T	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	127					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTGAATGACAAGAAATCATTT	0.443																																																	0													164.0	157.0	159.0					4																	47163405		2203	4300	6503	SO:0001583	missense	0				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.380A>C	4.37:g.47163405A>C	ENSP00000295454:p.Lys127Thr		B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.K127T	ENST00000295454.3	37	c.380	CCDS3474.1	4	.	.	.	.	.	.	.	.	.	.	A	25.1	4.598703	0.87055	.	.	ENSG00000163288	ENST00000513567;ENST00000295454;ENST00000538619	T;T;T	0.80994	-1.44;-1.44;-1.44	5.01	5.01	0.66863	Neurotransmitter-gated ion-channel ligand-binding (3);	0.073210	0.53938	D	0.000054	D	0.92123	0.7503	H	0.94620	3.56	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.85130	0.967;0.997	D	0.94105	0.7365	10	0.87932	D	0	-16.9901	14.0523	0.64745	1.0:0.0:0.0:0.0	.	57;127	F5GXV5;P18505	.;GBRB1_HUMAN	T	94;127;57	ENSP00000426753:K94T;ENSP00000295454:K127T;ENSP00000440330:K57T	ENSP00000295454:K127T	K	+	2	0	GABRB1	46858162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.139000	0.94554	2.109000	0.64355	0.528000	0.53228	AAG	GABRB1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000163288		0.443	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	HGNC	protein_coding	OTTHUMT00000216896.1	-	0.00	64	0	A			47163405	+1	tier1	-	no_errors	ENST00000295454	ensembl	human	known	74_37	missense	20.24	67	17	SNP	1.000	C
FSTL5	56884	genome.wustl.edu	37	4	162402181	162402181	+	Missense_Mutation	SNP	T	T	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:162402181T>A	ENST00000306100.5	-	13	2035	c.1599A>T	c.(1597-1599)aaA>aaT	p.K533N	FSTL5_ENST00000427802.2_Missense_Mutation_p.K523N|FSTL5_ENST00000379164.4_Missense_Mutation_p.K532N|FSTL5_ENST00000536695.1_Missense_Mutation_p.K532N	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	533						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.K533N(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CCTGAACAACTTTTTGGGACT	0.333																																																	1	Substitution - Missense(1)	ovary(1)																																								SO:0001583	missense	0			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1599A>T	4.37:g.162402181T>A	ENSP00000305334:p.Lys533Asn		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Kazal_dom,pfam_Ig_V-set,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.K533N	ENST00000306100.5	37	c.1599	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	T	18.98	3.738184	0.69304	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.8	1.96	0.26148	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.47414	0.1444	M	0.76574	2.34	0.58432	D	0.999994	D;D;D	0.69078	0.997;0.997;0.994	P;P;P	0.62382	0.879;0.901;0.829	T	0.35500	-0.9786	10	0.49607	T	0.09	.	9.1795	0.37131	0.0:0.208:0.0:0.792	.	523;532;533	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	N	533;532;523;532	ENSP00000305334:K533N;ENSP00000368462:K532N;ENSP00000389270:K523N;ENSP00000440409:K532N	ENSP00000305334:K533N	K	-	3	2	FSTL5	162621631	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.907000	0.28531	0.111000	0.17947	0.528000	0.53228	AAA	FSTL5	-	NULL	ENSG00000168843		0.333	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	HGNC	protein_coding	OTTHUMT00000364773.2		0.00	36	0	T	NM_020116		162402181	-1			no_errors	ENST00000306100	ensembl	human	known	74_37	missense	9.26	49	5	SNP	1.000	A
GALNT13	114805	genome.wustl.edu	37	2	155295209	155295209	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:155295209G>A	ENST00000392825.3	+	12	2068	c.1501G>A	c.(1501-1503)Gga>Aga	p.G501R	AC009227.2_ENST00000434635.1_RNA|GALNT13_ENST00000409237.1_Missense_Mutation_p.G501R	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	501	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CCATATGAGAGGAAATCAGTT	0.333																																																	0													129.0	132.0	131.0					2																	155295209		2203	4300	6503	SO:0001583	missense	0			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1501G>A	2.37:g.155295209G>A	ENSP00000376570:p.Gly501Arg		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.G501R	ENST00000392825.3	37	c.1501	CCDS2199.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.158550|5.158550	0.94686|0.94686	.|.	.|.	ENSG00000144278|ENSG00000144278	ENST00000392825;ENST00000409237;ENST00000453715|ENST00000450838;ENST00000422126	T;T;T|T	0.77877|0.25579	-1.13;-1.13;1.66|1.79	5.55|5.55	5.55|5.55	0.83447|0.83447	Ricin B-related lectin (1);Ricin B lectin (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.44664|0.44664	0.1304|0.1304	M|M	0.94021|0.94021	3.485|3.485	0.80722|0.80722	D|D	1|1	D;D|B	0.71674|0.21606	0.985;0.998|0.058	P;D|B	0.65874|0.20184	0.886;0.939|0.028	T|T	0.53049|0.53049	-0.8493|-0.8493	10|9	0.72032|0.87932	D|D	0.01|0	.|.	16.9935|16.9935	0.86360|0.86360	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	501;501|480	Q08ER7;Q8IUC8|Q8IUC8-2	.;GLT13_HUMAN|.	R|K	501;501;36|86;39	ENSP00000376570:G501R;ENSP00000387239:G501R;ENSP00000396612:G36R|ENSP00000406237:R86K	ENSP00000376570:G501R|ENSP00000391469:R39K	G|R	+|+	1|2	0|0	GALNT13|GALNT13	155003455|155003455	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.676000|9.676000	0.98643|0.98643	2.611000|2.611000	0.88343|0.88343	0.655000|0.655000	0.94253|0.94253	GGA|AGG	GALNT13	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000144278		0.333	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT13	HGNC	protein_coding	OTTHUMT00000254870.2	-	0.00	119	0	G	NM_052917		155295209	+1	tier1	-	no_errors	ENST00000409237	ensembl	human	known	74_37	missense	11.51	123	16	SNP	1.000	A
GINM1	116254	genome.wustl.edu	37	6	149899972	149899972	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:149899972C>A	ENST00000367419.5	+	4	413	c.292C>A	c.(292-294)Ctt>Att	p.L98I	RP1-12G14.6_ENST00000435273.2_RNA	NM_138785.3	NP_620140.1	Q9NU53	GINM1_HUMAN	glycoprotein integral membrane 1	98						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.L98V(1)									GAATGAAAATCTTGAAAATTT	0.318																																																	1	Substitution - Missense(1)	lung(1)											51.0	52.0	52.0					6																	149899972		2203	4299	6502	SO:0001583	missense	0			BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211			21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72			Standard	NM_138785		Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.292C>A	6.37:g.149899972C>A	ENSP00000356389:p.Leu98Ile		B2RDY7|E1P5A2	Missense_Mutation	SNP	NULL	p.L98I	ENST00000367419.5	37	c.292	CCDS5216.1	6	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043315	0.55003	.	.	ENSG00000055211	ENST00000367419	.	.	.	5.61	3.52	0.40303	.	0.376501	0.25135	N	0.032871	T	0.40956	0.1138	M	0.67953	2.075	0.33529	D	0.593321	D	0.59767	0.986	P	0.56278	0.795	T	0.47787	-0.9090	8	.	.	.	-7.6826	4.3711	0.11247	0.2171:0.6036:0.0:0.1793	.	98	Q9NU53	CF072_HUMAN	I	98	.	.	L	+	1	0	C6orf72	149941665	0.988000	0.35896	1.000000	0.80357	0.994000	0.84299	0.602000	0.24134	1.330000	0.45394	0.561000	0.74099	CTT	GINM1	-	NULL	ENSG00000055211		0.318	GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINM1	HGNC	protein_coding	OTTHUMT00000042644.1		0.00	34	0	C	NM_138785		149899972	+1			no_errors	ENST00000367419	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.993	A
GNAS	2778	genome.wustl.edu	37	20	57415196	57415196	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:57415196G>A	ENST00000313949.7	+	1	424	c.35G>A	c.(34-36)cGa>cAa	p.R12Q	GNAS-AS1_ENST00000443966.1_RNA|GNAS_ENST00000371098.2_Missense_Mutation_p.R12Q|GNAS_ENST00000371075.3_Missense_Mutation_p.R12Q|GNAS-AS1_ENST00000424094.2_RNA|GNAS-AS1_ENST00000598163.1_RNA			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CAGTGGCGCCGAGCTCGCCAT	0.672			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													29.0	37.0	34.0					20																	57415196		2198	4294	6492	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.35G>A	20.37:g.57415196G>A	ENSP00000323571:p.Arg12Gln		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_NESP55	p.R12Q	ENST00000313949.7	37	c.35	CCDS13471.1	20	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632302	0.67015	.	.	ENSG00000087460	ENST00000313949;ENST00000371098;ENST00000371075	.	.	.	3.75	3.75	0.43078	.	.	.	.	.	T	0.61035	0.2315	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.64377	-0.6422	8	0.87932	D	0	.	11.3582	0.49627	0.0:0.0:1.0:0.0	.	12	O95467	GNAS3_HUMAN	Q	12	.	ENSP00000323571:R12Q	R	+	2	0	GNAS	56848591	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.731000	0.55013	2.406000	0.81754	0.484000	0.47621	CGA	GNAS	-	pfam_NESP55	ENSG00000087460		0.672	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080418.7		0.00	96	0	G	NM_000516		57415196	+1			no_errors	ENST00000313949	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	A
GP2	2813	genome.wustl.edu	37	16	20327345	20327345	+	Silent	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:20327345T>C	ENST00000381362.4	-	10	1519	c.1443A>G	c.(1441-1443)caA>caG	p.Q481Q	GP2_ENST00000573897.1_5'Flank|GP2_ENST00000341642.5_Silent_p.Q331Q|GP2_ENST00000381360.5_Silent_p.Q334Q|GP2_ENST00000302555.5_Silent_p.Q478Q	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	481	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CACTGCGGACTTGACTTCTTG	0.483																																																	0													113.0	105.0	108.0					16																	20327345		2203	4300	6503	SO:0001819	synonymous_variant	0			U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.1443A>G	16.37:g.20327345T>C			A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.Q481	ENST00000381362.4	37	c.1443	CCDS42128.1	16																																																																																			GP2	-	pfscan_ZP_dom	ENSG00000169347		0.483	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GP2	HGNC	protein_coding	OTTHUMT00000436920.1	-	0.00	55	0	T	NM_016295		20327345	-1	tier1	-	no_errors	ENST00000381362	ensembl	human	known	74_37	silent	39.62	32	21	SNP	0.000	C
GPM6A	2823	genome.wustl.edu	37	4	176594834	176594834	+	Silent	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:176594834A>G	ENST00000280187.7	-	4	429	c.384T>C	c.(382-384)gcT>gcC	p.A128A	GPM6A_ENST00000506894.1_Silent_p.A117A|GPM6A_ENST00000515090.1_Silent_p.A121A|GPM6A_ENST00000393658.2_Silent_p.A128A	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	128					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		AACATACCCAAGCGCTCACAC	0.388																																																	0													85.0	83.0	84.0					4																	176594834		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.384T>C	4.37:g.176594834A>G			B7Z642|E9PHI5|Q92602	Silent	SNP	pfam_Myelin_PLP,smart_Myelin_PLP,prints_Myelin_PLP	p.A128	ENST00000280187.7	37	c.384	CCDS3824.1	4																																																																																			GPM6A	-	pfam_Myelin_PLP,prints_Myelin_PLP	ENSG00000150625		0.388	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPM6A	HGNC	protein_coding	OTTHUMT00000362163.1	-	0.00	21	0	A			176594834	-1	tier1	-	no_errors	ENST00000280187	ensembl	human	known	74_37	silent	21.05	15	4	SNP	0.998	G
GPR124	25960	genome.wustl.edu	37	8	37687410	37687410	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:37687410G>A	ENST00000412232.2	+	6	609	c.596G>A	c.(595-597)cGc>cAc	p.R199H	GPR124_ENST00000315215.7_Missense_Mutation_p.R199H	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	199	LRRCT.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGCCACCTGCGCTGGCTGCTG	0.667																																																	0													45.0	44.0	44.0					8																	37687410		2202	4298	6500	SO:0001583	missense	0			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.596G>A	8.37:g.37687410G>A	ENSP00000406367:p.Arg199His		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.R199H	ENST00000412232.2	37	c.596	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675658	0.47781	.	.	ENSG00000020181	ENST00000428068;ENST00000416514;ENST00000315215;ENST00000412232	D;D;D	0.90385	-2.66;-2.66;-2.66	5.21	1.18	0.20946	Cysteine-rich flanking region, C-terminal (1);	0.272209	0.35262	N	0.003334	T	0.81650	0.4867	L	0.57536	1.79	0.41863	D	0.990231	P;B	0.42993	0.797;0.002	B;B	0.30716	0.119;0.001	T	0.74127	-0.3765	10	0.15066	T	0.55	-5.5257	6.3853	0.21558	0.2129:0.0:0.6523:0.1348	.	199;199	Q96PE1-2;Q96PE1	.;GP124_HUMAN	H	157;192;199;199	ENSP00000400860:R157H;ENSP00000323508:R199H;ENSP00000406367:R199H	ENSP00000323508:R199H	R	+	2	0	GPR124	37806568	0.337000	0.24766	0.995000	0.50966	0.949000	0.60115	0.375000	0.20518	0.169000	0.19679	0.462000	0.41574	CGC	GPR124	-	smart_Cys-rich_flank_reg_C	ENSG00000020181		0.667	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	HGNC	protein_coding	OTTHUMT00000343331.2	-	0.00	30	0	G			37687410	+1	tier1	-	no_errors	ENST00000412232	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	A
GPR161	23432	genome.wustl.edu	37	1	168066003	168066003	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:168066003A>G	ENST00000367838.1	-	5	1155	c.842T>C	c.(841-843)gTc>gCc	p.V281A	GPR161_ENST00000367835.1_Missense_Mutation_p.V281A|GPR161_ENST00000367836.1_Missense_Mutation_p.V149A|GPR161_ENST00000271357.5_Missense_Mutation_p.V281A|GPR161_ENST00000546300.1_Missense_Mutation_p.V167A|GPR161_ENST00000539777.1_Missense_Mutation_p.V203A|GPR161_ENST00000537209.1_Missense_Mutation_p.V301A|GPR161_ENST00000361697.2_Missense_Mutation_p.V281A	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	281					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					GCCCCAGGTGACCATGAAGGC	0.602																																																	0													75.0	78.0	77.0					1																	168066003		2203	4300	6503	SO:0001583	missense	0			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.842T>C	1.37:g.168066003A>G	ENSP00000356812:p.Val281Ala		B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V301A	ENST00000367838.1	37	c.902	CCDS1268.1	1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.222863	0.58668	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.48	4.35	0.52113	GPCR, rhodopsin-like superfamily (1);	0.443969	0.25935	N	0.027342	T	0.22513	0.0543	L	0.51422	1.61	0.33485	D	0.588012	B;B;B;P;B;B	0.39424	0.43;0.202;0.372;0.673;0.082;0.27	B;B;B;B;B;B	0.37550	0.122;0.183;0.053;0.253;0.058;0.088	T	0.11916	-1.0568	9	0.87932	D	0	-48.8453	11.0083	0.47649	0.9261:0.0:0.0739:0.0	.	301;167;203;301;281;281	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;.;.;GP161_HUMAN	A	281;281;149;281;167;203;301;281	ENSP00000356812:V281A;ENSP00000271357:V281A;ENSP00000356810:V149A;ENSP00000356809:V281A;ENSP00000444348:V167A;ENSP00000437576:V203A;ENSP00000441039:V301A;ENSP00000355194:V281A	ENSP00000271357:V281A	V	-	2	0	GPR161	166332627	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.998000	0.70653	1.025000	0.39708	0.459000	0.35465	GTC	GPR161	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000143147		0.602	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR161	HGNC	protein_coding	OTTHUMT00000083829.1	-	0.00	42	0	A	NM_007369		168066003	-1	tier1	-	no_errors	ENST00000537209	ensembl	human	known	74_37	missense	9.62	47	5	SNP	1.000	G
GPR19	2842	genome.wustl.edu	37	12	12814845	12814845	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:12814845C>A	ENST00000540510.1	-	2	730	c.538G>T	c.(538-540)Gcc>Tcc	p.A180S	GPR19_ENST00000332427.2_Missense_Mutation_p.A180S			P46093	GPR4_HUMAN	G protein-coupled receptor 19	131					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		ATTTTCTTGGCTTTTTCTCTG	0.478																																																	0													118.0	102.0	107.0					12																	12814845		2203	4300	6503	SO:0001583	missense	0				CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.538G>T	12.37:g.12814845C>A	ENSP00000441832:p.Ala180Ser		A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A180S	ENST00000540510.1	37	c.538	CCDS8652.1	12	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533923	0.45073	.	.	ENSG00000183150	ENST00000540510;ENST00000332427	T;T	0.41758	0.99;0.99	5.67	4.77	0.60923	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.51805	0.1696	L	0.39085	1.19	0.58432	D	0.999993	D	0.61080	0.989	D	0.64144	0.922	T	0.47497	-0.9113	10	0.33940	T	0.23	-25.2443	15.6592	0.77169	0.1385:0.8615:0.0:0.0	.	180	Q15760	GPR19_HUMAN	S	180	ENSP00000441832:A180S;ENSP00000333744:A180S	ENSP00000333744:A180S	A	-	1	0	GPR19	12706112	1.000000	0.71417	0.997000	0.53966	0.001000	0.01503	7.760000	0.85248	1.379000	0.46325	-0.314000	0.08810	GCC	GPR19	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000183150		0.478	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR19	HGNC	protein_coding	OTTHUMT00000400662.1	-	0.00	46	0	C	NM_006143		12814845	-1	tier1	-	no_errors	ENST00000332427	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	A
GPX5	2880	genome.wustl.edu	37	6	28501887	28501887	+	Silent	SNP	G	G	A	rs567969552		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:28501887G>A	ENST00000412168.2	+	5	698	c.609G>A	c.(607-609)acG>acA	p.T203T	GPX5_ENST00000442674.2_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	203					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)	p.T203T(1)		endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	ACCGGGCTACGGTCAGCTCAG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		17816	0.0		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											83.0	81.0	82.0					6																	28501887		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.609G>A	6.37:g.28501887G>A			A1A4Y0	Silent	SNP	pfam_Glutathione_peroxidase,superfamily_Thioredoxin-like_fold,pirsf_Glutathione_peroxidase,prints_Glutathione_peroxidase	p.T203	ENST00000412168.2	37	c.609	CCDS4652.1	6																																																																																			GPX5	-	superfamily_Thioredoxin-like_fold,pirsf_Glutathione_peroxidase	ENSG00000224586		0.522	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPX5	HGNC	protein_coding	OTTHUMT00000043672.2	-	0.00	49	0	G			28501887	+1	tier1	-	no_errors	ENST00000412168	ensembl	human	known	74_37	silent	16.67	45	9	SNP	0.000	A
GRIK3	2899	genome.wustl.edu	37	1	37271877	37271877	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:37271877C>T	ENST00000373091.3	-	14	2158	c.2142G>A	c.(2140-2142)aaG>aaA	p.K714K	GRIK3_ENST00000373093.4_Silent_p.K714K	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	714					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GCGCCGATGGCTTGCTGCTCA	0.602																																																	0													95.0	84.0	88.0					1																	37271877		2203	4300	6503	SO:0001819	synonymous_variant	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2142G>A	1.37:g.37271877C>T			A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K714	ENST00000373091.3	37	c.2142	CCDS416.1	1																																																																																			GRIK3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000163873		0.602	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	-	0.00	73	0	C	NM_000831		37271877	-1	tier1	-	no_errors	ENST00000373091	ensembl	human	known	74_37	silent	25.00	45	15	SNP	1.000	T
GRIN2C	2905	genome.wustl.edu	37	17	72846347	72846347	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:72846347C>A	ENST00000293190.5	-	6	1635	c.1489G>T	c.(1489-1491)Gag>Tag	p.E497*	GRIN2C_ENST00000578159.1_5'Flank|GRIN2C_ENST00000347612.4_Nonsense_Mutation_p.E497*	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	497					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGGCCTACCTCCCCAATCATG	0.647																																																	0													82.0	67.0	72.0					17																	72846347		2203	4300	6503	SO:0001587	stop_gained	0				CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.1489G>T	17.37:g.72846347C>A	ENSP00000293190:p.Glu497*		B2RTT1	Nonsense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,pfam_NMDAR2_C,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E497*	ENST00000293190.5	37	c.1489	CCDS32724.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.755019	0.98471	.	.	ENSG00000161509	ENST00000293190;ENST00000347612	.	.	.	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.369	0.87371	0.0:1.0:0.0:0.0	.	.	.	.	X	497;531	.	ENSP00000293190:E497X	E	-	1	0	GRIN2C	70357942	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.522000	0.81844	2.484000	0.83849	0.491000	0.48974	GAG	GRIN2C	-	pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	ENSG00000161509		0.647	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2C	HGNC	protein_coding	OTTHUMT00000103824.1	-	0.00	72	0	C			72846347	-1	tier1	-	no_errors	ENST00000293190	ensembl	human	known	74_37	nonsense	8.89	41	4	SNP	1.000	A
GTF2I	2969	genome.wustl.edu	37	7	74133241	74133241	+	Silent	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:74133241A>G	ENST00000324896.4	+	12	1313	c.924A>G	c.(922-924)gaA>gaG	p.E308E	AC083884.8_ENST00000434256.1_RNA|GTF2I_ENST00000416070.1_Intron|GTF2I_ENST00000353920.4_Silent_p.E288E|AC083884.8_ENST00000450426.2_RNA|AC083884.8_ENST00000594967.1_RNA|GTF2I_ENST00000346152.4_Intron	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	308					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGACCCTGAAGTTGAGGTGA	0.318																																																	0													97.0	96.0	96.0					7																	74133241		2203	4299	6502	SO:0001819	synonymous_variant	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.924A>G	7.37:g.74133241A>G			O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Silent	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.E308	ENST00000324896.4	37	c.924	CCDS5573.1	7																																																																																			GTF2I	-	pirsf_TF_II-I	ENSG00000077809		0.318	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	HGNC	protein_coding	OTTHUMT00000252708.1	-	0.00	55	0	A	NM_032999		74133241	+1	tier1	-	no_errors	ENST00000324896	ensembl	human	known	74_37	silent	21.28	37	10	SNP	1.000	G
GUCY1A3	2982	genome.wustl.edu	37	4	156638421	156638421	+	Silent	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:156638421T>C	ENST00000296518.7	+	8	1892	c.1683T>C	c.(1681-1683)gaT>gaC	p.D561D	GUCY1A3_ENST00000455639.2_Silent_p.D561D|GUCY1A3_ENST00000511108.1_Silent_p.D561D|GUCY1A3_ENST00000393832.3_Silent_p.D303D|GUCY1A3_ENST00000513574.1_Silent_p.D561D|GUCY1A3_ENST00000511507.1_Silent_p.D561D|GUCY1A3_ENST00000506455.1_Silent_p.D561D			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	561	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		AGCTCTCTGATGAAGTTATGT	0.438																																																	0													128.0	117.0	121.0					4																	156638421		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1683T>C	4.37:g.156638421T>C			D3DP19|D6RDW3|O43843|Q8TAH3	Silent	SNP	pfam_A/G_cyclase,pfam_Haem_no_assoc-bd,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.D561	ENST00000296518.7	37	c.1683	CCDS34085.1	4																																																																																			GUCY1A3	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000164116		0.438	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GUCY1A3	HGNC	protein_coding	OTTHUMT00000365786.2	-	0.00	56	0	T			156638421	+1	tier1	-	no_errors	ENST00000296518	ensembl	human	known	74_37	silent	20.83	38	10	SNP	0.993	C
HADHA	3030	genome.wustl.edu	37	2	26416532	26416532	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:26416532G>A	ENST00000380649.3	-	17	1928	c.1799C>T	c.(1798-1800)gCg>gTg	p.A600V		NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	600					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)	p.A600G(1)		autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGATCTTCCGCCACATGTTT	0.547																																																	1	Substitution - Missense(1)	lung(1)											176.0	165.0	169.0					2																	26416532		2203	4300	6503	SO:0001583	missense	0			D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.1799C>T	2.37:g.26416532G>A	ENSP00000370023:p.Ala600Val		B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	pfam_Crotonase_core_superfam,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_Fa_ox_alpha_mit	p.A600V	ENST00000380649.3	37	c.1799	CCDS1721.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.730857	0.96856	.	.	ENSG00000084754	ENST00000380649;ENST00000492433	D;D	0.90324	-2.65;-2.65	5.97	5.97	0.96955	3-hydroxyacyl-CoA dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.148065	0.64402	D	0.000012	D	0.94248	0.8153	M	0.79011	2.435	0.80722	D	1	D;D	0.58620	0.983;0.983	P;P	0.56278	0.795;0.795	D	0.93189	0.6581	10	0.41790	T	0.15	-30.8695	18.9877	0.92779	0.0:0.0:1.0:0.0	.	600;600	E9KL44;P40939	.;ECHA_HUMAN	V	600;86	ENSP00000370023:A600V;ENSP00000438039:A86V	ENSP00000370023:A600V	A	-	2	0	HADHA	26270036	1.000000	0.71417	0.869000	0.34112	0.984000	0.73092	9.677000	0.98645	2.828000	0.97474	0.655000	0.94253	GCG	HADHA	-	pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_Fa_ox_alpha_mit	ENSG00000084754		0.547	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADHA	HGNC	protein_coding	OTTHUMT00000214051.1		0.00	40	0	G	NM_000182		26416532	-1			no_errors	ENST00000380649	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.960	A
HDAC3	8841	genome.wustl.edu	37	5	141016116	141016118	+	Splice_Site	DEL	ATC	ATC	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	ATC	ATC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:141016116_141016118delATC	ENST00000305264.3	-	2	214_216	c.135_137delGAT	c.(133-138)atgatc>atc	p.M45del	RELL2_ENST00000518856.1_5'Flank|FCHSD1_ENST00000523856.1_5'Flank|RELL2_ENST00000297164.3_5'Flank|RELL2_ENST00000521367.1_5'Flank|RELL2_ENST00000444782.1_5'Flank	NM_003883.3	NP_003874.2	O15379	HDAC3_HUMAN	histone deacetylase 3	45	Histone deacetylase.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|protein deacetylation (GO:0006476)|regulation of mitotic cell cycle (GO:0007346)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|cyclin binding (GO:0030332)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Vorinostat(DB02546)	GGAACTCACGATCATCTTCTTAT	0.631																																																	0																																										SO:0001630	splice_region_variant	0			AF059650	CCDS4264.1	5q31.1-q31.2	2008-07-18			ENSG00000171720	ENSG00000171720	3.5.1.98		4854	protein-coding gene	gene with protein product		605166				9501169, 9464271	Standard	NM_003883		Approved	RPD3, HD3, RPD3-2	uc003llf.2	O15379	OTTHUMG00000129629	ENST00000305264.3:c.138+1GAT>-	5.37:g.141016119_141016121delATC			D3DQE1|O43268|Q9UEI5|Q9UEV0	In_Frame_Del	DEL	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.M45in_frame_del	ENST00000305264.3	37	c.137_135	CCDS4264.1	5																																																																																			HDAC3	-	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1	ENSG00000171720		0.631	HDAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC3	HGNC	protein_coding	OTTHUMT00000251824.2		0.00	168	0	ATC	NM_003883	In_Frame_Del	141016118	-1	tier1		no_errors	ENST00000305264	ensembl	human	known	74_37	in_frame_del	13.33	143	22	DEL	1.000:1.000:1.000	-
HERC2	8924	genome.wustl.edu	37	15	28389296	28389296	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:28389296G>T	ENST00000261609.7	-	73	11334	c.11226C>A	c.(11224-11226)aaC>aaA	p.N3742K		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TAGAGGCAAGGTTGAGTCGGA	0.537																																																	0													126.0	110.0	115.0					15																	28389296		2203	4300	6503	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.11226C>A	15.37:g.28389296G>T	ENSP00000261609:p.Asn3742Lys			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.N3742K	ENST00000261609.7	37	c.11226	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016530	0.35606	.	.	ENSG00000128731	ENST00000261609	T	0.36878	1.23	5.66	-4.05	0.03998	.	0.046189	0.85682	D	0.000000	T	0.11495	0.0280	N	0.03608	-0.345	0.49483	D	0.999794	B	0.23377	0.084	B	0.17722	0.019	T	0.34950	-0.9808	10	0.06494	T	0.89	.	12.1774	0.54194	0.5615:0.0:0.4385:0.0	.	3742	O95714	HERC2_HUMAN	K	3742	ENSP00000261609:N3742K	ENSP00000261609:N3742K	N	-	3	2	HERC2	26062891	1.000000	0.71417	0.519000	0.27824	0.965000	0.64279	0.795000	0.26972	-0.668000	0.05296	-0.302000	0.09304	AAC	HERC2	-	NULL	ENSG00000128731		0.537	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	21	0	G	NM_004667		28389296	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.998	T
HIPK1	204851	genome.wustl.edu	37	1	114516033	114516034	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:114516033_114516034delCA	ENST00000369558.1	+	16	3764_3765	c.3532_3533delCA	c.(3532-3534)cagfs	p.Q1178fs	HIPK1_ENST00000426820.2_Frame_Shift_Del_p.Q1178fs|HIPK1_ENST00000369553.1_Frame_Shift_Del_p.Q784fs|HIPK1_ENST00000340480.4_Frame_Shift_Del_p.Q804fs|HIPK1_ENST00000406344.1_Frame_Shift_Del_p.Q784fs|HIPK1_ENST00000369561.4_Frame_Shift_Del_p.Q1144fs|HIPK1_ENST00000369554.2_Frame_Shift_Del_p.Q1133fs|HIPK1_ENST00000369555.2_Frame_Shift_Del_p.Q1133fs			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	1178					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACCAACACCAGTTTGCCACC	0.54																																																	0																																										SO:0001589	frameshift_variant	0			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.3532_3533delCA	1.37:g.114516033_114516034delCA	ENSP00000358571:p.Gln1178fs		A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q1178fs	ENST00000369558.1	37	c.3532_3533	CCDS867.1	1																																																																																			HIPK1	-	NULL	ENSG00000163349		0.540	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	HGNC	protein_coding	OTTHUMT00000033127.1		0.00	27	0	CA	NM_198268		114516034	+1	tier1		no_errors	ENST00000369558	ensembl	human	known	74_37	frame_shift_del	30.00	14	6	DEL	1.000:1.000	-
HIST1H3D	8351	genome.wustl.edu	37	6	26197097	26197097	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:26197097C>A	ENST00000356476.2	-	1	381	c.382G>T	c.(382-384)Gct>Tct	p.A128S	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000377831.5_Missense_Mutation_p.A128S			P68431	H31_HUMAN	histone cluster 1, H3d	128					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				ATGCGGCGAGCAAGCTGGATG	0.532																																					GBM(108;3816 4467)												0													99.0	92.0	95.0					6																	26197097		2203	4300	6503	SO:0001583	missense	0			Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.382G>T	6.37:g.26197097C>A	ENSP00000366999:p.Ala128Ser		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.A128S	ENST00000356476.2	37	c.382	CCDS4590.1	6	.	.	.	.	.	.	.	.	.	.	.	13.68	2.308846	0.40895	.	.	ENSG00000197409	ENST00000356476;ENST00000377831	T;T	0.79247	-1.25;-1.25	4.28	3.39	0.38822	.	.	.	.	.	T	0.76162	0.3949	.	.	.	0.33229	D	0.55574	.	.	.	.	.	.	T	0.77555	-0.2544	6	0.87932	D	0	.	13.3339	0.60505	0.0:0.8401:0.1599:0.0	.	.	.	.	S	128	ENSP00000366999:A128S;ENSP00000367062:A128S	ENSP00000366999:A128S	A	-	1	0	HIST1H3D	26305076	1.000000	0.71417	0.004000	0.12327	0.143000	0.21401	5.676000	0.68131	0.890000	0.36211	0.655000	0.94253	GCT	HIST1H3D	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000197409		0.532	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3D	HGNC	protein_coding	OTTHUMT00000040096.1	-	0.00	90	0	C	NM_003530		26197097	-1	tier1	-	no_errors	ENST00000356476	ensembl	human	known	74_37	missense	32.26	42	20	SNP	0.998	A
HIST1H1B	3009	genome.wustl.edu	37	6	27835214	27835214	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:27835214C>T	ENST00000331442.3	-	1	145	c.94G>A	c.(94-96)Ggc>Agc	p.G32S		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	32					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						TTAGCAGCGCCGGCGCCGGCA	0.627																																																	0													34.0	41.0	38.0					6																	27835214		2199	4296	6495	SO:0001583	missense	0			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.94G>A	6.37:g.27835214C>T	ENSP00000330074:p.Gly32Ser		Q14529|Q3MJ42	Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.G32S	ENST00000331442.3	37	c.94	CCDS4635.1	6	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347351	0.24426	.	.	ENSG00000184357	ENST00000331442	T	0.08102	3.13	3.96	3.96	0.45880	.	0.205289	0.33572	N	0.004770	T	0.01454	0.0047	N	0.08118	0	0.39480	D	0.967875	B	0.19706	0.038	B	0.11329	0.006	T	0.42816	-0.9429	10	0.10111	T	0.7	-18.5866	12.3917	0.55362	0.1684:0.8316:0.0:0.0	.	32	P16401	H15_HUMAN	S	32	ENSP00000330074:G32S	ENSP00000330074:G32S	G	-	1	0	HIST1H1B	27943193	0.823000	0.29233	0.776000	0.31678	0.341000	0.28922	0.924000	0.28777	2.204000	0.70986	0.511000	0.50034	GGC	HIST1H1B	-	prints_Histone_H5	ENSG00000184357		0.627	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1B	HGNC	protein_coding	OTTHUMT00000043371.1	-	0.00	48	0	C	NM_005322		27835214	-1	tier1	-	no_errors	ENST00000331442	ensembl	human	known	74_37	missense	14.58	41	7	SNP	0.865	T
HLA-DQB2	3120	genome.wustl.edu	37	6	32725559	32725559	+	Missense_Mutation	SNP	C	C	T	rs113761247		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:32725559C>T	ENST00000437316.2	-	4	811	c.748G>A	c.(748-750)Ggt>Agt	p.G250S	HLA-DQB2_ENST00000435145.2_Missense_Mutation_p.G250S|HLA-DQB2_ENST00000411527.1_Intron			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	254					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						CCTTTCTGACCCCTGTGACGG	0.552																																																	0																																										SO:0001583	missense	0			M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.748G>A	6.37:g.32725559C>T	ENSP00000396330:p.Gly250Ser		A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.G250S	ENST00000437316.2	37	c.748		6	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.519393	0.00149	.	.	ENSG00000232629	ENST00000437316;ENST00000435145	T;T	0.00623	6.18;6.15	3.24	-1.21	0.09524	.	0.870743	0.09631	N	0.776240	T	0.00178	0.0005	.	.	.	0.21967	N	0.999447	B	0.10296	0.003	B	0.09377	0.004	T	0.22277	-1.0221	9	0.36615	T	0.2	.	4.3261	0.11041	0.0:0.2114:0.1703:0.6183	.	250	A2ADX3	.	S	250	ENSP00000396330:G250S;ENSP00000410512:G250S	ENSP00000410512:G250S	G	-	1	0	HLA-DQB2	32833537	0.000000	0.05858	0.134000	0.22075	0.023000	0.10783	0.266000	0.18534	-0.331000	0.08501	-1.846000	0.00573	GGT	HLA-DQB2	-	NULL	ENSG00000232629		0.552	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	HLA-DQB2	HGNC	protein_coding	OTTHUMT00000076216.2	-	0.00	48	0	C			32725559	-1	tier1	rs113761247	no_errors	ENST00000435145	ensembl	human	known	74_37	missense	10.13	71	8	SNP	0.392	T
HMCN2	256158	genome.wustl.edu	37	9	133305924	133305924	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:133305924G>T	ENST00000428715.1	+	11	1711	c.1710G>T	c.(1708-1710)atG>atT	p.M570I	HMCN2_ENST00000302481.1_Start_Codon_SNP_p.M1I			Q8NDA2	HMCN2_HUMAN	hemicentin 2	4846	Ig-like C2-type 1.				response to stimulus (GO:0050896)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)										CGGGTCCCATGGCCCTGAGCA	0.677																																																	0																																										SO:0001583	missense	0			AK074396		9q34.11	2013-01-29			ENSG00000148357	ENSG00000148357		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21293	protein-coding gene	gene with protein product							Standard	XM_006710218		Approved	DKFZp434P0216, FLJ23816		Q8NDA2	OTTHUMG00000140096	ENST00000428715.1:c.1710G>T	9.37:g.133305924G>T	ENSP00000387564:p.Met570Ile		Q8N225|Q8TCI8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,superfamily_TIL_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.M1I	ENST00000428715.1	37	c.3		9	.	.	.	.	.	.	.	.	.	.	G	2.438	-0.329371	0.05314	.	.	ENSG00000148357	ENST00000428715;ENST00000302481	T;T	0.80123	-1.03;-1.34	4.82	-6.32	0.01995	.	.	.	.	.	T	0.40498	0.1119	N	0.00771	-1.2	0.80722	D	1.000000	.	.	.	.	.	.	T	0.44003	-0.9356	6	0.10377	T	0.69	.	2.0056	0.03477	0.2264:0.2298:0.3883:0.1554	.	.	.	.	I	570;1	ENSP00000387564:M570I;ENSP00000305590:M1I	ENSP00000305590:M1I	M	+	3	0	HMCN2	132295745	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.867000	0.04241	-0.824000	0.04295	-0.379000	0.06801	ATG	HMCN2	-	NULL	ENSG00000148357		0.677	HMCN2-001	NOVEL	basic|exp_conf	protein_coding	HMCN2	HGNC	protein_coding	OTTHUMT00000054661.2	-	0.00	64	0	G	XM_175125		133305924	+1	tier1	-	no_errors	ENST00000302481	ensembl	human	known	74_37	missense	34.43	40	21	SNP	0.000	T
HSF4	3299	genome.wustl.edu	37	16	67199459	67199459	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:67199459G>A	ENST00000521374.1	+	2	158	c.158G>A	c.(157-159)cGt>cAt	p.R53H	HSF4_ENST00000421453.1_Missense_Mutation_p.R53H|HSF4_ENST00000264009.8_Missense_Mutation_p.R53H|RP11-5A19.5_ENST00000518227.1_3'UTR|HSF4_ENST00000584272.1_Missense_Mutation_p.R53H			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	53					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GACCAGAGCCGTTTCGCCAAG	0.642																																																	0													57.0	65.0	62.0					16																	67199459		2148	4279	6427	SO:0001583	missense	0			D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.158G>A	16.37:g.67199459G>A	ENSP00000430947:p.Arg53His		Q99472|Q9ULV6	Missense_Mutation	SNP	pfam_HSF_DNA-bd,smart_HSF_DNA-bd,prints_HSF_DNA-bd	p.R53H	ENST00000521374.1	37	c.158	CCDS42175.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.279152	0.95489	.	.	ENSG00000102878	ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374;ENST00000517729	D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65	5.37	5.37	0.77165	Winged helix-turn-helix transcription repressor DNA-binding (1);Heat shock factor (HSF)-type, DNA-binding (2);	0.227987	0.45126	D	0.000400	D	0.95695	0.8600	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.72625	0.978;0.887	D	0.95780	0.8816	10	0.66056	D	0.02	-14.4533	17.8428	0.88720	0.0:0.0:1.0:0.0	.	53;53	Q9ULV5-2;Q9ULV5	.;HSF4_HUMAN	H	53;53;53;53;11	ENSP00000408815:R53H;ENSP00000264009:R53H;ENSP00000428978:R53H;ENSP00000430947:R53H;ENSP00000430299:R11H	ENSP00000264009:R53H	R	+	2	0	HSF4	65756960	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.584000	0.60971	2.786000	0.95864	0.561000	0.74099	CGT	HSF4	-	pfam_HSF_DNA-bd,smart_HSF_DNA-bd	ENSG00000102878		0.642	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF4	HGNC	protein_coding	OTTHUMT00000375080.1	-	0.00	26	0	G	NM_001538		67199459	+1	tier1	-	no_errors	ENST00000264009	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	A
ICAM3	3385	genome.wustl.edu	37	19	10446014	10446014	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:10446014G>A	ENST00000160262.5	-	4	873	c.665C>T	c.(664-666)cCc>cTc	p.P222L	RAVER1_ENST00000293677.6_5'Flank|ICAM3_ENST00000589261.1_Missense_Mutation_p.P145L	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	222					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			GAGGCGCGGGGGGGTCACGGG	0.647																																																	0													9.0	11.0	11.0					19																	10446014		2149	4175	6324	SO:0001583	missense	0				CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.665C>T	19.37:g.10446014G>A	ENSP00000160262:p.Pro222Leu		Q6PD68	Missense_Mutation	SNP	pfam_ICAM_N,smart_Ig_sub,pfscan_Ig-like_dom,prints_ICAM_VCAM_N,prints_ICAM	p.P222L	ENST00000160262.5	37	c.665	CCDS12235.1	19	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216969	0.39201	.	.	ENSG00000076662	ENST00000160262	T	0.03468	3.92	5.06	1.64	0.23874	Immunoglobulin-like fold (1);	0.978321	0.08344	N	0.960300	T	0.04497	0.0123	L	0.34521	1.04	0.09310	N	1	B	0.30114	0.269	B	0.37650	0.255	T	0.47736	-0.9094	10	0.49607	T	0.09	-8.5172	4.7046	0.12844	0.1969:0.1817:0.6214:0.0	.	222	P32942	ICAM3_HUMAN	L	222	ENSP00000160262:P222L	ENSP00000160262:P222L	P	-	2	0	ICAM3	10307014	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.190000	0.17057	0.602000	0.29896	-0.379000	0.06801	CCC	ICAM3	-	NULL	ENSG00000076662		0.647	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM3	HGNC	protein_coding	OTTHUMT00000451234.1	-	0.00	80	0	G			10446014	-1	tier1	-	no_errors	ENST00000160262	ensembl	human	known	74_37	missense	9.52	57	6	SNP	0.000	A
IGDCC3	9543	genome.wustl.edu	37	15	65621744	65621744	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:65621744G>A	ENST00000327987.4	-	13	2440	c.2189C>T	c.(2188-2190)cCg>cTg	p.P730L	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	730					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TCTGGGGTCCGGCTGCCCTGC	0.652																																																	0													72.0	86.0	82.0					15																	65621744		2199	4277	6476	SO:0001583	missense	0			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2189C>T	15.37:g.65621744G>A	ENSP00000332773:p.Pro730Leu		O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P730L	ENST00000327987.4	37	c.2189	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281398	0.23392	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.66460	-0.21	4.89	-0.636	0.11508	.	0.885835	0.09723	N	0.764121	T	0.39784	0.1091	N	0.24115	0.695	0.09310	N	0.999997	P	0.48640	0.913	B	0.30855	0.121	T	0.34204	-0.9838	10	0.54805	T	0.06	-1.64	3.9268	0.09267	0.2972:0.0:0.5351:0.1678	.	730	Q8IVU1	IGDC3_HUMAN	L	730;554	ENSP00000332773:P730L	ENSP00000332773:P730L	P	-	2	0	IGDCC3	63408797	0.428000	0.25522	0.000000	0.03702	0.001000	0.01503	0.918000	0.28678	0.044000	0.15775	-1.202000	0.01658	CCG	IGDCC3	-	NULL	ENSG00000174498		0.652	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	-	0.00	99	0	G	NM_004884		65621744	-1	tier1	-	no_errors	ENST00000327987	ensembl	human	known	74_37	missense	6.82	82	6	SNP	0.000	A
ITPR1	3708	genome.wustl.edu	37	3	4693856	4693856	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:4693856delT	ENST00000443694.2	+	9	905	c.905delT	c.(904-906)cttfs	p.L302fs	ITPR1_ENST00000354582.6_Frame_Shift_Del_p.L302fs|ITPR1_ENST00000302640.8_Frame_Shift_Del_p.L302fs|ITPR1_ENST00000423119.2_Frame_Shift_Del_p.L302fs|ITPR1_ENST00000544951.1_Frame_Shift_Del_p.L302fs|ITPR1_ENST00000456211.2_Frame_Shift_Del_p.L302fs|ITPR1_ENST00000357086.4_Frame_Shift_Del_p.L302fs			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	302	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TGGAACAGCCTTTTCCGTTTC	0.527																																																	0													91.0	93.0	92.0					3																	4693856		2026	4175	6201	SO:0001589	frameshift_variant	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.905delT	3.37:g.4693856delT	ENSP00000401671:p.Leu302fs		E7EPX7|E9PDE9|Q14660|Q99897	Frame_Shift_Del	DEL	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.F303fs	ENST00000443694.2	37	c.905	CCDS54551.1	3																																																																																			ITPR1	-	pfam_MIR_motif,superfamily_MIR_motif,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	ENSG00000150995		0.527	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3		0.00	57	0	T	NM_002222		4693856	+1	tier1		no_errors	ENST00000302640	ensembl	human	known	74_37	frame_shift_del	6.67	42	3	DEL	1.000	-
IL17RC	84818	genome.wustl.edu	37	3	9970020	9970020	+	Silent	SNP	C	C	T	rs370054868		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:9970020C>T	ENST00000295981.3	+	11	1340	c.1122C>T	c.(1120-1122)gcC>gcT	p.A374A	IL17RC_ENST00000498214.1_3'UTR|IL17RC_ENST00000403601.3_Silent_p.A303A|IL17RC_ENST00000413608.1_Silent_p.A303A|IL17RC_ENST00000383812.4_Silent_p.A288A|IL17RC_ENST00000455057.1_Silent_p.A288A|IL17RC_ENST00000416074.2_Silent_p.A159A	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	374					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TCTGGCAAGCCGCCCGACTGC	0.692																																																	0								C	,,,,,	0,4406		0,0,2203	37.0	43.0	41.0		909,909,864,864,909,1122	-10.6	0.0	3		41	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	IL17RC	NM_001203263.1,NM_001203264.1,NM_001203265.1,NM_032732.5,NM_153460.3,NM_153461.3	,,,,,	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,,,,,	303/708,303/691,288/689,288/706,303/721,374/792	9970020	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	0			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.1122C>T	3.37:g.9970020C>T			E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Silent	SNP	pfam_SEFIR	p.A374	ENST00000295981.3	37	c.1122	CCDS2590.1	3																																																																																			IL17RC	-	NULL	ENSG00000163702		0.692	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL17RC	HGNC	protein_coding	OTTHUMT00000250526.2	-	0.00	88	0	C	NM_032732		9970020	+1	tier1	-	no_errors	ENST00000295981	ensembl	human	known	74_37	silent	6.10	154	10	SNP	0.000	T
IGSF11	152404	genome.wustl.edu	37	3	118824023	118824023	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:118824023A>C	ENST00000425327.2	-	2	285	c.17T>G	c.(16-18)cTt>cGt	p.L6R	IGSF11_ENST00000354673.2_Missense_Mutation_p.L6R|IGSF11_ENST00000441144.2_Missense_Mutation_p.L6R			Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	11					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CCAGAGCAAAAGTTCCACCAG	0.363																																																	0													112.0	108.0	110.0					3																	118824023		2203	4300	6503	SO:0001583	missense	0			AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000425327.2:c.17T>G	3.37:g.118824023A>C	ENSP00000406092:p.Leu6Arg		C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L6R	ENST00000425327.2	37	c.17	CCDS2983.1	3	.	.	.	.	.	.	.	.	.	.	A	7.795	0.712305	0.15306	.	.	ENSG00000144847	ENST00000425327;ENST00000354673;ENST00000441144	T;T;D	0.84516	-1.16;-1.16;-1.86	2.18	0.928	0.19443	.	.	.	.	.	T	0.73908	0.3647	.	.	.	0.09310	N	1	B;B	0.20780	0.048;0.022	B;B	0.14023	0.01;0.005	T	0.61192	-0.7112	8	0.48119	T	0.1	.	4.1699	0.10324	0.6373:0.0:0.0:0.3627	.	6;6	Q5DX21-3;Q5DX21-2	.;.	R	6	ENSP00000406092:L6R;ENSP00000346700:L6R;ENSP00000401240:L6R	ENSP00000346700:L6R	L	-	2	0	IGSF11	120306713	0.029000	0.19370	0.010000	0.14722	0.054000	0.15201	0.975000	0.29449	0.233000	0.21120	0.379000	0.24179	CTT	IGSF11	-	NULL	ENSG00000144847		0.363	IGSF11-001	KNOWN	basic|CCDS	protein_coding	IGSF11	HGNC	protein_coding	OTTHUMT00000355074.2	-	0.00	49	0	A			118824023	-1	tier1	-	no_errors	ENST00000354673	ensembl	human	known	74_37	missense	31.71	28	13	SNP	0.023	C
KAZN	23254	genome.wustl.edu	37	1	15441059	15441059	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:15441059C>T	ENST00000376030.2	+	15	2550	c.2256C>T	c.(2254-2256)gaC>gaT	p.D752D	TMEM51-AS1_ENST00000310916.3_RNA	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	752					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)		p.D199D(1)|p.D752D(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						ATTGCGGAGACGATGACCCCC	0.557																																																	2	Substitution - coding silent(2)	large_intestine(2)											63.0	50.0	55.0					1																	15441059		2203	4300	6503	SO:0001819	synonymous_variant	0			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.2256C>T	1.37:g.15441059C>T			B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.D752	ENST00000376030.2	37	c.2256	CCDS152.2	1																																																																																			KAZN	-	NULL	ENSG00000189337		0.557	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZN	HGNC	protein_coding	OTTHUMT00000005690.2		0.00	53	0	C	NM_001017999		15441059	+1			no_errors	ENST00000376030	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.005	T
KCND3	3752	genome.wustl.edu	37	1	112525097	112525097	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:112525097G>A	ENST00000315987.2	-	2	731	c.252C>T	c.(250-252)ttC>ttT	p.F84F	KCND3_ENST00000369697.1_Silent_p.F84F|KCND3_ENST00000302127.4_Silent_p.F84F	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	84					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.F84F(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GGTCCCGGTCGAAGAAGTACT	0.622																																																	1	Substitution - coding silent(1)	breast(1)											125.0	113.0	117.0					1																	112525097		2203	4300	6503	SO:0001819	synonymous_variant	0			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.252C>T	1.37:g.112525097G>A			O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.3,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.F84	ENST00000315987.2	37	c.252	CCDS843.1	1																																																																																			KCND3	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	ENSG00000171385		0.622	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	HGNC	protein_coding	OTTHUMT00000033144.1		0.00	32	0	G	NM_172198		112525097	-1			no_errors	ENST00000315987	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.747	A
KCNH5	27133	genome.wustl.edu	37	14	63447960	63447960	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:63447960A>C	ENST00000322893.7	-	6	840	c.572T>G	c.(571-573)aTc>aGc	p.I191S	KCNH5_ENST00000394968.1_Missense_Mutation_p.I133S|KCNH5_ENST00000420622.2_Missense_Mutation_p.I191S|KCNH5_ENST00000394964.2_Missense_Mutation_p.I133S	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	191					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CTGAGGAAGGATATCTGATCC	0.363																																																	0													63.0	66.0	65.0					14																	63447960		2203	4300	6503	SO:0001583	missense	0			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.572T>G	14.37:g.63447960A>C	ENSP00000321427:p.Ile191Ser		C9JP98	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.I191S	ENST00000322893.7	37	c.572	CCDS9756.1	14	.	.	.	.	.	.	.	.	.	.	A	15.75	2.924694	0.52653	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.98849	-5.18;-4.98;-4.97;-4.96	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.96558	0.8877	L	0.35593	1.075	0.80722	D	1	B;B;B;P	0.37824	0.141;0.317;0.167;0.609	B;B;B;B	0.37780	0.155;0.124;0.053;0.258	D	0.96779	0.9574	10	0.49607	T	0.09	.	15.1763	0.72913	1.0:0.0:0.0:0.0	.	133;133;191;191	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	S	191;191;133;133	ENSP00000321427:I191S;ENSP00000395439:I191S;ENSP00000378419:I133S;ENSP00000378415:I133S	ENSP00000321427:I191S	I	-	2	0	KCNH5	62517713	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.273000	0.95719	1.991000	0.58162	0.377000	0.23210	ATC	KCNH5	-	prints_K_chnl_volt-dep_EAG	ENSG00000140015		0.363	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1		0.00	15	0	A	NM_139318		63447960	-1			no_errors	ENST00000322893	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	C
KCTD19	146212	genome.wustl.edu	37	16	67333573	67333573	+	Intron	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:67333573C>T	ENST00000304372.5	-	6	831				KCTD19_ENST00000562860.1_5'UTR	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19						protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		TCCATTGTACCGAGGAGGCTC	0.468																																																	0																																										SO:0001627	intron_variant	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.776-97G>A	16.37:g.67333573C>T			B4DZ49|Q8N804	RNA	SNP	-	NULL	ENST00000304372.5	37	NULL	CCDS42179.1	16																																																																																			KCTD19	-	-	ENSG00000168676		0.468	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	-	0.00	31	0	C	XM_085367		67333573	-1	tier1	-	no_errors	ENST00000562860	ensembl	human	known	74_37	rna	22.86	27	8	SNP	0.000	T
KIAA1210	57481	genome.wustl.edu	37	X	118223626	118223626	+	Missense_Mutation	SNP	G	G	A	rs201877365		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chrX:118223626G>A	ENST00000402510.2	-	11	1566	c.1567C>T	c.(1567-1569)Cgg>Tgg	p.R523W		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	523								p.R347W(1)|p.R523W(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						CCCTGACTCCGAGAAGCATCA	0.433																																																	2	Substitution - Missense(2)	prostate(2)						G	TRP/ARG	4,3681		0,3,1,1554,570	253.0	243.0	246.0		1567	1.5	0.0	X		246	0,6637		0,0,0,2399,1839	yes	missense	KIAA1210	NM_020721.1	101	0,3,1,3953,2409	AA,AG,A,GG,G		0.0,0.1085,0.0388	benign	523/1710	118223626	4,10318	2128	4238	6366	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1567C>T	X.37:g.118223626G>A	ENSP00000384670:p.Arg523Trp		B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.R523W	ENST00000402510.2	37	c.1567	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	G	9.342	1.063226	0.19987	0.001085	0.0	ENSG00000250423	ENST00000402510	T	0.10573	2.86	4.35	1.55	0.23275	.	.	.	.	.	T	0.04861	0.0131	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39165	-0.9627	9	0.51188	T	0.08	.	2.9111	0.05737	0.1832:0.5354:0.1751:0.1063	.	523	Q9ULL0	K1210_HUMAN	W	523	ENSP00000384670:R523W	ENSP00000384670:R523W	R	-	1	2	RP13-347D8.6	118107654	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.511000	0.06321	0.074000	0.16767	-0.385000	0.06624	CGG	KIAA1210	-	NULL	ENSG00000250423		0.433	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	-	0.00	70	0	G	NM_020721		118223626	-1	tier1	rs201877365	no_errors	ENST00000402510	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.000	A
KIAA1217	56243	genome.wustl.edu	37	10	24784014	24784015	+	Intron	INS	-	-	A	rs570535110|rs398045908|rs533221743|rs78603449|rs546700737|rs550542591|rs71506836	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:24784014_24784015insA	ENST00000376454.3	+	8	1814				KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000376451.2_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000430453.2_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217						embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GAATGGGCTTTAAAAAAAAAAA	0.386																																																	0																																										SO:0001627	intron_variant	0			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1785-61->A	10.37:g.24784025_24784025dupA			A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	RNA	INS	-	NULL	ENST00000376454.3	37	NULL	CCDS31165.1	10																																																																																			KIAA1217	-	-	ENSG00000120549		0.386	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2		0.00	23	0	-	NM_019590		24784015	+1	tier1		no_errors	ENST00000460373	ensembl	human	putative	74_37	rna	15.38	22	4	INS	0.000:0.000	A
KIF1A	547	genome.wustl.edu	37	2	241737163	241737163	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:241737163C>T	ENST00000320389.7	-	2	165	c.7G>A	c.(7-9)Ggg>Agg	p.G3R	KIF1A_ENST00000498729.2_Missense_Mutation_p.G3R	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	3					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		ACCGAAGCCCCGGCCATCTCT	0.567																																																	0													24.0	28.0	27.0					2																	241737163		1950	4133	6083	SO:0001583	missense	0			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.7G>A	2.37:g.241737163C>T	ENSP00000322791:p.Gly3Arg		B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G3R	ENST00000320389.7	37	c.7	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.095670	0.94197	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283;ENST00000448728	T;T;T	0.74947	-0.72;-0.82;-0.89	4.78	4.78	0.61160	Kinesin, motor domain (2);	0.000000	0.85682	U	0.000000	T	0.80706	0.4674	L	0.35542	1.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.80764	0.991;0.994;0.844	D	0.83425	0.0035	10	0.87932	D	0	.	17.7694	0.88487	0.0:1.0:0.0:0.0	.	3;3;3	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	R	3	ENSP00000322791:G3R;ENSP00000438388:G3R;ENSP00000384231:G3R	ENSP00000322791:G3R	G	-	1	0	KIF1A	241385836	1.000000	0.71417	0.998000	0.56505	0.928000	0.56348	5.600000	0.67599	2.360000	0.80028	0.467000	0.42956	GGG	KIF1A	-	superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000130294		0.567	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	-	0.00	47	0	C	NM_138483		241737163	-1	tier1	-	no_errors	ENST00000498729	ensembl	human	known	74_37	missense	19.61	41	10	SNP	1.000	T
KIR3DL1	3811	genome.wustl.edu	37	19	55333153	55333153	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:55333153A>C	ENST00000391728.4	+	5	822	c.789A>C	c.(787-789)gaA>gaC	p.E263D	KIR3DL1_ENST00000538269.1_Missense_Mutation_p.E263D|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.E263D|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.E263D|KIR3DL1_ENST00000358178.4_Missense_Mutation_p.E168D|KIR3DL1_ENST00000541392.1_Missense_Mutation_p.E263D	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	263	Ig-like C2-type 3.				immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GAGCCCATGAACGTAGGCTCC	0.602																																																	0													13.0	13.0	13.0					19																	55333153		2038	3959	5997	SO:0001583	missense	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.789A>C	19.37:g.55333153A>C	ENSP00000375608:p.Glu263Asp		O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.E263D	ENST00000391728.4	37	c.789	CCDS42621.1	19	.	.	.	.	.	.	.	.	.	.	-	9.483	1.098625	0.20552	.	.	ENSG00000167633	ENST00000402254;ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87	1.47	-1.11	0.09840	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.37073	0.0990	L	0.60957	1.885	0.09310	N	1	B;B;P;B	0.41131	0.353;0.021;0.739;0.012	B;B;P;B	0.60236	0.12;0.018;0.871;0.007	T	0.38802	-0.9644	9	0.87932	D	0	.	2.2697	0.04087	0.4695:0.313:0.2176:0.0	.	263;168;263;263	Q15702;Q14946;F6QF33;P43629	.;.;.;KI3L1_HUMAN	D	263;263;263;241;263;263;168	ENSP00000384528:E263D;ENSP00000443350:E263D;ENSP00000442355:E263D;ENSP00000375608:E263D;ENSP00000326868:E263D;ENSP00000350901:E168D	ENSP00000326868:E263D	E	+	3	2	KIR3DL1	60024965	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.841000	0.00737	-0.387000	0.07809	0.155000	0.16302	GAA	KIR3DL1	-	pfam_Immunoglobulin,smart_Ig_sub	ENSG00000167633		0.602	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIR3DL1	HGNC	protein_coding	OTTHUMT00000141238.1	-	0.00	58	0	A	NM_013289		55333153	+1	tier1	-	no_errors	ENST00000402254	ensembl	human	known	74_37	missense	15.79	32	6	SNP	0.000	C
KLHDC3	116138	genome.wustl.edu	37	6	42986642	42986642	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:42986642C>T	ENST00000326974.4	+	8	1057	c.862C>T	c.(862-864)Cca>Tca	p.P288S	KLHDC3_ENST00000332245.8_Missense_Mutation_p.P229S|KLHDC3_ENST00000244670.8_Missense_Mutation_p.P154S|RRP36_ENST00000244496.5_5'Flank	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	288					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGGGAAGGGGCCATGTCCCCG	0.522																																																	0													62.0	75.0	70.0					6																	42986642		2203	4299	6502	SO:0001583	missense	0			AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.862C>T	6.37:g.42986642C>T	ENSP00000313995:p.Pro288Ser		A8K2W9	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1	p.P288S	ENST00000326974.4	37	c.862	CCDS4880.1	6	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660825	0.88154	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000244670;ENST00000394096;ENST00000426116;ENST00000332245	T;T;T	0.72835	-0.69;-0.69;-0.69	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.88973	0.6583	H	0.95850	3.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.91789	0.5442	10	0.87932	D	0	-2.8406	19.6136	0.95619	0.0:1.0:0.0:0.0	.	288;229;154;288	E7ENU0;E7ERR0;F8W6A4;Q9BQ90	.;.;.;KLDC3_HUMAN	S	288;288;154;288;261;229	ENSP00000313995:P288S;ENSP00000244670:P154S;ENSP00000331562:P229S	ENSP00000244670:P154S	P	+	1	0	KLHDC3	43094620	1.000000	0.71417	0.981000	0.43875	0.913000	0.54294	5.511000	0.67024	2.712000	0.92718	0.407000	0.27541	CCA	KLHDC3	-	NULL	ENSG00000124702		0.522	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC3	HGNC	protein_coding	OTTHUMT00000040570.1		0.00	54	0	C	NM_057161		42986642	+1			no_errors	ENST00000326974	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
KLHL6	89857	genome.wustl.edu	37	3	183273292	183273292	+	Silent	SNP	G	G	A	rs201171041		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:183273292G>A	ENST00000341319.3	-	1	185	c.150C>T	c.(148-150)gaC>gaT	p.D50D		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	50					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GTCCCGCGTCGTCAAATTTGA	0.483																																																	0													158.0	165.0	162.0					3																	183273292		2203	4300	6503	SO:0001819	synonymous_variant	0			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.150C>T	3.37:g.183273292G>A			B2RB31|D3DNS8|Q8N5I1|Q8N892	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D50	ENST00000341319.3	37	c.150	CCDS3245.2	3																																																																																			KLHL6	-	superfamily_BTB/POZ_fold,pirsf_Kelch-like_gigaxonin	ENSG00000172578		0.483	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL6	HGNC	protein_coding	OTTHUMT00000309024.1	-	0.00	42	0	G	NM_130446		183273292	-1	tier1	rs201171041	no_errors	ENST00000341319	ensembl	human	known	74_37	silent	16.22	31	6	SNP	0.976	A
LAMA1	284217	genome.wustl.edu	37	18	6986337	6986337	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr18:6986337T>G	ENST00000389658.3	-	37	5271	c.5178A>C	c.(5176-5178)gaA>gaC	p.E1726D		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1726	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACAATAAATCTTCAGCAGCCC	0.353																																																	0													61.0	60.0	61.0					18																	6986337		2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5178A>C	18.37:g.6986337T>G	ENSP00000374309:p.Glu1726Asp			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.E1726D	ENST00000389658.3	37	c.5178	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	t	13.64	2.296260	0.40594	.	.	ENSG00000101680	ENST00000389658	T	0.10960	2.82	5.8	2.17	0.27698	Laminin I (1);	0.258238	0.37809	N	0.001923	T	0.15176	0.0366	L	0.53249	1.67	0.23156	N	0.998202	P	0.48834	0.916	P	0.49085	0.6	T	0.04885	-1.0920	10	0.48119	T	0.1	.	9.598	0.39587	0.0:0.2607:0.0:0.7393	.	1726	P25391	LAMA1_HUMAN	D	1726	ENSP00000374309:E1726D	ENSP00000374309:E1726D	E	-	3	2	LAMA1	6976337	0.768000	0.28519	0.601000	0.28877	0.354000	0.29330	0.748000	0.26305	0.473000	0.27368	-0.256000	0.11100	GAA	LAMA1	-	pfam_Laminin_I	ENSG00000101680		0.353	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	88	0	T	NM_005559		6986337	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	46.00	27	23	SNP	0.368	G
LAT2	7462	genome.wustl.edu	37	7	73631157	73631157	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:73631157G>A	ENST00000460943.1	+	4	986	c.97G>A	c.(97-99)Gca>Aca	p.A33T	LAT2_ENST00000275635.7_Missense_Mutation_p.A33T|LAT2_ENST00000344995.5_Missense_Mutation_p.A33T|LAT2_ENST00000398475.1_Missense_Mutation_p.A33T	NM_032464.2	NP_115853.2	Q9UHI5	LAT2_HUMAN	linker for activation of T cells family, member 2	0					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6					L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	TCTTGCAGGTGCAAAGAGGTC	0.552																																																	0													84.0	90.0	88.0					7																	73631157		1950	4153	6103	SO:0001583	missense	0			AF257135	CCDS5566.2	7q11.23	2011-11-01	2005-04-26	2005-04-26	ENSG00000086730	ENSG00000086730			12749	protein-coding gene	gene with protein product	"""linker for activation of B cells"", ""non-T cell activation linker"", ""linker for activation of T cells, transmembrane adaptor 2"""	605719	"""Williams-Beuren syndrome chromosome region 5"""	WBSCR15, WBSCR5		8812460, 12514734	Standard	NM_032464		Approved	WSCR5, HSPC046, LAB, NTAL	uc003uai.3	Q9GZY6	OTTHUMG00000130151	ENST00000460943.1:c.97G>A	7.37:g.73631157G>A	ENSP00000420494:p.Ala33Thr		B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	NULL	p.A33T	ENST00000460943.1	37	c.97	CCDS5566.2	7	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797039	0.31777	.	.	ENSG00000086730	ENST00000465116;ENST00000344995;ENST00000460943;ENST00000475494;ENST00000398475;ENST00000361082;ENST00000275635;ENST00000470709	T;T;T;T;T;T;T;T	0.04015	3.73;3.73;3.73;3.73;3.73;3.73;3.73;3.73	3.84	0.985	0.19779	.	1.625650	0.04094	N	0.311852	T	0.02649	0.0080	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.12156	0.007	T	0.43702	-0.9375	10	0.12103	T	0.63	-2.6288	4.1333	0.10159	0.2252:0.2173:0.5575:0.0	.	33	Q9GZY6	NTAL_HUMAN	T	33	ENSP00000420549:A33T;ENSP00000344881:A33T;ENSP00000420494:A33T;ENSP00000417533:A33T;ENSP00000381492:A33T;ENSP00000354374:A33T;ENSP00000275635:A33T;ENSP00000419150:A33T	ENSP00000275635:A33T	A	+	1	0	LAT2	73269093	0.000000	0.05858	0.006000	0.13384	0.761000	0.43186	-0.035000	0.12205	0.200000	0.20447	0.561000	0.74099	GCA	LAT2	-	NULL	ENSG00000086730		0.552	LAT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LAT2	HGNC	protein_coding	OTTHUMT00000277062.1		0.00	61	0	G			73631157	+1			no_errors	ENST00000275635	ensembl	human	known	74_37	missense	7.69	60	5	SNP	0.007	A
LCE3A	353142	genome.wustl.edu	37	1	152595447	152595447	+	Missense_Mutation	SNP	G	G	A	rs375349290		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:152595447G>A	ENST00000335674.1	-	1	132	c.133C>T	c.(133-135)Cgc>Tgc	p.R45C		NM_178431.1	NP_848518.1	Q5TA76	LCE3A_HUMAN	late cornified envelope 3A	45					keratinization (GO:0031424)					endometrium(1)|lung(5)	6	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGCAGCTGCGCTCGGAGCTG	0.657																																																	0													47.0	50.0	49.0					1																	152595447		2203	4300	6503	SO:0001583	missense	0				CCDS1017.1	1q21.3	2008-02-05			ENSG00000185962	ENSG00000185962		"""Late cornified envelopes"""	29461	protein-coding gene	gene with protein product		612613				11698679	Standard	NM_178431		Approved	LEP13	uc010pdt.2	Q5TA76	OTTHUMG00000012397	ENST00000335674.1:c.133C>T	1.37:g.152595447G>A	ENSP00000335006:p.Arg45Cys			Missense_Mutation	SNP	NULL	p.R45C	ENST00000335674.1	37	c.133	CCDS1017.1	1	.	.	.	.	.	.	.	.	.	.	C	8.887	0.953125	0.18431	.	.	ENSG00000185962	ENST00000335674	T	0.03553	3.89	3.61	1.65	0.23941	.	.	.	.	.	T	0.00936	0.0031	.	.	.	0.09310	N	1	B	0.23058	0.079	B	0.10450	0.005	T	0.48031	-0.9070	8	0.56958	D	0.05	.	4.2341	0.10616	0.0:0.5864:0.1897:0.2239	.	45	Q5TA76	LCE3A_HUMAN	C	45	ENSP00000335006:R45C	ENSP00000335006:R45C	R	-	1	0	LCE3A	150862071	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.720000	0.04969	0.014000	0.14944	-0.786000	0.03341	CGC	LCE3A	-	NULL	ENSG00000185962		0.657	LCE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE3A	HGNC	protein_coding	OTTHUMT00000034517.2	-	0.00	71	0	G	NM_178431		152595447	-1	tier1	-	no_errors	ENST00000335674	ensembl	human	known	74_37	missense	26.32	42	15	SNP	0.000	A
LMF1	64788	genome.wustl.edu	37	16	920018	920018	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:920018G>A	ENST00000262301.11	-	9	1299	c.1281C>T	c.(1279-1281)tcC>tcT	p.S427S	LMF1_ENST00000399843.2_Silent_p.S427S|LMF1_ENST00000543238.1_Silent_p.S190S|LMF1_ENST00000568897.1_Silent_p.S210S|LMF1_ENST00000568268.1_5'Flank	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	427					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				CGCTGGCGTTGGAGCTGGCTG	0.677																																																	0													53.0	63.0	60.0					16																	920018		2159	4253	6412	SO:0001819	synonymous_variant	0			AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.1281C>T	16.37:g.920018G>A			Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Silent	SNP	pfam_LMF	p.S427	ENST00000262301.11	37	c.1281	CCDS45373.1	16																																																																																			LMF1	-	pfam_LMF	ENSG00000103227		0.677	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LMF1	HGNC	protein_coding	OTTHUMT00000109071.3	-	0.00	113	0	G	NM_022773		920018	-1	tier1	-	no_errors	ENST00000262301	ensembl	human	known	74_37	silent	34.57	53	28	SNP	0.907	A
LMNB2	84823	genome.wustl.edu	37	19	2431820	2431820	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:2431820G>A	ENST00000582871.1	-	10	1697	c.1611C>T	c.(1609-1611)ggC>ggT	p.G537G	LMNB2_ENST00000475819.1_5'UTR|LMNB2_ENST00000325327.3_Silent_p.G557G	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	537	LTD.|Tail.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAGCTCTCGCCCGTGCCCC	0.687																																																	0													57.0	49.0	52.0					19																	2431820		2200	4298	6498	SO:0001819	synonymous_variant	0			M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.1611C>T	19.37:g.2431820G>A			O75292|Q14734|Q96DF6	Silent	SNP	pfam_IF,pfam_Lamin_tail_dom,superfamily_Prefoldin	p.G557	ENST00000582871.1	37	c.1671		19																																																																																			LMNB2	-	pfam_Lamin_tail_dom	ENSG00000176619		0.687	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	LMNB2	HGNC	protein_coding		-	0.00	54	0	G	NM_032737		2431820	-1	tier1	-	no_errors	ENST00000325327	ensembl	human	known	74_37	silent	16.33	41	8	SNP	0.035	A
LMTK3	114783	genome.wustl.edu	37	19	49004773	49004773	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:49004773G>A	ENST00000600059.1	-	8	1068	c.841C>T	c.(841-843)Cgc>Tgc	p.R281C	LMTK3_ENST00000270238.3_Missense_Mutation_p.R310C			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	281	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		TCTCCGATGCGCACGGTCAGG	0.687																																																	0													42.0	51.0	48.0					19																	49004773		2178	4258	6436	SO:0001583	missense	0			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.841C>T	19.37:g.49004773G>A	ENSP00000472020:p.Arg281Cys		Q4G0U1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R310C	ENST00000600059.1	37	c.928		19	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245525	0.80024	.	.	ENSG00000142235	ENST00000270238	D	0.83673	-1.75	3.44	3.44	0.39384	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000003	D	0.84844	0.5562	L	0.31578	0.945	0.52099	D	0.999947	D	0.89917	1.0	D	0.79784	0.993	D	0.86567	0.1845	10	0.87932	D	0	.	12.8489	0.57846	0.0:0.0:1.0:0.0	.	281	Q96Q04	LMTK3_HUMAN	C	310	ENSP00000270238:R310C	ENSP00000270238:R310C	R	-	1	0	LMTK3	53696585	0.993000	0.37304	1.000000	0.80357	0.970000	0.65996	2.524000	0.45589	1.950000	0.56595	0.444000	0.29173	CGC	LMTK3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000142235		0.687	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	LMTK3	HGNC	protein_coding	OTTHUMT00000466137.1	-	0.00	65	0	G	NM_052895		49004773	-1	tier1	-	no_errors	ENST00000270238	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	A
LOC101927588	101927588	genome.wustl.edu	37	8	125220497	125220497	+	lincRNA	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:125220497C>A	ENST00000523703.1	-	0	180																											tggtcgctggcaggctgtagt	0.542																																																	0																																												0																															8.37:g.125220497C>A				RNA	SNP	-	NULL	ENST00000523703.1	37	NULL		8																																																																																			RP11-37N22.1	-	-	ENSG00000214803		0.542	RP11-37N22.1-001	KNOWN	basic|exp_conf	lincRNA	LOC101927588	Clone_based_vega_gene	lincRNA	OTTHUMT00000381461.1	-	0.00	37	0	C			125220497	-1	tier1	-	no_errors	ENST00000523703	ensembl	human	known	74_37	rna	16.22	31	6	SNP	0.009	A
FRMD4A	55691	genome.wustl.edu	37	10	13686069	13686069	+	3'UTR	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:13686069T>C	ENST00000357447.2	-	0	6457				RP11-295P9.3_ENST00000596044.1_Intron|FRMD4A_ENST00000358621.4_3'UTR|RP11-295P9.3_ENST00000610032.1_3'UTR	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A						establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TGGGGTTTGCTATATTTAGAA	0.308																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.*2969A>G	10.37:g.13686069T>C			A7E2Y3|Q5T377	RNA	SNP	-	NULL	ENST00000357447.2	37	NULL	CCDS7101.1	10																																																																																			RP11-295P9.3	-	-	ENSG00000239665		0.308	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC101928524	Clone_based_vega_gene	protein_coding	OTTHUMT00000046889.1	-	0.00	37	0	T	NM_018027		13686069	+1	tier1	-	no_errors	ENST00000610032	ensembl	human	known	74_37	rna	15.38	22	4	SNP	1.000	C
DPP6	1804	genome.wustl.edu	37	7	153756397	153756397	+	Intron	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:153756397C>T	ENST00000377770.3	+	1	384				DPP6_ENST00000406326.1_Intron|DPP6_ENST00000404039.1_Intron|AC006019.3_ENST00000425591.1_RNA			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6						cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GAGAGCCAGACCCTCTTCCCC	0.607																																					NSCLC(125;1384 1783 2490 7422 34254)												0																																										SO:0001627	intron_variant	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.243+6249C>T	7.37:g.153756397C>T				RNA	SNP	-	NULL	ENST00000377770.3	37	NULL		7																																																																																			AC006019.3	-	-	ENSG00000203335		0.607	DPP6-003	KNOWN	basic|appris_principal	protein_coding	LOC101930187	Clone_based_vega_gene	protein_coding	OTTHUMT00000322932.1	-	0.00	12	0	C	NM_130797		153756397	-1	tier1	-	no_errors	ENST00000425591	ensembl	human	known	74_37	rna	71.43	2	5	SNP	0.075	T
LPA	4018	genome.wustl.edu	37	6	160999713	160999713	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:160999713C>A	ENST00000316300.5	-	27	4357	c.4313G>T	c.(4312-4314)aGg>aTg	p.R1438M	LPA_ENST00000447678.1_Missense_Mutation_p.R1438M			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3946	Kringle 13. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	ATCTGGATTCCTGCAGTAGTT	0.498																																																	0													85.0	85.0	85.0					6																	160999713		2082	4244	6326	SO:0001583	missense	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4313G>T	6.37:g.160999713C>A	ENSP00000321334:p.Arg1438Met		Q5VTD7|Q9UD88	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1	p.R1438M	ENST00000316300.5	37	c.4313	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	c	15.54	2.862483	0.51482	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	D;D	0.93953	-3.32;-3.32	2.37	2.37	0.29283	Kringle (4);Kringle-like fold (1);Kringle, conserved site (1);	.	.	.	.	D	0.97977	0.9334	H	0.99855	4.85	0.43971	D	0.996658	D	0.89917	1.0	D	0.97110	1.0	D	0.97250	0.9897	9	0.87932	D	0	.	10.3857	0.44138	0.0:1.0:0.0:0.0	.	3946	P08519	APOA_HUMAN	M	1438	ENSP00000321334:R1438M;ENSP00000395608:R1438M	ENSP00000321334:R1438M	R	-	2	0	LPA	160919703	0.853000	0.29707	0.333000	0.25482	0.140000	0.21249	3.140000	0.50585	1.308000	0.44962	0.174000	0.16983	AGG	LPA	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000198670		0.498	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1		0.00	81	0	C	NM_005577		160999713	-1			no_errors	ENST00000316300	ensembl	human	known	74_37	missense	8.75	73	7	SNP	1.000	A
LPHN2	23266	genome.wustl.edu	37	1	82457881	82457881	+	3'UTR	SNP	A	A	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:82457881A>T	ENST00000370728.1	+	0	6077				LPHN2_ENST00000370730.1_3'UTR|LPHN2_ENST00000370717.2_3'UTR|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000271029.4_3'UTR|LPHN2_ENST00000394879.1_3'UTR|LPHN2_ENST00000335786.5_3'UTR			O95490	LPHN2_HUMAN	latrophilin 2						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		ATTCttttttaaaaaaataaa	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.*1052A>T	1.37:g.82457881A>T			A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	RNA	SNP	-	NULL	ENST00000370728.1	37	NULL		1																																																																																			LPHN2	-	-	ENSG00000117114		0.299	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	-	0.00	29	0	A	NM_012302		82457881	+1	tier1	-	no_errors	ENST00000469377	ensembl	human	known	74_37	rna	24.14	22	7	SNP	0.986	T
LRCOL1	100507055	genome.wustl.edu	37	12	133179888	133179888	+	lincRNA	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:133179888G>A	ENST00000545517.1	-	0	1842							A6NCL2	LRCL1_HUMAN	leucine rich colipase-like 1						digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										AGCACAAACCGTAAGGGAAGC	0.612																																																	0																																												0				CCDS73547.1	12q24.33	2012-07-02			ENSG00000204583	ENSG00000204583			44160	protein-coding gene	gene with protein product							Standard	NM_001195520		Approved		uc021rgr.1	A6NCL2	OTTHUMG00000168043		12.37:g.133179888G>A			H9BFB1	RNA	SNP	-	NULL	ENST00000545517.1	37	NULL		12																																																																																			LRCOL1	-	-	ENSG00000204583		0.612	LRCOL1-003	KNOWN	basic	lincRNA	LRCOL1	HGNC	lincRNA	OTTHUMT00000397683.1	-	0.00	92	0	G	NM_001195520		133179888	-1	tier1	-	no_errors	ENST00000376608	ensembl	human	known	74_37	rna	29.03	44	18	SNP	0.001	A
LRRC9	341883	genome.wustl.edu	37	14	60451884	60451884	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:60451884T>G	ENST00000445360.1	+	17	2357	c.2153T>G	c.(2152-2154)cTt>cGt	p.L718R	RP11-16B13.1_ENST00000554123.1_RNA|RP11-16B13.1_ENST00000555432.1_RNA			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	718																	TTAACAGGACTTCGAAAACTA	0.303																																																	0																																										SO:0001583	missense	0			AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.2153T>G	14.37:g.60451884T>G	ENSP00000454748:p.Leu718Arg			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L718R	ENST00000445360.1	37	c.2153		14																																																																																			LRRC9	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000131951		0.303	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC9	HGNC	protein_coding	OTTHUMT00000072281.3	-	0.00	53	0	T			60451884	+1	tier1	-	no_errors	ENST00000254271	ensembl	human	known	74_37	missense	25.00	33	11	SNP	1.000	G
MACF1	23499	genome.wustl.edu	37	1	39784168	39784168	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:39784168C>G	ENST00000372915.3	+	29	3928	c.3841C>G	c.(3841-3843)Cga>Gga	p.R1281G	MACF1_ENST00000567887.1_Missense_Mutation_p.R1313G|MACF1_ENST00000539005.1_Missense_Mutation_p.R1281G|MACF1_ENST00000361689.2_Missense_Mutation_p.R1281G|MACF1_ENST00000564288.1_Missense_Mutation_p.R1276G|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000545844.1_Missense_Mutation_p.R1281G|MACF1_ENST00000317713.7_Missense_Mutation_p.R1281G			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1281					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGGAGATTACCGAGCCTGCCA	0.463																																																	0													65.0	62.0	63.0					1																	39784168		2203	4300	6503	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.3841C>G	1.37:g.39784168C>G	ENSP00000362006:p.Arg1281Gly		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R1281G	ENST00000372915.3	37	c.3841		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.09|19.09	3.759248|3.759248	0.69763|0.69763	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262	.|T;T;T;T;T;T;T	.|0.35421	.|1.31;1.31;1.31;1.31;1.31;1.65;1.65	5.97|5.97	0.605|0.605	0.17553|0.17553	.|.	.|.	.|.	.|.	.|.	T|T	0.60728|0.60728	0.2291|0.2291	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	.|D;P;P	.|0.89917	.|1.0;0.917;0.747	.|D;P;P	.|0.87578	.|0.998;0.622;0.597	T|T	0.66838|0.66838	-0.5822|-0.5822	5|9	.|0.66056	.|D	.|0.02	.|.	17.4674|17.4674	0.87637|0.87637	0.6822:0.3178:0.0:0.0|0.6822:0.3178:0.0:0.0	.|.	.|1281;1281;1246	.|F8W8Q1;Q9UPN3-2;Q9UPN3-3	.|.;.;.	R|G	414|1281;1281;1281;1281;1281;1239;1430	.|ENSP00000439537:R1281G;ENSP00000362006:R1281G;ENSP00000354573:R1281G;ENSP00000313438:R1281G;ENSP00000444364:R1281G;ENSP00000435070:R1239G;ENSP00000437059:R1430G	.|ENSP00000313438:R1281G	P|R	+|+	2|1	0|2	MACF1|MACF1	39556755|39556755	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.998000|0.998000	0.95712|0.95712	1.326000|1.326000	0.33735|0.33735	-0.135000|-0.135000	0.11495|0.11495	0.655000|0.655000	0.94253|0.94253	CCG|CGA	MACF1	-	smart_Spectrin/alpha-actinin	ENSG00000127603		0.463	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	61	0	C	NM_033044		39784168	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	11.36	38	5	SNP	0.999	G
MAGEC3	139081	genome.wustl.edu	37	X	140984912	140984912	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chrX:140984912G>A	ENST00000298296.1	+	7	1368	c.1368G>A	c.(1366-1368)ctG>ctA	p.L456L	MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000443323.2_Silent_p.L78L|MAGEC3_ENST00000544766.1_Silent_p.L158L|MAGEC3_ENST00000409007.1_Silent_p.L158L|MAGEC3_ENST00000536088.1_Silent_p.L158L	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	456	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GGTATGCCCTGGATGAAAAGG	0.483																																																	0													78.0	72.0	74.0					X																	140984912		2203	4300	6503	SO:0001819	synonymous_variant	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1368G>A	X.37:g.140984912G>A			Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L456	ENST00000298296.1	37	c.1368	CCDS14676.1	X																																																																																			MAGEC3	-	pfscan_MAGE	ENSG00000165509		0.483	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1		0.00	40	0	G	NM_138702		140984912	+1			no_errors	ENST00000298296	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.001	A
MAMDC2	256691	genome.wustl.edu	37	9	72840670	72840672	+	In_Frame_Del	DEL	TTT	TTT	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	TTT	TTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:72840670_72840672delTTT	ENST00000377182.4	+	13	2533_2535	c.1916_1918delTTT	c.(1915-1920)attttt>att	p.F640del	SMC5-AS1_ENST00000594708.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	640	MAM 4. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						TTTCAGATAATTTTTGAAGCCAT	0.345																																																	0																																										SO:0001651	inframe_deletion	0			BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.1916_1918delTTT	9.37:g.72840670_72840672delTTT	ENSP00000366387:p.Phe640del		Q5VW47|Q8WX43|Q96BM4	In_Frame_Del	DEL	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom	p.F640in_frame_del	ENST00000377182.4	37	c.1916_1918	CCDS6631.1	9																																																																																			MAMDC2	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom	ENSG00000165072		0.345	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAMDC2	HGNC	protein_coding	OTTHUMT00000052600.1		0.00	56	0	TTT	NM_153267		72840672	+1	tier1		no_errors	ENST00000377182	ensembl	human	known	74_37	in_frame_del	16.18	57	11	DEL	1.000:0.997:1.000	-
MAP2	4133	genome.wustl.edu	37	2	210559608	210559608	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:210559608G>A	ENST00000360351.4	+	7	3220	c.2714G>A	c.(2713-2715)cGa>cAa	p.R905Q	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.R901Q	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	905					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GATAAAGTTCGAAGAGATTTG	0.448																																					Pancreas(27;423 979 28787 29963)												0													71.0	71.0	71.0					2																	210559608		2203	4300	6503	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2714G>A	2.37:g.210559608G>A	ENSP00000353508:p.Arg905Gln		Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.R905Q	ENST00000360351.4	37	c.2714	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.042877	0.75732	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.26223	1.75;1.75	5.9	5.9	0.94986	MAP2/Tau projection (1);	0.000000	0.52532	D	0.000062	T	0.50171	0.1600	L	0.59436	1.845	0.36792	D	0.884906	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.54543	-0.8278	10	0.87932	D	0	-9.5774	18.4573	0.90725	0.0:0.0:1.0:0.0	.	901;905	P11137-3;P11137	.;MAP2_HUMAN	Q	905;901	ENSP00000353508:R905Q;ENSP00000392164:R901Q	ENSP00000353508:R905Q	R	+	2	0	MAP2	210267853	0.998000	0.40836	0.913000	0.36048	0.986000	0.74619	3.747000	0.55134	2.808000	0.96608	0.650000	0.86243	CGA	MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.448	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2		0.00	38	0	G	NM_001039538		210559608	+1			no_errors	ENST00000360351	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.968	A
BMS1P21	100288974	genome.wustl.edu	37	10	81666445	81666445	+	IGR	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:81666445C>T								NUTM2E (55813 upstream) : MBL1P (13488 downstream)																							TCTGCAGGATCTCCAGCTAGG	0.438																																																	0																																										SO:0001628	intergenic_variant	0																															10.37:g.81666445C>T				RNA	SNP	-	NULL		37	NULL		10																																																																																			MBL1P	-	-	ENSG00000242600	0	0.438					MBL1P	HGNC			-	0.00	431	0	C			81666445	+1	tier1	-	no_errors	ENST00000453174	ensembl	human	known	74_37	rna	22.85	367	109	SNP	0.544	T
MICALCL	84953	genome.wustl.edu	37	11	12376403	12376403	+	Splice_Site	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:12376403G>T	ENST00000256186.2	+	8	2193	c.1902G>T	c.(1900-1902)gaG>gaT	p.E634D		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	634					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		TGCTCAAGGAGGGTGAGTATG	0.502																																																	0													70.0	71.0	70.0					11																	12376403		1903	4132	6035	SO:0001630	splice_region_variant	0			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1903+1G>T	11.37:g.12376403G>T			Q7RTP7|Q96JU6	Missense_Mutation	SNP	pfam_DUF3585,smart_ProQ/FinO	p.E634D	ENST00000256186.2	37	c.1902	CCDS41620.1	11	.	.	.	.	.	.	.	.	.	.	G	11.87	1.768270	0.31320	.	.	ENSG00000133808	ENST00000256186	T	0.47177	0.85	5.81	-4.9	0.03094	Domain of unknown function DUF3585 (1);	0.291028	0.18007	N	0.154711	T	0.15305	0.0369	N	0.05487	-0.04	0.26109	N	0.980703	B	0.17852	0.024	B	0.26969	0.075	T	0.30090	-0.9990	10	0.06236	T	0.91	.	0.8754	0.01223	0.2125:0.2585:0.1397:0.3893	.	634	Q6ZW33	MICLK_HUMAN	D	634	ENSP00000256186:E634D	ENSP00000256186:E634D	E	+	3	2	MICALCL	12332979	0.879000	0.30193	0.982000	0.44146	0.878000	0.50629	-0.229000	0.09098	-0.452000	0.07087	-0.175000	0.13238	GAG	MICALCL	-	pfam_DUF3585	ENSG00000133808		0.502	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALCL	HGNC	protein_coding	OTTHUMT00000386164.1	-	0.00	69	0	G	NM_032867	Missense_Mutation	12376403	+1	tier1	-	no_errors	ENST00000256186	ensembl	human	known	74_37	missense	20.43	74	19	SNP	0.789	T
MME	4311	genome.wustl.edu	37	3	154898237	154898237	+	Missense_Mutation	SNP	C	C	T	rs141665432	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:154898237C>T	ENST00000460393.1	+	23	2362	c.2242C>T	c.(2242-2244)Cgg>Tgg	p.R748W	MME_ENST00000492661.1_Missense_Mutation_p.R748W|MME_ENST00000493237.1_Missense_Mutation_p.R748W|MME-AS1_ENST00000484721.1_RNA|MME_ENST00000360490.2_Missense_Mutation_p.R748W|MME_ENST00000462745.1_Missense_Mutation_p.R748W	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	748					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	AAAGAAGTGCCGGGTTTGGTG	0.438													C|||	2	0.000399361	0.0	0.0	5008	,	,		17786	0.0		0.0	False		,,,				2504	0.002																0								C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	86.0	91.0	90.0		2242,2242,2242,2242	3.8	0.7	3	dbSNP_134	90	0,8600		0,0,4300	yes	missense,missense,missense,missense	MME	NM_000902.3,NM_007287.2,NM_007288.2,NM_007289.2	101,101,101,101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging	748/751,748/751,748/751,748/751	154898237	2,13004	2203	4300	6503	SO:0001583	missense	0				CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.2242C>T	3.37:g.154898237C>T	ENSP00000418525:p.Arg748Trp		A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.R748W	ENST00000460393.1	37	c.2242	CCDS3172.1	3	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051988	0.75960	4.54E-4	0.0	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	D;D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89;-2.89	5.65	3.85	0.44370	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.187842	0.47093	D	0.000260	D	0.96629	0.8900	H	0.94542	3.55	0.50039	D	0.999843	D	0.89917	1.0	D	0.97110	1.0	D	0.95875	0.8894	10	0.87932	D	0	-15.156	9.3556	0.38164	0.1434:0.7841:0.0:0.0725	.	748	P08473	NEP_HUMAN	W	748	ENSP00000420389:R748W;ENSP00000418525:R748W;ENSP00000419653:R748W;ENSP00000417079:R748W;ENSP00000353679:R748W	ENSP00000353679:R748W	R	+	1	2	MME	156380931	1.000000	0.71417	0.704000	0.30370	0.881000	0.50899	4.055000	0.57441	0.734000	0.32515	0.650000	0.86243	CGG	MME	-	pfam_Peptidase_M13_C	ENSG00000196549		0.438	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MME	HGNC	protein_coding	OTTHUMT00000351076.1	-	0.00	28	0	C	NM_000902		154898237	+1	tier1	rs141665432	no_errors	ENST00000360490	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.998	T
MROH7	374977	genome.wustl.edu	37	1	55145583	55145583	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:55145583G>A	ENST00000421030.2	+	13	2531	c.2246G>A	c.(2245-2247)gGc>gAc	p.G749D	MROH7_ENST00000454855.2_Missense_Mutation_p.G267D|MROH7_ENST00000395690.2_Missense_Mutation_p.G749D|MROH7_ENST00000339553.5_Missense_Mutation_p.G749D|MROH7_ENST00000545244.1_Missense_Mutation_p.G317D|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.G749D|MROH7_ENST00000409996.1_Missense_Mutation_p.G317D	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	749						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											ATCATGCAAGGCATCTACATG	0.647																																																	0													90.0	100.0	97.0					1																	55145583		2000	4167	6167	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2246G>A	1.37:g.55145583G>A	ENSP00000396622:p.Gly749Asp		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G749D	ENST00000421030.2	37	c.2246	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375688	0.42105	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73	3.75	0.21	0.15231	.	0.862161	0.09554	N	0.786534	T	0.59088	0.2168	M	0.63843	1.955	0.25584	N	0.986761	D;D;P	0.61080	0.989;0.989;0.898	P;P;P	0.58928	0.848;0.776;0.572	T	0.53989	-0.8360	10	0.32370	T	0.25	-5.1365	12.4248	0.55540	0.0:0.5197:0.4803:0.0	.	749;749;317	F8W8P2;Q68CQ1;F5H7R4	.;HEAT8_HUMAN;.	D	749;317;778;749;317;267;749	ENSP00000396622:G749D;ENSP00000442333:G317D;ENSP00000343211:G749D;ENSP00000387048:G317D;ENSP00000401130:G267D;ENSP00000379044:G749D	ENSP00000343211:G749D	G	+	2	0	HEATR8	54918171	1.000000	0.71417	0.990000	0.47175	0.690000	0.40134	1.437000	0.34991	-0.187000	0.10516	0.455000	0.32223	GGC	MROH7-TTC4	-	superfamily_ARM-type_fold	ENSG00000271723		0.647	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7-TTC4	HGNC	protein_coding	OTTHUMT00000346978.1		0.00	27	0	G	NM_198547		55145583	+1			no_errors	ENST00000414150	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.990	A
MT-ND2	4536	genome.wustl.edu	37	M	2292	2292	+	5'Flank	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chrM:2292G>A	ENST00000361453.3	+	0	0				MT-ND1_ENST00000361390.2_5'Flank|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TF_ENST00000387314.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CACCCTATAGAAGAACTAATG	0.383																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2292G>A	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.383	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	94	0	G	YP_003024027		2292	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	18.95	123	29	SNP	NULL	A
MTRNR2L1	100462977	genome.wustl.edu	37	17	22024731	22024731	+	IGR	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:22024731T>C	ENST00000540040.1	+	0	1555				RP11-846F4.12_ENST00000483901.2_RNA|MTND1P15_ENST00000579693.1_RNA	NM_001190452.1	NP_001177381.1			MT-RNR2-like 1																		CGCCCTATTCTTTATAGCCGA	0.378																																																	0																																										SO:0001628	intergenic_variant	0			CR612552	CCDS54097.1	17p11.2	2014-02-18			ENSG00000256618	ENSG00000256618			37155	protein-coding gene	gene with protein product	"""humanin-like 1"""					19477263	Standard	NM_001190452		Approved		uc002gzb.2	P0CJ68	OTTHUMG00000179068		17.37:g.22024731T>C				RNA	SNP	-	NULL	ENST00000540040.1	37	NULL	CCDS54097.1	17																																																																																			MTND1P15	-	-	ENSG00000264168		0.378	MTRNR2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTND1P15	HGNC	protein_coding	OTTHUMT00000444600.2	-	0.00	25	0	T	NM_001190452		22024731	+1	tier1	-	no_errors	ENST00000579693	ensembl	human	known	74_37	rna	25.00	12	4	SNP	0.999	C
MTO1	25821	genome.wustl.edu	37	6	74190469	74190469	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:74190469C>T	ENST00000370300.4	+	8	1366	c.1276C>T	c.(1276-1278)Cga>Tga	p.R426*	MTO1_ENST00000370305.1_Nonsense_Mutation_p.R352*|MTO1_ENST00000415954.2_Nonsense_Mutation_p.R401*|MTO1_ENST00000498286.1_Nonsense_Mutation_p.R401*	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	426					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						TTTGGTTCAACGACTCTTCTT	0.413																																																	0													160.0	143.0	149.0					6																	74190469		2203	4300	6503	SO:0001587	stop_gained	0			AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.1276C>T	6.37:g.74190469C>T	ENSP00000359323:p.Arg426*		B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Nonsense_Mutation	SNP	pfam_GIDA-rel,pfam_FAD_bind_dom,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_GidA	p.R401*	ENST00000370300.4	37	c.1201	CCDS4979.1	6	.	.	.	.	.	.	.	.	.	.	C	15.68	2.906423	0.52333	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370305;ENST00000370300	.	.	.	5.15	4.26	0.50523	.	0.059282	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-15.3552	12.583	0.56401	0.3019:0.6981:0.0:0.0	.	.	.	.	X	401;401;304;352;426	.	ENSP00000350506:R304X	R	+	1	2	MTO1	74247190	1.000000	0.71417	0.954000	0.39281	0.556000	0.35491	3.176000	0.50863	1.096000	0.41439	0.591000	0.81541	CGA	MTO1	-	pfam_GIDA-rel,tigrfam_GidA	ENSG00000135297		0.413	MTO1-003	KNOWN	basic|CCDS	protein_coding	MTO1	HGNC	protein_coding	OTTHUMT00000041215.2	-	0.00	77	0	C	NM_012123		74190469	+1	tier1	-	no_errors	ENST00000415954	ensembl	human	known	74_37	nonsense	6.59	84	6	SNP	1.000	T
MTTP	4547	genome.wustl.edu	37	4	100540256	100540259	+	Splice_Site	DEL	GTAA	GTAA	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	GTAA	GTAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:100540256_100540259delGTAA	ENST00000265517.5	+	16	2545		c.e16+1		RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000511045.1_Splice_Site|MTTP_ENST00000457717.1_Splice_Site			P55157	MTP_HUMAN	microsomal triglyceride transfer protein						cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TGAAAAATAGGTAAGTGTTTATGC	0.338																																																	0																																										SO:0001630	splice_region_variant	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2342+1GTAA>-	4.37:g.100540256_100540259delGTAA			A8K428|Q08AM4|Q6P5T3	Splice_Site	DEL	-	e16+1	ENST00000265517.5	37	c.2342+1_2342+1	CCDS3651.1	4																																																																																			MTTP	-	-	ENSG00000138823		0.338	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3		0.00	64	0	GTAA		Intron	100540259	+1	tier1		no_errors	ENST00000265517	ensembl	human	known	74_37	splice_site_del	9.38	58	6	DEL	1.000:1.000:1.000:1.000	-
MUC17	140453	genome.wustl.edu	37	7	100685048	100685048	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:100685048T>G	ENST00000306151.4	+	3	10415	c.10351T>G	c.(10351-10353)Tca>Gca	p.S3451A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3451	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTTGCCAACCTCAACTACTAG	0.498																																																	0													236.0	248.0	244.0					7																	100685048		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10351T>G	7.37:g.100685048T>G	ENSP00000302716:p.Ser3451Ala		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S3451A	ENST00000306151.4	37	c.10351	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	T	7.411	0.634673	0.14322	.	.	ENSG00000169876	ENST00000306151	T	0.01963	4.53	1.29	0.0642	0.14352	.	.	.	.	.	T	0.02727	0.0082	N	0.14661	0.345	0.09310	N	1	P	0.52842	0.956	D	0.64410	0.925	T	0.44907	-0.9297	9	0.10111	T	0.7	.	3.5958	0.08005	0.0:0.5134:0.0:0.4866	.	3451	Q685J3	MUC17_HUMAN	A	3451	ENSP00000302716:S3451A	ENSP00000302716:S3451A	S	+	1	0	MUC17	100471768	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	-0.473000	0.06615	0.553000	0.29044	0.156000	0.16432	TCA	MUC17	-	NULL	ENSG00000169876		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	103	0	T	NM_001040105		100685048	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	17.12	92	19	SNP	0.006	G
MUC19	283463	genome.wustl.edu	37	12	40854119	40854119	+	Silent	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:40854119T>C	ENST00000454784.4	+	38	4162	c.3429T>C	c.(3427-3429)ggT>ggC	p.G1143G				Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	1143	Approximate repeats of G-V-T-G-T-T-G-P-S- A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CCGTCACTGGTGCTTCAGGCA	0.418																																																	0																																										SO:0001819	synonymous_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.3429T>C	12.37:g.40854119T>C			Q8NA85	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich	p.G1143	ENST00000454784.4	37	c.3429		12																																																																																			MUC19	-	NULL	ENSG00000205592		0.418	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	-	0.00	15	0	T	XM_003403524		40854119	+1	tier1	-	no_errors	ENST00000454784	ensembl	human	novel	74_37	silent	37.50	10	6	SNP	0.000	C
MUC4	4585	genome.wustl.edu	37	3	195515498	195515498	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:195515498C>T	ENST00000463781.3	-	2	3412	c.2953G>A	c.(2953-2955)Gca>Aca	p.A985T	MUC4_ENST00000475231.1_Missense_Mutation_p.A985T|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	990	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCTGTGGATGCCGAGGAAGCG	0.577																																																	0													74.0	68.0	70.0					3																	195515498		2197	4281	6478	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2953G>A	3.37:g.195515498C>T	ENSP00000417498:p.Ala985Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.A985T	ENST00000463781.3	37	c.2953	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	c	8.047	0.765126	0.15914	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.40225	1.04;1.04	.	.	.	.	2.756270	0.02100	N	0.053862	T	0.23886	0.0578	N	0.14661	0.345	0.09310	N	1	B	0.30727	0.292	B	0.26416	0.069	T	0.12604	-1.0541	8	0.15499	T	0.54	.	.	.	.	.	985	E7ESK3	.	T	985;985;959	ENSP00000417498:A985T;ENSP00000420243:A985T	ENSP00000376209:A959T	A	-	1	0	MUC4	196999893	0.001000	0.12720	0.001000	0.08648	0.000000	0.00434	1.058000	0.30504	0.367000	0.24454	0.372000	0.22366	GCA	MUC4	-	NULL	ENSG00000145113		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	232	0	C	NM_018406		195515498	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	8.13	191	17	SNP	0.001	T
MYLK2	85366	genome.wustl.edu	37	20	30414509	30414509	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:30414509C>T	ENST00000375994.2	+	6	1347	c.1074C>T	c.(1072-1074)ttC>ttT	p.F358F	MYLK2_ENST00000375985.4_Silent_p.F358F			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	358	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			IVLFMEY -> GGVCAHS (in Ref. 4; AAH07753). {ECO:0000305}.	cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TCGTCCTGTTCATGGAGTAGT	0.577																																																	0													97.0	80.0	86.0					20																	30414509		2203	4300	6503	SO:0001819	synonymous_variant	0			AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1074C>T	20.37:g.30414509C>T			Q569L1|Q96I84	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F358	ENST00000375994.2	37	c.1074	CCDS13191.1	20																																																																																			MYLK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000101306		0.577	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYLK2	HGNC	protein_coding	OTTHUMT00000078583.2	-	0.00	40	0	C	NM_033118		30414509	+1	tier1	-	no_errors	ENST00000375985	ensembl	human	known	74_37	silent	17.14	29	6	SNP	1.000	T
NAA16	79612	genome.wustl.edu	37	13	41894959	41894959	+	Splice_Site	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr13:41894959G>A	ENST00000379406.3	+	4	725	c.401G>A	c.(400-402)cGa>cAa	p.R134Q	NAA16_ENST00000403412.3_Splice_Site_p.R134Q|NAA16_ENST00000379367.3_Splice_Site_p.R134Q	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	134					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						GAAGGTTACCGAGTAAGTACT	0.358																																																	0													49.0	48.0	48.0					13																	41894959		2203	4300	6503	SO:0001630	splice_region_variant	0			AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.402+1G>A	13.37:g.41894959G>A			B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	pfam_TPR_2,pfam_NatA_aux_su,pfam_TPR_1,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R134Q	ENST00000379406.3	37	c.401	CCDS9379.1	13	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885687	0.72410	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	T;T;T	0.60171	0.21;0.21;0.21	4.99	4.99	0.66335	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.224873	0.29253	N	0.012684	T	0.75860	0.3907	M	0.75777	2.31	0.53688	D	0.999971	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.68621	0.938;0.959;0.956	T	0.78036	-0.2361	10	0.59425	D	0.04	-6.7463	18.4393	0.90660	0.0:0.0:1.0:0.0	.	134;134;134	Q6N069;Q6N069-4;Q6N069-5	NAA16_HUMAN;.;.	Q	134	ENSP00000368674:R134Q;ENSP00000368716:R134Q;ENSP00000386103:R134Q	ENSP00000368674:R134Q	R	+	2	0	NAA16	40792959	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.196000	0.77805	2.588000	0.87417	0.655000	0.94253	CGA	NAA16	-	pirsf_NatA_aux_su,pfscan_TPR-contain_dom	ENSG00000172766		0.358	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA16	HGNC	protein_coding	OTTHUMT00000044672.2	-	0.00	56	0	G	NM_018527	Missense_Mutation	41894959	+1	tier1	-	no_errors	ENST00000379406	ensembl	human	known	74_37	missense	13.73	44	7	SNP	1.000	A
NAGLU	4669	genome.wustl.edu	37	17	40693105	40693105	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:40693105A>G	ENST00000225927.2	+	5	1003	c.902A>G	c.(901-903)aAa>aGa	p.K301R	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	301					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	GAGCTGATCAAAGAGTTTGGC	0.567																																																	0			GRCh37	CD982816	NAGLU	D							131.0	123.0	126.0					17																	40693105		2203	4300	6503	SO:0001583	missense	0				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.902A>G	17.37:g.40693105A>G	ENSP00000225927:p.Lys301Arg			Missense_Mutation	SNP	pfam_NAGLU_tim-barrel,superfamily_Glycoside_hydrolase_SF	p.K301R	ENST00000225927.2	37	c.902	CCDS11427.1	17	.	.	.	.	.	.	.	.	.	.	A	12.46	1.944634	0.34283	.	.	ENSG00000108784	ENST00000225927	D	0.97976	-4.64	5.03	0.147	0.14838	Alpha-N-acetylglucosaminidase, tim-barrel domain (1);	0.392593	0.28156	N	0.016386	D	0.93959	0.8066	L	0.46885	1.475	0.29192	N	0.875805	B	0.11235	0.004	B	0.17098	0.017	D	0.86989	0.2109	10	0.38643	T	0.18	-0.416	5.0077	0.14297	0.5947:0.1463:0.2591:0.0	.	301	P54802	ANAG_HUMAN	R	301	ENSP00000225927:K301R	ENSP00000225927:K301R	K	+	2	0	NAGLU	37946631	1.000000	0.71417	0.259000	0.24435	0.778000	0.44026	2.994000	0.49433	-0.148000	0.11234	0.454000	0.30748	AAA	NAGLU	-	pfam_NAGLU_tim-barrel,superfamily_Glycoside_hydrolase_SF	ENSG00000108784		0.567	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAGLU	HGNC	protein_coding	OTTHUMT00000450385.1	-	0.00	45	0	A	NM_000263		40693105	+1	tier1	-	no_errors	ENST00000225927	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.919	G
NEK4	6787	genome.wustl.edu	37	3	52786006	52786006	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:52786006delT	ENST00000233027.5	-	7	1512	c.1310delA	c.(1309-1311)aagfs	p.K437fs	NEK4_ENST00000383721.4_Frame_Shift_Del_p.K437fs|NEK4_ENST00000535191.1_Frame_Shift_Del_p.K348fs	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	437					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		TGGTTCATTCTTTTCCCCAGT	0.478																																																	0													172.0	170.0	171.0					3																	52786006		2203	4300	6503	SO:0001589	frameshift_variant	0			L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.1310delA	3.37:g.52786006delT	ENSP00000233027:p.Lys437fs		A5YM70|B2R633|B7Z200|Q6P576	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K437fs	ENST00000233027.5	37	c.1310	CCDS2863.1	3																																																																																			NEK4	-	NULL	ENSG00000114904		0.478	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEK4	HGNC	protein_coding	OTTHUMT00000352386.2		0.00	39	0	T	NM_003157		52786006	-1	tier1		no_errors	ENST00000233027	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	0.001	-
NIN	51199	genome.wustl.edu	37	14	51223369	51223369	+	Missense_Mutation	SNP	T	T	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:51223369T>A	ENST00000382041.3	-	18	4569	c.4379A>T	c.(4378-4380)aAg>aTg	p.K1460M	NIN_ENST00000530997.2_Missense_Mutation_p.K1460M|NIN_ENST00000245441.5_Missense_Mutation_p.K1460M|NIN_ENST00000382043.4_Intron|NIN_ENST00000453196.1_Missense_Mutation_p.K1460M|NIN_ENST00000389868.3_Intron|NIN_ENST00000324330.9_Missense_Mutation_p.K1460M	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1460					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					ctcctgtaactttgttttctc	0.408			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													114.0	90.0	98.0					14																	51223369		2185	4264	6449	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4379A>T	14.37:g.51223369T>A	ENSP00000371472:p.Lys1460Met		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.K1460M	ENST00000382041.3	37	c.4379	CCDS32079.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.72|17.72	3.459690|3.459690	0.63401|0.63401	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196|ENST00000530997;ENST00000389869;ENST00000530853	T;T;T;T|.	0.08546|.	3.35;3.08;3.08;3.08|.	5.59|5.59	4.42|4.42	0.53409|0.53409	.|.	0.165539|0.165539	0.39985|0.39985	N|N	0.001211|0.001211	T|T	0.48909|0.48909	0.1526|0.1526	L|L	0.54323|0.54323	1.7|1.7	0.32106|0.32106	N|N	0.589947|0.589947	D;D;P;P|.	0.61080|.	0.989;0.979;0.925;0.828|.	P;P;P;B|.	0.51170|.	0.661;0.561;0.661;0.392|.	T|T	0.58493|0.58493	-0.7627|-0.7627	10|6	0.66056|.	D|.	0.02|.	-17.1474|-17.1474	8.662|8.662	0.34099|0.34099	0.0:0.0896:0.0:0.9104|0.0:0.0896:0.0:0.9104	.|.	1466;1460;1460;1460|.	Q8N4C6-5;C9J066;Q8N4C6;Q8N4C6-7|.	.;.;NIN_HUMAN;.|.	M|N	1460;1443;1466;1460;1460;1460|950	ENSP00000245441:K1460M;ENSP00000371472:K1460M;ENSP00000324210:K1460M;ENSP00000412391:K1460M|.	ENSP00000245441:K1460M|.	K|K	-|-	2|3	0|2	NIN|NIN	50293119|50293119	0.247000|0.247000	0.23920|0.23920	0.990000|0.990000	0.47175|0.47175	0.991000|0.991000	0.79684|0.79684	0.720000|0.720000	0.25896|0.25896	2.122000|2.122000	0.65172|0.65172	0.533000|0.533000	0.62120|0.62120	AAG|AAA	NIN	-	NULL	ENSG00000100503		0.408	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	-	0.00	65	0	T	NM_182946		51223369	-1	tier1	-	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	16.39	51	10	SNP	0.992	A
NKX2-6	137814	genome.wustl.edu	37	8	23560506	23560506	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:23560506C>T	ENST00000325017.3	-	2	363	c.364G>A	c.(364-366)Ggc>Agc	p.G122S	NKX2-6_ENST00000418222.1_Missense_Mutation_p.G40S	NM_001136271.2	NP_001129743.2	A6NCS4	NKX26_HUMAN	NK2 homeobox 6	122					atrial cardiac muscle cell development (GO:0055014)|cell differentiation (GO:0030154)|digestive tract development (GO:0048565)|embryonic heart tube development (GO:0035050)|hypothalamus development (GO:0021854)|negative regulation of apoptotic process (GO:0043066)|pericardium development (GO:0060039)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCCGAGCGGCCACCCCGCACG	0.726																																																	0													3.0	5.0	4.0					8																	23560506		651	1487	2138	SO:0001583	missense	0			CN272646		8p21.2	2012-03-09	2011-06-01			ENSG00000180053		"""Homeoboxes / ANTP class : NKL subclass"""	32940	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	611770	"""NK2 transcription factor related, locus 6 (Drosophila)"""			15649947	Standard	NM_001136271		Approved	CSX2, NKX4-2	uc011kzy.3	A6NCS4		ENST00000325017.3:c.364G>A	8.37:g.23560506C>T	ENSP00000320089:p.Gly122Ser			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.G122S	ENST00000325017.3	37	c.364		8	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121256	0.37436	.	.	ENSG00000180053	ENST00000325017;ENST00000418222	D;D	0.95518	-3.73;-3.73	3.99	0.94	0.19513	Homeodomain-related (1);Homeodomain-like (1);	1.055400	0.07514	N	0.909350	D	0.88032	0.6328	N	0.19112	0.55	0.09310	N	1	B	0.32051	0.354	B	0.29353	0.101	T	0.78290	-0.2261	10	0.10111	T	0.7	.	5.945	0.19213	0.0:0.6522:0.1559:0.1919	.	122	A6NCS4	NKX26_HUMAN	S	122;40	ENSP00000320089:G122S;ENSP00000402231:G40S	ENSP00000320089:G122S	G	-	1	0	NKX2-6	23616451	0.000000	0.05858	0.003000	0.11579	0.029000	0.11900	0.888000	0.28268	0.339000	0.23719	0.462000	0.41574	GGC	NKX2-6	-	superfamily_Homeodomain-like	ENSG00000180053		0.726	NKX2-6-001	KNOWN	basic|appris_principal	protein_coding	NKX2-6	HGNC	protein_coding	OTTHUMT00000376057.4	-	0.00	17	0	C	NM_001136271		23560506	-1	tier1	-	no_errors	ENST00000325017	ensembl	human	known	74_37	missense	29.41	12	5	SNP	0.013	T
NLK	51701	genome.wustl.edu	37	17	26370318	26370318	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:26370318C>T	ENST00000407008.3	+	1	1137	c.419C>T	c.(418-420)cCg>cTg	p.P140L	NLK_ENST00000583517.1_3'UTR|NLK_ENST00000582037.1_Missense_Mutation_p.P140L	NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Required for interaction with TAB2. {ECO:0000250}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GATATTGAGCCGGATAGACCT	0.507																																																	0													472.0	370.0	405.0					17																	26370318		2203	4300	6503	SO:0001583	missense	0			AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.419C>T	17.37:g.26370318C>T	ENSP00000384625:p.Pro140Leu		B2RCX1|Q2PNI9|Q6P2A3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P140L	ENST00000407008.3	37	c.419	CCDS11224.2	17	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732227	0.48939	.	.	ENSG00000087095	ENST00000407008	T	0.70749	-0.51	5.65	5.65	0.86999	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.54711	0.1875	N	0.05177	-0.1	0.80722	D	1	P	0.48589	0.912	B	0.41236	0.351	T	0.66352	-0.5945	10	0.87932	D	0	-14.3642	18.7287	0.91726	0.0:1.0:0.0:0.0	.	140	Q9UBE8	NLK_HUMAN	L	140	ENSP00000384625:P140L	ENSP00000384625:P140L	P	+	2	0	NLK	23394445	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	7.263000	0.78421	2.655000	0.90218	0.655000	0.94253	CCG	NLK	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000087095		0.507	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLK	HGNC	protein_coding	OTTHUMT00000255607.3	-	0.00	309	0	C	NM_016231		26370318	+1	tier1	-	no_errors	ENST00000407008	ensembl	human	known	74_37	missense	7.33	316	25	SNP	1.000	T
NME9	347736	genome.wustl.edu	37	3	138038346	138038346	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:138038346C>T	ENST00000333911.3	-	3	196	c.169G>A	c.(169-171)Ggc>Agc	p.G57S	NME9_ENST00000341790.5_Missense_Mutation_p.G57S|NME9_ENST00000536478.1_Missense_Mutation_p.G35S|NME9_ENST00000317876.4_Missense_Mutation_p.G35S|NME9_ENST00000484930.1_Missense_Mutation_p.G57S|NME9_ENST00000383180.2_Missense_Mutation_p.G35S			Q86XW9	TXND6_HUMAN	NME/NM23 family member 9	57	Thioredoxin.				cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										AGGTCCAGGCCGACCTCGATC	0.448																																																	0													74.0	66.0	69.0					3																	138038346		2203	4300	6503	SO:0001583	missense	0			AF196568	CCDS3099.1	3q22.3	2012-05-18	2012-05-18	2011-08-24	ENSG00000181322	ENSG00000181322			21343	protein-coding gene	gene with protein product			"""thioredoxin domain containing 6"", ""NME gene family member 9"", ""NME family member 9"""	TXNDC6		12569107, 19852809	Standard	NM_178130		Approved	TXL-2, NM23-H9	uc003ese.1	Q86XW9	OTTHUMG00000159823	ENST00000333911.3:c.169G>A	3.37:g.138038346C>T	ENSP00000335444:p.Gly57Ser		Q7Z4A8|Q8N1V7	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,pfam_Thioredoxin_domain,superfamily_Nucleoside_diP_kinase,superfamily_Thioredoxin-like_fold,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	p.G57S	ENST00000333911.3	37	c.169		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.952068|3.952068	0.73787|0.73787	.|.	.|.	ENSG00000181322|ENSG00000181322	ENST00000383180;ENST00000317876;ENST00000484930;ENST00000341790;ENST00000536478;ENST00000333911;ENST00000475751|ENST00000474690	T;T;T;T;T;T;T|.	0.46451|.	4.13;4.13;0.87;0.87;4.13;4.13;4.13|.	5.44|5.44	5.44|5.44	0.79542|0.79542	Thioredoxin domain (1);Thioredoxin-like fold (2);|.	0.057482|.	0.64402|.	D|.	0.000002|.	T|T	0.49287|0.49287	0.1548|0.1548	N|N	0.13140|0.13140	0.3|0.3	0.39235|0.39235	D|D	0.963754|0.963754	D;D;D|.	0.76494|.	0.999;0.999;0.992|.	P;D;P|.	0.66196|.	0.901;0.942;0.761|.	T|T	0.48948|0.48948	-0.8989|-0.8989	10|5	0.40728|.	T|.	0.16|.	-16.0982|-16.0982	16.7334|16.7334	0.85440|0.85440	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	57;57;35|.	Q86XW9-3;Q86XW9;Q86XW9-2|.	.;TXND6_HUMAN;.|.	S|Q	35;35;57;57;35;57;57|26	ENSP00000372667:G35S;ENSP00000321929:G35S;ENSP00000419882:G57S;ENSP00000341084:G57S;ENSP00000440143:G35S;ENSP00000335444:G57S;ENSP00000419147:G57S|.	ENSP00000321929:G35S|.	G|R	-|-	1|2	0|0	TXNDC6|TXNDC6	139521036|139521036	0.998000|0.998000	0.40836|0.40836	0.905000|0.905000	0.35620|0.35620	0.949000|0.949000	0.60115|0.60115	4.103000|4.103000	0.57783|0.57783	2.560000|2.560000	0.86352|0.86352	0.484000|0.484000	0.47621|0.47621	GGC|CGG	NME9	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000181322		0.448	NME9-003	KNOWN	basic|appris_principal	protein_coding	NME9	HGNC	protein_coding	OTTHUMT00000357583.1	-	0.00	39	0	C	NM_178130		138038346	-1	tier1	-	no_errors	ENST00000333911	ensembl	human	known	74_37	missense	19.44	29	7	SNP	0.960	T
NPIPB5	100132247	genome.wustl.edu	37	16	22503114	22503114	+	3'UTR	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:22503114T>C	ENST00000415654.1	+	0	2028				SMG1P1_ENST00000431681.1_RNA	NR_002555.2		A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5							integral component of membrane (GO:0016021)											TAAGGTATACTGTGTACCAGA	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000415654.1:c.*2025T>C	16.37:g.22503114T>C			B4DK13	RNA	SNP	-	NULL	ENST00000415654.1	37	NULL		16																																																																																			NPIPB5	-	-	ENSG00000243716		0.353	NPIPB5-016	KNOWN	mRNA_end_NF|basic	processed_transcript	NPIPB5	HGNC	protein_coding	OTTHUMT00000402477.1	-	0.00	83	0	T	NM_001135865		22503114	+1	tier1	-	no_errors	ENST00000415654	ensembl	human	known	74_37	rna	13.73	44	7	SNP	0.942	C
NRF1	4899	genome.wustl.edu	37	7	129350386	129350386	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:129350386C>G	ENST00000393232.1	+	7	1055	c.938C>G	c.(937-939)cCt>cGt	p.P313R	NRF1_ENST00000393231.3_Missense_Mutation_p.P313R|NRF1_ENST00000223190.4_Missense_Mutation_p.P313R|NRF1_ENST00000311967.2_Missense_Mutation_p.P313R|NRF1_ENST00000353868.4_Intron|NRF1_ENST00000393230.2_Missense_Mutation_p.P313R|NRF1_ENST00000539636.1_Missense_Mutation_p.P152R	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	313	Required for transcriptional activation.				cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						TTTAGTAACCCTGATGGCACT	0.483																																																	0													157.0	135.0	142.0					7																	129350386		2203	4300	6503	SO:0001583	missense	0			L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.938C>G	7.37:g.129350386C>G	ENSP00000376924:p.Pro313Arg		A8K4C6|B4DDV6|Q15305|Q96AN2	Missense_Mutation	SNP	pfam_Nrf1_NLS/DNA-bd_dimer,pfam_Nrf1_activation-bd	p.P313R	ENST00000393232.1	37	c.938	CCDS5813.2	7	.	.	.	.	.	.	.	.	.	.	C	27.9	4.874163	0.91664	.	.	ENSG00000106459	ENST00000393232;ENST00000539636;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	D;D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.88720	0.6513	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69307	0.963;0.946	D	0.86936	0.2076	10	0.45353	T	0.12	-10.5697	19.8676	0.96824	0.0:1.0:0.0:0.0	.	313;313	Q96AN2;Q16656	.;NRF1_HUMAN	R	313;152;313;313;313;313	ENSP00000376924:P313R;ENSP00000440455:P152R;ENSP00000223190:P313R;ENSP00000309826:P313R;ENSP00000376922:P313R;ENSP00000376923:P313R	ENSP00000223190:P313R	P	+	2	0	NRF1	129137622	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.773000	0.85462	2.941000	0.99782	0.655000	0.94253	CCT	NRF1	-	NULL	ENSG00000106459		0.483	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	NRF1	HGNC	protein_coding	OTTHUMT00000289813.1		0.00	39	0	C	NM_001040110		129350386	+1			no_errors	ENST00000393231	ensembl	human	known	74_37	missense	9.52	37	4	SNP	1.000	G
NRIP1	8204	genome.wustl.edu	37	21	16338329	16338330	+	Frame_Shift_Ins	INS	-	-	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr21:16338329_16338330insT	ENST00000400202.1	-	3	2896_2897	c.2184_2185insA	c.(2182-2187)aaagagfs	p.E729fs	NRIP1_ENST00000318948.4_Frame_Shift_Ins_p.E729fs|AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_Frame_Shift_Ins_p.E729fs			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	729					androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		GGAGTTTTCTCTTTTTTTTCAC	0.411																																																	0																																										SO:0001589	frameshift_variant	0			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2185dupA	21.37:g.16338337_16338337dupT	ENSP00000383063:p.Glu729fs		Q8IWE8	Frame_Shift_Ins	INS	NULL	p.E728fs	ENST00000400202.1	37	c.2185_2184	CCDS13568.1	21																																																																																			NRIP1	-	NULL	ENSG00000180530		0.411	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1		0.00	33	0	-	NM_003489		16338330	-1	tier1		no_errors	ENST00000318948	ensembl	human	known	74_37	frame_shift_ins	11.11	24	3	INS	0.999:0.998	T
NUCB1	4924	genome.wustl.edu	37	19	49414486	49414486	+	Missense_Mutation	SNP	G	G	A	rs375589971		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:49414486G>A	ENST00000405315.4	+	5	791	c.457G>A	c.(457-459)Gac>Aac	p.D153N	NUCB1_ENST00000485798.1_Intron|NUCB1-AS1_ENST00000416432.1_RNA|NUCB1_ENST00000263273.5_Missense_Mutation_p.D153N|NUCB1_ENST00000407032.1_Missense_Mutation_p.D153N	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	153						endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		CGAGGCCCGCGACCTGGAGCT	0.557																																																	0								G	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	61.0	52.0	55.0		457	5.0	1.0	19		55	0,8600		0,0,4300	no	missense	NUCB1	NM_006184.5	23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	153/462	49414486	1,13005	2203	4300	6503	SO:0001583	missense	0			BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.457G>A	19.37:g.49414486G>A	ENSP00000385923:p.Asp153Asn		B2RD64|Q15838|Q7Z4J7|Q9BUR1	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.D153N	ENST00000405315.4	37	c.457	CCDS12740.1	19	.	.	.	.	.	.	.	.	.	.	G	33	5.218225	0.95104	2.27E-4	0.0	ENSG00000104805	ENST00000405315;ENST00000407032;ENST00000452087;ENST00000263273	T;T;T	0.36878	1.23;1.23;1.23	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.74904	-0.3505	10	0.72032	D	0.01	.	16.2298	0.82323	0.0:0.0:1.0:0.0	.	153;153	Q02818;Q53GX6	NUCB1_HUMAN;.	N	153	ENSP00000385923:D153N;ENSP00000385211:D153N;ENSP00000263273:D153N	ENSP00000263273:D153N	D	+	1	0	NUCB1	54106298	1.000000	0.71417	0.998000	0.56505	0.890000	0.51754	9.278000	0.95766	2.519000	0.84933	0.549000	0.68633	GAC	NUCB1	-	NULL	ENSG00000104805		0.557	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUCB1	HGNC	protein_coding	OTTHUMT00000326545.2	-	0.00	41	0	G	NM_006184		49414486	+1	tier1	-	no_errors	ENST00000263273	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	A
NXF2B	728343	genome.wustl.edu	37	X	101615753	101615753	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chrX:101615753C>T	ENST00000372750.1	-	26	2595	c.1796G>A	c.(1795-1797)tGg>tAg	p.W599*	NXF2B_ENST00000372749.1_Nonsense_Mutation_p.W599*|NXF2B_ENST00000372752.1_3'UTR|NXF2B_ENST00000457521.2_Nonsense_Mutation_p.W599*|NXF2B_ENST00000412230.2_Nonsense_Mutation_p.W599*			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	599	TAP-C. {ECO:0000255|PROSITE- ProRule:PRU00611}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(1)|lung(4)|ovary(1)	7						AGTGTAGTTCCACTCATTGTC	0.537																																																	0													5.0	4.0	5.0					X																	101615753		1630	2648	4278	SO:0001587	stop_gained	0				CCDS43979.1	Xq22.1	2013-05-14			ENSG00000185945	ENSG00000269437			23984	protein-coding gene	gene with protein product						16382448	Standard	NM_001099686		Approved	bA353J17.1		Q9GZY0	OTTHUMG00000154920	ENST00000372750.1:c.1796G>A	X.37:g.101615753C>T	ENSP00000361836:p.Trp599*		Q9BXU4|Q9NSS1|Q9NX66	Nonsense_Mutation	SNP	pfam_Tap_RNA-bd,pfam_TAP_C_dom,pfam_NTF2,superfamily_UBA-like,smart_TAP_C_dom,pfscan_Nuclear_transport_factor_2_euk	p.W599*	ENST00000372750.1	37	c.1796	CCDS43979.1	X	.	.	.	.	.	.	.	.	.	.	.	39	7.328976	0.98214	.	.	ENSG00000185945	ENST00000457521;ENST00000372749;ENST00000372750;ENST00000412230	.	.	.	2.45	2.45	0.29901	.	0.000000	0.64402	U	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0023	10.1883	0.43011	0.0:1.0:0.0:0.0	.	.	.	.	X	599	.	ENSP00000361835:W599X	W	-	2	0	NXF2B	101502409	1.000000	0.71417	0.383000	0.26132	0.949000	0.60115	6.285000	0.72658	1.507000	0.48752	0.502000	0.49764	TGG	NXF2B	-	pfam_TAP_C_dom,superfamily_UBA-like,smart_TAP_C_dom	ENSG00000185945		0.537	NXF2B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF2B	HGNC	protein_coding	OTTHUMT00000058979.1	-	0.00	28	0	C			101615753	-1	tier1	-	no_errors	ENST00000372749	ensembl	human	known	74_37	nonsense	15.00	17	3	SNP	1.000	T
NXPE1	120400	genome.wustl.edu	37	11	114401612	114401612	+	Silent	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:114401612A>G	ENST00000424269.1	-	2	117	c.118T>C	c.(118-120)Tta>Cta	p.L40L	NXPE1_ENST00000536271.1_5'Flank|NXPE1_ENST00000251921.2_5'UTR|NXPE1_ENST00000536312.1_Silent_p.L40L			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	40						extracellular region (GO:0005576)											GAGATGGATAAGTTTAGAGCA	0.338																																																	0																																										SO:0001819	synonymous_variant	0			BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.118T>C	11.37:g.114401612A>G			B0YJ13	Silent	SNP	pfam_NXPH/NXPE,superfamily_Ig_E-set	p.L40	ENST00000424269.1	37	c.118		11																																																																																			NXPE1	-	NULL	ENSG00000095110		0.338	NXPE1-201	KNOWN	basic	protein_coding	NXPE1	HGNC	protein_coding			0.00	62	0	A	NM_152315		114401612	-1			no_errors	ENST00000424269	ensembl	human	known	74_37	silent	7.46	62	5	SNP	0.000	G
OAS3	4940	genome.wustl.edu	37	12	113376342	113376342	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:113376342T>G	ENST00000228928.7	+	1	186	c.7T>G	c.(7-9)Ttg>Gtg	p.L3V	OAS3_ENST00000548514.1_Missense_Mutation_p.L3V|OAS3_ENST00000551007.1_Missense_Mutation_p.L3V|RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	3					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						GGCCATGGACTTGTACAGCAC	0.692																																																	0													11.0	13.0	13.0					12																	113376342		1763	3935	5698	SO:0001583	missense	0			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.7T>G	12.37:g.113376342T>G	ENSP00000228928:p.Leu3Val		Q2HJ14|Q9H3P5	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.L3V	ENST00000228928.7	37	c.7	CCDS44981.1	12	.	.	.	.	.	.	.	.	.	.	T	12.95	2.090305	0.36855	.	.	ENSG00000111331	ENST00000228928;ENST00000551007;ENST00000548514;ENST00000323881	T;T;T	0.11604	2.76;2.76;2.76	3.11	-1.3	0.09259	.	.	.	.	.	T	0.09158	0.0226	L	0.52206	1.635	0.80722	D	1	B;B;B	0.34372	0.002;0.137;0.451	B;B;B	0.33568	0.003;0.073;0.166	T	0.21381	-1.0247	9	0.51188	T	0.08	.	6.1368	0.20237	0.0:0.4971:0.31:0.1929	.	3;3;3	Q9Y6K5;F8VS35;F8VWK9	OAS3_HUMAN;.;.	V	3	ENSP00000228928:L3V;ENSP00000449299:L3V;ENSP00000448388:L3V	ENSP00000228928:L3V	L	+	1	2	OAS3	111860725	0.529000	0.26322	0.988000	0.46212	0.142000	0.21351	-0.247000	0.08866	0.028000	0.15324	-0.677000	0.03784	TTG	OAS3	-	NULL	ENSG00000111331		0.692	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAS3	HGNC	protein_coding	OTTHUMT00000405920.1		0.00	9	0	T			113376342	+1			no_errors	ENST00000228928	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.982	G
OLIG3	167826	genome.wustl.edu	37	6	137815154	137815154	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:137815154G>A	ENST00000367734.2	-	1	377	c.154C>T	c.(154-156)Ccc>Tcc	p.P52S		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	52					spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		CTTTCCCCGGGCATCTTCTGC	0.612																																																	0													76.0	80.0	79.0					6																	137815154		2203	4300	6503	SO:0001583	missense	0			AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.154C>T	6.37:g.137815154G>A	ENSP00000356708:p.Pro52Ser		Q8N8Q0	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.P52S	ENST00000367734.2	37	c.154	CCDS5186.1	6	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.150185	0.00328	.	.	ENSG00000177468	ENST00000367734	D	0.99353	-5.77	5.55	2.39	0.29439	.	0.551476	0.17383	N	0.176231	D	0.88941	0.6574	N	0.08118	0	0.24566	N	0.993948	B	0.02656	0.0	B	0.01281	0.0	D	0.85275	0.1058	10	0.05721	T	0.95	-0.6652	4.9892	0.14205	0.2805:0.2941:0.4255:0.0	.	52	Q7RTU3	OLIG3_HUMAN	S	52	ENSP00000356708:P52S	ENSP00000356708:P52S	P	-	1	0	OLIG3	137856847	1.000000	0.71417	0.981000	0.43875	0.472000	0.32918	1.036000	0.30228	0.707000	0.31934	-1.094000	0.02160	CCC	OLIG3	-	NULL	ENSG00000177468		0.612	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLIG3	HGNC	protein_coding	OTTHUMT00000042405.1		0.00	31	0	G	NM_175747		137815154	-1			no_errors	ENST00000367734	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.961	A
OR1A1	8383	genome.wustl.edu	37	17	3119721	3119721	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:3119721C>T	ENST00000304094.1	+	1	807	c.807C>T	c.(805-807)gaC>gaT	p.D269D		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						GCCTAAAAGACGCAGTGATCA	0.478																																																	0													153.0	135.0	141.0					17																	3119721		2203	4300	6503	SO:0001819	synonymous_variant	0			AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.807C>T	17.37:g.3119721C>T			A5D914|Q6IFM1|Q6NTA9|Q96R87	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D269	ENST00000304094.1	37	c.807	CCDS11022.1	17																																																																																			OR1A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172146		0.478	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A1	HGNC	protein_coding	OTTHUMT00000207292.1	-	0.00	40	0	C	NM_014565		3119721	+1	tier1	-	no_errors	ENST00000304094	ensembl	human	known	74_37	silent	16.00	42	8	SNP	0.002	T
OR1J4	26219	genome.wustl.edu	37	9	125282234	125282234	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:125282234T>C	ENST00000340750.1	+	1	815	c.815T>C	c.(814-816)gTa>gCa	p.V272A		NM_001004452.1	NP_001004452.1	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J, member 4	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	20						GACAAGGACGTAATTGCCTCT	0.488																																																	0													130.0	116.0	120.0					9																	125282234		2203	4300	6503	SO:0001583	missense	0			X64979	CCDS35122.1	9q33.2	2013-09-20			ENSG00000239590	ENSG00000239590		"""GPCR / Class A : Olfactory receptors"""	8211	protein-coding gene	gene with protein product						1370859	Standard	NM_001004452		Approved	HTPCRX01, HSHTPCRX01	uc011lyw.2	Q8NGS1	OTTHUMG00000020606	ENST00000340750.1:c.815T>C	9.37:g.125282234T>C	ENSP00000343521:p.Val272Ala		A3KFM0|Q6IEZ3|Q96R89	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V272A	ENST00000340750.1	37	c.815	CCDS35122.1	9	.	.	.	.	.	.	.	.	.	.	T	9.276	1.046898	0.19748	.	.	ENSG00000239590	ENST00000340750	T	0.00084	8.75	5.36	0.425	0.16473	GPCR, rhodopsin-like superfamily (1);	0.850599	0.09332	U	0.816794	T	0.00073	0.0002	N	0.05383	-0.06	0.09310	N	1	B	0.09022	0.002	B	0.15052	0.012	T	0.18272	-1.0342	10	0.02654	T	1	.	3.9839	0.09507	0.2422:0.3582:0.0:0.3997	.	272	Q8NGS1	OR1J4_HUMAN	A	272	ENSP00000343521:V272A	ENSP00000343521:V272A	V	+	2	0	OR1J4	124322055	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	0.210000	0.17455	-0.065000	0.13021	0.529000	0.55759	GTA	OR1J4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000239590		0.488	OR1J4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1J4	HGNC	protein_coding	OTTHUMT00000053936.1	-	0.00	72	0	T			125282234	+1	tier1	-	no_errors	ENST00000340750	ensembl	human	known	74_37	missense	37.97	49	30	SNP	0.000	C
OR2G2	81470	genome.wustl.edu	37	1	247752514	247752514	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:247752514A>C	ENST00000320065.1	+	1	853	c.853A>C	c.(853-855)Acc>Ccc	p.T285P	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CACTGTGGTAACCCGCATGCT	0.433																																																	0													129.0	130.0	130.0					1																	247752514		2203	4300	6503	SO:0001583	missense	0			BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.853A>C	1.37:g.247752514A>C	ENSP00000326349:p.Thr285Pro		Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T285P	ENST00000320065.1	37	c.853	CCDS31092.1	1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.240557	0.39598	.	.	ENSG00000177489	ENST00000320065	T	0.37235	1.21	4.14	4.14	0.48551	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38326	U	0.001725	T	0.57814	0.2079	M	0.76838	2.35	0.09310	N	1	D	0.61080	0.989	D	0.71656	0.974	T	0.52087	-0.8622	10	0.87932	D	0	.	11.2007	0.48739	1.0:0.0:0.0:0.0	.	285	Q8NGZ5	OR2G2_HUMAN	P	285	ENSP00000326349:T285P	ENSP00000326349:T285P	T	+	1	0	OR2G2	245819137	0.000000	0.05858	0.814000	0.32528	0.682000	0.39822	0.429000	0.21412	1.730000	0.51580	0.481000	0.45027	ACC	OR2G2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000177489		0.433	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G2	HGNC	protein_coding	OTTHUMT00000097623.1	-	0.00	104	0	A			247752514	+1	tier1	-	no_errors	ENST00000320065	ensembl	human	known	74_37	missense	20.21	75	19	SNP	0.040	C
OR4A5	81318	genome.wustl.edu	37	11	51411456	51411456	+	Missense_Mutation	SNP	G	G	C	rs555282850		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:51411456G>C	ENST00000319760.6	-	1	992	c.940C>G	c.(940-942)Ctc>Gtc	p.L314V		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				ACCTACATGAGGACGGACACT	0.373																																																	0													17.0	17.0	17.0					11																	51411456		2165	4287	6452	SO:0001583	missense	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.940C>G	11.37:g.51411456G>C	ENSP00000367664:p.Leu314Val		Q6IF84	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L314V	ENST00000319760.6	37	c.940	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	1.280	-0.610601	0.03690	.	.	ENSG00000221840	ENST00000319760	T	0.00363	7.82	0.681	-1.36	0.09085	.	.	.	.	.	T	0.00144	0.0004	N	0.08118	0	0.09310	N	1	B	0.26876	0.162	B	0.12156	0.007	T	0.29397	-1.0013	8	0.72032	D	0.01	.	.	.	.	.	314	Q8NH83	OR4A5_HUMAN	V	314	ENSP00000367664:L314V	ENSP00000367664:L314V	L	-	1	0	OR4A5	51268032	0.005000	0.15991	0.000000	0.03702	0.000000	0.00434	0.336000	0.19823	-0.441000	0.07201	-0.552000	0.04208	CTC	OR4A5	-	NULL	ENSG00000221840		0.373	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1		0.00	68	0	G	NM_001005272		51411456	-1			no_errors	ENST00000319760	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.000	C
OR4A5	81318	genome.wustl.edu	37	11	51411866	51411866	+	Missense_Mutation	SNP	T	T	C	rs567373135		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:51411866T>C	ENST00000319760.6	-	1	582	c.530A>G	c.(529-531)gAc>gGc	p.D177G		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				TGGGTGCATGTCACAACTGAA	0.433													.|||	1	0.000199681	0.0	0.0	5008	,	,		21250	0.0		0.001	False		,,,				2504	0.0																0													69.0	58.0	62.0					11																	51411866		2201	4295	6496	SO:0001583	missense	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.530A>G	11.37:g.51411866T>C	ENSP00000367664:p.Asp177Gly		Q6IF84	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D177G	ENST00000319760.6	37	c.530	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	11.54	1.670147	0.29693	.	.	ENSG00000221840	ENST00000319760	T	0.00198	8.57	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000123	T	0.00936	0.0031	H	0.99368	4.535	0.30557	N	0.764853	D	0.67145	0.996	D	0.74023	0.982	T	0.06058	-1.0848	10	0.87932	D	0	.	7.8263	0.29318	0.0:0.0:0.0:1.0	.	177	Q8NH83	OR4A5_HUMAN	G	177	ENSP00000367664:D177G	ENSP00000367664:D177G	D	-	2	0	OR4A5	51268442	1.000000	0.71417	0.926000	0.36857	0.015000	0.08874	6.123000	0.71614	1.143000	0.42306	0.136000	0.15936	GAC	OR4A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000221840		0.433	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	-	0.00	106	0	T	NM_001005272		51411866	-1	tier1	-	no_errors	ENST00000319760	ensembl	human	known	74_37	missense	6.67	126	9	SNP	0.998	C
OR5I1	10798	genome.wustl.edu	37	11	55703182	55703182	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:55703182G>A	ENST00000301532.3	-	1	694	c.695C>T	c.(694-696)tCt>tTt	p.S232F		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	232					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CCCACTGAAAGAGCGGATCTT	0.458																																																	0													53.0	54.0	53.0					11																	55703182		2201	4296	6497	SO:0001583	missense	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.695C>T	11.37:g.55703182G>A	ENSP00000301532:p.Ser232Phe		Q6IEU4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S232F	ENST00000301532.3	37	c.695	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399805	0.25291	.	.	ENSG00000167825	ENST00000301532	T	0.00340	8.04	5.16	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000272	T	0.00906	0.0030	M	0.93594	3.435	0.09310	N	1	D	0.58620	0.983	P	0.57057	0.812	T	0.12941	-1.0528	10	0.87932	D	0	.	13.774	0.63041	0.0:0.2939:0.7061:0.0	.	232	Q13606	OR5I1_HUMAN	F	232	ENSP00000301532:S232F	ENSP00000301532:S232F	S	-	2	0	OR5I1	55459758	0.985000	0.35326	0.033000	0.17914	0.036000	0.12997	5.527000	0.67123	0.643000	0.30638	-0.189000	0.12847	TCT	OR5I1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000167825		0.458	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1	-	0.00	34	0	G	NM_006637		55703182	-1	tier1	-	no_errors	ENST00000301532	ensembl	human	known	74_37	missense	15.79	32	6	SNP	0.001	A
OR5M10	390167	genome.wustl.edu	37	11	56345015	56345015	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:56345015G>T	ENST00000526812.2	-	1	248	c.183C>A	c.(181-183)ttC>ttA	p.F61L		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						GACCAAGGAAGAAATACATGG	0.463																																																	0													171.0	164.0	166.0					11																	56345015		1960	4159	6119	SO:0001583	missense	0			BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.183C>A	11.37:g.56345015G>T	ENSP00000436004:p.Phe61Leu		B9EIL9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F61L	ENST00000526812.2	37	c.183	CCDS53630.1	11	.	.	.	.	.	.	.	.	.	.	G	9.671	1.146837	0.21288	.	.	ENSG00000254834	ENST00000526812	T	0.00551	6.65	4.04	2.15	0.27550	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00875	0.0029	M	0.80028	2.48	0.30353	N	0.784609	B	0.24675	0.109	B	0.24394	0.053	T	0.02560	-1.1141	9	0.62326	D	0.03	.	9.5561	0.39339	0.1903:0.0:0.8097:0.0	.	61	Q6IEU7	OR5MA_HUMAN	L	61	ENSP00000436004:F61L	ENSP00000436004:F61L	F	-	3	2	OR5M10	56101591	0.581000	0.26741	1.000000	0.80357	0.185000	0.23345	-0.108000	0.10857	1.039000	0.40074	-0.164000	0.13417	TTC	OR5M10	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000254834		0.463	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M10	HGNC	protein_coding	OTTHUMT00000391609.1	-	0.00	63	0	G	NM_001004741		56345015	-1	tier1	-	no_errors	ENST00000526812	ensembl	human	known	74_37	missense	10.67	67	8	SNP	0.996	T
OR5M1	390168	genome.wustl.edu	37	11	56380545	56380545	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:56380545A>G	ENST00000526538.1	-	1	433	c.434T>C	c.(433-435)gTc>gCc	p.V145A		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						AGGGATAGTGACCAGACAGAC	0.433																																																	0													130.0	112.0	118.0					11																	56380545		1965	4167	6132	SO:0001583	missense	0			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.434T>C	11.37:g.56380545A>G	ENSP00000435416:p.Val145Ala		Q6IF60|Q96RB6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V145A	ENST00000526538.1	37	c.434	CCDS53631.1	11	.	.	.	.	.	.	.	.	.	.	A	2.711	-0.268811	0.05716	.	.	ENSG00000255012	ENST00000526538	T	0.39056	1.1	3.71	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36002	N	0.002846	T	0.21674	0.0522	N	0.10874	0.06	0.09310	N	1	B	0.14438	0.01	B	0.26517	0.07	T	0.13308	-1.0514	10	0.30854	T	0.27	-61.7982	6.9414	0.24494	0.8122:0.0:0.1878:0.0	.	145	Q8NGP8	OR5M1_HUMAN	A	145	ENSP00000435416:V145A	ENSP00000435416:V145A	V	-	2	0	OR5M1	56137121	0.002000	0.14202	0.014000	0.15608	0.038000	0.13279	1.749000	0.38319	1.586000	0.49944	0.232000	0.17820	GTC	OR5M1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000255012		0.433	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M1	HGNC	protein_coding	OTTHUMT00000391610.1	-	0.00	18	0	A	NM_001004740		56380545	-1	tier1	-	no_errors	ENST00000526538	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.098	G
PATZ1	23598	genome.wustl.edu	37	22	31741150	31741150	+	Missense_Mutation	SNP	A	A	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr22:31741150A>T	ENST00000266269.5	-	1	1068	c.439T>A	c.(439-441)Tcg>Acg	p.S147T	PATZ1_ENST00000405309.3_Missense_Mutation_p.S147T|AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000215919.3_Missense_Mutation_p.S147T|PATZ1_ENST00000351933.4_Missense_Mutation_p.S147T	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	147					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						TCGATAACCGACCTCATCAGC	0.567																																																	0													144.0	151.0	148.0					22																	31741150		2203	4300	6503	SO:0001583	missense	0			AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.439T>A	22.37:g.31741150A>T	ENSP00000266269:p.Ser147Thr		Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S147T	ENST00000266269.5	37	c.439	CCDS13894.1	22	.	.	.	.	.	.	.	.	.	.	A	20.3	3.972027	0.74246	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933;ENST00000215919	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	4.26	4.26	0.50523	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.70657	0.3249	L	0.27053	0.805	0.58432	D	0.99999	D;D;D;D	0.63046	0.99;0.99;0.992;0.99	P;P;D;P	0.76071	0.719;0.719;0.987;0.719	T	0.73662	-0.3912	10	0.59425	D	0.04	-5.7681	12.8742	0.57982	1.0:0.0:0.0:0.0	.	147;147;147;147	Q9HBE1-4;Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;.;PATZ1_HUMAN;.	T	147	ENSP00000266269:S147T;ENSP00000384173:S147T;ENSP00000337520:S147T;ENSP00000215919:S147T	ENSP00000215919:S147T	S	-	1	0	PATZ1	30071150	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.643000	0.74334	1.698000	0.51180	0.459000	0.35465	TCG	PATZ1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000100105		0.567	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATZ1	HGNC	protein_coding	OTTHUMT00000321932.1	-	0.00	23	0	A	NM_032052		31741150	-1	tier1	-	no_errors	ENST00000266269	ensembl	human	known	74_37	missense	21.88	25	7	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55943308	55943308	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:55943308T>C	ENST00000320301.6	-	13	1880	c.1486A>G	c.(1486-1488)Aat>Gat	p.N496D	PCDH15_ENST00000395430.1_Missense_Mutation_p.N496D|PCDH15_ENST00000395445.1_Missense_Mutation_p.N503D|PCDH15_ENST00000395446.1_Missense_Mutation_p.N496D|PCDH15_ENST00000414778.1_Missense_Mutation_p.N501D|PCDH15_ENST00000395438.1_Missense_Mutation_p.N496D|PCDH15_ENST00000373957.3_Missense_Mutation_p.N474D|PCDH15_ENST00000373965.2_Missense_Mutation_p.N503D|PCDH15_ENST00000395433.1_Missense_Mutation_p.N474D|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.N496D|PCDH15_ENST00000373955.1_Missense_Mutation_p.N496D|PCDH15_ENST00000361849.3_Missense_Mutation_p.N496D|PCDH15_ENST00000395432.2_Missense_Mutation_p.N459D|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.N107D	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	496	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ACTTGAATATTGACGATGACT	0.388										HNSCC(58;0.16)																																							0													279.0	241.0	254.0					10																	55943308		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1486A>G	10.37:g.55943308T>C	ENSP00000322604:p.Asn496Asp		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N496D	ENST00000320301.6	37	c.1486	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	T	13.89	2.371436	0.42003	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.61274	0.12;0.62;0.62;0.17;0.12;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62	5.07	5.07	0.68467	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.68586	0.3017	L	0.45581	1.43	0.30149	N	0.80326	D;B;B;B;P;B;D;B;B;B;B;B;B;B;B	0.63880	0.993;0.049;0.213;0.049;0.759;0.049;0.986;0.009;0.026;0.026;0.025;0.025;0.016;0.009;0.025	D;B;B;B;P;B;D;B;B;B;B;B;B;B;B	0.69307	0.963;0.05;0.143;0.039;0.449;0.09;0.932;0.02;0.013;0.013;0.02;0.029;0.017;0.02;0.034	T	0.66196	-0.5984	9	0.40728	T	0.16	.	14.1671	0.65486	0.0:0.0:0.0:1.0	.	474;496;496;501;496;459;496;496;503;503;496;501;496;474;496	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	D	503;501;496;496;107;503;496;459;496;474;474;496;496;501;496;496	ENSP00000363076:N503D;ENSP00000410304:N501D;ENSP00000378826:N496D;ENSP00000386693:N107D;ENSP00000378832:N503D;ENSP00000378833:N496D;ENSP00000378820:N459D;ENSP00000354950:N496D;ENSP00000378821:N474D;ENSP00000363068:N474D;ENSP00000322604:N496D;ENSP00000378818:N496D;ENSP00000412628:N496D;ENSP00000363066:N496D	ENSP00000322604:N496D	N	-	1	0	PCDH15	55613314	1.000000	0.71417	0.999000	0.59377	0.171000	0.22731	4.777000	0.62361	2.052000	0.61016	0.524000	0.50904	AAT	PCDH15	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000150275		0.388	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	83	0	T	NM_033056		55943308	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	6.67	112	8	SNP	1.000	C
PCNXL3	399909	genome.wustl.edu	37	11	65385641	65385641	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:65385641C>T	ENST00000355703.3	+	6	1347	c.808C>T	c.(808-810)Cgg>Tgg	p.R270W		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	270						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CAGCAGTCGACGGGAACAACG	0.677																																																	0													19.0	24.0	22.0					11																	65385641		1934	4132	6066	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.808C>T	11.37:g.65385641C>T	ENSP00000347931:p.Arg270Trp		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.R270W	ENST00000355703.3	37	c.808	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	C	17.37	3.373386	0.61624	.	.	ENSG00000197136	ENST00000355703	T	0.08546	3.08	5.11	1.78	0.24846	.	0.000000	0.36134	N	0.002774	T	0.04998	0.0134	N	0.08118	0	0.28532	N	0.912545	D	0.63880	0.993	B	0.44133	0.442	T	0.24190	-1.0167	10	0.72032	D	0.01	.	10.4701	0.44631	0.613:0.387:0.0:0.0	.	270	Q9H6A9	PCX3_HUMAN	W	270	ENSP00000347931:R270W	ENSP00000347931:R270W	R	+	1	2	PCNXL3	65142217	0.398000	0.25279	0.994000	0.49952	0.931000	0.56810	0.624000	0.24462	0.501000	0.28013	0.655000	0.94253	CGG	PCNXL3	-	NULL	ENSG00000197136		0.677	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	-	0.00	34	0	C	NM_032223		65385641	+1	tier1	-	no_errors	ENST00000355703	ensembl	human	known	74_37	missense	43.48	13	10	SNP	0.993	T
PDE11A	50940	genome.wustl.edu	37	2	178769881	178769881	+	Missense_Mutation	SNP	C	C	T	rs560754146	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:178769881C>T	ENST00000286063.6	-	3	1422	c.1105G>A	c.(1105-1107)Gcc>Acc	p.A369T	PDE11A_ENST00000449286.2_Missense_Mutation_p.A11T|PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000358450.4_Missense_Mutation_p.A119T|PDE11A_ENST00000409504.1_Missense_Mutation_p.A11T	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	369	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	TTAGATATGGCGATTCCACAA	0.363									Primary Pigmented Nodular Adrenocortical Disease, Familial				C|||	2	0.000399361	0.0015	0.0	5008	,	,		19626	0.0		0.0	False		,,,				2504	0.0																0													126.0	111.0	116.0					2																	178769881		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1105G>A	2.37:g.178769881C>T	ENSP00000286063:p.Ala369Thr		Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.A369T	ENST00000286063.6	37	c.1105	CCDS33334.1	2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.393992	0.83011	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000409504;ENST00000431253;ENST00000449286	T;T;T;T	0.75704	-0.96;-0.96;-0.32;-0.32	5.36	5.36	0.76844	GAF (2);	0.154289	0.56097	D	0.000024	D	0.83184	0.5199	M	0.80847	2.515	0.80722	D	1	D;D	0.59357	0.969;0.985	P;P	0.52514	0.701;0.636	D	0.84377	0.0547	10	0.46703	T	0.11	.	19.0924	0.93233	0.0:1.0:0.0:0.0	.	119;369	Q9HCR9-2;Q9HCR9	.;PDE11_HUMAN	T	369;119;11;44;11	ENSP00000286063:A369T;ENSP00000351232:A119T;ENSP00000386539:A11T;ENSP00000390599:A11T	ENSP00000286063:A369T	A	-	1	0	PDE11A	178478127	1.000000	0.71417	0.964000	0.40570	0.771000	0.43674	5.597000	0.67577	2.513000	0.84729	0.563000	0.77884	GCC	PDE11A	-	pfam_GAF,smart_GAF	ENSG00000128655		0.363	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE11A	HGNC	protein_coding	OTTHUMT00000334313.2	-	0.00	54	0	C			178769881	-1	tier1	-	no_errors	ENST00000286063	ensembl	human	known	74_37	missense	12.68	62	9	SNP	1.000	T
PDE1C	5137	genome.wustl.edu	37	7	31917639	31917639	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:31917639G>A	ENST00000396191.1	-	5	891	c.436C>T	c.(436-438)Cgg>Tgg	p.R146W	PDE1C_ENST00000396182.2_Missense_Mutation_p.R146W|PDE1C_ENST00000396193.1_Missense_Mutation_p.R206W|PDE1C_ENST00000321453.7_Missense_Mutation_p.R146W|PDE1C_ENST00000396184.3_Missense_Mutation_p.R146W	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	146					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TTTGATGTCCGTCTATACATT	0.343																																																	0													111.0	102.0	105.0					7																	31917639		2203	4300	6503	SO:0001583	missense	0			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.436C>T	7.37:g.31917639G>A	ENSP00000379494:p.Arg146Trp		B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.R146W	ENST00000396191.1	37	c.436	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337977	0.81911	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.74737	-0.87;-0.86;-0.86;-0.83;-0.83	5.75	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.86569	0.5964	M	0.85299	2.745	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.72338	0.977;0.962;0.899	D	0.88549	0.3115	10	0.87932	D	0	.	13.3151	0.60403	0.0:0.0:0.7121:0.2879	.	146;206;146	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	W	206;146;146;146;146	ENSP00000379496:R206W;ENSP00000379494:R146W;ENSP00000318105:R146W;ENSP00000379487:R146W;ENSP00000379485:R146W	ENSP00000318105:R146W	R	-	1	2	PDE1C	31884164	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.140000	0.50585	1.389000	0.46526	0.650000	0.86243	CGG	PDE1C	-	NULL	ENSG00000154678		0.343	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	-	0.00	32	0	G			31917639	-1	tier1	-	no_errors	ENST00000321453	ensembl	human	known	74_37	missense	43.10	33	25	SNP	1.000	A
PDE7B	27115	genome.wustl.edu	37	6	136508214	136508214	+	Silent	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:136508214T>C	ENST00000308191.6	+	12	1389	c.1086T>C	c.(1084-1086)ctT>ctC	p.L362L	RP13-143G15.4_ENST00000585946.1_RNA|RP13-143G15.4_ENST00000591521.1_RNA|RP13-143G15.4_ENST00000417643.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	362	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	TCAGTCCTCTTTGTAATCAAC	0.318																																																	0													90.0	97.0	94.0					6																	136508214		2203	4300	6503	SO:0001819	synonymous_variant	0			AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.1086T>C	6.37:g.136508214T>C			Q5W154	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.L362	ENST00000308191.6	37	c.1086	CCDS5175.1	6																																																																																			PDE7B	-	pfam_PDEase_catalytic_dom	ENSG00000171408		0.318	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7B	HGNC	protein_coding	OTTHUMT00000042371.1		0.00	29	0	T			136508214	+1			no_errors	ENST00000308191	ensembl	human	known	74_37	silent	13.79	25	4	SNP	1.000	C
PHKB	5257	genome.wustl.edu	37	16	47614247	47614247	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:47614247G>C	ENST00000323584.5	+	8	776	c.752G>C	c.(751-753)gGa>gCa	p.G251A	PHKB_ENST00000566044.1_Missense_Mutation_p.G244A|PHKB_ENST00000455779.1_Missense_Mutation_p.G244A|PHKB_ENST00000299167.8_Missense_Mutation_p.G251A|PHKB_ENST00000567402.1_3'UTR	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	251					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GCAATTAATGGATTCAACCTT	0.333																																																	0													127.0	121.0	123.0					16																	47614247		2201	4299	6500	SO:0001583	missense	0				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.752G>C	16.37:g.47614247G>C	ENSP00000313504:p.Gly251Ala		Q8N4T5	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.G251A	ENST00000323584.5	37	c.752	CCDS10729.1	16	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585259	0.86748	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.93019	-3.15;-3.15	5.76	4.81	0.61882	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.97216	0.9090	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97690	1.0178	10	0.56958	D	0.05	-23.9477	14.7507	0.69522	0.0693:0.0:0.9307:0.0	.	251;244	Q93100;Q93100-4	KPBB_HUMAN;.	A	244;244;251	ENSP00000414345:G244A;ENSP00000313504:G251A	ENSP00000299167:G244A	G	+	2	0	PHKB	46171748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.480000	0.90434	1.445000	0.47624	0.655000	0.94253	GGA	PHKB	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	ENSG00000102893		0.333	PHKB-002	KNOWN	basic|CCDS	protein_coding	PHKB	HGNC	protein_coding	OTTHUMT00000430413.1		0.00	80	0	G			47614247	+1			no_errors	ENST00000299167	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	C
PIEZO2	63895	genome.wustl.edu	37	18	10682197	10682197	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr18:10682197C>G	ENST00000503781.3	-	46	7250	c.7251G>C	c.(7249-7251)tgG>tgC	p.W2417C	PIEZO2_ENST00000581680.1_5'Flank|PIEZO2_ENST00000538948.1_Missense_Mutation_p.W374C|PIEZO2_ENST00000580640.1_Missense_Mutation_p.W2442C|PIEZO2_ENST00000285141.4_Intron|PIEZO2_ENST00000302079.6_Intron	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2417					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										GAAGAGGAAACCAGACAATGC	0.512																																																	0													234.0	221.0	225.0					18																	10682197		692	1591	2283	SO:0001583	missense	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7251G>C	18.37:g.10682197C>G	ENSP00000421377:p.Trp2417Cys		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	pfam_Piezo	p.W374C	ENST00000503781.3	37	c.1122		18	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088769	0.76756	.	.	ENSG00000154864	ENST00000302079;ENST00000538948	T	0.73152	-0.72	4.96	4.96	0.65561	.	.	.	.	.	D	0.85952	0.5817	M	0.87971	2.92	0.80722	D	1	.	.	.	.	.	.	D	0.88706	0.3219	7	0.87932	D	0	.	18.5603	0.91097	0.0:1.0:0.0:0.0	.	.	.	.	C	2417;374	ENSP00000443129:W374C	ENSP00000303316:W2417C	W	-	3	0	FAM38B	10672197	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.411000	0.80078	2.455000	0.83008	0.563000	0.77884	TGG	PIEZO2	-	pfam_Piezo	ENSG00000154864		0.512	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4		0.00	47	0	C	NM_022068		10682197	-1			no_errors	ENST00000538948	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	G
PIK3R3	8503	genome.wustl.edu	37	1	46511680	46511680	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:46511680A>G	ENST00000262741.5	-	9	1786	c.1097T>C	c.(1096-1098)gTa>gCa	p.V366A	PIK3R3_ENST00000354242.4_Missense_Mutation_p.V307A|PIK3R3_ENST00000420542.1_Missense_Mutation_p.V366A|PIK3R3_ENST00000540385.1_Missense_Mutation_p.V412A|RP4-533D7.4_ENST00000450004.1_RNA|PIK3R3_ENST00000423209.1_Missense_Mutation_p.V307A|PIK3R3_ENST00000488808.1_5'UTR|PIK3R3_ENST00000340332.6_Missense_Mutation_p.V271A|PIK3R3_ENST00000372006.1_Missense_Mutation_p.V366A	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	366	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	CTCTGCTTGTACTCGATTGAT	0.378																																																	0													157.0	148.0	151.0					1																	46511680		2203	4300	6503	SO:0001583	missense	0			BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.1097T>C	1.37:g.46511680A>G	ENSP00000262741:p.Val366Ala		B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_PI3kinase_P85,prints_SH2	p.V412A	ENST00000262741.5	37	c.1235	CCDS529.1	1	.	.	.	.	.	.	.	.	.	.	A	9.648	1.140747	0.21205	.	.	ENSG00000117461	ENST00000372006;ENST00000262741;ENST00000420542;ENST00000354242;ENST00000340332;ENST00000540385;ENST00000423209	D;D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	6.08	4.96	0.65561	SH2 motif (4);	0.318342	0.36591	N	0.002505	T	0.73583	0.3605	N	0.12569	0.235	0.28001	N	0.935291	B;B;B;B	0.10296	0.003;0.001;0.0;0.002	B;B;B;B	0.19946	0.01;0.012;0.004;0.027	T	0.56571	-0.7957	10	0.08837	T	0.75	-12.2193	11.6879	0.51497	0.9317:0.0:0.0683:0.0	.	412;399;307;366	F6TDL0;Q7Z3W2;Q92569-2;Q92569	.;.;.;P55G_HUMAN	A	366;366;366;307;271;412;307	ENSP00000361075:V366A;ENSP00000262741:V366A;ENSP00000412546:V366A;ENSP00000346188:V307A;ENSP00000342484:V271A;ENSP00000439913:V412A;ENSP00000391431:V307A	ENSP00000262741:V366A	V	-	2	0	PIK3R3	46284267	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.783000	0.47766	2.333000	0.79357	0.533000	0.62120	GTA	PIK3R3	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_PI3kinase_P85	ENSG00000117461		0.378	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R3	HGNC	protein_coding	OTTHUMT00000022171.1	-	0.00	22	0	A	NM_003629		46511680	-1	tier1	-	no_errors	ENST00000540385	ensembl	human	known	74_37	missense	29.41	24	10	SNP	0.968	G
PLA2G4D	283748	genome.wustl.edu	37	15	42375440	42375440	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:42375440G>A	ENST00000290472.3	-	8	722	c.628C>T	c.(628-630)Cac>Tac	p.H210Y		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	210					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		GCCATGTAGTGGAAGCGGAAG	0.602																																																	0													79.0	76.0	77.0					15																	42375440		2203	4299	6502	SO:0001583	missense	0			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.628C>T	15.37:g.42375440G>A	ENSP00000290472:p.His210Tyr		Q8N176	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.H210Y	ENST00000290472.3	37	c.628	CCDS32203.1	15	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560279	0.65538	.	.	ENSG00000159337	ENST00000290472	T	0.01548	4.78	3.38	3.38	0.38709	.	0.153840	0.31312	N	0.007864	T	0.05777	0.0151	M	0.85630	2.765	0.29034	N	0.885529	D	0.61080	0.989	P	0.50082	0.63	T	0.05699	-1.0869	10	0.42905	T	0.14	-18.9738	10.4285	0.44393	0.0:0.0:1.0:0.0	.	210	Q86XP0	PA24D_HUMAN	Y	210	ENSP00000290472:H210Y	ENSP00000290472:H210Y	H	-	1	0	PLA2G4D	40162732	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.601000	0.54059	1.895000	0.54865	0.511000	0.50034	CAC	PLA2G4D	-	NULL	ENSG00000159337		0.602	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4D	HGNC	protein_coding	OTTHUMT00000419317.1	-	0.00	45	0	G	NM_178034		42375440	-1	tier1	-	no_errors	ENST00000290472	ensembl	human	known	74_37	missense	16.67	35	7	SNP	1.000	A
PLEKHA7	144100	genome.wustl.edu	37	11	16813275	16813275	+	Intron	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:16813275T>C	ENST00000355661.3	-	20	2756				PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Intron|PLEKHA7_ENST00000448080.2_Intron|PLEKHA7_ENST00000332954.4_5'UTR			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7						epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						ATCAGAAATGTGCATGGTTAC	0.512																																																	0																																										SO:0001627	intron_variant	0			BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.2746-529A>G	11.37:g.16813275T>C			B4DK33|B4DWC3|Q86VZ7	RNA	SNP	-	NULL	ENST00000355661.3	37	NULL	CCDS31434.1	11																																																																																			PLEKHA7	-	-	ENSG00000166689		0.512	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA7	HGNC	protein_coding	OTTHUMT00000387242.2	-	0.00	41	0	T	NM_175058		16813275	-1	tier1	-	no_errors	ENST00000332954	ensembl	human	known	74_37	rna	19.35	24	6	SNP	0.094	C
PLXNA4	91584	genome.wustl.edu	37	7	131853149	131853149	+	Silent	SNP	G	G	A	rs200917567		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:131853149G>A	ENST00000359827.3	-	22	5162	c.4200C>T	c.(4198-4200)taC>taT	p.Y1400Y	PLXNA4_ENST00000321063.4_Silent_p.Y1400Y			Q9HCM2	PLXA4_HUMAN	plexin A4	1400					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CATCAGTGGCGTACTCCAGCT	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23275	0.0		0.0	False		,,,				2504	0.0																0								G		1,4405	2.1+/-5.4	0,1,2202	82.0	83.0	83.0		4200	-5.5	0.8	7		83	0,8600		0,0,4300	no	coding-synonymous	PLXNA4	NM_020911.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1400/1895	131853149	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4200C>T	7.37:g.131853149G>A			A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.Y1400	ENST00000359827.3	37	c.4200	CCDS43646.1	7																																																																																			PLXNA4	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000221866		0.592	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	-	0.00	56	0	G	NM_181775		131853149	-1	tier1	rs200917567	no_errors	ENST00000321063	ensembl	human	known	74_37	silent	14.71	29	5	SNP	0.119	A
PLXNA4	91584	genome.wustl.edu	37	7	131865470	131865470	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:131865470C>A	ENST00000359827.3	-	19	4476	c.3514G>T	c.(3514-3516)Gtg>Ttg	p.V1172L	PLXNA4_ENST00000321063.4_Missense_Mutation_p.V1172L			Q9HCM2	PLXA4_HUMAN	plexin A4	1172	IPT/TIG 4.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CCCCCAGCCACAGGCGGGATC	0.597																																																	0													50.0	53.0	52.0					7																	131865470		2065	4212	6277	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3514G>T	7.37:g.131865470C>A	ENSP00000352882:p.Val1172Leu		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.V1172L	ENST00000359827.3	37	c.3514	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	13.24	2.179341	0.38511	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.58210	0.35;0.35	5.38	4.47	0.54385	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.304626	0.35805	N	0.002966	T	0.38612	0.1047	N	0.22421	0.69	0.38023	D	0.934921	B	0.25351	0.124	B	0.24701	0.055	T	0.26155	-1.0111	10	0.17369	T	0.5	.	15.1734	0.72894	0.1421:0.8579:0.0:0.0	.	1172	Q9HCM2	PLXA4_HUMAN	L	1172	ENSP00000323194:V1172L;ENSP00000352882:V1172L	ENSP00000323194:V1172L	V	-	1	0	PLXNA4	131516010	0.998000	0.40836	0.658000	0.29665	0.936000	0.57629	3.691000	0.54720	1.229000	0.43630	0.561000	0.74099	GTG	PLXNA4	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000221866		0.597	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2		0.00	55	0	C	NM_181775		131865470	-1			no_errors	ENST00000321063	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.985	A
POLR3F	10621	genome.wustl.edu	37	20	18453556	18453556	+	Intron	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:18453556A>G	ENST00000377603.4	+	3	628				MIR3192_ENST00000584920.1_RNA|POLR3F_ENST00000462997.1_Intron	NM_006466.2	NP_006457.2	Q9H1D9	RPC6_HUMAN	polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa						defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)	2						AATGCTGGGTAAGTACTTGTT	0.328																																					GBM(69;898 1468 19907 52011)												0													49.0	51.0	50.0					20																	18453556		2203	4295	6498	SO:0001627	intron_variant	0			U93869	CCDS13135.1	20p11.23	2013-01-21	2002-08-29		ENSG00000132664	ENSG00000132664		"""RNA polymerase subunits"""	15763	protein-coding gene	gene with protein product	"""RNA polymerase III C39 subunit"""		"""polymerase (RNA) III (DNA directed) polypeptide F (39 kDa)"""			9171375	Standard	NM_006466		Approved	RPC39, RPC6	uc002wqv.3	Q9H1D9	OTTHUMG00000031971	ENST00000377603.4:c.248+3A>G	20.37:g.18453556A>G			A8K4C7|O15319	RNA	SNP	-	NULL	ENST00000377603.4	37	NULL	CCDS13135.1	20																																																																																			POLR3F	-	-	ENSG00000132664		0.328	POLR3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3F	HGNC	protein_coding	OTTHUMT00000078170.2	-	0.00	91	0	A	NM_006466		18453556	+1	tier1	-	no_errors	ENST00000475192	ensembl	human	known	74_37	rna	16.50	86	17	SNP	1.000	G
POP4	10775	genome.wustl.edu	37	19	30101337	30101337	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:30101337G>A	ENST00000585603.1	+	3	2384	c.82G>A	c.(82-84)Gag>Aag	p.E28K	POP4_ENST00000392279.3_Intron|POP4_ENST00000221770.3_Intron|POP4_ENST00000591824.1_3'UTR			O95707	RPP29_HUMAN	processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)	28					mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)|ribonuclease P complex (GO:0030677)	ribonuclease P activity (GO:0004526)|ribonuclease P RNA binding (GO:0033204)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|lung(4)	6	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			ACAGCGGGCCGAGGCCTTCGT	0.706											OREG0025393	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(89;1165 1449 14085 34436 43672)												0													9.0	10.0	10.0					19																	30101337		2184	4271	6455	SO:0001583	missense	0			BC006098	CCDS12416.1	19q13.11	2012-05-21				ENSG00000105171			30081	protein-coding gene	gene with protein product		606114				10352175, 10024167	Standard	NM_006627		Approved	RPP29	uc002nsf.2	O95707		ENST00000585603.1:c.82G>A	19.37:g.30101337G>A	ENSP00000465213:p.Glu28Lys	814	Q5XKL7|Q6FHW9|Q9UQQ3	Missense_Mutation	SNP	pfam_RNase_P/MRP_p29,superfamily_Rof/RNase_P-like,smart_RNase_P/MRP_p29,pirsf_RNase_P/MRP_p29-subunit	p.E28K	ENST00000585603.1	37	c.82	CCDS12416.1	19	.	.	.	.	.	.	.	.	.	.	G	13.52	2.262888	0.39995	.	.	ENSG00000105171	ENST00000221770	.	.	.	5.55	5.55	0.83447	.	0.199015	0.51477	D	0.000088	T	0.53126	0.1777	L	0.49350	1.555	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.45264	-0.9273	9	0.15066	T	0.55	-32.4252	12.1814	0.54214	0.087:0.0:0.913:0.0	.	28	O95707	RPP29_HUMAN	K	28	.	ENSP00000221770:E28K	E	+	1	0	POP4	34793177	1.000000	0.71417	0.991000	0.47740	0.616000	0.37450	4.385000	0.59613	2.773000	0.95371	0.585000	0.79938	GAG	POP4	-	pirsf_RNase_P/MRP_p29-subunit	ENSG00000105171		0.706	POP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP4	HGNC	protein_coding	OTTHUMT00000458710.1		0.00	19	0	G	NM_006627		30101337	+1			no_errors	ENST00000585603	ensembl	human	known	74_37	missense	10.00	18	2	SNP	0.994	A
POU4F3	5459	genome.wustl.edu	37	5	145719156	145719156	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:145719156C>T	ENST00000230732.4	+	2	255	c.166C>T	c.(166-168)Cgc>Tgc	p.R56C	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	56					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTGCTGGCACGCGCCGAAGC	0.577																																																	0													71.0	74.0	73.0					5																	145719156		2203	4300	6503	SO:0001583	missense	0			U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.166C>T	5.37:g.145719156C>T	ENSP00000230732:p.Arg56Cys		O60557|Q2M3F8	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.R56C	ENST00000230732.4	37	c.166	CCDS4281.1	5	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350148	0.61183	.	.	ENSG00000091010	ENST00000230732	T	0.27557	1.66	4.63	3.73	0.42828	.	0.205055	0.42294	D	0.000733	T	0.53254	0.1785	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.63488	0.915	T	0.59862	-0.7374	10	0.87932	D	0	.	12.1827	0.54221	0.0:0.826:0.174:0.0	.	56	Q15319	PO4F3_HUMAN	C	56	ENSP00000230732:R56C	ENSP00000230732:R56C	R	+	1	0	POU4F3	145699349	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	1.956000	0.40382	1.108000	0.41662	0.462000	0.41574	CGC	POU4F3	-	NULL	ENSG00000091010		0.577	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F3	HGNC	protein_coding	OTTHUMT00000251887.2	-	0.00	57	0	C	NM_002700		145719156	+1	tier1	-	no_errors	ENST00000230732	ensembl	human	known	74_37	missense	15.38	33	6	SNP	1.000	T
PPARG	5468	genome.wustl.edu	37	3	12475550	12475550	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:12475550C>T	ENST00000287820.6	+	7	1545	c.1424C>T	c.(1423-1425)aCg>aTg	p.T475M	PPARG_ENST00000397010.2_Missense_Mutation_p.T447M|PPARG_ENST00000539812.1_3'UTR|PPARG_ENST00000397000.1_3'UTR|PPARG_ENST00000397012.2_Missense_Mutation_p.T447M|PPARG_ENST00000397015.2_Missense_Mutation_p.T447M|PPARG_ENST00000309576.6_Missense_Mutation_p.T447M|PPARG_ENST00000397026.2_Missense_Mutation_p.T453M	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	475	Ligand-binding.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	CAGATTGTCACGGAACACGTG	0.527			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																	Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	0													82.0	73.0	76.0					3																	12475550		2203	4300	6503	SO:0001583	missense	0			X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.1424C>T	3.37:g.12475550C>T	ENSP00000287820:p.Thr475Met		A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_PPARgamma_N,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt,prints_1Cnucl_rcpt_G,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.T475M	ENST00000287820.6	37	c.1424	CCDS2609.1	3	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759437	0.89932	.	.	ENSG00000132170	ENST00000397010;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000287820	D;D;D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04;-4.04;-4.04	5.61	5.61	0.85477	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.000000	0.85682	D	0.000000	D	0.98188	0.9401	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98581	1.0650	10	0.62326	D	0.03	.	19.6973	0.96031	0.0:1.0:0.0:0.0	.	475	P37231	PPARG_HUMAN	M	447;447;447;447;453;475	ENSP00000380205:T447M;ENSP00000312472:T447M;ENSP00000380210:T447M;ENSP00000380207:T447M;ENSP00000380221:T453M;ENSP00000287820:T475M	ENSP00000287820:T475M	T	+	2	0	PPARG	12450550	1.000000	0.71417	0.847000	0.33407	0.969000	0.65631	7.776000	0.85560	2.657000	0.90304	0.650000	0.86243	ACG	PPARG	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,prints_Str_hrmn_rcpt	ENSG00000132170		0.527	PPARG-002	KNOWN	basic|CCDS	protein_coding	PPARG	HGNC	protein_coding	OTTHUMT00000251979.2	-	0.00	41	0	C	NM_005037		12475550	+1	tier1	-	no_errors	ENST00000287820	ensembl	human	known	74_37	missense	50.00	23	23	SNP	1.000	T
PPARGC1B	133522	genome.wustl.edu	37	5	149216400	149216402	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:149216400_149216402delCAG	ENST00000309241.5	+	8	2414_2416	c.2382_2384delCAG	c.(2380-2385)gacagc>gac	p.S799del	PPARGC1B_ENST00000403750.1_In_Frame_Del_p.S735del|PPARGC1B_ENST00000394320.3_In_Frame_Del_p.S799del|PPARGC1B_ENST00000360453.4_In_Frame_Del_p.S760del	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	799	Glu-rich.				actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.S795N(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TCTTTGAAGACAGCAGCAGCAGC	0.601																																																	1	Substitution - Missense(1)	breast(1)																																								SO:0001651	inframe_deletion	0			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2382_2384delCAG	5.37:g.149216409_149216411delCAG	ENSP00000312649:p.Ser799del		A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	In_Frame_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S798in_frame_del	ENST00000309241.5	37	c.2382_2384	CCDS4298.1	5																																																																																			PPARGC1B	-	NULL	ENSG00000155846		0.601	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1		0.00	18	0	CAG	NM_133263		149216402	+1	tier1		no_errors	ENST00000309241	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	1.000:1.000:1.000	-
PPFIBP2	8495	genome.wustl.edu	37	11	7670439	7670439	+	Silent	SNP	C	C	T	rs201176923		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:7670439C>T	ENST00000299492.4	+	20	2359	c.1971C>T	c.(1969-1971)gaC>gaT	p.D657D	PPFIBP2_ENST00000533792.1_Silent_p.D499D|PPFIBP2_ENST00000528883.1_Silent_p.D545D|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000530181.1_Silent_p.D514D	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	657	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CTAGAGTTGACAGACGAATGC	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		19699	0.0		0.0	False		,,,				2504	0.001																0													117.0	108.0	111.0					11																	7670439		2201	4296	6497	SO:0001819	synonymous_variant	0			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1971C>T	11.37:g.7670439C>T			B7Z433|E9PK77|O75337|Q8WW26	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_DNA-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.D657	ENST00000299492.4	37	c.1971	CCDS31419.1	11																																																																																			PPFIBP2	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000166387		0.423	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2		0.00	78	0	C	NM_003621		7670439	+1			no_errors	ENST00000299492	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.999	T
PPP1R26	9858	genome.wustl.edu	37	9	138379416	138379416	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:138379416G>T	ENST00000356818.2	+	4	3609	c.3060G>T	c.(3058-3060)caG>caT	p.Q1020H	PPP1R26_ENST00000605286.1_Missense_Mutation_p.Q1020H|PPP1R26_ENST00000401470.3_Missense_Mutation_p.Q1020H|PPP1R26_ENST00000604351.1_Missense_Mutation_p.Q1020H|PPP1R26_ENST00000605660.1_Missense_Mutation_p.Q1020H|PPP1R26_ENST00000602993.1_Intron	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	1020					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CTGGAGCCCAGGCCGACCGCA	0.716																																																	0													5.0	5.0	5.0					9																	138379416		1995	3957	5952	SO:0001583	missense	0			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.3060G>T	9.37:g.138379416G>T	ENSP00000349274:p.Gln1020His		Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	NULL	p.Q1020H	ENST00000356818.2	37	c.3060	CCDS6988.1	9	.	.	.	.	.	.	.	.	.	.	G	9.065	0.995538	0.19043	.	.	ENSG00000196422	ENST00000356818	T	0.10288	2.89	4.03	0.954	0.19595	.	0.924765	0.09140	N	0.843179	T	0.07098	0.0180	N	0.19112	0.55	0.09310	N	1	B	0.24882	0.113	B	0.27887	0.084	T	0.42085	-0.9472	10	0.42905	T	0.14	-11.956	4.745	0.13033	0.2128:0.1786:0.6086:0.0	.	1020	Q5T8A7	PPR26_HUMAN	H	1020	ENSP00000349274:Q1020H	ENSP00000349274:Q1020H	Q	+	3	2	KIAA0649	137519237	0.001000	0.12720	0.042000	0.18584	0.067000	0.16453	0.081000	0.14823	0.075000	0.16796	0.455000	0.32223	CAG	PPP1R26	-	NULL	ENSG00000196422		0.716	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	HGNC	protein_coding	OTTHUMT00000054987.1		0.00	33	0	G	NM_014811		138379416	+1			no_errors	ENST00000356818	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.236	T
PPP4R4	57718	genome.wustl.edu	37	14	94712746	94712746	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:94712746C>G	ENST00000304338.3	+	14	1635	c.1481C>G	c.(1480-1482)gCt>gGt	p.A494G		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	494					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						GAACAGCGAGCTGCAGCCTCT	0.398																																																	0													75.0	76.0	76.0					14																	94712746		2203	4300	6503	SO:0001583	missense	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1481C>G	14.37:g.94712746C>G	ENSP00000305924:p.Ala494Gly		Q9BUF8|Q9HCF0	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A494G	ENST00000304338.3	37	c.1481	CCDS9921.1	14	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314193	0.81358	.	.	ENSG00000119698	ENST00000304338	T	0.30981	1.51	5.78	4.9	0.64082	Armadillo-like helical (1);Armadillo-type fold (1);	0.102107	0.64402	D	0.000002	T	0.40767	0.1130	L	0.56769	1.78	0.80722	D	1	P	0.43885	0.82	P	0.49999	0.628	T	0.33007	-0.9885	10	0.72032	D	0.01	-6.2645	11.2141	0.48817	0.0:0.8595:0.0:0.1405	.	494	Q6NUP7	PP4R4_HUMAN	G	494	ENSP00000305924:A494G	ENSP00000305924:A494G	A	+	2	0	PPP4R4	93782499	0.999000	0.42202	0.990000	0.47175	0.997000	0.91878	4.056000	0.57448	1.587000	0.49959	0.655000	0.94253	GCT	PPP4R4	-	superfamily_ARM-type_fold	ENSG00000119698		0.398	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1		0.00	48	0	C	NM_058237		94712746	+1			no_errors	ENST00000304338	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.974	G
PROX1	5629	genome.wustl.edu	37	1	214170813	214170813	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:214170813G>C	ENST00000366958.4	+	2	1543	c.935G>C	c.(934-936)cGa>cCa	p.R312P	PROX1_ENST00000435016.1_Missense_Mutation_p.R312P|PROX1_ENST00000498508.2_Missense_Mutation_p.R312P|PROX1_ENST00000261454.4_Missense_Mutation_p.R312P	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	312					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		GACCGAGCTCGAGCCCTGATC	0.537																																																	0													80.0	82.0	82.0					1																	214170813		2203	4300	6503	SO:0001583	missense	0			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.935G>C	1.37:g.214170813G>C	ENSP00000355925:p.Arg312Pro		A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	pfam_Homeo_prospero_dom,superfamily_Homeodomain-like	p.R312P	ENST00000366958.4	37	c.935	CCDS31021.1	1	.	.	.	.	.	.	.	.	.	.	G	8.554	0.876243	0.17395	.	.	ENSG00000117707	ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.51817	0.7;0.69;0.7;0.7	5.71	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.64527	0.2606	M	0.63428	1.95	0.58432	D	0.999997	D	0.67145	0.996	D	0.64877	0.93	T	0.65520	-0.6148	10	0.42905	T	0.14	-1.7657	16.8312	0.85945	0.0:0.1285:0.8714:0.0	.	312	Q92786	PROX1_HUMAN	P	312	ENSP00000420283:R312P;ENSP00000355925:R312P;ENSP00000400694:R312P;ENSP00000261454:R312P	ENSP00000261454:R312P	R	+	2	0	PROX1	212237436	1.000000	0.71417	0.803000	0.32268	0.109000	0.19521	7.393000	0.79851	1.397000	0.46682	0.563000	0.77884	CGA	PROX1	-	NULL	ENSG00000117707		0.537	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROX1	HGNC	protein_coding	OTTHUMT00000089727.6	-	0.00	21	0	G	NM_002763		214170813	+1	tier1	-	no_errors	ENST00000261454	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.991	C
PSTPIP2	9050	genome.wustl.edu	37	18	43572095	43572095	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr18:43572095C>T	ENST00000409746.5	-	11	886	c.815G>A	c.(814-816)cGc>cAc	p.R272H	PSTPIP2_ENST00000589328.1_Intron|PSTPIP2_ENST00000588801.1_Intron|RN7SKP26_ENST00000410247.1_RNA	NM_024430.3	NP_077748.3	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting protein 2	272						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	17						TCCAGTTTTGCGTTGATTCAC	0.388																																																	0													79.0	75.0	77.0					18																	43572095		1568	3582	5150	SO:0001583	missense	0				CCDS32820.2	18q12	2008-07-28			ENSG00000152229	ENSG00000152229			9581	protein-coding gene	gene with protein product						9804817	Standard	NM_024430		Approved		uc002lbp.4	Q9H939	OTTHUMG00000152674	ENST00000409746.5:c.815G>A	18.37:g.43572095C>T	ENSP00000387261:p.Arg272His			Missense_Mutation	SNP	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	p.R272H	ENST00000409746.5	37	c.815	CCDS32820.2	18	.	.	.	.	.	.	.	.	.	.	C	13.88	2.368201	0.42003	.	.	ENSG00000152229	ENST00000409746	T	0.39592	1.07	5.51	3.73	0.42828	.	0.112192	0.64402	N	0.000016	T	0.28797	0.0714	L	0.38838	1.175	0.27828	N	0.941545	B	0.18166	0.026	B	0.14023	0.01	T	0.17899	-1.0354	10	0.17369	T	0.5	.	8.6954	0.34293	0.0:0.7638:0.0:0.2362	.	272	Q9H939	PPIP2_HUMAN	H	272	ENSP00000387261:R272H	ENSP00000387261:R272H	R	-	2	0	PSTPIP2	41826093	0.595000	0.26857	0.942000	0.38095	0.946000	0.59487	1.538000	0.36094	0.820000	0.34516	0.579000	0.79373	CGC	PSTPIP2	-	NULL	ENSG00000152229		0.388	PSTPIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSTPIP2	HGNC	protein_coding	OTTHUMT00000327522.1	-	0.00	84	0	C			43572095	-1	tier1	-	no_errors	ENST00000409746	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.967	T
PTDSS1	9791	genome.wustl.edu	37	8	97321829	97321829	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:97321829G>A	ENST00000517309.1	+	9	1378	c.1052G>A	c.(1051-1053)gGa>gAa	p.G351E	PTDSS1_ENST00000455950.2_Missense_Mutation_p.G205E|Y_RNA_ENST00000362862.1_RNA|PTDSS1_ENST00000522072.1_Missense_Mutation_p.G148E	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	351					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.G351A(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	AAGCGCGTAGGAACACAATGC	0.428																																																	1	Substitution - Missense(1)	lung(1)											99.0	91.0	94.0					8																	97321829		2203	4300	6503	SO:0001583	missense	0			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.1052G>A	8.37:g.97321829G>A	ENSP00000430548:p.Gly351Glu		E5RFC5|Q9BUQ5	Missense_Mutation	SNP	pfam_PSS	p.G351E	ENST00000517309.1	37	c.1052	CCDS6271.1	8	.	.	.	.	.	.	.	.	.	.	G	34	5.348796	0.95807	.	.	ENSG00000156471	ENST00000517309;ENST00000455950;ENST00000522072	T;T;T	0.68903	-0.36;-0.19;-0.33	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.86957	0.6058	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89721	0.3919	10	0.87932	D	0	-14.6411	18.224	0.89911	0.0:0.0:1.0:0.0	.	351	P48651	PTSS1_HUMAN	E	351;205;148	ENSP00000430548:G351E;ENSP00000401248:G205E;ENSP00000430928:G148E	ENSP00000401248:G205E	G	+	2	0	PTDSS1	97391005	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.837000	0.99465	2.731000	0.93534	0.650000	0.86243	GGA	PTDSS1	-	pfam_PSS	ENSG00000156471		0.428	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTDSS1	HGNC	protein_coding	OTTHUMT00000379743.2	-	0.00	66	0	G			97321829	+1	tier1	-	no_errors	ENST00000517309	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	A
PTPN1	5770	genome.wustl.edu	37	20	49195805	49195805	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:49195805G>T	ENST00000371621.3	+	7	977	c.803G>T	c.(802-804)cGc>cTc	p.R268L	PTPN1_ENST00000541713.1_Missense_Mutation_p.R195L|RP4-530I15.9_ENST00000431019.1_RNA	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	268	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	GACCAGCTGCGCTTCTCCTAC	0.498																																																	0													137.0	140.0	139.0					20																	49195805		2203	4300	6503	SO:0001583	missense	0				CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.803G>T	20.37:g.49195805G>T	ENSP00000360683:p.Arg268Leu		Q5TGD8|Q9BQV9|Q9NQQ4	Missense_Mutation	SNP	pirsf_Ptpn1/Ptpn2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R268L	ENST00000371621.3	37	c.803	CCDS13430.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.136638	0.94517	.	.	ENSG00000196396	ENST00000371621;ENST00000541713	D;D	0.82619	-1.63;-1.63	5.64	4.7	0.59300	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000003	D	0.88262	0.6389	L	0.49778	1.585	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.89199	0.3556	10	0.72032	D	0.01	.	14.5221	0.67856	0.0704:0.0:0.9296:0.0	.	268	P18031	PTN1_HUMAN	L	268;195	ENSP00000360683:R268L;ENSP00000437732:R195L	ENSP00000360683:R268L	R	+	2	0	PTPN1	48629212	1.000000	0.71417	0.997000	0.53966	0.968000	0.65278	9.869000	0.99810	1.382000	0.46385	0.563000	0.77884	CGC	PTPN1	-	pirsf_Ptpn1/Ptpn2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000196396		0.498	PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN1	HGNC	protein_coding	OTTHUMT00000079694.2	-	0.00	61	0	G			49195805	+1	tier1	-	no_errors	ENST00000371621	ensembl	human	known	74_37	missense	24.56	43	14	SNP	1.000	T
PTPRJ	5795	genome.wustl.edu	37	11	48161120	48161120	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:48161120C>T	ENST00000418331.2	+	11	2587	c.2235C>T	c.(2233-2235)ggC>ggT	p.G745G		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	745	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GCCCTCCTGGCGCCAATGCAG	0.582																																																	0													61.0	61.0	61.0					11																	48161120		2201	4298	6499	SO:0001819	synonymous_variant	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.2235C>T	11.37:g.48161120C>T			Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.G745	ENST00000418331.2	37	c.2235	CCDS7945.1	11																																																																																			PTPRJ	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000149177		0.582	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1	-	0.00	52	0	C			48161120	+1	tier1	-	no_errors	ENST00000418331	ensembl	human	known	74_37	silent	16.00	42	8	SNP	0.001	T
PTPRZ1	5803	genome.wustl.edu	37	7	121695040	121695040	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:121695040A>G	ENST00000393386.2	+	27	6838	c.6427A>G	c.(6427-6429)Aat>Gat	p.N2143D	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.N1276D	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2143	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TGAGCCTATAAATTGTGAGAG	0.328																																																	0													90.0	93.0	92.0					7																	121695040		2203	4298	6501	SO:0001583	missense	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6427A>G	7.37:g.121695040A>G	ENSP00000377047:p.Asn2143Asp		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.N2143D	ENST00000393386.2	37	c.6427	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110303	0.77210	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	D;D	0.83419	-1.72;-1.72	5.96	5.96	0.96718	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.142113	0.48767	D	0.000163	D	0.85982	0.5824	L	0.31578	0.945	0.31785	N	0.630386	P;B;D	0.63046	0.867;0.036;0.992	B;B;D	0.65684	0.359;0.105;0.937	D	0.87793	0.2620	10	0.72032	D	0.01	.	16.4293	0.83835	1.0:0.0:0.0:0.0	.	1282;1276;2143	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	D	2143;1276	ENSP00000377047:N2143D;ENSP00000410000:N1276D	ENSP00000377047:N2143D	N	+	1	0	PTPRZ1	121482276	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.401000	0.79962	2.271000	0.75665	0.528000	0.53228	AAT	PTPRZ1	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000106278		0.328	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	-	0.00	38	0	A	NM_002851		121695040	+1	tier1	-	no_errors	ENST00000393386	ensembl	human	known	74_37	missense	18.92	30	7	SNP	1.000	G
RALGAPA1	253959	genome.wustl.edu	37	14	36096451	36096451	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:36096451T>G	ENST00000389698.3	-	33	5574	c.5184A>C	c.(5182-5184)caA>caC	p.Q1728H	RALGAPA1_ENST00000307138.6_Missense_Mutation_p.Q1728H|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.Q1775H|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.Q1741H	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1728	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTTCTGTATGTTGCTTAAGGA	0.353																																																	0													67.0	66.0	66.0					14																	36096451		2203	4295	6498	SO:0001583	missense	0			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.5184A>C	14.37:g.36096451T>G	ENSP00000374348:p.Gln1728His		A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.Q1775H	ENST00000389698.3	37	c.5325	CCDS32065.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.98|15.98	2.993990|2.993990	0.54041|0.54041	.|.	.|.	ENSG00000174373|ENSG00000174373	ENST00000554573|ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	.|D;D;D;D;D;D	.|0.93712	.|-3.27;-3.27;-3.27;-3.27;-3.27;-3.27	5.4|5.4	0.136|0.136	0.14780|0.14780	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95513|0.95513	0.8542|0.8542	M|M	0.78285|0.78285	2.405|2.405	0.46499|0.46499	D|D	0.999077|0.999077	.|D;P;P;D	.|0.76494	.|0.999;0.855;0.947;0.989	.|D;P;P;P	.|0.85130	.|0.997;0.667;0.777;0.878	D|D	0.94023|0.94023	0.7294|0.7294	5|10	.|0.87932	.|D	.|0	-12.2717|-12.2717	10.1517|10.1517	0.42799|0.42799	0.0:0.5089:0.0:0.4911|0.0:0.5089:0.0:0.4911	.|.	.|1775;1741;1728;1728	.|Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.|.;.;.;RGPA1_HUMAN	T|H	11|1728;1728;1728;1775;366;1741;1775	.|ENSP00000374348:Q1728H;ENSP00000302647:Q1728H;ENSP00000258840:Q1775H;ENSP00000451133:Q366H;ENSP00000371803:Q1741H;ENSP00000451877:Q1775H	.|ENSP00000258840:Q1775H	N|Q	-|-	2|3	0|2	RALGAPA1|RALGAPA1	35166202|35166202	0.997000|0.997000	0.39634|0.39634	0.993000|0.993000	0.49108|0.49108	0.997000|0.997000	0.91878|0.91878	0.818000|0.818000	0.27295|0.27295	0.061000|0.061000	0.16311|0.16311	0.533000|0.533000	0.62120|0.62120	AAC|CAA	RALGAPA1	-	NULL	ENSG00000174373		0.353	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	RALGAPA1	HGNC	protein_coding	OTTHUMT00000409829.1	-	0.00	138	0	T	XM_210022		36096451	-1	tier1	-	no_errors	ENST00000258840	ensembl	human	known	74_37	missense	20.30	106	27	SNP	0.997	G
RAP1GDS1	5910	genome.wustl.edu	37	4	99355168	99355168	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:99355168A>G	ENST00000408927.3	+	13	1635	c.1522A>G	c.(1522-1524)Aat>Gat	p.N508D	RAP1GDS1_ENST00000453712.2_Missense_Mutation_p.N508D|RAP1GDS1_ENST00000264572.7_Missense_Mutation_p.N417D|RAP1GDS1_ENST00000408900.3_Missense_Mutation_p.N459D|RAP1GDS1_ENST00000339360.5_Missense_Mutation_p.N509D|RAP1GDS1_ENST00000380158.4_Missense_Mutation_p.N460D	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	508					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		AATAATGCAGAATGAAGCTCT	0.353			T	NUP98	T-ALL																																			Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	0													115.0	111.0	112.0					4																	99355168		1908	4124	6032	SO:0001583	missense	0				CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1522A>G	4.37:g.99355168A>G	ENSP00000386153:p.Asn508Asp		E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.N509D	ENST00000408927.3	37	c.1525	CCDS43253.1	4	.	.	.	.	.	.	.	.	.	.	A	26.1	4.702775	0.88924	.	.	ENSG00000138698	ENST00000380158;ENST00000264572;ENST00000408927;ENST00000453712;ENST00000408900;ENST00000339360	T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.92	5.92	0.95590	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.78622	0.4312	L	0.61218	1.895	0.80722	D	1	D;B;B;P;P;D	0.89917	1.0;0.116;0.141;0.734;0.885;0.999	D;B;B;P;P;D	0.87578	0.998;0.075;0.122;0.449;0.637;0.956	T	0.74368	-0.3688	10	0.18276	T	0.48	-17.1937	16.3533	0.83225	1.0:0.0:0.0:0.0	.	417;459;460;508;509;508	E9PH06;P52306-2;Q499L7;P52306;Q4QQI8;G5E9P9	.;.;.;GDS1_HUMAN;.;.	D	460;417;508;508;459;509	ENSP00000369503:N460D;ENSP00000264572:N417D;ENSP00000386153:N508D;ENSP00000407157:N508D;ENSP00000386223:N459D;ENSP00000340454:N509D	ENSP00000264572:N417D	N	+	1	0	RAP1GDS1	99574191	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.350000	0.90069	2.257000	0.74773	0.454000	0.30748	AAT	RAP1GDS1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000138698		0.353	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GDS1	HGNC	protein_coding	OTTHUMT00000363273.2	-	0.00	85	0	A	NM_001100426		99355168	+1	tier1	-	no_errors	ENST00000339360	ensembl	human	known	74_37	missense	37.14	44	26	SNP	1.000	G
RBM33	155435	genome.wustl.edu	37	7	155532574	155532576	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	CAC	CAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:155532574_155532576delCAC	ENST00000401878.3	+	12	2101_2103	c.1903_1905delCAC	c.(1903-1905)cacdel	p.H641del		NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	641	His-rich.|Pro-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		gcagcaccagcaccaccaccaCC	0.714																																																	0										2,136,3674		0,0,2,12,112,1780						-0.4	0.4			17	8,243,7015		0,0,8,19,205,3401	no	codingComplex	RBM33	NM_053043.2		0,0,10,31,317,5181	A1A1,A1A2,A1R,A2A2,A2R,RR		3.4544,3.6201,3.5115				10,379,10689				SO:0001651	inframe_deletion	0			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.1903_1905delCAC	7.37:g.155532583_155532585delCAC	ENSP00000384160:p.His641del		A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	In_Frame_Del	DEL	smart_RRM_dom	p.H638in_frame_del	ENST00000401878.3	37	c.1903_1905	CCDS5941.2	7																																																																																			RBM33	-	NULL	ENSG00000184863		0.714	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	HGNC	protein_coding	OTTHUMT00000317225.3		0.00	31	0	CAC	NM_001008408		155532576	+1	tier1		no_errors	ENST00000401878	ensembl	human	known	74_37	in_frame_del	16.67	15	3	DEL	0.994:0.987:0.985	-
RBM44	375316	genome.wustl.edu	37	2	238726336	238726336	+	Silent	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:238726336A>C	ENST00000409864.1	+	3	1031	c.777A>C	c.(775-777)tcA>tcC	p.S259S	RBM44_ENST00000316997.4_Silent_p.S259S|RBM44_ENST00000444524.2_Intron			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	258						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		AAGAAGAGTCACTTCATGTCT	0.343																																																	0													64.0	62.0	63.0					2																	238726336		1856	4095	5951	SO:0001819	synonymous_variant	0			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.777A>C	2.37:g.238726336A>C			A0AUW3	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S259	ENST00000409864.1	37	c.777	CCDS46554.1	2																																																																																			RBM44	-	NULL	ENSG00000177483		0.343	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM44	HGNC	protein_coding	OTTHUMT00000328733.2	-	0.00	47	0	A	NM_001080504		238726336	+1	tier1	-	no_errors	ENST00000316997	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.002	C
RELN	5649	genome.wustl.edu	37	7	103175830	103175830	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:103175830G>A	ENST00000428762.1	-	46	7441	c.7282C>T	c.(7282-7284)Cgg>Tgg	p.R2428W	RELN_ENST00000424685.2_Missense_Mutation_p.R2428W|RELN_ENST00000343529.5_Missense_Mutation_p.R2428W	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2428					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R2428W(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACCAGGATCCGTTGCAGATGA	0.458																																					NSCLC(146;835 1944 15585 22231 52158)												1	Substitution - Missense(1)	kidney(1)											175.0	134.0	147.0					7																	103175830		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7282C>T	7.37:g.103175830G>A	ENSP00000392423:p.Arg2428Trp		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.R2428W	ENST00000428762.1	37	c.7282	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821598	0.71028	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.22539	1.95;1.95;1.95	5.57	2.32	0.28847	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.39937	0.1097	L	0.54323	1.7	0.49915	D	0.99983	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.951	T	0.33163	-0.9879	10	0.87932	D	0	.	14.2227	0.65839	0.0:0.0:0.3047:0.6953	.	2428;2428	P78509-2;P78509	.;RELN_HUMAN	W	2428	ENSP00000392423:R2428W;ENSP00000345694:R2428W;ENSP00000388446:R2428W	ENSP00000345694:R2428W	R	-	1	2	RELN	102963066	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.032000	0.41127	0.662000	0.31006	0.655000	0.94253	CGG	RELN	-	superfamily_Sialidases	ENSG00000189056		0.458	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1		0.00	47	0	G	NM_005045		103175830	-1			no_errors	ENST00000424685	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
RELN	5649	genome.wustl.edu	37	7	103243886	103243886	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:103243886C>T	ENST00000428762.1	-	24	3357	c.3198G>A	c.(3196-3198)ccG>ccA	p.P1066P	RELN_ENST00000424685.2_Silent_p.P1066P|RELN_ENST00000343529.5_Silent_p.P1066P	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1066					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TAATTGTGGACGGAAGGGCAG	0.517																																					NSCLC(146;835 1944 15585 22231 52158)												0													97.0	94.0	95.0					7																	103243886		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3198G>A	7.37:g.103243886C>T			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.P1066	ENST00000428762.1	37	c.3198	CCDS47680.1	7																																																																																			RELN	-	superfamily_Growth_fac_rcpt_N_dom,superfamily_Sialidases	ENSG00000189056		0.517	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	69	0	C	NM_005045		103243886	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	silent	11.49	77	10	SNP	0.949	T
REV3L	5980	genome.wustl.edu	37	6	111656701	111656701	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:111656701A>C	ENST00000358835.3	-	23	8105	c.7651T>G	c.(7651-7653)Ttt>Gtt	p.F2551V	REV3L_ENST00000368802.3_Missense_Mutation_p.F2551V|REV3L_ENST00000368805.1_Missense_Mutation_p.F2551V|REV3L_ENST00000435970.1_Missense_Mutation_p.F2473V			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2551					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ACATGTAAAAACTGAATGCCA	0.408								DNA polymerases (catalytic subunits)																																									0													154.0	147.0	150.0					6																	111656701		2203	4300	6503	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.7651T>G	6.37:g.111656701A>C	ENSP00000351697:p.Phe2551Val		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.F2551V	ENST00000358835.3	37	c.7651	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	A	28.2	4.897774	0.91962	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	T;T;T;T	0.44881	4.77;4.77;4.77;0.91	5.53	5.53	0.82687	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	M	0.92367	3.3	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.77558	-0.2543	10	0.87932	D	0	-8.8965	15.6624	0.77197	1.0:0.0:0.0:0.0	.	2551	O60673	DPOLZ_HUMAN	V	2551;2551;2551;2473;624	ENSP00000357792:F2551V;ENSP00000357795:F2551V;ENSP00000351697:F2551V;ENSP00000402003:F2473V	ENSP00000351697:F2551V	F	-	1	0	REV3L	111763394	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.335000	0.96500	2.090000	0.63153	0.377000	0.23210	TTT	REV3L	-	superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	ENSG00000009413		0.408	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	28	0	A	NM_002912		111656701	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	C
RGS12	6002	genome.wustl.edu	37	4	3318886	3318887	+	In_Frame_Ins	INS	-	-	GGG			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:3318886_3318887insGGG	ENST00000344733.5	+	2	1893_1894	c.989_990insGGG	c.(988-993)gagggc>gaGGGgggc	p.331_332insG	RGS12_ENST00000336727.3_In_Frame_Ins_p.331_332insG|RGS12_ENST00000382788.3_In_Frame_Ins_p.331_332insG|RGS12_ENST00000543385.1_In_Frame_Ins_p.331_332insG	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	331	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CAGGAGGAGGAGGGCGCCCTGC	0.599																																																	0																																										SO:0001652	inframe_insertion	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.990_992dupGGG	4.37:g.3318887_3318889dupGGG	ENSP00000339381:p.Gly331_Gly331dup		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	In_Frame_Ins	INS	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTB/PI_dom,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTB/PI_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.332in_frame_insG	ENST00000344733.5	37	c.989_990	CCDS3366.1	4																																																																																			RGS12	-	smart_PTB/PI_dom,pfscan_PTB/PI_dom	ENSG00000159788		0.599	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1		0.00	38	0	-	NM_002926		3318887	+1	tier1		no_errors	ENST00000344733	ensembl	human	known	74_37	in_frame_ins	17.50	33	7	INS	0.251:0.143	GGG
RIMS2	9699	genome.wustl.edu	37	8	104973332	104973332	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:104973332A>G	ENST00000436393.2	+	13	2316	c.2075A>G	c.(2074-2076)gAc>gGc	p.D692G	RIMS2_ENST00000406091.3_Missense_Mutation_p.D914G|RIMS2_ENST00000507740.1_Missense_Mutation_p.D706G|RIMS2_ENST00000262231.10_Missense_Mutation_p.D753G			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	976	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCTGACTATGACTGTGATGAT	0.289										HNSCC(12;0.0054)																																							0													106.0	114.0	112.0					8																	104973332		1799	4058	5857	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2075A>G	8.37:g.104973332A>G	ENSP00000390665:p.Asp692Gly		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.D914G	ENST00000436393.2	37	c.2741		8	.	.	.	.	.	.	.	.	.	.	A	21.8	4.205735	0.79127	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.24151	1.87;2.36;1.97;1.98;1.91;2.19	5.95	5.95	0.96441	.	.	.	.	.	T	0.48732	0.1516	M	0.66939	2.045	0.80722	D	1	D;D;D;D;D;D	0.89917	0.996;0.997;0.997;0.997;0.999;1.0	P;D;D;D;D;D	0.91635	0.876;0.979;0.993;0.995;0.998;0.999	T	0.41052	-0.9530	9	0.40728	T	0.16	.	13.9284	0.63978	1.0:0.0:0.0:0.0	.	976;976;692;753;706;914	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	G	914;929;914;976;753;706;706;692	ENSP00000427018:D914G;ENSP00000384892:D914G;ENSP00000262231:D753G;ENSP00000423559:D706G;ENSP00000386228:D706G;ENSP00000390665:D692G	ENSP00000262231:D753G	D	+	2	0	RIMS2	105042508	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.042000	0.76565	2.279000	0.76181	0.402000	0.26972	GAC	RIMS2	-	NULL	ENSG00000176406		0.289	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1		0.00	52	0	A	NM_001100117		104973332	+1			no_errors	ENST00000406091	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	G
RPL6P27	645387	genome.wustl.edu	37	18	6462681	6462681	+	RNA	SNP	C	C	T	rs577381872		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr18:6462681C>T	ENST00000583065.1	-	0	217									ribosomal protein L6 pseudogene 27																		AGGCATTTTGCGAAGTTTAAC	0.473																																																	0																																												0					18p11.31	2009-03-11				ENSG00000235552			36133	pseudogene	pseudogene						19123937	Standard	NG_009652		Approved						18.37:g.6462681C>T				RNA	SNP	-	NULL	ENST00000583065.1	37	NULL		18																																																																																			RPL6P27	-	-	ENSG00000235552		0.473	RPL6P27-002	KNOWN	basic	processed_transcript	RPL6P27	HGNC	pseudogene	OTTHUMT00000444194.1	-	0.00	74	0	C	NG_009652		6462681	-1	tier1	-	no_errors	ENST00000583065	ensembl	human	known	74_37	rna	9.09	60	6	SNP	1.000	T
RTL1	388015	genome.wustl.edu	37	14	101348911	101348911	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:101348911A>C	ENST00000534062.1	-	1	2273	c.2215T>G	c.(2215-2217)Tca>Gca	p.S739A	MIR127_ENST00000384876.1_RNA|MIR433_ENST00000384837.1_RNA|MIR431_ENST00000385266.1_RNA|MIR432_ENST00000606207.1_RNA|MIR136_ENST00000385207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	739					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TGACTCATTGAGTAGATCAGG	0.537																																																	0													100.0	94.0	96.0					14																	101348911		692	1591	2283	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2215T>G	14.37:g.101348911A>C	ENSP00000435342:p.Ser739Ala		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.S739A	ENST00000534062.1	37	c.2215	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	A	16.99	3.273146	0.59649	.	.	ENSG00000254656	ENST00000534062	T	0.53857	0.6	3.81	3.81	0.43845	.	0.000000	0.33534	N	0.004813	T	0.72366	0.3451	M	0.85542	2.76	0.29425	N	0.860271	D	0.76494	0.999	D	0.76071	0.987	T	0.70375	-0.4889	10	0.87932	D	0	.	11.1911	0.48685	1.0:0.0:0.0:0.0	.	739	E9PKS8	.	A	739	ENSP00000435342:S739A	ENSP00000435342:S739A	S	-	1	0	RTL1	100418664	1.000000	0.71417	0.997000	0.53966	0.543000	0.35085	6.381000	0.73163	1.967000	0.57214	0.459000	0.35465	TCA	RTL1	-	NULL	ENSG00000254656		0.537	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1		0.00	28	0	A	NM_001134888		101348911	-1			no_errors	ENST00000534062	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	C
RUNDC3B	154661	genome.wustl.edu	37	7	87370826	87370826	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:87370826A>C	ENST00000338056.3	+	7	1022	c.611A>C	c.(610-612)aAg>aCg	p.K204T	RUNDC3B_ENST00000496000.1_3'UTR|RUNDC3B_ENST00000493037.1_Missense_Mutation_p.K187T|RUNDC3B_ENST00000394654.3_Missense_Mutation_p.K187T	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	204	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.							p.K204T(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					TTCTGCCTAAAGGGAGAGGGG	0.303																																																	1	Substitution - Missense(1)	large_intestine(1)											62.0	61.0	61.0					7																	87370826		2203	4298	6501	SO:0001583	missense	0				CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.611A>C	7.37:g.87370826A>C	ENSP00000337732:p.Lys204Thr		B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.K204T	ENST00000338056.3	37	c.611	CCDS5609.1	7	.	.	.	.	.	.	.	.	.	.	A	20.8	4.057190	0.76074	.	.	ENSG00000105784	ENST00000338056;ENST00000493037;ENST00000394654	T;T;T	0.28069	1.63;1.63;1.63	5.16	5.16	0.70880	RUN (3);	0.000000	0.85682	D	0.000000	T	0.61362	0.2341	M	0.89414	3.03	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.988	D;D;D;D;D	0.87578	0.998;0.998;0.994;0.994;0.919	T	0.68853	-0.5299	10	0.59425	D	0.04	-11.8876	13.9767	0.64277	1.0:0.0:0.0:0.0	.	187;187;109;187;204	E9PBR4;B4DFD0;Q96NL0-2;Q96NL0-4;Q96NL0	.;.;.;.;RUN3B_HUMAN	T	204;187;187	ENSP00000337732:K204T;ENSP00000420394:K187T;ENSP00000378149:K187T	ENSP00000337732:K204T	K	+	2	0	RUNDC3B	87208762	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.489000	0.81451	1.929000	0.55896	0.533000	0.62120	AAG	RUNDC3B	-	pfam_Run,smart_Run,pfscan_Run	ENSG00000105784		0.303	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	RUNDC3B	HGNC	protein_coding	OTTHUMT00000253679.1	-	0.00	140	0	A	NM_138290		87370826	+1	tier1	-	no_errors	ENST00000338056	ensembl	human	known	74_37	missense	16.03	131	25	SNP	1.000	C
SASH1	23328	genome.wustl.edu	37	6	148711341	148711341	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:148711341C>T	ENST00000367467.3	+	2	703	c.228C>T	c.(226-228)gaC>gaT	p.D76D	SASH1_ENST00000367469.1_Silent_p.D31D	NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	76					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.D76D(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GTTTCTCCGACGTGTGCGAGA	0.562																																																	1	Substitution - coding silent(1)	lung(1)											100.0	89.0	93.0					6																	148711341		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.228C>T	6.37:g.148711341C>T			Q5TGN5|Q8TAI0|Q9H7R7	Silent	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.D76	ENST00000367467.3	37	c.228	CCDS5212.1	6																																																																																			SASH1	-	NULL	ENSG00000111961		0.562	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	HGNC	protein_coding	OTTHUMT00000042619.1	-	0.00	58	0	C	NM_015278		148711341	+1	tier1	-	no_errors	ENST00000367467	ensembl	human	known	74_37	silent	25.86	43	15	SNP	1.000	T
SAV1	60485	genome.wustl.edu	37	14	51132289	51132289	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:51132289G>C	ENST00000324679.4	-	2	506	c.143C>G	c.(142-144)aCt>aGt	p.T48S	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	48					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					ACAGATATCAGTTCGTCTTGG	0.363																																																	0													38.0	39.0	39.0					14																	51132289		2202	4300	6502	SO:0001583	missense	0			AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.143C>G	14.37:g.51132289G>C	ENSP00000324729:p.Thr48Ser		A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Missense_Mutation	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_SARAH_dom,pfscan_WW_dom	p.T48S	ENST00000324679.4	37	c.143	CCDS9701.1	14	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632412	0.46944	.	.	ENSG00000151748	ENST00000324679;ENST00000535862	T	0.41400	1.0	5.18	5.18	0.71444	.	0.100972	0.64402	D	0.000003	T	0.29914	0.0748	N	0.17082	0.46	0.38333	D	0.94384	B	0.19331	0.035	B	0.19946	0.027	T	0.11966	-1.0566	10	0.21540	T	0.41	-2.8107	17.6718	0.88220	0.0:0.0:1.0:0.0	.	48	Q9H4B6	SAV1_HUMAN	S	48;15	ENSP00000324729:T48S	ENSP00000324729:T48S	T	-	2	0	SAV1	50202039	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.087000	0.94110	2.422000	0.82143	0.563000	0.77884	ACT	SAV1	-	NULL	ENSG00000151748		0.363	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAV1	HGNC	protein_coding	OTTHUMT00000276879.1	-	0.00	52	0	G			51132289	-1	tier1	-	no_errors	ENST00000324679	ensembl	human	known	74_37	missense	12.68	62	9	SNP	1.000	C
SCAF4	57466	genome.wustl.edu	37	21	33063176	33063176	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr21:33063176C>G	ENST00000286835.7	-	15	2201	c.1819G>C	c.(1819-1821)Gtc>Ctc	p.V607L	SCAF4_ENST00000399804.1_Missense_Mutation_p.V607L|SCAF4_ENST00000434667.3_Missense_Mutation_p.V592L	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	607						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TCAGGCTTGACTTTGTCCCAT	0.398																																																	0													206.0	198.0	201.0					21																	33063176		2203	4300	6503	SO:0001583	missense	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.1819G>C	21.37:g.33063176C>G	ENSP00000286835:p.Val607Leu		C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_CID_dom,smart_RRM_dom,pfscan_RRM_dom	p.V607L	ENST00000286835.7	37	c.1819	CCDS33537.1	21	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141108	0.56936	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.48522	0.81;0.87;0.87	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000018	T	0.43545	0.1252	N	0.20530	0.585	0.58432	D	0.99999	P;P;P;P	0.50528	0.894;0.894;0.936;0.894	B;B;P;B	0.50405	0.437;0.437;0.64;0.437	T	0.12863	-1.0531	10	0.08837	T	0.75	-11.9762	20.2033	0.98269	0.0:1.0:0.0:0.0	.	592;607;607;607	C9JLZ0;C9J1W7;O95104-2;O95104	.;.;.;SFR15_HUMAN	L	592;607;607	ENSP00000402377:V592L;ENSP00000286835:V607L;ENSP00000382703:V607L	ENSP00000286835:V607L	V	-	1	0	SCAF4	31985047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.186000	0.50942	2.779000	0.95612	0.655000	0.94253	GTC	SCAF4	-	NULL	ENSG00000156304		0.398	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCAF4	HGNC	protein_coding	OTTHUMT00000192659.1	-	0.00	74	0	C	XM_047889		33063176	-1	tier1	-	no_errors	ENST00000286835	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	G
SCN10A	6336	genome.wustl.edu	37	3	38835375	38835376	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:38835375_38835376delCC	ENST00000449082.2	-	1	125_126	c.126_127delGG	c.(124-129)agggagfs	p.E43fs		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	43					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TCCTTCTGCTCCCTATGCTTCT	0.525																																																	0																																										SO:0001589	frameshift_variant	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.126_127delGG	3.37:g.38835375_38835376delCC	ENSP00000390600:p.Glu43fs		A6NDQ1	Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.E43fs	ENST00000449082.2	37	c.127_126	CCDS33736.1	3																																																																																			SCN10A	-	NULL	ENSG00000185313		0.525	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3		0.00	63	0	CC	NM_006514		38835376	-1	tier1		no_errors	ENST00000449082	ensembl	human	known	74_37	frame_shift_del	11.59	61	8	DEL	0.041:0.001	-
SCN10A	6336	genome.wustl.edu	37	3	38835377	38835377	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:38835377C>T	ENST00000449082.2	-	1	124	c.125G>A	c.(124-126)aGg>aAg	p.R42K		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	42					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CTTCTGCTCCCTATGCTTCTC	0.522																																																	0													167.0	171.0	169.0					3																	38835377		2203	4300	6503	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.125G>A	3.37:g.38835377C>T	ENSP00000390600:p.Arg42Lys		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.R42K	ENST00000449082.2	37	c.125	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	C	1.365	-0.587768	0.03799	.	.	ENSG00000185313	ENST00000449082	D	0.95412	-3.7	5.05	-2.09	0.07232	.	1.752560	0.02493	N	0.089656	D	0.90263	0.6955	N	0.20483	0.58	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.80881	-0.1184	10	0.49607	T	0.09	.	7.4797	0.27398	0.0:0.4606:0.1949:0.3445	.	42	Q9Y5Y9	SCNAA_HUMAN	K	42	ENSP00000390600:R42K	ENSP00000390600:R42K	R	-	2	0	SCN10A	38810381	0.000000	0.05858	0.000000	0.03702	0.171000	0.22731	-3.240000	0.00544	-0.273000	0.09246	-0.251000	0.11542	AGG	SCN10A	-	NULL	ENSG00000185313		0.522	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	-	0.00	62	0	C	NM_006514		38835377	-1	tier1	-	no_errors	ENST00000449082	ensembl	human	known	74_37	missense	11.76	59	8	SNP	0.000	T
SCN3A	6328	genome.wustl.edu	37	2	165972030	165972030	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:165972030C>T	ENST00000360093.3	-	19	3940	c.3449G>A	c.(3448-3450)cGa>cAa	p.R1150Q	SCN3A_ENST00000409101.3_Missense_Mutation_p.R1101Q|SCN3A_ENST00000283254.7_Missense_Mutation_p.R1150Q	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1150					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCACCTTCTCGGGGTAGAAC	0.398																																																	0													129.0	120.0	123.0					2																	165972030		2203	4300	6503	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.3449G>A	2.37:g.165972030C>T	ENSP00000353206:p.Arg1150Gln		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.R1150Q	ENST00000360093.3	37	c.3449		2	.	.	.	.	.	.	.	.	.	.	C	15.17	2.752574	0.49362	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	5.22	5.22	0.72569	Sodium ion transport-associated (1);	0.000000	0.45126	D	0.000382	T	0.78773	0.4336	L	0.36672	1.1	0.80722	D	1	B;B;B;B;B	0.27791	0.02;0.189;0.157;0.157;0.034	B;B;B;B;B	0.28991	0.085;0.097;0.058;0.058;0.051	T	0.74948	-0.3490	10	0.38643	T	0.18	.	19.1509	0.93488	0.0:1.0:0.0:0.0	.	1150;1101;1101;1101;1150	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	Q	1150;1150;1101;1101	ENSP00000353206:R1150Q;ENSP00000283254:R1150Q;ENSP00000386726:R1101Q;ENSP00000403348:R1101Q	ENSP00000283254:R1150Q	R	-	2	0	SCN3A	165680276	0.981000	0.34729	1.000000	0.80357	0.997000	0.91878	2.993000	0.49425	2.599000	0.87857	0.563000	0.77884	CGA	SCN3A	-	pfam_Na_trans_assoc	ENSG00000153253		0.398	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	47	0	C	NM_006922		165972030	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	10.34	52	6	SNP	1.000	T
SCN4A	6329	genome.wustl.edu	37	17	62020234	62020234	+	Missense_Mutation	SNP	C	C	T	rs369929462		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:62020234C>T	ENST00000435607.1	-	23	4316	c.4240G>A	c.(4240-4242)Gtt>Att	p.V1414I	SCN4A_ENST00000578147.1_Missense_Mutation_p.V1414I	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1414					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCCAGCCAACGGTGAAGTAG	0.572																																																	0								C	ILE/VAL	0,4404		0,0,2202	137.0	133.0	134.0		4240	-0.5	1.0	17		134	2,8592	2.2+/-6.3	0,2,4295	no	missense	SCN4A	NM_000334.4	29	0,2,6497	TT,TC,CC		0.0233,0.0,0.0154	benign	1414/1837	62020234	2,12996	2202	4297	6499	SO:0001583	missense	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.4240G>A	17.37:g.62020234C>T	ENSP00000396320:p.Val1414Ile		Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.V1414I	ENST00000435607.1	37	c.4240	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	C	2.943	-0.218558	0.06101	0.0	2.33E-4	ENSG00000007314	ENST00000435607	D	0.98381	-4.9	3.86	-0.502	0.12004	Ion transport (1);	0.361157	0.26840	N	0.022231	D	0.90635	0.7063	N	0.04746	-0.17	0.24917	N	0.992009	B	0.02656	0.0	B	0.08055	0.003	T	0.81970	-0.0689	10	0.02654	T	1	.	9.0864	0.36584	0.0:0.4951:0.0:0.5049	.	1414	P35499	SCN4A_HUMAN	I	1414	ENSP00000396320:V1414I	ENSP00000396320:V1414I	V	-	1	0	SCN4A	59373966	0.383000	0.25156	0.990000	0.47175	0.969000	0.65631	-0.009000	0.12765	-0.144000	0.11314	0.455000	0.32223	GTT	SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.572	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding			0.00	44	0	C	NM_000334		62020234	-1			no_errors	ENST00000435607	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.977	T
SCO2	9997	genome.wustl.edu	37	22	50962128	50962128	+	Missense_Mutation	SNP	G	G	A	rs149439760	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr22:50962128G>A	ENST00000543927.1	-	2	919	c.713C>T	c.(712-714)aCg>aTg	p.T238M	SCO2_ENST00000395693.3_Missense_Mutation_p.T238M|SCO2_ENST00000535425.1_Missense_Mutation_p.T238M|CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000252785.3_Missense_Mutation_p.T238M	NM_001169109.1	NP_001162580.1	O43819	SCO2_HUMAN	SCO2 cytochrome c oxidase assembly protein	238	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|eye development (GO:0001654)|in utero embryonic development (GO:0001701)|muscle system process (GO:0003012)|oxidation-reduction process (GO:0055114)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			endometrium(1)|lung(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GTAGTAATCCGTGAAGAGGCC	0.587																																																	0								G	MET/THR,MET/THR,MET/THR,,MET/THR,	4,4402	8.1+/-20.4	0,4,2199	151.0	136.0	141.0		713,713,713,,713,	4.0	1.0	22	dbSNP_134	141	0,8600		0,0,4300	no	missense,missense,missense,utr-3,missense,utr-3	SCO2,NCAPH2	NM_001169109.1,NM_001169110.1,NM_001169111.1,NM_001185011.1,NM_005138.2,NM_152299.3	81,81,81,,81,	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	probably-damaging,probably-damaging,probably-damaging,,probably-damaging,	238/267,238/267,238/267,,238/267,	50962128	4,13002	2203	4300	6503	SO:0001583	missense	0			AL021683	CCDS14095.1	22q13.33	2014-01-30	2012-10-15		ENSG00000130489	ENSG00000130489		"""Mitochondrial respiratory chain complex assembly factors"""	10604	protein-coding gene	gene with protein product		604272	"""SCO (cytochrome oxidase deficient, yeast) homolog 2"", ""SCO cytochrome oxidase deficient homolog 2 (yeast)"", ""myopia 6"""	MYP6		10218584, 16091356, 23643385	Standard	NM_005138		Approved	SCO1L	uc003bma.3	O43819	OTTHUMG00000150251	ENST00000543927.1:c.713C>T	22.37:g.50962128G>A	ENSP00000444433:p.Thr238Met		Q3T1B5|Q9UK87	Missense_Mutation	SNP	pfam_SCO1/SenC,superfamily_Thioredoxin-like_fold,pirsf_Synth_of_cyt-c-oxidase_Sco1/2	p.T238M	ENST00000543927.1	37	c.713	CCDS14095.1	22	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036099	0.35893	9.08E-4	0.0	ENSG00000130489	ENST00000395693;ENST00000543927;ENST00000535425;ENST00000252785	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28	5.07	4.04	0.47022	Thioredoxin-like fold (3);	0.242826	0.29225	N	0.012773	D	0.88746	0.6520	N	0.26042	0.785	0.36995	D	0.894952	D	0.52996	0.957	P	0.46320	0.512	D	0.89940	0.4072	10	0.56958	D	0.05	-18.4396	9.3878	0.38354	0.1525:0.0:0.8475:0.0	.	238	O43819	SCO2_HUMAN	M	238	ENSP00000379046:T238M;ENSP00000444433:T238M;ENSP00000444242:T238M;ENSP00000252785:T238M	ENSP00000252785:T238M	T	-	2	0	SCO2	49308994	0.998000	0.40836	0.954000	0.39281	0.194000	0.23727	3.364000	0.52328	2.544000	0.85801	0.643000	0.83706	ACG	SCO2	-	pfam_SCO1/SenC,superfamily_Thioredoxin-like_fold,pirsf_Synth_of_cyt-c-oxidase_Sco1/2	ENSG00000130489		0.587	SCO2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SCO2	HGNC	protein_coding	OTTHUMT00000317091.1	-	0.00	80	0	G	NM_005138		50962128	-1	tier1	rs149439760	no_errors	ENST00000252785	ensembl	human	known	74_37	missense	6.10	77	5	SNP	0.692	A
SERPINA9	327657	genome.wustl.edu	37	14	94936069	94936069	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:94936069T>C	ENST00000380365.3	-	2	187	c.109A>G	c.(109-111)Aag>Gag	p.K37E	SERPINA9_ENST00000539349.1_5'Flank|SERPINA9_ENST00000298845.7_Missense_Mutation_p.K55E|SERPINA9_ENST00000337425.5_Missense_Mutation_p.K55E|SERPINA9_ENST00000448305.2_Intron|SERPINA9_ENST00000424550.2_Intron|SERPINA9_ENST00000546329.1_Intron			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	37					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		GGGGTGCTCTTTGTGGAGGAA	0.552																																																	0													82.0	84.0	84.0					14																	94936069		2004	4169	6173	SO:0001583	missense	0			AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.109A>G	14.37:g.94936069T>C	ENSP00000369723:p.Lys37Glu		B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.K55E	ENST00000380365.3	37	c.163		14	.	.	.	.	.	.	.	.	.	.	T	8.940	0.965500	0.18583	.	.	ENSG00000170054	ENST00000298845;ENST00000337425;ENST00000380365	D;D;D	0.87029	-2.2;-2.2;-2.2	3.99	2.83	0.33086	Serpin domain (1);	6.977240	0.00769	U	0.001198	T	0.75576	0.3868	N	0.08118	0	0.09310	N	1	B;B;B	0.27932	0.002;0.003;0.194	B;B;B	0.20767	0.004;0.01;0.031	T	0.66638	-0.5873	10	0.87932	D	0	.	4.5667	0.12189	0.0:0.1076:0.1945:0.6979	.	37;55;55	Q86WD7;Q86WD7-7;Q86WD7-2	SPA9_HUMAN;.;.	E	55;55;37	ENSP00000298845:K55E;ENSP00000337133:K55E;ENSP00000369723:K37E	ENSP00000298845:K55E	K	-	1	0	SERPINA9	94005822	0.001000	0.12720	0.000000	0.03702	0.217000	0.24651	0.645000	0.24782	0.525000	0.28522	-0.856000	0.03024	AAG	SERPINA9	-	superfamily_Serpin_dom	ENSG00000170054		0.552	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	SERPINA9	HGNC	protein_coding	OTTHUMT00000395803.2		0.00	34	0	T	NM_175739		94936069	-1			no_errors	ENST00000337425	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.001	C
SERTAD3	29946	genome.wustl.edu	37	19	40947484	40947484	+	Silent	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:40947484T>C	ENST00000322354.3	-	2	1000	c.504A>G	c.(502-504)ccA>ccG	p.P168P	SERTAD3_ENST00000392028.4_Silent_p.P168P|CTC-492K19.4_ENST00000599050.1_RNA|SERTAD3_ENST00000601217.1_5'Flank	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3	168					negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAGGAGGCTCTGGTGGGGCCC	0.532																																																	0													84.0	91.0	89.0					19																	40947484		2203	4300	6503	SO:0001819	synonymous_variant	0			AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.504A>G	19.37:g.40947484T>C			B3KQB3|Q96CQ2	Silent	SNP	pfam_SERTA,pfscan_SERTA	p.P168	ENST00000322354.3	37	c.504	CCDS12558.1	19																																																																																			SERTAD3	-	NULL	ENSG00000167565		0.532	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SERTAD3	HGNC	protein_coding	OTTHUMT00000462573.1	-	0.00	38	0	T	NM_013368		40947484	-1	tier1	-	no_errors	ENST00000322354	ensembl	human	known	74_37	silent	26.47	25	9	SNP	0.000	C
LRRC37B	114659	genome.wustl.edu	37	17	30368344	30368344	+	Intron	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:30368344A>G	ENST00000341671.7	+	8	2128				LRRC37B_ENST00000584368.1_Intron|SH3GL1P1_ENST00000579186.1_RNA|LRRC37B_ENST00000327564.7_Intron|LRRC37B_ENST00000394713.3_Intron|LRRC37B_ENST00000543378.2_Intron	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				TCCTAGCAGGAGCATGCCGCC	0.582																																																	0																																										SO:0001627	intron_variant	0			AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.2124-4375A>G	17.37:g.30368344A>G			Q17RC9|Q5YKG6	RNA	SNP	-	NULL	ENST00000341671.7	37	NULL	CCDS32609.1	17																																																																																			SH3GL1P1	-	-	ENSG00000266777		0.582	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL1P1	HGNC	protein_coding	OTTHUMT00000446508.1	-	0.00	51	0	A	NM_052888		30368344	+1	tier1	-	no_errors	ENST00000579186	ensembl	human	known	74_37	rna	9.68	56	6	SNP	0.733	G
SHKBP1	92799	genome.wustl.edu	37	19	41094536	41094536	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:41094536C>T	ENST00000291842.5	+	14	1392	c.1343C>T	c.(1342-1344)gCc>gTc	p.A448V	SHKBP1_ENST00000600733.1_Missense_Mutation_p.A423V|SHKBP1_ENST00000597649.1_3'UTR	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	448					protein homooligomerization (GO:0051260)			p.A448V(1)		breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCAGTCTGTGCCGACAACAAC	0.617																																																	1	Substitution - Missense(1)	urinary_tract(1)											161.0	145.0	151.0					19																	41094536		2203	4300	6503	SO:0001583	missense	0			AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1343C>T	19.37:g.41094536C>T	ENSP00000291842:p.Ala448Val		Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_WD40_repeat,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.A448V	ENST00000291842.5	37	c.1343	CCDS12560.1	19	.	.	.	.	.	.	.	.	.	.	C	32	5.165977	0.94768	.	.	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.06768	3.26	4.21	4.21	0.49690	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.23289	0.0563	L	0.50333	1.59	0.80722	D	1	D;D;D;D;D;D	0.76494	0.968;0.992;0.994;0.996;0.999;0.993	P;D;D;D;D;D	0.77557	0.79;0.913;0.985;0.99;0.986;0.978	T	0.01045	-1.1470	10	0.87932	D	0	-10.7559	15.5015	0.75703	0.0:1.0:0.0:0.0	.	326;228;371;285;448;448	B4DLI0;B4DUW2;B4DUV2;B3KVX8;B2R6W9;Q8TBC3	.;.;.;.;.;SHKB1_HUMAN	V	448;228	ENSP00000291842:A448V	ENSP00000291842:A448V	A	+	2	0	SHKBP1	45786376	1.000000	0.71417	0.996000	0.52242	0.969000	0.65631	5.514000	0.67043	2.182000	0.69389	0.462000	0.41574	GCC	SHKBP1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000160410		0.617	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHKBP1	HGNC	protein_coding	OTTHUMT00000462613.2		0.00	53	0	C	NM_138392		41094536	+1			no_errors	ENST00000291842	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	T
SIGLEC1	6614	genome.wustl.edu	37	20	3674201	3674201	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:3674201A>G	ENST00000344754.4	-	13	3400	c.3401T>C	c.(3400-3402)aTc>aCc	p.I1134T	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.I1134T	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1134	Ig-like C2-type 11.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GGGCAGGGGGATGGAGTGGGC	0.657																																																	0													62.0	48.0	53.0					20																	3674201		2203	4300	6503	SO:0001583	missense	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3401T>C	20.37:g.3674201A>G	ENSP00000341141:p.Ile1134Thr		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I1134T	ENST00000344754.4	37	c.3401	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	A	13.82	2.351789	0.41700	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.12672	2.66;2.66	5.52	5.52	0.82312	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.42548	D	0.000692	T	0.27866	0.0686	M	0.69358	2.11	0.31066	N	0.713526	P;B	0.50066	0.931;0.295	P;B	0.54100	0.742;0.132	T	0.28490	-1.0042	10	0.87932	D	0	.	12.0405	0.53450	1.0:0.0:0.0:0.0	.	1134;1134	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	T	1134	ENSP00000341141:I1134T;ENSP00000202578:I1134T	ENSP00000202578:I1134T	I	-	2	0	SIGLEC1	3622201	1.000000	0.71417	0.904000	0.35570	0.014000	0.08584	5.080000	0.64437	2.111000	0.64477	0.533000	0.62120	ATC	SIGLEC1	-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000088827		0.657	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	-	0.00	144	0	A	NM_023068		3674201	-1	tier1	-	no_errors	ENST00000344754	ensembl	human	known	74_37	missense	5.74	113	7	SNP	0.722	G
SIPA1L3	23094	genome.wustl.edu	37	19	38652939	38652939	+	Silent	SNP	C	C	T	rs542753643		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:38652939C>T	ENST00000222345.6	+	14	4217	c.3708C>T	c.(3706-3708)gcC>gcT	p.A1236A		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1236					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CAGCCATAGCCGGAAGCAGCG	0.607													C|||	0	0.0	0.0	0.0	5008	,	,		18269	0.0		0.0	False		,,,				2504	0.0																0													88.0	77.0	81.0					19																	38652939		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3708C>T	19.37:g.38652939C>T			Q2TV87	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.A1236	ENST00000222345.6	37	c.3708	CCDS33007.1	19																																																																																			SIPA1L3	-	NULL	ENSG00000105738		0.607	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L3	HGNC	protein_coding	OTTHUMT00000156294.2	-	0.00	36	0	C	XM_032278		38652939	+1	tier1	-	no_errors	ENST00000222345	ensembl	human	known	74_37	silent	23.53	39	12	SNP	0.013	T
SIGLEC12	89858	genome.wustl.edu	37	19	52004579	52004580	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:52004579_52004580GC>AA	ENST00000291707.3	-	1	463_464	c.408_409GC>TT	c.(406-411)caGCtc>caTTtc	p.136_137QL>HF	SIGLEC12_ENST00000598614.1_5'Flank	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	136	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TTCACAGAGAGCTGGTCATATT	0.485																																																	0																																										SO:0001583	missense	0			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.408_409delinsAA	19.37:g.52004579_52004580delinsAA	ENSP00000291707:p.Q136_L137delinsHF		Q8IYH7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L137F|p.Q136H	ENST00000291707.3	37	c.409|c.408	CCDS12833.1	19																																																																																			SIGLEC12	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000254521		0.485	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC12	HGNC	protein_coding	OTTHUMT00000384641.2	|-	0.00	96	0	G|C	NM_053003		52004579|52004580	-1	|tier1	|-	no_errors	ENST00000291707	ensembl	human	known	74_37	missense	6.25	75	5	SNP	0.000	A
SLAMF8	56833	genome.wustl.edu	37	1	159799784	159799784	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:159799784G>A	ENST00000289707.5	+	2	318	c.169G>A	c.(169-171)Gaa>Aaa	p.E57K	SLAMF8_ENST00000368104.4_Intron	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	57					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					CTGGCCTTCAGAAGAGCTCCT	0.627																																																	0													126.0	134.0	131.0					1																	159799784		2203	4300	6503	SO:0001583	missense	0			AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.169G>A	1.37:g.159799784G>A	ENSP00000289707:p.Glu57Lys		Q32MC6|Q5VU15	Missense_Mutation	SNP	pfscan_Ig-like_dom	p.E57K	ENST00000289707.5	37	c.169	CCDS1188.1	1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.531174	0.45073	.	.	ENSG00000158714	ENST00000289707	T	0.20738	2.05	4.44	4.44	0.53790	.	0.550760	0.19332	N	0.116865	T	0.16514	0.0397	L	0.34521	1.04	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.02774	-1.1112	10	0.06365	T	0.9	-18.7212	12.4262	0.55548	0.0:0.0:1.0:0.0	.	57	Q9P0V8	SLAF8_HUMAN	K	57	ENSP00000289707:E57K	ENSP00000289707:E57K	E	+	1	0	SLAMF8	158066408	0.999000	0.42202	0.971000	0.41717	0.194000	0.23727	4.590000	0.61013	2.296000	0.77279	0.313000	0.20887	GAA	SLAMF8	-	NULL	ENSG00000158714		0.627	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF8	HGNC	protein_coding	OTTHUMT00000085983.1	-	0.00	28	0	G	NM_020125		159799784	+1	tier1	-	no_errors	ENST00000289707	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.990	A
SLC17A6	57084	genome.wustl.edu	37	11	22398160	22398160	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:22398160T>G	ENST00000263160.3	+	11	1792	c.1355T>G	c.(1354-1356)gTt>gGt	p.V452G		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	452					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TCGAATGGTGTTGGCACATTG	0.383																																																	0													227.0	197.0	207.0					11																	22398160		2203	4300	6503	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1355T>G	11.37:g.22398160T>G	ENSP00000263160:p.Val452Gly		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.V452G	ENST00000263160.3	37	c.1355	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	T	28.4	4.918391	0.92249	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.58060	0.36	5.91	5.91	0.95273	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.74038	0.3664	M	0.79926	2.475	0.80722	D	1	D	0.67145	0.996	D	0.70487	0.969	T	0.77991	-0.2379	10	0.87932	D	0	.	16.3483	0.83171	0.0:0.0:0.0:1.0	.	452	Q9P2U8	VGLU2_HUMAN	G	452;340	ENSP00000263160:V452G	ENSP00000263160:V452G	V	+	2	0	SLC17A6	22354736	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	6.290000	0.72712	2.254000	0.74563	0.533000	0.62120	GTT	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.383	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	-	0.00	92	0	T	NM_020346		22398160	+1	tier1	-	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	13.86	87	14	SNP	1.000	G
SLC22A11	55867	genome.wustl.edu	37	11	64331893	64331893	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:64331893C>T	ENST00000301891.4	+	5	1309	c.935C>T	c.(934-936)aCc>aTc	p.T312I	SLC22A11_ENST00000490834.1_Intron|SLC22A11_ENST00000377581.3_Missense_Mutation_p.T312I|SLC22A11_ENST00000377585.3_Missense_Mutation_p.T312I	NM_018484.2	NP_060954.1	Q9NSA0	S22AB_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 11	312					organic anion transport (GO:0015711)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23					Aminohippurate(DB00345)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Estradiol(DB00783)|Furosemide(DB00695)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Novobiocin(DB01051)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Salicylic acid(DB00936)|Tetracycline(DB00759)|Zidovudine(DB00495)	AAGAACCTGACCATAGAGGTG	0.567																																																	0													93.0	86.0	89.0					11																	64331893		2201	4297	6498	SO:0001583	missense	0			AB026116	CCDS8074.1	11q13.3	2013-05-22	2008-01-11		ENSG00000168065	ENSG00000168065		"""Solute carriers"""	18120	protein-coding gene	gene with protein product		607097				10660625, 15576633, 17229912	Standard	NM_018484		Approved	OAT4	uc001oai.3	Q9NSA0	OTTHUMG00000045142	ENST00000301891.4:c.935C>T	11.37:g.64331893C>T	ENSP00000301891:p.Thr312Ile		A8K426|Q53GR2|Q6ZP72|Q8NBU4	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T312I	ENST00000301891.4	37	c.935	CCDS8074.1	11	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184776	0.57909	.	.	ENSG00000168065	ENST00000301891;ENST00000377585;ENST00000377581	T;T;T	0.71934	-0.61;-0.61;-0.61	4.31	3.39	0.38822	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.942280	0.02869	N	0.131355	D	0.84165	0.5412	M	0.76170	2.325	0.19945	N	0.99994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;1.0	T	0.62937	-0.6748	10	0.22706	T	0.39	.	11.3147	0.49386	0.1834:0.8166:0.0:0.0	.	312;106;312;312	Q9NSA0-2;Q8NBZ3;A6NCG2;Q9NSA0	.;.;.;S22AB_HUMAN	I	312	ENSP00000301891:T312I;ENSP00000366809:T312I;ENSP00000366804:T312I	ENSP00000301891:T312I	T	+	2	0	SLC22A11	64088469	0.303000	0.24463	0.449000	0.26957	0.270000	0.26580	0.673000	0.25203	1.022000	0.39626	0.573000	0.79308	ACC	SLC22A11	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000168065		0.567	SLC22A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A11	HGNC	protein_coding	OTTHUMT00000104886.4	-	0.00	61	0	C	NM_018484		64331893	+1	tier1	-	no_errors	ENST00000301891	ensembl	human	known	74_37	missense	21.88	50	14	SNP	0.424	T
CAPN1	823	genome.wustl.edu	37	11	64981529	64981529	+	IGR	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:64981529C>T	ENST00000527323.1	+	0	3086				SLC22A20_ENST00000525437.1_RNA			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		AGGCCTCCACCAACGACTCGG	0.701																																																	0													10.0	13.0	12.0					11																	64981529		1885	4070	5955	SO:0001628	intergenic_variant	0			X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614		11.37:g.64981529C>T			Q2TTR0|Q6DHV4	RNA	SNP	-	NULL	ENST00000527323.1	37	NULL	CCDS44644.1	11																																																																																			SLC22A20	-	-	ENSG00000197847		0.701	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC22A20	HGNC	protein_coding	OTTHUMT00000385325.1	-	0.00	104	0	C			64981529	+1	tier1	-	no_errors	ENST00000525264	ensembl	human	known	74_37	rna	16.13	78	15	SNP	0.007	T
SLC22A4	6583	genome.wustl.edu	37	5	131630432	131630432	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:131630432C>A	ENST00000200652.3	+	1	297	c.123C>A	c.(121-123)ttC>ttA	p.F41L	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	41					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	CAGTCGTGTTCCTGGCGGGGA	0.672																																																	0													51.0	58.0	56.0					5																	131630432		2203	4300	6503	SO:0001583	missense	0			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.123C>A	5.37:g.131630432C>A	ENSP00000200652:p.Phe41Leu		O14546	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.F41L	ENST00000200652.3	37	c.123	CCDS4153.1	5	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561881	0.86335	.	.	ENSG00000197208	ENST00000200652	D	0.90444	-2.67	4.45	2.66	0.31614	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.95978	0.8690	H	0.94658	3.565	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95929	0.8937	10	0.87932	D	0	.	10.7453	0.46177	0.0:0.7744:0.0:0.2256	.	41	Q9H015	S22A4_HUMAN	L	41	ENSP00000200652:F41L	ENSP00000200652:F41L	F	+	3	2	SLC22A4	131658331	0.995000	0.38212	1.000000	0.80357	0.978000	0.69477	0.640000	0.24705	1.228000	0.43614	0.491000	0.48974	TTC	SLC22A4	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_Orgcat_transp	ENSG00000197208		0.672	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A4	HGNC	protein_coding	OTTHUMT00000132661.1	-	0.00	53	0	C	NM_003059		131630432	+1	tier1	-	no_errors	ENST00000200652	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	A
SLC26A1	10861	genome.wustl.edu	37	4	983911	983911	+	Silent	SNP	C	C	T	rs139361937		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:983911C>T	ENST00000361661.2	-	4	1193	c.816G>A	c.(814-816)gcG>gcA	p.A272A	IDUA_ENST00000453894.1_Intron|IDUA_ENST00000247933.4_Intron|SLC26A1_ENST00000398516.2_Silent_p.A272A|SLC26A1_ENST00000513138.1_5'Flank|SLC26A1_ENST00000398520.2_Intron	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	272					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CTAGCAGCACCGCCAGGCACA	0.697																																																	0								C	,,,	0,4352		0,0,2176	22.0	17.0	19.0		,816,,816	-9.6	0.0	4	dbSNP_134	19	1,8549		0,1,4274	no	intron,coding-synonymous,intron,coding-synonymous	IDUA,SLC26A1	NM_000203.3,NM_022042.2,NM_134425.1,NM_213613.2	,,,	0,1,6450	TT,TC,CC		0.0117,0.0,0.0078	,,,	,272/702,,272/702	983911	1,12901	2176	4275	6451	SO:0001819	synonymous_variant	0			AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.816G>A	4.37:g.983911C>T			A8K9N2|Q7Z5R3|Q96BK0	Silent	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.A272	ENST00000361661.2	37	c.816	CCDS33934.1	4																																																																																			SLC26A1	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000145217		0.697	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A1	HGNC	protein_coding	OTTHUMT00000358783.1	-	0.00	27	0	C	NM_022042, NM_134425		983911	-1	tier1	rs139361937	no_errors	ENST00000361661	ensembl	human	known	74_37	silent	28.00	18	7	SNP	0.000	T
SLC27A4	10999	genome.wustl.edu	37	9	131107437	131107437	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:131107437C>T	ENST00000300456.4	+	3	282	c.165C>T	c.(163-165)ggC>ggT	p.G55G	SLC27A4_ENST00000372870.1_Intron	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	55					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						CACACAGTGGCGGCCTGGTCC	0.637																																					Pancreas(107;1554 2241 10946 12953)												0													44.0	31.0	36.0					9																	131107437		2183	4258	6441	SO:0001819	synonymous_variant	0			AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.165C>T	9.37:g.131107437C>T			A8K2F7|O95186|Q96G53	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.G55	ENST00000300456.4	37	c.165	CCDS6899.1	9																																																																																			SLC27A4	-	NULL	ENSG00000167114		0.637	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A4	HGNC	protein_coding	OTTHUMT00000054432.2	-	0.00	70	0	C			131107437	+1	tier1	-	no_errors	ENST00000300456	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.176	T
SLC43A2	124935	genome.wustl.edu	37	17	1531134	1531134	+	Missense_Mutation	SNP	C	C	T	rs535314897		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:1531134C>T	ENST00000301335.5	-	2	123	c.35G>A	c.(34-36)cGc>cAc	p.R12H	SLC43A2_ENST00000571650.1_Missense_Mutation_p.R12H|SLC43A2_ENST00000382147.4_Missense_Mutation_p.R12H	NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	Q8N370	LAT4_HUMAN	solute carrier family 43 (amino acid system L transporter), member 2	12					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-amino acid transmembrane transporter activity (GO:0015179)			endometrium(4)|large_intestine(4)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		CATCCACCAGCGGCGCCGATG	0.701													C|||	1	0.000199681	0.0	0.0	5008	,	,		9102	0.0		0.0	False		,,,				2504	0.001																0													17.0	14.0	15.0					17																	1531134		2195	4292	6487	SO:0001583	missense	0			BC027923	CCDS11006.1, CCDS67107.1, CCDS67108.1	17p13.3	2013-07-17	2013-07-17		ENSG00000167703	ENSG00000167703		"""Solute carriers"""	23087	protein-coding gene	gene with protein product		610791				23268354	Standard	NM_001284498		Approved	MGC34680	uc002fsv.3	Q8N370	OTTHUMG00000090345	ENST00000301335.5:c.35G>A	17.37:g.1531134C>T	ENSP00000301335:p.Arg12His		B7Z6X9|C9JNU8|D3DTH9|Q5CD75|Q6IPM1|Q8NBX1|Q8NC21|Q8WZ00	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.R12H	ENST00000301335.5	37	c.35	CCDS11006.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.869291	0.97049	.	.	ENSG00000167703	ENST00000301335;ENST00000382147	T;T	0.56776	0.44;0.44	4.65	4.65	0.58169	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.72301	0.3443	M	0.71871	2.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	T	0.76438	-0.2959	10	0.87932	D	0	-12.6091	17.7081	0.88314	0.0:1.0:0.0:0.0	.	12;12;12	Q8N370-2;Q8N370;Q8N370-3	.;LAT4_HUMAN;.	H	12	ENSP00000301335:R12H;ENSP00000371582:R12H	ENSP00000301335:R12H	R	-	2	0	SLC43A2	1477884	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.544000	0.82117	2.415000	0.81967	0.561000	0.74099	CGC	SLC43A2	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000167703		0.701	SLC43A2-001	KNOWN	basic|CCDS	protein_coding	SLC43A2	HGNC	protein_coding	OTTHUMT00000206717.4		0.00	100	0	C	NM_152346		1531134	-1			no_errors	ENST00000382147	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
SLITRK5	26050	genome.wustl.edu	37	13	88328573	88328573	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr13:88328573G>A	ENST00000325089.6	+	2	1149	c.930G>A	c.(928-930)ccG>ccA	p.P310P	SLITRK5_ENST00000400028.3_Silent_p.P69P	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	310					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					ACACCACCCCGGCGTCAGTGA	0.557																																																	0													63.0	71.0	68.0					13																	88328573		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.930G>A	13.37:g.88328573G>A			B3KNB8|B4DSH5|Q5VT81	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.P310	ENST00000325089.6	37	c.930	CCDS9465.1	13																																																																																			SLITRK5	-	NULL	ENSG00000165300		0.557	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3		0.00	38	0	G			88328573	+1			no_errors	ENST00000325089	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.027	A
SMARCB1	6598	genome.wustl.edu	37	22	24133947	24133947	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr22:24133947G>A	ENST00000263121.7	+	2	294	c.98G>A	c.(97-99)gGa>gAa	p.G33E	SMARCB1_ENST00000407082.3_Missense_Mutation_p.G33E|SMARCB1_ENST00000407422.3_Missense_Mutation_p.G33E|SMARCB1_ENST00000344921.6_Missense_Mutation_p.G33E	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	33					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				TCATAGGTGGGAAACTACCTC	0.517			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	2	Unknown(2)	soft_tissue(2)											147.0	150.0	149.0					22																	24133947		2203	4300	6503	SO:0001583	missense	0			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.98G>A	22.37:g.24133947G>A	ENSP00000263121:p.Gly33Glu		O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	pfam_SNF5,pirsf_SWI_SNF_chromatin_remodel_cplx	p.G33E	ENST00000263121.7	37	c.98	CCDS13817.1	22	.	.	.	.	.	.	.	.	.	.	G	33	5.231848	0.95207	.	.	ENSG00000099956	ENST00000417137;ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	D;D;D;D;D	0.96940	-4.18;-4.18;-4.18;-4.18;-4.18	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.98086	0.9369	M	0.77103	2.36	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.998;1.0;1.0;0.996	D	0.98643	1.0676	10	0.87932	D	0	-15.9727	19.0134	0.92884	0.0:0.0:1.0:0.0	.	33;33;33;33;33;33	B4E117;B4DRT1;G5E975;Q17S11;Q12824;C9JTA6	.;.;.;.;SNF5_HUMAN;.	E	33	ENSP00000388489:G33E;ENSP00000340883:G33E;ENSP00000263121:G33E;ENSP00000383984:G33E;ENSP00000385226:G33E	ENSP00000263121:G33E	G	+	2	0	SMARCB1	22463947	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.539000	0.98076	2.815000	0.96918	0.650000	0.86243	GGA	SMARCB1	-	pirsf_SWI_SNF_chromatin_remodel_cplx	ENSG00000099956		0.517	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCB1	HGNC	protein_coding	OTTHUMT00000319872.1	-	0.00	34	0	G	NM_003073		24133947	+1	tier1	-	no_errors	ENST00000263121	ensembl	human	known	74_37	missense	20.59	27	7	SNP	1.000	A
SMCR8	140775	genome.wustl.edu	37	17	18221391	18221391	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:18221391C>T	ENST00000406438.3	+	1	2768	c.2288C>T	c.(2287-2289)cCc>cTc	p.P763L		NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	763						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TACGCTAAGCCCGTGAAACAT	0.537																																																	0													129.0	114.0	119.0					17																	18221391		2203	4300	6503	SO:0001583	missense	0			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.2288C>T	17.37:g.18221391C>T	ENSP00000385025:p.Pro763Leu		A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	pfam_Folliculin	p.P763L	ENST00000406438.3	37	c.2288	CCDS11195.2	17	.	.	.	.	.	.	.	.	.	.	C	26.5	4.746193	0.89663	.	.	ENSG00000176994	ENST00000406438	T	0.23147	1.92	5.55	5.55	0.83447	.	0.200670	0.41712	D	0.000837	T	0.35219	0.0924	L	0.44542	1.39	0.80722	D	1	D	0.53151	0.958	P	0.49387	0.609	T	0.04347	-1.0958	10	0.66056	D	0.02	-16.3967	19.861	0.96785	0.0:1.0:0.0:0.0	.	763	Q8TEV9	SMCR8_HUMAN	L	763	ENSP00000385025:P763L	ENSP00000385025:P763L	P	+	2	0	SMCR8	18162116	0.625000	0.27111	0.863000	0.33907	0.907000	0.53573	3.419000	0.52728	2.767000	0.95098	0.655000	0.94253	CCC	SMCR8	-	NULL	ENSG00000176994		0.537	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2	-	0.00	40	0	C	NM_144775		18221391	+1	tier1	-	no_errors	ENST00000406438	ensembl	human	known	74_37	missense	19.35	25	6	SNP	0.998	T
MTCL1	23255	genome.wustl.edu	37	18	8793058	8793058	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr18:8793058C>T	ENST00000359865.3	+	8	2092	c.1950C>T	c.(1948-1950)ctC>ctT	p.L650L	SOGA2_ENST00000517570.1_Intron|SOGA2_ENST00000518815.1_Intron|SOGA2_ENST00000306329.11_Intron|SOGA2_ENST00000400050.3_Intron|SOGA2_ENST00000306285.7_5'UTR	NM_015210.3	NP_056025.2												p.L650L(1)									AGGGTCAGCTCGTGCAGGCGG	0.498																																																	1	Substitution - coding silent(1)	large_intestine(1)											100.0	111.0	107.0					18																	8793058		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000359865.3:c.1950C>T	18.37:g.8793058C>T				Silent	SNP	pfam_SOGA	p.L650	ENST00000359865.3	37	c.1950	CCDS11841.1	18																																																																																			SOGA2	-	NULL	ENSG00000168502		0.498	SOGA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000254476.1		0.00	22	0	C			8793058	+1			no_errors	ENST00000359865	ensembl	human	known	74_37	silent	8.00	23	2	SNP	0.060	T
SP6	80320	genome.wustl.edu	37	17	45924821	45924821	+	Silent	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:45924821G>T	ENST00000536300.1	-	2	1306	c.975C>A	c.(973-975)cgC>cgA	p.R325R	SP6_ENST00000342234.2_Silent_p.R325R	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	325					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						GGTGGTCGCTGCGCATGAAGA	0.692																																																	0													37.0	35.0	36.0					17																	45924821		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.975C>A	17.37:g.45924821G>T			B3KXS4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R325	ENST00000536300.1	37	c.975	CCDS11520.1	17																																																																																			SP6	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189120		0.692	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SP6	HGNC	protein_coding	OTTHUMT00000441395.1	-	0.00	55	0	G	NM_199262		45924821	-1	tier1	-	no_errors	ENST00000342234	ensembl	human	known	74_37	silent	9.52	38	4	SNP	1.000	T
SPATA20	64847	genome.wustl.edu	37	17	48627597	48627597	+	Missense_Mutation	SNP	A	A	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:48627597A>T	ENST00000356488.4	+	8	1057	c.974A>T	c.(973-975)cAg>cTg	p.Q325L	SPATA20_ENST00000006658.6_Missense_Mutation_p.Q341L|SPATA20_ENST00000393244.3_Missense_Mutation_p.Q281L|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	325					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			ACAGACCGCCAGTGGCACGTC	0.637											OREG0024568	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													78.0	79.0	78.0					17																	48627597		2203	4300	6503	SO:0001583	missense	0				CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.974A>T	17.37:g.48627597A>T	ENSP00000348878:p.Gln325Leu	119	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	pfam_DUF255,pfam_AGE/RnBP,superfamily_6-hairpin_glycosidase-like,superfamily_Thioredoxin-like_fold	p.Q341L	ENST00000356488.4	37	c.1022	CCDS58563.1	17	.	.	.	.	.	.	.	.	.	.	A	8.817	0.936651	0.18206	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.30182	1.54;1.54;1.54	5.81	4.74	0.60224	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.389677	0.29537	N	0.011866	T	0.19644	0.0472	L	0.27053	0.805	0.34020	D	0.652498	B;B	0.15141	0.012;0.011	B;B	0.22386	0.036;0.039	T	0.15838	-1.0423	10	0.38643	T	0.18	-23.604	5.5645	0.17163	0.7113:0.1517:0.137:0.0	.	325;341	Q8TB22;Q8TB22-2	SPT20_HUMAN;.	L	341;325;281	ENSP00000006658:Q341L;ENSP00000348878:Q325L;ENSP00000376935:Q281L	ENSP00000006658:Q341L	Q	+	2	0	SPATA20	45982596	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.500000	0.53318	2.217000	0.71921	0.533000	0.62120	CAG	SPATA20	-	pfam_AGE/RnBP,superfamily_6-hairpin_glycosidase-like	ENSG00000006282		0.637	SPATA20-004	KNOWN	basic|CCDS	protein_coding	SPATA20	HGNC	protein_coding	OTTHUMT00000367651.1		0.00	58	0	A	NM_022827		48627597	+1			no_errors	ENST00000006658	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
SPIDR	23514	genome.wustl.edu	37	8	48614549	48614549	+	Missense_Mutation	SNP	A	A	G	rs531434787		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:48614549A>G	ENST00000297423.4	+	14	2333	c.1949A>G	c.(1948-1950)tAt>tGt	p.Y650C	SPIDR_ENST00000517693.1_Missense_Mutation_p.Y125C|SPIDR_ENST00000541342.1_Missense_Mutation_p.Y580C|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000518074.1_Missense_Mutation_p.Y590C	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	650					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											TGCAGTTTCTATGCCACGGTG	0.433																																																	0													114.0	107.0	109.0					8																	48614549		1898	4127	6025	SO:0001583	missense	0			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1949A>G	8.37:g.48614549A>G	ENSP00000297423:p.Tyr650Cys		B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	NULL	p.Y650C	ENST00000297423.4	37	c.1949	CCDS43737.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.355|9.355	1.066626|1.066626	0.20067|0.20067	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000519401|ENST00000297423;ENST00000518074;ENST00000541342;ENST00000519141;ENST00000517693;ENST00000519362;ENST00000522321;ENST00000518692;ENST00000521056	.|.	.|.	.|.	5.61|5.61	0.491|0.491	0.16867|0.16867	.|.	.|0.766226	.|0.12963	.|N	.|0.424868	T|T	0.31104|0.31104	0.0786|0.0786	L|L	0.47716|0.47716	1.5|1.5	0.28920|0.28920	N|N	0.892167|0.892167	.|B;B;B;B;B;B;B	.|0.25743	.|0.028;0.028;0.133;0.009;0.063;0.028;0.009	.|B;B;B;B;B;B;B	.|0.25759	.|0.018;0.018;0.063;0.007;0.026;0.018;0.007	T|T	0.22382|0.22382	-1.0218|-1.0218	5|9	.|0.33940	.|T	.|0.23	.|.	5.4592|5.4592	0.16607|0.16607	0.4822:0.1512:0.3666:0.0|0.4822:0.1512:0.3666:0.0	.|.	.|140;155;590;580;650;125;650	.|B4DZY2;B4DWT8;B4E0Y6;B4DFV2;B4DEV5;B3KP42;Q14159	.|.;.;.;.;.;.;K0146_HUMAN	V|C	332|650;590;580;155;125;125;11;11;11	.|.	.|ENSP00000297423:Y650C	M|Y	+|+	1|2	0|0	KIAA0146|KIAA0146	48777102|48777102	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.487000|0.487000	0.33371|0.33371	1.022000|1.022000	0.30052|0.30052	-0.129000|-0.129000	0.11620|0.11620	0.529000|0.529000	0.55759|0.55759	ATG|TAT	SPIDR	-	NULL	ENSG00000164808		0.433	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPIDR	HGNC	protein_coding	OTTHUMT00000377611.1	-	0.00	58	0	A	NM_001080394		48614549	+1	tier1	-	no_errors	ENST00000297423	ensembl	human	known	74_37	missense	20.37	43	11	SNP	0.989	G
SPTA1	6708	genome.wustl.edu	37	1	158609665	158609665	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:158609665A>G	ENST00000368147.4	-	34	5050	c.4870T>C	c.(4870-4872)Tca>Cca	p.S1624P		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1624					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ATTACCTCTGAGAGCCAGAAC	0.433																																																	0													179.0	166.0	170.0					1																	158609665		1874	4115	5989	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4870T>C	1.37:g.158609665A>G	ENSP00000357129:p.Ser1624Pro		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.S1624P	ENST00000368147.4	37	c.4870	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.294739	0.81025	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.52526	0.66;0.66	5.53	5.53	0.82687	.	0.000000	0.27388	N	0.019583	T	0.56775	0.2008	M	0.78049	2.395	0.41952	D	0.990664	D	0.76494	0.999	D	0.71184	0.972	T	0.59904	-0.7366	10	0.37606	T	0.19	.	9.9489	0.41628	0.8485:0.0:0.0:0.1515	.	1624	P02549	SPTA1_HUMAN	P	1624	ENSP00000357130:S1624P;ENSP00000357129:S1624P	ENSP00000357129:S1624P	S	-	1	0	SPTA1	156876289	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.578000	0.74032	2.324000	0.78689	0.533000	0.62120	TCA	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.433	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	53	0	A	NM_003126		158609665	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	24.62	49	16	SNP	1.000	G
AL133247.2	0	genome.wustl.edu	37	2	31754426	31754426	+	RNA	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:31754426C>T	ENST00000435713.1	+	0	255				SRD5A2_ENST00000405650.1_RNA																							GAGAAAAATGCAAATGCAAGT	0.458																																																	0													71.0	70.0	70.0					2																	31754426		1902	4122	6024			0																															2.37:g.31754426C>T				RNA	SNP	-	NULL	ENST00000435713.1	37	NULL		2																																																																																			SRD5A2	-	-	ENSG00000049319		0.458	AL133247.2-001	KNOWN	basic|exp_conf	antisense	SRD5A2	HGNC	antisense	OTTHUMT00000325125.1	-	0.00	51	0	C			31754426	-1	tier1	-	no_errors	ENST00000233139	ensembl	human	known	74_37	rna	9.30	39	4	SNP	1.000	T
SREBF2	6721	genome.wustl.edu	37	22	42289188	42289188	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr22:42289188G>A	ENST00000361204.4	+	12	2442	c.2276G>A	c.(2275-2277)cGc>cAc	p.R759H	SREBF2_ENST00000491541.1_3'UTR	NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	759					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GACTCCCTGCGCTGGCTCTGC	0.597																																																	0													65.0	66.0	66.0					22																	42289188		2203	4300	6503	SO:0001583	missense	0			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.2276G>A	22.37:g.42289188G>A	ENSP00000354476:p.Arg759His		Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R759H	ENST00000361204.4	37	c.2276	CCDS14023.1	22	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144576	0.77888	.	.	ENSG00000198911	ENST00000361204;ENST00000457567	T	0.08282	3.11	5.42	5.42	0.78866	.	0.047192	0.85682	D	0.000000	T	0.10165	0.0249	L	0.52126	1.63	0.80722	D	1	P	0.44521	0.837	B	0.34385	0.181	T	0.05954	-1.0854	10	0.49607	T	0.09	-21.8036	19.2386	0.93873	0.0:0.0:1.0:0.0	.	759	Q12772	SRBP2_HUMAN	H	759	ENSP00000354476:R759H	ENSP00000354476:R759H	R	+	2	0	SREBF2	40619134	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.615000	0.54167	2.543000	0.85770	0.650000	0.86243	CGC	SREBF2	-	NULL	ENSG00000198911		0.597	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	HGNC	protein_coding	OTTHUMT00000321956.1		0.00	40	0	G	NM_004599		42289188	+1			no_errors	ENST00000361204	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	A
SSH2	85464	genome.wustl.edu	37	17	27959603	27959603	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:27959603G>T	ENST00000269033.3	-	15	2679	c.2528C>A	c.(2527-2529)cCa>cAa	p.P843Q	SSH2_ENST00000540801.1_Missense_Mutation_p.P870Q|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	843					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCCCTCAGCTGGTTCCCCTTC	0.582																																																	0													148.0	131.0	137.0					17																	27959603		2203	4300	6503	SO:0001583	missense	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.2528C>A	17.37:g.27959603G>T	ENSP00000269033:p.Pro843Gln		Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.P843Q	ENST00000269033.3	37	c.2528	CCDS11253.1	17	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986229	0.35036	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.08546	3.08;3.08	6.08	2.62	0.31277	.	0.899640	0.09818	N	0.751910	T	0.09512	0.0234	L	0.46157	1.445	0.09310	N	1	P;P	0.49961	0.919;0.93	B;B	0.43052	0.406;0.36	T	0.27938	-1.0059	10	0.59425	D	0.04	-1.2174	6.2399	0.20785	0.2816:0.0:0.587:0.1314	.	870;843	F5H527;Q76I76	.;SSH2_HUMAN	Q	843;870	ENSP00000269033:P843Q;ENSP00000444743:P870Q	ENSP00000269033:P843Q	P	-	2	0	SSH2	24983729	0.012000	0.17670	0.878000	0.34440	0.672000	0.39443	1.172000	0.31908	0.913000	0.36797	0.655000	0.94253	CCA	SSH2	-	NULL	ENSG00000141298		0.582	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	-	0.00	41	0	G	NM_033389		27959603	-1	tier1	-	no_errors	ENST00000269033	ensembl	human	known	74_37	missense	29.73	26	11	SNP	0.000	T
SRSF1	6426	genome.wustl.edu	37	17	56082445	56082445	+	3'UTR	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:56082445C>T	ENST00000258962.4	-	0	1277				SRSF1_ENST00000582730.2_3'UTR|SRSF1_ENST00000581497.1_5'UTR|SRSF1_ENST00000584773.1_Intron|SRSF1_ENST00000585096.1_Intron|RP11-159D12.5_ENST00000578794.1_5'UTR	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1						cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATAAGAACTTCCCCAGGTAAG	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.*322G>A	17.37:g.56082445C>T			B2R6Z7|D3DTZ3|Q13809	RNA	SNP	-	NULL	ENST00000258962.4	37	NULL	CCDS11600.1	17																																																																																			SRSF1	-	-	ENSG00000136450		0.393	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF1	HGNC	protein_coding	OTTHUMT00000443335.1	-	0.00	31	0	C	NM_006924		56082445	-1	tier1	-	no_errors	ENST00000581497	ensembl	human	known	74_37	rna	12.12	29	4	SNP	1.000	T
ST3GAL2	6483	genome.wustl.edu	37	16	70417132	70417132	+	Silent	SNP	G	G	A	rs566916255		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:70417132G>A	ENST00000393640.4	-	4	2827	c.720C>T	c.(718-720)taC>taT	p.Y240Y	ST3GAL2_ENST00000342907.2_Silent_p.Y240Y|RP11-529K1.4_ENST00000566960.1_RNA			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	240					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				TCACTGGGGCGTAGGTGCTGT	0.532													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20258	0.0		0.0	False		,,,				2504	0.0																0													73.0	70.0	71.0					16																	70417132		2198	4300	6498	SO:0001819	synonymous_variant	0			U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.720C>T	16.37:g.70417132G>A			O00654	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.Y240	ENST00000393640.4	37	c.720	CCDS10890.1	16																																																																																			ST3GAL2	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000157350		0.532	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL2	HGNC	protein_coding	OTTHUMT00000268968.1		0.00	22	0	G	NM_006927		70417132	-1			no_errors	ENST00000342907	ensembl	human	known	74_37	silent	21.05	15	4	SNP	0.972	A
STAU2	27067	genome.wustl.edu	37	8	74515978	74515978	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:74515978G>A	ENST00000521451.1	-	5	728	c.352C>T	c.(352-354)Cga>Tga	p.R118*	STAU2_ENST00000519961.1_Nonsense_Mutation_p.R338*|STAU2_ENST00000523558.1_Nonsense_Mutation_p.R166*|STAU2_ENST00000517542.1_Nonsense_Mutation_p.R300*|STAU2_ENST00000521210.1_Nonsense_Mutation_p.R234*|STAU2_ENST00000524300.1_Nonsense_Mutation_p.R338*|STAU2_ENST00000522695.1_Nonsense_Mutation_p.R306*|STAU2_ENST00000355780.5_Nonsense_Mutation_p.R306*|STAU2_ENST00000521727.1_Nonsense_Mutation_p.R318*|STAU2_ENST00000522509.1_Nonsense_Mutation_p.R306*			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	338	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			ACAAATTCTCGACGTCGAGGC	0.428																																																	0													81.0	79.0	80.0					8																	74515978		2203	4300	6503	SO:0001587	stop_gained	0			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521451.1:c.352C>T	8.37:g.74515978G>A	ENSP00000428476:p.Arg118*		B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Nonsense_Mutation	SNP	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.R338*	ENST00000521451.1	37	c.1012		8	.	.	.	.	.	.	.	.	.	.	G	36	5.943132	0.97128	.	.	ENSG00000040341	ENST00000522695;ENST00000524300;ENST00000523558;ENST00000521210;ENST00000355780;ENST00000519961;ENST00000521727;ENST00000521451;ENST00000522509;ENST00000517542;ENST00000518767	.	.	.	5.73	4.8	0.61643	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.3988	13.3936	0.60836	0.0:0.0:0.7245:0.2754	.	.	.	.	X	306;338;166;234;306;338;318;118;306;300;166	.	ENSP00000344030:R166X	R	-	1	2	STAU2	74678532	0.980000	0.34600	1.000000	0.80357	0.996000	0.88848	1.409000	0.34680	2.706000	0.92434	0.585000	0.79938	CGA	STAU2	-	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	ENSG00000040341		0.428	STAU2-006	PUTATIVE	basic|exp_conf	protein_coding	STAU2	HGNC	protein_coding	OTTHUMT00000379006.4	-	0.00	75	0	G	NM_001164380		74515978	-1	tier1	-	no_errors	ENST00000524300	ensembl	human	known	74_37	nonsense	14.93	57	10	SNP	0.993	A
STK3	6788	genome.wustl.edu	37	8	99761534	99761534	+	Silent	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:99761534G>T	ENST00000419617.2	-	4	461	c.321C>A	c.(319-321)gtC>gtA	p.V107V	STK3_ENST00000523601.1_Silent_p.V135V	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	107	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		TTATGTCTGAGACAGAGCCAG	0.323																																																	0													87.0	86.0	86.0					8																	99761534		1903	4157	6060	SO:0001819	synonymous_variant	0			BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.321C>A	8.37:g.99761534G>T			A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Mst1_SARAH_domain,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SARAH_dom,pfscan_Prot_kinase_dom	p.V107	ENST00000419617.2	37	c.321	CCDS47900.1	8																																																																																			STK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000104375		0.323	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK3	HGNC	protein_coding	OTTHUMT00000379635.1	-	0.00	136	0	G	NM_006281		99761534	-1	tier1	-	no_errors	ENST00000419617	ensembl	human	known	74_37	silent	7.50	111	9	SNP	1.000	T
STON1	11037	genome.wustl.edu	37	2	48822435	48822435	+	Silent	SNP	T	T	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:48822435T>C	ENST00000406226.1	+	5	2397	c.2202T>C	c.(2200-2202)acT>acC	p.T734T	STON1_ENST00000404752.1_Silent_p.T734T|STON1-GTF2A1L_ENST00000309827.2_Intron|STON1-GTF2A1L_ENST00000394754.1_Intron|STON1-GTF2A1L_ENST00000402114.2_Intron|STON1-GTF2A1L_ENST00000394751.3_Intron|STON1-GTF2A1L_ENST00000405008.1_Intron|STON1_ENST00000309835.3_Silent_p.T734T	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	734					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ACTGCATAACTCAGTAGGAGT	0.398																																																	0													121.0	108.0	113.0					2																	48822435		2203	4300	6503	SO:0001819	synonymous_variant	0			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.2202T>C	2.37:g.48822435T>C			A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Silent	SNP	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C,pfscan_SHD	p.T734	ENST00000406226.1	37	c.2202	CCDS1841.1	2																																																																																			STON1	-	pirsf_Stonin	ENSG00000243244		0.398	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1	HGNC	protein_coding	OTTHUMT00000323848.2	-	0.00	87	0	T	NM_006873		48822435	+1	tier1	-	no_errors	ENST00000309835	ensembl	human	known	74_37	silent	15.87	53	10	SNP	0.994	C
STK39	27347	genome.wustl.edu	37	2	169020387	169020387	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:169020387G>A	ENST00000355999.4	-	4	1139	c.434C>T	c.(433-435)tCa>tTa	p.S145L		NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39	145	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						ATCCAACATTGAACCTAAGTA	0.318																																																	0													106.0	96.0	99.0					2																	169020387		1846	4090	5936	SO:0001583	missense	0			AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.434C>T	2.37:g.169020387G>A	ENSP00000348278:p.Ser145Leu		O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S145L	ENST00000355999.4	37	c.434	CCDS42770.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.282201	0.95489	.	.	ENSG00000198648	ENST00000355999	T	0.28069	1.63	5.73	5.73	0.89815	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.59662	0.2210	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60434	-0.7264	10	0.87932	D	0	-8.7479	20.2602	0.98440	0.0:0.0:1.0:0.0	.	145	Q9UEW8	STK39_HUMAN	L	145	ENSP00000348278:S145L	ENSP00000348278:S145L	S	-	2	0	STK39	168728633	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	TCA	STK39	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000198648		0.318	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK39	HGNC	protein_coding	OTTHUMT00000258112.2	-	0.00	54	0	G	NM_013233		169020387	-1	tier1	-	no_errors	ENST00000355999	ensembl	human	known	74_37	missense	16.67	40	8	SNP	1.000	A
STOX1	219736	genome.wustl.edu	37	10	70644118	70644118	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr10:70644118C>T	ENST00000298596.6	+	3	649	c.566C>T	c.(565-567)cCt>cTt	p.P189L	STOX1_ENST00000421961.2_Missense_Mutation_p.P79L|STOX1_ENST00000399162.2_Intron|STOX1_ENST00000399169.4_Missense_Mutation_p.P189L|STOX1_ENST00000399165.4_Missense_Mutation_p.P189L	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	189						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						ATAGTTACTCCTCAGACTTAC	0.403																																																	0													98.0	93.0	95.0					10																	70644118		1892	4117	6009	SO:0001583	missense	0			AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.566C>T	10.37:g.70644118C>T	ENSP00000298596:p.Pro189Leu		A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	pfam_Storkhead-box_winged-helix	p.P189L	ENST00000298596.6	37	c.566	CCDS41535.1	10	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612457	0.87258	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000399165;ENST00000421961	D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51	5.58	5.58	0.84498	Storkhead-box protein, winged-helix domain (1);	0.000000	0.85682	U	0.000000	D	0.90830	0.7120	M	0.82630	2.6	0.80722	D	1	D;D	0.76494	0.999;0.973	D;P	0.79108	0.992;0.859	D	0.91654	0.5337	10	0.87932	D	0	.	19.5709	0.95419	0.0:1.0:0.0:0.0	.	189;189	Q6ZVD7;Q6ZVD7-2	STOX1_HUMAN;.	L	189;189;189;79	ENSP00000382121:P189L;ENSP00000298596:P189L;ENSP00000382118:P189L;ENSP00000394509:P79L	ENSP00000298596:P189L	P	+	2	0	STOX1	70314124	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.743000	0.85020	2.620000	0.88729	0.491000	0.48974	CCT	STOX1	-	pfam_Storkhead-box_winged-helix	ENSG00000165730		0.403	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX1	HGNC	protein_coding	OTTHUMT00000276849.3	-	0.00	20	0	C	NM_152709		70644118	+1	tier1	-	no_errors	ENST00000298596	ensembl	human	known	74_37	missense	27.78	13	5	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152679647	152679647	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:152679647A>G	ENST00000367255.5	-	66	11070	c.10469T>C	c.(10468-10470)cTt>cCt	p.L3490P	SYNE1_ENST00000423061.1_Missense_Mutation_p.L3497P|SYNE1_ENST00000448038.1_Missense_Mutation_p.L3497P|SYNE1_ENST00000341594.5_Missense_Mutation_p.L3461P|SYNE1_ENST00000265368.4_Missense_Mutation_p.L3490P	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3490					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGGCGGACAAGTTTTTCAGA	0.383										HNSCC(10;0.0054)																																							0													116.0	107.0	110.0					6																	152679647		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10469T>C	6.37:g.152679647A>G	ENSP00000356224:p.Leu3490Pro		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L3490P	ENST00000367255.5	37	c.10469	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	17.53	3.413077	0.62511	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.54279	0.58;1.23;0.58;1.23;0.58	5.35	5.35	0.76521	.	0.137634	0.33075	N	0.005306	T	0.62332	0.2419	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.75484	0.969;0.969;0.969;0.986	T	0.64685	-0.6349	10	0.48119	T	0.1	.	15.3249	0.74154	1.0:0.0:0.0:0.0	.	3490;3490;3490;3497	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	P	3490;3497;3490;3497;3461	ENSP00000356224:L3490P;ENSP00000396024:L3497P;ENSP00000265368:L3490P;ENSP00000390975:L3497P;ENSP00000341887:L3461P	ENSP00000265368:L3490P	L	-	2	0	SYNE1	152721340	1.000000	0.71417	0.936000	0.37596	0.987000	0.75469	6.640000	0.74319	2.037000	0.60232	0.459000	0.35465	CTT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.383	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	107	0	A	NM_182961		152679647	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	15.31	83	15	SNP	0.999	G
SYNE3	161176	genome.wustl.edu	37	14	95921763	95921763	+	Missense_Mutation	SNP	G	G	A	rs142727232		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:95921763G>A	ENST00000334258.5	-	5	1102	c.1088C>T	c.(1087-1089)gCg>gTg	p.A363V	SYNE3_ENST00000557275.1_Missense_Mutation_p.A363V|SYNE3_ENST00000553340.1_Missense_Mutation_p.A363V|SYNE3_ENST00000554873.1_Missense_Mutation_p.A120V	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	363					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)	p.A363V(1)		breast(1)|endometrium(2)|lung(25)	28						CCCCGCTTTCGCCGCAGGCTG	0.652																																																	1	Substitution - Missense(1)	prostate(1)						C	VAL/ALA	1,4405		0,1,2202	30.0	33.0	32.0		1088	-9.4	0.0	14	dbSNP_134	32	0,8600		0,0,4300	no	missense	C14orf49	NM_152592.3	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	363/976	95921763	1,13005	2203	4300	6503	SO:0001583	missense	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1088C>T	14.37:g.95921763G>A	ENSP00000334308:p.Ala363Val		A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.A363V	ENST00000334258.5	37	c.1088	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	g	5.655	0.305492	0.10678	2.27E-4	0.0	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.35973	3.53;1.28;3.53;2.94	4.99	-9.44	0.00603	.	1.724190	0.03672	N	0.244098	T	0.17238	0.0414	L	0.31294	0.92	0.09310	N	1	B;B;B	0.16166	0.016;0.009;0.009	B;B;B	0.11329	0.006;0.004;0.003	T	0.14504	-1.0470	10	0.19590	T	0.45	-3.9851	0.4105	0.00440	0.3651:0.1557:0.1687:0.3106	.	363;363;363	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	V	363;120;363;363	ENSP00000334308:A363V;ENSP00000452154:A120V;ENSP00000450562:A363V;ENSP00000450774:A363V	ENSP00000334308:A363V	A	-	2	0	C14orf49	94991516	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.109000	0.03309	-1.615000	0.01573	-1.507000	0.00952	GCG	SYNE3	-	NULL	ENSG00000176438		0.652	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	-	0.00	43	0	G	NM_152592		95921763	-1	tier1	rs142727232	no_errors	ENST00000334258	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.000	A
TAOK3	51347	genome.wustl.edu	37	12	118682750	118682750	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:118682750A>C	ENST00000392533.3	-	4	631	c.141T>G	c.(139-141)agT>agG	p.S47R	TAOK3_ENST00000419821.2_Missense_Mutation_p.S47R	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	47	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> N (in dbSNP:rs428073). {ECO:0000269|PubMed:13679851, ECO:0000269|PubMed:17344846, ECO:0000269|Ref.4}.		cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCACCACCTCACTGGTGTGAG	0.368																																																	0													145.0	138.0	140.0					12																	118682750		2203	4300	6503	SO:0001583	missense	0			AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.141T>G	12.37:g.118682750A>C	ENSP00000376317:p.Ser47Arg		Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S47R	ENST00000392533.3	37	c.141	CCDS9188.1	12	.	.	.	.	.	.	.	.	.	.	A	12.18	1.861515	0.32884	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000535570;ENST00000541186;ENST00000541878;ENST00000542902	T;T;T;T;T;T	0.43688	1.84;1.84;1.84;1.84;0.94;0.94	5.14	1.19	0.21007	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.20495	0.0493	N	0.10733	0.035	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.03875	-1.0996	10	0.42905	T	0.14	.	8.7499	0.34609	0.7579:0.0:0.2421:0.0	.	47	Q9H2K8	TAOK3_HUMAN	R	47	ENSP00000416374:S47R;ENSP00000376317:S47R;ENSP00000443465:S47R;ENSP00000438820:S47R;ENSP00000444057:S47R;ENSP00000440315:S47R	ENSP00000376317:S47R	S	-	3	2	TAOK3	117167133	0.996000	0.38824	0.998000	0.56505	0.671000	0.39405	0.584000	0.23864	0.046000	0.15833	-0.376000	0.06991	AGT	TAOK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135090		0.368	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK3	HGNC	protein_coding	OTTHUMT00000401456.2	-	0.00	30	0	A	NM_016281		118682750	-1	tier1	-	no_errors	ENST00000392533	ensembl	human	known	74_37	missense	28.57	10	4	SNP	1.000	C
TBC1D3P1-DHX40P1	653645	genome.wustl.edu	37	17	58086037	58086037	+	lincRNA	SNP	T	T	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:58086037T>A	ENST00000407042.3	-	0	1399									TBC1D3P1-DHX40P1 readthrough transcribed pseudogene																		CTGGTCCTCCTGGGATATGGC	0.632																																																	0																																												0					17q23.1	2014-09-10	2012-12-07		ENSG00000267104	ENSG00000267104			42362	other	readthrough			"""TBC1D3P1-DHX40P1 readthrough (non-protein coding)"""				Standard	NR_002924		Approved		uc002iyf.2		OTTHUMG00000179977		17.37:g.58086037T>A				RNA	SNP	-	NULL	ENST00000407042.3	37	NULL		17																																																																																			TBC1D3P1-DHX40P1	-	-	ENSG00000267104		0.632	TBC1D3P1-DHX40P1-201	KNOWN	basic	lincRNA	TBC1D3P1-DHX40P1	HGNC	lincRNA		-	0.00	65	0	T	NR_002924		58086037	-1	tier1	-	no_errors	ENST00000407042	ensembl	human	known	74_37	rna	15.00	34	6	SNP	0.145	A
TBPL2	387332	genome.wustl.edu	37	14	55890916	55890916	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:55890916C>T	ENST00000247219.5	-	6	1082	c.1012G>A	c.(1012-1014)Gtg>Atg	p.V338M		NM_199047.2	NP_950248.1			TATA box binding protein like 2											endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						ATAAGCAACACAATTCGTGGT	0.333																																																	0													124.0	112.0	116.0					14																	55890916		2203	4299	6502	SO:0001583	missense	0			AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.1012G>A	14.37:g.55890916C>T	ENSP00000247219:p.Val338Met			Missense_Mutation	SNP	pfam_TBP,prints_TBP	p.V338M	ENST00000247219.5	37	c.1012	CCDS9724.1	14	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899847	0.72754	.	.	ENSG00000182521	ENST00000247219	T	0.58060	0.36	5.41	5.41	0.78517	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83514	0.5271	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89788	0.3966	10	0.87932	D	0	-14.4097	18.1951	0.89818	0.0:1.0:0.0:0.0	.	338	Q6SJ96	TBPL2_HUMAN	M	338	ENSP00000247219:V338M	ENSP00000247219:V338M	V	-	1	0	TBPL2	54960669	1.000000	0.71417	1.000000	0.80357	0.376000	0.30014	7.655000	0.83696	2.535000	0.85469	0.650000	0.86243	GTG	TBPL2	-	pfam_TBP,prints_TBP	ENSG00000182521		0.333	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBPL2	HGNC	protein_coding	OTTHUMT00000276916.1	-	0.00	42	0	C	NM_199047		55890916	-1	tier1	-	no_errors	ENST00000247219	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	T
TC2N	123036	genome.wustl.edu	37	14	92258843	92258844	+	Frame_Shift_Ins	INS	-	-	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:92258843_92258844insA	ENST00000435962.2	-	9	1237_1238	c.914_915insT	c.(913-915)gtafs	p.V305fs	TC2N_ENST00000556018.1_Intron|TC2N_ENST00000340892.5_Frame_Shift_Ins_p.V305fs|TC2N_ENST00000360594.5_Frame_Shift_Ins_p.V305fs	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	305					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		ATACAAGTCTTACAGTTTGTAG	0.307																																																	0																																										SO:0001589	frameshift_variant	0			AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.915dupT	14.37:g.92258844_92258844dupA	ENSP00000387882:p.Val305fs			Frame_Shift_Ins	INS	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R306fs	ENST00000435962.2	37	c.915_914	CCDS9897.1	14																																																																																			TC2N	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	ENSG00000165929		0.307	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	HGNC	protein_coding	OTTHUMT00000411778.1		0.00	106	0	-	NM_152332		92258844	-1	tier1		no_errors	ENST00000340892	ensembl	human	known	74_37	frame_shift_ins	6.32	89	6	INS	0.303:0.904	A
TCF20	6942	genome.wustl.edu	37	22	42607342	42607342	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr22:42607342C>T	ENST00000359486.3	-	1	4106	c.3970G>A	c.(3970-3972)Gat>Aat	p.D1324N	TCF20_ENST00000335626.4_Missense_Mutation_p.D1324N|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TTTCTACTATCTGGACTTGGA	0.468																																																	0													135.0	136.0	136.0					22																	42607342		2203	4300	6503	SO:0001583	missense	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3970G>A	22.37:g.42607342C>T	ENSP00000352463:p.Asp1324Asn		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.D1324N	ENST00000359486.3	37	c.3970	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	C	18.40	3.615987	0.66672	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.59364	0.27;0.27	5.28	5.28	0.74379	.	0.153421	0.44688	D	0.000436	T	0.65995	0.2745	L	0.43152	1.355	0.80722	D	1	D;D	0.63880	0.993;0.988	P;P	0.60789	0.879;0.76	T	0.57481	-0.7804	10	0.17832	T	0.49	-15.8456	19.0957	0.93249	0.0:1.0:0.0:0.0	.	1324;1324	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	N	1324	ENSP00000352463:D1324N;ENSP00000335561:D1324N	ENSP00000335561:D1324N	D	-	1	0	TCF20	40937286	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.244000	0.58728	2.755000	0.94549	0.655000	0.94253	GAT	TCF20	-	NULL	ENSG00000100207		0.468	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	-	0.00	42	0	C	NM_181492		42607342	-1	tier1	-	no_errors	ENST00000359486	ensembl	human	known	74_37	missense	8.06	57	5	SNP	1.000	T
TFEC	22797	genome.wustl.edu	37	7	115750911	115750911	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:115750911C>A	ENST00000484212.1	-	3	223	c.49G>T	c.(49-51)Gga>Tga	p.G17*	TFEC_ENST00000474337.1_5'UTR			O14948	TFEC_HUMAN	transcription factor EC	0	Necessary for transcriptional transactivation.				cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			TCCTTTTCTCCTAATTGTTCT	0.373																																																	0																																										SO:0001587	stop_gained	0			D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000484212.1:c.49G>T	7.37:g.115750911C>A	ENSP00000417432:p.Gly17*		B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Nonsense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G17*	ENST00000484212.1	37	c.49		7	.	.	.	.	.	.	.	.	.	.	c	21.2	4.118326	0.77323	.	.	ENSG00000105967	ENST00000484212	.	.	.	5.48	1.4	0.22301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	5.0429	0.14467	0.0:0.4438:0.2454:0.3108	.	.	.	.	X	17	.	ENSP00000390171:G17X	G	-	1	0	TFEC	115538147	0.990000	0.36364	1.000000	0.80357	0.990000	0.78478	0.245000	0.18142	0.263000	0.21812	0.650000	0.86243	GGA	TFEC	-	NULL	ENSG00000105967		0.373	TFEC-008	NOVEL	basic	protein_coding	TFEC	HGNC	protein_coding	OTTHUMT00000351050.2	-	0.00	77	0	C	NM_012252		115750911	-1	tier1	-	no_errors	ENST00000484212	ensembl	human	novel	74_37	nonsense	5.06	75	4	SNP	0.986	A
THAP9	79725	genome.wustl.edu	37	4	83838912	83838912	+	Missense_Mutation	SNP	A	A	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:83838912A>T	ENST00000302236.5	+	5	1598	c.1547A>T	c.(1546-1548)aAt>aTt	p.N516I	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	516					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				TTAATTAACAATCTGTTTGAC	0.353																																																	0													130.0	136.0	134.0					4																	83838912		2203	4300	6503	SO:0001583	missense	0			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.1547A>T	4.37:g.83838912A>T	ENSP00000305533:p.Asn516Ile		B3KRE2|Q59AC9	Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.N516I	ENST00000302236.5	37	c.1547	CCDS3598.1	4	.	.	.	.	.	.	.	.	.	.	A	7.199	0.593059	0.13875	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	D	0.91068	-2.78	3.87	2.7	0.31948	.	0.379360	0.22834	N	0.055072	D	0.86506	0.5949	L	0.55990	1.75	0.41988	D	0.990831	P	0.45348	0.856	P	0.44477	0.451	T	0.82971	-0.0192	10	0.49607	T	0.09	-17.162	3.4138	0.07368	0.5837:0.205:0.2113:0.0	.	516	Q9H5L6	THAP9_HUMAN	I	516	ENSP00000305533:N516I	ENSP00000305533:N516I	N	+	2	0	THAP9	84057936	0.972000	0.33761	0.991000	0.47740	0.247000	0.25773	0.134000	0.15932	0.848000	0.35191	0.533000	0.62120	AAT	THAP9	-	NULL	ENSG00000168152		0.353	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP9	HGNC	protein_coding	OTTHUMT00000252633.1		0.00	74	0	A	NM_024672		83838912	+1			no_errors	ENST00000302236	ensembl	human	known	74_37	missense	5.13	73	4	SNP	0.766	T
TM9SF4	9777	genome.wustl.edu	37	20	30734620	30734620	+	Silent	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:30734620C>A	ENST00000398022.2	+	9	1151	c.916C>A	c.(916-918)Cgg>Agg	p.R306R	TM9SF4_ENST00000217315.5_Silent_p.R289R	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	306						integral component of membrane (GO:0016021)		p.R289W(1)		central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TCGGACCCTCCGGAAGGACAT	0.552																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											126.0	93.0	104.0					20																	30734620		2203	4300	6503	SO:0001819	synonymous_variant	0			BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.916C>A	20.37:g.30734620C>A			B0QYT7|Q9NUA3	Silent	SNP	pfam_EMP70	p.R306	ENST00000398022.2	37	c.916	CCDS13196.2	20																																																																																			TM9SF4	-	pfam_EMP70	ENSG00000101337		0.552	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF4	HGNC	protein_coding	OTTHUMT00000323568.1		0.00	40	0	C	NM_014742		30734620	+1			no_errors	ENST00000398022	ensembl	human	known	74_37	silent	5.00	38	2	SNP	1.000	A
TMEM132D	121256	genome.wustl.edu	37	12	130184584	130184584	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:130184584T>G	ENST00000422113.2	-	2	1065	c.739A>C	c.(739-741)Agc>Cgc	p.S247R	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	247					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		ATCCCATTGCTTCTCCTCGCG	0.622																																																	0													98.0	86.0	90.0					12																	130184584		2203	4300	6503	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.739A>C	12.37:g.130184584T>G	ENSP00000408581:p.Ser247Arg		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.S247R	ENST00000422113.2	37	c.739	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	T	6.509	0.462062	0.12342	.	.	ENSG00000151952	ENST00000422113	T	0.10288	2.89	5.21	-4.96	0.03038	.	0.840280	0.10623	N	0.653166	T	0.05960	0.0155	L	0.27053	0.805	0.09310	N	1	B	0.30973	0.302	B	0.23716	0.048	T	0.30534	-0.9975	9	.	.	.	-3.4553	10.3771	0.44088	0.0:0.5597:0.1188:0.3214	.	247	Q14C87	T132D_HUMAN	R	247	ENSP00000408581:S247R	.	S	-	1	0	TMEM132D	128750537	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.688000	0.05150	-1.278000	0.02408	-0.417000	0.06048	AGC	TMEM132D	-	NULL	ENSG00000151952		0.622	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1		0.00	31	0	T	NM_133448		130184584	-1			no_errors	ENST00000422113	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.000	G
TMEM141	85014	genome.wustl.edu	37	9	139686714	139686714	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr9:139686714G>A	ENST00000290079.8	+	4	233	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	TMEM141_ENST00000465017.1_3'UTR|RP11-216L13.17_ENST00000456614.2_Missense_Mutation_p.V48M	NM_032928.3	NP_116317.1	Q96I45	TM141_HUMAN	transmembrane protein 141	73						integral component of membrane (GO:0016021)				large_intestine(1)|lung(2)|prostate(1)	4	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.67e-06)|Epithelial(140;0.000112)		TGCAGGCTCTGTGGTCAGCTA	0.592											OREG0019622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													35.0	35.0	35.0					9																	139686714		2194	4294	6488	SO:0001583	missense	0			BC007834	CCDS7007.1	9q34.3	2009-11-13			ENSG00000244187	ENSG00000244187			28211	protein-coding gene	gene with protein product							Standard	NM_032928		Approved	MGC14141	uc004cje.4	Q96I45	OTTHUMG00000020945	ENST00000290079.8:c.217G>A	9.37:g.139686714G>A	ENSP00000290079:p.Val73Met	1650	A6NIZ7|Q5T5R5	Missense_Mutation	SNP	NULL	p.V73M	ENST00000290079.8	37	c.217	CCDS7007.1	9	.	.	.	.	.	.	.	.	.	.	G	6.232	0.410873	0.11812	.	.	ENSG00000244187	ENST00000290079	.	.	.	4.69	0.485	0.16830	.	.	.	.	.	T	0.29158	0.0725	L	0.43152	1.355	0.28799	N	0.898892	B	0.18741	0.03	B	0.20767	0.031	T	0.27971	-1.0058	8	0.41790	T	0.15	.	1.9746	0.03413	0.1855:0.154:0.5024:0.1581	.	73	Q96I45	TM141_HUMAN	M	73	.	ENSP00000290079:V73M	V	+	1	0	TMEM141	138806535	0.347000	0.24853	0.865000	0.33974	0.008000	0.06430	0.327000	0.19663	0.050000	0.15949	-0.823000	0.03104	GTG	TMEM141	-	NULL	ENSG00000244187		0.592	TMEM141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM141	HGNC	protein_coding	OTTHUMT00000055119.1		0.00	35	0	G	NM_032928		139686714	+1			no_errors	ENST00000290079	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.596	A
TMPO	7112	genome.wustl.edu	37	12	98941483	98941483	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr12:98941483G>T	ENST00000556029.1	+	9	1568	c.1212G>T	c.(1210-1212)aaG>aaT	p.K404N	TMPO_ENST00000393053.2_Missense_Mutation_p.K295N|TMPO_ENST00000548223.1_3'UTR|TMPO_ENST00000343315.5_Missense_Mutation_p.K364N	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin	404	Nucleoplasmic. {ECO:0000255}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AGTCAGAAAAGACAAAAAAGG	0.403																																																	0													111.0	110.0	110.0					12																	98941483		2203	4300	6503	SO:0001583	missense	0				CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.1212G>T	12.37:g.98941483G>T	ENSP00000450627:p.Lys404Asn		A2T926|Q14861	Missense_Mutation	SNP	pfam_LEM-like_dom,pfam_LEM_dom,superfamily_LEM/LEM-like_dom,smart_LEM_dom,pfscan_LEM_dom,pfscan_LEM-like_dom	p.K404N	ENST00000556029.1	37	c.1212	CCDS31879.1	12	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792020	0.50102	.	.	ENSG00000120802	ENST00000556029;ENST00000343315;ENST00000393053	T;T;T	0.66460	0.15;0.12;-0.21	5.59	3.77	0.43336	.	.	.	.	.	T	0.77110	0.4082	M	0.71581	2.175	0.80722	D	1	D;P	0.71674	0.998;0.956	D;P	0.78314	0.991;0.527	T	0.76517	-0.2930	9	0.72032	D	0.01	.	7.2697	0.26250	0.3664:0.0:0.6336:0.0	.	328;404	Q59G12;P42167	.;LAP2B_HUMAN	N	404;364;295	ENSP00000450627:K404N;ENSP00000340251:K364N;ENSP00000376773:K295N	ENSP00000340251:K404N	K	+	3	2	TMPO	97465614	0.881000	0.30235	0.998000	0.56505	0.989000	0.77384	0.624000	0.24462	0.832000	0.34804	0.655000	0.94253	AAG	TMPO	-	NULL	ENSG00000120802		0.403	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPO	HGNC	protein_coding	OTTHUMT00000407973.2	-	0.00	57	0	G	NM_003276		98941483	+1	tier1	-	no_errors	ENST00000556029	ensembl	human	known	74_37	missense	11.32	47	6	SNP	0.990	T
TNK2	10188	genome.wustl.edu	37	3	195593867	195593867	+	Silent	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:195593867C>A	ENST00000333602.6	-	14	3620	c.3003G>T	c.(3001-3003)ctG>ctT	p.L1001L	TNK2_ENST00000392400.1_Silent_p.L1001L|TNK2_ENST00000428187.1_Silent_p.L1003L|TNK2_ENST00000381916.2_Silent_p.L1049L	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	1001				Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GCCGCAGACCCAGCCCGAAGA	0.697																																																	0													29.0	33.0	32.0					3																	195593867		2201	4300	6501	SO:0001819	synonymous_variant	0			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.3003G>T	3.37:g.195593867C>A			Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cdc42_binding_dom_like,pfam_Inhibitor_Mig-6,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.L1049	ENST00000333602.6	37	c.3147	CCDS33928.1	3																																																																																			TNK2	-	superfamily_UBA-like	ENSG00000061938		0.697	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TNK2	HGNC	protein_coding	OTTHUMT00000341437.3		0.00	112	0	C	NM_005781		195593867	-1			no_errors	ENST00000381916	ensembl	human	known	74_37	silent	5.06	75	4	SNP	1.000	A
TNRC6C	57690	genome.wustl.edu	37	17	76063908	76063908	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:76063908G>C	ENST00000588061.1	+	7	3409	c.2682G>C	c.(2680-2682)gaG>gaC	p.E894D	TNRC6C_ENST00000541771.1_Missense_Mutation_p.E894D|RNU6-625P_ENST00000459412.1_RNA|TNRC6C_ENST00000588847.1_Missense_Mutation_p.E891D|TNRC6C_ENST00000335749.4_Missense_Mutation_p.E891D|TNRC6C_ENST00000301624.4_Missense_Mutation_p.E894D|TNRC6C_ENST00000544502.1_Missense_Mutation_p.E891D			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	894	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GCCAGTGGGAGGATGAAGAAG	0.493																																																	0													142.0	144.0	143.0					17																	76063908		1959	4151	6110	SO:0001583	missense	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2682G>C	17.37:g.76063908G>C	ENSP00000468647:p.Glu894Asp		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.E891D	ENST00000588061.1	37	c.2673	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930072	0.52759	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.84	-3.47	0.04753	Argonaute hook domain (1);	0.093317	0.64402	N	0.000001	T	0.31513	0.0799	L	0.43598	1.365	0.48571	D	0.999677	B;B;B	0.23377	0.084;0.082;0.001	B;B;B	0.26614	0.071;0.054;0.01	T	0.03000	-1.1084	10	0.26408	T	0.33	-13.8866	7.3418	0.26641	0.327:0.235:0.4379:0.0	.	891;894;894	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	D	894;891;891;894;894;891	ENSP00000336783:E891D;ENSP00000301624:E894D;ENSP00000440310:E894D;ENSP00000442421:E891D	ENSP00000301624:E894D	E	+	3	2	TNRC6C	73575503	0.987000	0.35691	0.960000	0.40013	0.998000	0.95712	0.252000	0.18278	-0.483000	0.06772	0.591000	0.81541	GAG	TNRC6C	-	pfam_Argonaute_hook_dom	ENSG00000078687		0.493	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	-	0.00	23	0	G	NM_018996		76063908	+1	tier1	-	no_errors	ENST00000335749	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.852	C
TNXB	7148	genome.wustl.edu	37	6	32064950	32064950	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:32064950C>A	ENST00000479795.1	-	3	820	c.680G>T	c.(679-681)cGc>cTc	p.R227L	TNXB_ENST00000375247.2_Missense_Mutation_p.R227L|TNXB_ENST00000375244.3_Missense_Mutation_p.R227L			P22105	TENX_HUMAN	tenascin XB	227	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTGCACGCAGCGCCCACGGCC	0.697																																																	0													15.0	20.0	18.0					6																	32064950		2149	4230	6379	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.680G>T	6.37:g.32064950C>A	ENSP00000418248:p.Arg227Leu		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.R227L	ENST00000479795.1	37	c.680		6	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659348	0.67586	.	.	ENSG00000168477	ENST00000375244;ENST00000375247;ENST00000479795	T;T;T	0.09911	2.93;2.93;2.93	4.22	4.22	0.49857	.	0.000000	0.46442	D	0.000295	T	0.15046	0.0363	L	0.56769	1.78	0.30137	N	0.804313	D	0.76494	0.999	D	0.83275	0.996	T	0.03887	-1.0995	10	0.19590	T	0.45	.	14.1225	0.65198	0.0:1.0:0.0:0.0	.	227	P22105-3	.	L	227	ENSP00000364393:R227L;ENSP00000364396:R227L;ENSP00000418248:R227L	ENSP00000364393:R227L	R	-	2	0	TNXB	32172928	0.000000	0.05858	1.000000	0.80357	0.783000	0.44284	-0.315000	0.08081	2.161000	0.67846	0.655000	0.94253	CGC	TNXB	-	pfam_EGF_extracell,smart_EG-like_dom	ENSG00000168477		0.697	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000357059.1	-	0.00	47	0	C	NM_019105		32064950	-1	tier1	-	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	14.89	40	7	SNP	1.000	A
TOX3	27324	genome.wustl.edu	37	16	52484404	52484404	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:52484404G>A	ENST00000219746.9	-	4	747	c.463C>T	c.(463-465)Cgg>Tgg	p.R155W	TOX3_ENST00000407228.3_Missense_Mutation_p.R150W	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	155					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)	p.R155W(1)|p.R150W(1)		NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						ACGATGGACCGCATGATCAGG	0.562																																																	2	Substitution - Missense(2)	kidney(2)											91.0	97.0	95.0					16																	52484404		2091	4210	6301	SO:0001583	missense	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.463C>T	16.37:g.52484404G>A	ENSP00000219746:p.Arg155Trp		B4DRD0|B5MCW4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.R155W	ENST00000219746.9	37	c.463	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	G	14.03	2.413193	0.42817	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.42900	0.96;0.96	5.85	4.76	0.60689	.	0.174050	0.49916	D	0.000122	T	0.59252	0.2180	M	0.68952	2.095	0.48040	D	0.999571	D;D	0.89917	1.0;1.0	D;D	0.63283	0.913;0.913	T	0.62191	-0.6906	10	0.66056	D	0.02	.	13.1115	0.59277	0.0:0.0:0.1397:0.8602	.	150;155	B4DRD0;O15405	.;TOX3_HUMAN	W	155;150	ENSP00000219746:R155W;ENSP00000385705:R150W	ENSP00000219746:R155W	R	-	1	2	TOX3	51041905	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	2.633000	0.46519	1.049000	0.40321	-0.457000	0.05445	CGG	TOX3	-	NULL	ENSG00000103460		0.562	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1		0.00	36	0	G	XM_049037		52484404	-1			no_errors	ENST00000219746	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	A
TPST2	8459	genome.wustl.edu	37	22	26937283	26937283	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr22:26937283C>T	ENST00000338754.4	-	3	584	c.314G>A	c.(313-315)cGc>cAc	p.R105H	TPST2_ENST00000403880.1_Missense_Mutation_p.R105H|TPST2_ENST00000398110.2_Missense_Mutation_p.R105H	NM_003595.3	NP_003586.3	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	105					fusion of sperm to egg plasma membrane (GO:0007342)|peptidyl-tyrosine sulfation (GO:0006478)|prevention of polyspermy (GO:0060468)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			central_nervous_system(1)|large_intestine(1)|lung(5)	7						GGCCAGCACGCGCGGGATGAT	0.701																																																	0													26.0	24.0	25.0					22																	26937283		2199	4297	6496	SO:0001583	missense	0			AF049891	CCDS13839.1	22q12.1	2012-12-13			ENSG00000128294	ENSG00000128294	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12021	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog B (Drosophila)"""	603126				9736702, 9733778	Standard	NM_003595		Approved	TANGO13B	uc003acx.3	O60704	OTTHUMG00000150987	ENST00000338754.4:c.314G>A	22.37:g.26937283C>T	ENSP00000339813:p.Arg105His		B3KQA7|Q6FI98|Q9H0V4	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.R105H	ENST00000338754.4	37	c.314	CCDS13839.1	22	.	.	.	.	.	.	.	.	.	.	C	26.2	4.714495	0.89112	.	.	ENSG00000128294	ENST00000338754;ENST00000398110;ENST00000403880;ENST00000528868;ENST00000442495;ENST00000454778	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.09	5.09	0.68999	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.65688	0.2715	M	0.86573	2.825	0.80722	D	1	D	0.61697	0.99	P	0.52309	0.695	T	0.72276	-0.4341	10	0.48119	T	0.1	-24.5774	17.4869	0.87691	0.0:1.0:0.0:0.0	.	105	O60704	TPST2_HUMAN	H	105;105;105;38;105;105	ENSP00000339813:R105H;ENSP00000381180:R105H;ENSP00000385192:R105H;ENSP00000403875:R105H;ENSP00000400357:R105H	ENSP00000339813:R105H	R	-	2	0	TPST2	25267283	1.000000	0.71417	0.994000	0.49952	0.585000	0.36419	7.204000	0.77872	2.384000	0.81235	0.609000	0.83330	CGC	TPST2	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000128294		0.701	TPST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPST2	HGNC	protein_coding	OTTHUMT00000320820.3	-	0.00	33	0	C	NM_003595		26937283	-1	tier1	-	no_errors	ENST00000338754	ensembl	human	known	74_37	missense	30.77	27	12	SNP	1.000	T
TPTE2P6	374491	genome.wustl.edu	37	13	25168448	25168449	+	RNA	INS	-	-	TA			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr13:25168448_25168449insTA	ENST00000453498.1	+	0	1120_1121				TPTE2P6_ENST00000440905.1_RNA																							ATTAACTAATGTATATGACAGT	0.376																																																	0																																												0																															13.37:g.25168451_25168452dupTA				RNA	INS	-	NULL	ENST00000453498.1	37	NULL		13																																																																																			TPTE2P6	-	-	ENSG00000205822		0.376	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	TPTE2P6	HGNC	processed_transcript	OTTHUMT00000044193.1		0.00	127	0	0			25168449	+1			no_errors	ENST00000440905	ensembl	human	known	74_37	rna	8.25	178	16	INS	0.000:0.000	TA
TRIM3	10612	genome.wustl.edu	37	11	6478032	6478032	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr11:6478032C>T	ENST00000525074.1	-	6	1318	c.924G>A	c.(922-924)tcG>tcA	p.S308S	TRIM3_ENST00000536344.1_Silent_p.S189S|TRIM3_ENST00000345851.3_Silent_p.S308S|TRIM3_ENST00000537602.1_Silent_p.S230S|TRIM3_ENST00000359518.3_Silent_p.S308S|TRIM3_ENST00000529058.1_5'UTR	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	308					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GATTGAGCACCGATCGCCGCA	0.672																																					Melanoma(6;5 510 1540 25169 29084)												0													66.0	61.0	63.0					11																	6478032		2189	4275	6464	SO:0001819	synonymous_variant	0			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.924G>A	11.37:g.6478032C>T			B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Silent	SNP	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.S308	ENST00000525074.1	37	c.924	CCDS7764.1	11																																																																																			TRIM3	-	NULL	ENSG00000110171		0.672	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM3	HGNC	protein_coding	OTTHUMT00000384224.2	-	0.00	73	0	C	NM_006458		6478032	-1	tier1	-	no_errors	ENST00000345851	ensembl	human	known	74_37	silent	17.11	62	13	SNP	0.841	T
TRIM31	11074	genome.wustl.edu	37	6	30071921	30071921	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:30071921G>A	ENST00000376734.3	-	8	1107	c.982C>T	c.(982-984)Cat>Tat	p.H328Y	TRIM31_ENST00000540829.1_Missense_Mutation_p.H328Y|TRIM31_ENST00000485864.1_5'Flank|TRIM31-AS1_ENST00000440874.1_RNA	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	328					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						TTCATTTTATGATTATTTTTC	0.408																																																	0													103.0	118.0	112.0					6																	30071921		1511	2709	4220	SO:0001583	missense	0			AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.982C>T	6.37:g.30071921G>A	ENSP00000365924:p.His328Tyr		A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,prints_Znf_B-box_chordata,pfscan_Znf_B-box,pfscan_Znf_RING	p.H328Y	ENST00000376734.3	37	c.982	CCDS34374.1	6	.	.	.	.	.	.	.	.	.	.	G	5.959	0.360980	0.11296	.	.	ENSG00000204616	ENST00000376734;ENST00000376728;ENST00000540829	T;T	0.65916	-0.18;-0.18	2.16	0.0285	0.14158	.	.	.	.	.	T	0.12561	0.0305	N	0.08118	0	0.09310	N	1	P	0.35139	0.486	B	0.19946	0.027	T	0.08659	-1.0711	9	0.34782	T	0.22	.	4.0015	0.09582	0.5267:0.0:0.4733:0.0	.	328	Q9BZY9	TRI31_HUMAN	Y	328	ENSP00000365924:H328Y;ENSP00000444311:H328Y	ENSP00000365918:H328Y	H	-	1	0	TRIM31	30179900	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.809000	0.04510	-0.022000	0.13986	0.530000	0.56133	CAT	TRIM31	-	NULL	ENSG00000204616		0.408	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM31	HGNC	protein_coding	OTTHUMT00000076081.2	-	0.00	82	0	G			30071921	-1	tier1	-	no_errors	ENST00000376734	ensembl	human	known	74_37	missense	21.13	56	15	SNP	0.001	A
TRIM52	84851	genome.wustl.edu	37	5	180687595	180687595	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:180687595C>T	ENST00000327767.4	-	1	524	c.220G>A	c.(220-222)Gcc>Acc	p.A74T	TRIM52-AS1_ENST00000507434.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|TRIM52_ENST00000514805.1_5'UTR|TRIM52-AS1_ENST00000514146.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	74	Glu-rich.				positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		CCATCCATGGCCCCCACCGCT	0.582																																																	0													161.0	121.0	134.0					5																	180687595		2203	4300	6503	SO:0001583	missense	0				CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.220G>A	5.37:g.180687595C>T	ENSP00000332152:p.Ala74Thr			Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.A74T	ENST00000327767.4	37	c.220	CCDS4467.1	5	.	.	.	.	.	.	.	.	.	.	c	15.44	2.834958	0.50951	.	.	ENSG00000183718	ENST00000327767	T	0.23552	1.9	3.45	3.45	0.39498	Zinc finger, RING-type (1);	.	.	.	.	T	0.31071	0.0785	L	0.32530	0.975	0.25118	N	0.990661	D	0.64830	0.994	P	0.56127	0.792	T	0.06162	-1.0842	8	.	.	.	.	11.1343	0.48365	0.0:1.0:0.0:0.0	.	74	Q96A61	TRI52_HUMAN	T	74	ENSP00000332152:A74T	.	A	-	1	0	TRIM52	180620201	0.862000	0.29867	0.507000	0.27676	0.111000	0.19643	2.421000	0.44688	1.887000	0.54652	0.511000	0.50034	GCC	TRIM52	-	smart_Znf_RING	ENSG00000183718		0.582	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM52	HGNC	protein_coding	OTTHUMT00000253572.3	-	0.00	48	0	C	NM_032765		180687595	-1	tier1	-	no_errors	ENST00000327767	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.832	T
TRIM55	84675	genome.wustl.edu	37	8	67062654	67062654	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr8:67062654A>C	ENST00000315962.4	+	7	1311	c.938A>C	c.(937-939)aAc>aCc	p.N313T	TRIM55_ENST00000276573.7_Missense_Mutation_p.N313T|TRIM55_ENST00000353317.5_Missense_Mutation_p.N313T|TRIM55_ENST00000350034.4_Intron	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	313	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TTCACAGTCAACCTCAATAGA	0.403																																																	0													108.0	103.0	105.0					8																	67062654		2203	4300	6503	SO:0001583	missense	0			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.938A>C	8.37:g.67062654A>C	ENSP00000323913:p.Asn313Thr		B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.N313T	ENST00000315962.4	37	c.938	CCDS6184.1	8	.	.	.	.	.	.	.	.	.	.	A	16.32	3.090279	0.55968	.	.	ENSG00000147573	ENST00000315962;ENST00000353317;ENST00000276573	T;T;T	0.33654	1.4;1.42;1.44	5.84	5.84	0.93424	COS domain (1);	0.292488	0.44483	D	0.000447	T	0.39682	0.1087	L	0.50333	1.59	0.80722	D	1	P;B;B	0.35821	0.523;0.07;0.249	B;B;B	0.38842	0.283;0.131;0.274	T	0.33420	-0.9869	10	0.87932	D	0	.	16.226	0.82293	1.0:0.0:0.0:0.0	.	313;313;313	Q9BYV6-2;Q9BYV6;Q9BYV6-3	.;TRI55_HUMAN;.	T	313	ENSP00000323913:N313T;ENSP00000297348:N313T;ENSP00000276573:N313T	ENSP00000276573:N313T	N	+	2	0	TRIM55	67225208	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.090000	0.64498	2.230000	0.72887	0.528000	0.53228	AAC	TRIM55	-	NULL	ENSG00000147573		0.403	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM55	HGNC	protein_coding	OTTHUMT00000378921.1	-	0.00	42	0	A	NM_184085		67062654	+1	tier1	-	no_errors	ENST00000315962	ensembl	human	known	74_37	missense	16.98	44	9	SNP	1.000	C
TRIM60	166655	genome.wustl.edu	37	4	165961334	165961334	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr4:165961334G>A	ENST00000512596.1	+	3	326	c.110G>A	c.(109-111)cGc>cAc	p.R37H	TRIM60_ENST00000508504.1_Missense_Mutation_p.R37H|TRIM60_ENST00000341062.5_Missense_Mutation_p.R37H	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	37						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		AACTTCTGTCGCTCCTGCCTC	0.522																																																	0													156.0	137.0	144.0					4																	165961334		2203	4300	6503	SO:0001583	missense	0			AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.110G>A	4.37:g.165961334G>A	ENSP00000421142:p.Arg37His		Q8NA35	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R37H	ENST00000512596.1	37	c.110	CCDS3808.1	4	.	.	.	.	.	.	.	.	.	.	g	3.533	-0.095366	0.07010	.	.	ENSG00000176979	ENST00000512596;ENST00000507119;ENST00000508504;ENST00000341062	T;T;T;T	0.08193	3.12;3.12;3.12;3.12	2.34	-3.8	0.04307	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	2.215630	0.04518	N	0.384083	T	0.07458	0.0188	L	0.60845	1.875	0.09310	N	1	B	0.27416	0.178	B	0.21708	0.036	T	0.36138	-0.9760	10	0.15066	T	0.55	.	3.2547	0.06827	0.3407:0.0:0.2189:0.4404	.	37	Q495X7	TRI60_HUMAN	H	37	ENSP00000421142:R37H;ENSP00000421784:R37H;ENSP00000426496:R37H;ENSP00000343765:R37H	ENSP00000343765:R37H	R	+	2	0	TRIM60	166180784	0.000000	0.05858	0.000000	0.03702	0.315000	0.28087	-1.465000	0.02357	-1.189000	0.02702	-0.150000	0.13652	CGC	TRIM60	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000176979		0.522	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM60	HGNC	protein_coding	OTTHUMT00000364325.1	-	0.00	67	0	G	NM_152620		165961334	+1	tier1	-	no_errors	ENST00000341062	ensembl	human	known	74_37	missense	13.56	51	8	SNP	0.000	A
TRPV1	7442	genome.wustl.edu	37	17	3489096	3489096	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:3489096G>A	ENST00000571088.1	-	8	1562	c.1349C>T	c.(1348-1350)aCc>aTc	p.T450I	TRPV1_ENST00000310522.5_Missense_Mutation_p.T390I|TRPV1_ENST00000425167.2_Missense_Mutation_p.T461I|TRPV1_ENST00000174621.6_Missense_Mutation_p.T448I|TRPV1_ENST00000399756.4_Missense_Mutation_p.T450I|TRPV1_ENST00000399759.3_Missense_Mutation_p.T450I|TRPV1_ENST00000576351.1_Missense_Mutation_p.T440I|SHPK_ENST00000572705.1_Missense_Mutation_p.T450I	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	450					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	GGCAGCCATGGTGAAGATGAT	0.587																																					Melanoma(38;962 1762 15789)												0													63.0	72.0	69.0					17																	3489096		2091	4209	6300	SO:0001583	missense	0			AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.1349C>T	17.37:g.3489096G>A	ENSP00000461007:p.Thr450Ile		A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	p.T450I	ENST00000571088.1	37	c.1349	CCDS45576.1	17	.	.	.	.	.	.	.	.	.	.	g	18.09	3.545911	0.65198	.	.	ENSG00000196689	ENST00000399759;ENST00000399756;ENST00000174621;ENST00000425167;ENST00000310522	D;D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75;-2.75	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.95652	0.8586	M	0.85945	2.785	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.995;0.995;0.999	D	0.96450	0.9333	10	0.87932	D	0	-16.6068	16.8554	0.86004	0.0:0.0:1.0:0.0	.	450;448;390;461	Q8NER1;E7EQ80;E7ESJ2;E7EQ78	TRPV1_HUMAN;.;.;.	I	450;450;448;461;390	ENSP00000382661:T450I;ENSP00000382659:T450I;ENSP00000174621:T448I;ENSP00000409627:T461I;ENSP00000311692:T390I	ENSP00000174621:T448I	T	-	2	0	TRPV1	3435845	1.000000	0.71417	0.966000	0.40874	0.244000	0.25665	9.301000	0.96167	2.266000	0.75297	0.651000	0.88453	ACC	TRPV1	-	prints_TRPV1-4_channel,tigrfam_TRP_channel	ENSG00000196689		0.587	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV1	HGNC	protein_coding	OTTHUMT00000438254.1		0.00	38	0	G	NM_018727		3489096	-1			no_errors	ENST00000399756	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.999	A
TTC21B	79809	genome.wustl.edu	37	2	166747426	166747426	+	Missense_Mutation	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:166747426A>C	ENST00000243344.7	-	23	3160	c.3023T>G	c.(3022-3024)tTt>tGt	p.F1008C	TTC21B_ENST00000536175.1_5'Flank	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	1008					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)		p.F1008S(1)		breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						CATTGAGAAAAATCTTGGGAC	0.328																																																	1	Substitution - Missense(1)	large_intestine(1)											62.0	67.0	65.0					2																	166747426		2203	4300	6503	SO:0001583	missense	0			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.3023T>G	2.37:g.166747426A>C	ENSP00000243344:p.Phe1008Cys		A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.F1008C	ENST00000243344.7	37	c.3023	CCDS33315.1	2	.	.	.	.	.	.	.	.	.	.	A	19.69	3.874378	0.72180	.	.	ENSG00000123607	ENST00000243344	T	0.53423	0.62	5.57	4.38	0.52667	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.092533	0.85682	D	0.000000	T	0.68732	0.3033	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.72097	-0.4393	10	0.72032	D	0.01	-15.8224	11.7456	0.51817	0.8678:0.0:0.0:0.1322	.	1008	Q7Z4L5	TT21B_HUMAN	C	1008	ENSP00000243344:F1008C	ENSP00000243344:F1008C	F	-	2	0	TTC21B	166455672	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.442000	0.80503	0.880000	0.35969	0.445000	0.29226	TTT	TTC21B	-	pfscan_TPR-contain_dom	ENSG00000123607		0.328	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC21B	HGNC	protein_coding	OTTHUMT00000333770.1	-	0.00	50	0	A	NM_024753		166747426	-1	tier1	-	no_errors	ENST00000243344	ensembl	human	known	74_37	missense	19.61	41	10	SNP	1.000	C
TTC24	164118	genome.wustl.edu	37	1	156551817	156551817	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:156551817delA	ENST00000368237.3	+	1	661	c.661delA	c.(661-663)aaafs	p.K221fs	TTC24_ENST00000368236.3_Frame_Shift_Del_p.K221fs			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	221										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGTGCTGGAGAAAAGCCGGAG	0.647																																																	0													7.0	8.0	8.0					1																	156551817		689	1587	2276	SO:0001589	frameshift_variant	0				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.661delA	1.37:g.156551817delA	ENSP00000357220:p.Lys221fs		Q5T3H7	Frame_Shift_Del	DEL	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S222fs	ENST00000368237.3	37	c.661	CCDS53379.1	1																																																																																			TTC24	-	pfscan_TPR-contain_dom	ENSG00000187862		0.647	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1		0.00	63	0	A	XM_089384		156551817	+1	tier1		no_errors	ENST00000368236	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	1.000	-
TTN	7273	genome.wustl.edu	37	2	179544127	179544127	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:179544127C>G	ENST00000591111.1	-	140	32954	c.32730G>C	c.(32728-32730)aaG>aaC	p.K10910N	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K11227N|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K9983N|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11681	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTCTGGCTTCTTAGGAACCT	0.363																																																	0													100.0	94.0	96.0					2																	179544127		1827	4087	5914	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32730G>C	2.37:g.179544127C>G	ENSP00000465570:p.Lys10910Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K9983N	ENST00000591111.1	37	c.29949		2	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800539	0.31869	.	.	ENSG00000155657	ENST00000342992	T	0.70869	-0.52	5.82	5.82	0.92795	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.73536	0.3599	M	0.89904	3.07	0.80722	D	1	P	0.37061	0.58	B	0.37601	0.254	T	0.78448	-0.2200	9	0.87932	D	0	.	6.1454	0.20283	0.183:0.7063:0.0:0.1107	.	10910	Q8WZ42	TITIN_HUMAN	N	9983	ENSP00000343764:K9983N	ENSP00000343764:K9983N	K	-	3	2	TTN	179252372	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.288000	0.33296	2.734000	0.93682	0.655000	0.94253	AAG	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.363	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	101	0	C	NM_133378		179544127	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	13.95	111	18	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179479099	179479100	+	Intron	INS	-	-	A	rs79190382|rs77072635		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:179479099_179479100insA	ENST00000591111.1	-	212	44350				TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACAGATGCAGAAAAAAAAATT	0.371																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.44126-24->T	2.37:g.179479108_179479108dupA			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	INS	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			TTN-AS1	-	-	ENSG00000237298		0.371	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	15	0	-	NM_133378		179479100	+1	tier1		no_errors	ENST00000456053	ensembl	human	known	74_37	rna	11.76	15	2	INS	0.000:0.004	A
TTN	7273	genome.wustl.edu	37	2	179659787	179659787	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr2:179659787C>A	ENST00000591111.1	-	7	1331	c.1107G>T	c.(1105-1107)caG>caT	p.Q369H	TTN_ENST00000342175.6_Missense_Mutation_p.Q369H|TTN_ENST00000360870.5_Missense_Mutation_p.Q369H|TTN_ENST00000589042.1_Missense_Mutation_p.Q369H|TTN_ENST00000359218.5_Missense_Mutation_p.Q369H|TTN_ENST00000460472.2_Missense_Mutation_p.Q369H|TTN_ENST00000342992.6_Missense_Mutation_p.Q369H			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTCCTGATCTGAGTAGAGG	0.582																																																	0													119.0	109.0	112.0					2																	179659787		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1107G>T	2.37:g.179659787C>A	ENSP00000465570:p.Gln369His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Q369H	ENST00000591111.1	37	c.1107		2	.	.	.	.	.	.	.	.	.	.	C	10.31	1.315881	0.23908	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.69306	-0.39;-0.05;-0.09;-0.1;-0.07	6.16	5.26	0.73747	.	.	.	.	.	T	0.49915	0.1585	N	0.17082	0.46	0.23287	N	0.997976	B;B;B;B;B	0.16166	0.0;0.0;0.0;0.002;0.016	B;B;B;B;B	0.19666	0.001;0.001;0.001;0.003;0.026	T	0.34428	-0.9829	9	0.87932	D	0	.	7.314	0.26491	0.1466:0.7183:0.0:0.1351	.	369;369;369;369;369	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	369	ENSP00000343764:Q369H;ENSP00000434586:Q369H;ENSP00000340554:Q369H;ENSP00000352154:Q369H;ENSP00000354117:Q369H	ENSP00000340554:Q369H	Q	-	3	2	TTN	179368032	1.000000	0.71417	0.999000	0.59377	0.469000	0.32828	1.522000	0.35921	2.937000	0.99478	0.650000	0.86243	CAG	TTN	-	NULL	ENSG00000155657		0.582	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	65	0	C	NM_133378		179659787	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	18.42	62	14	SNP	1.000	A
TXLNB	167838	genome.wustl.edu	37	6	139564250	139564250	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr6:139564250C>T	ENST00000358430.3	-	10	1700	c.1468G>A	c.(1468-1470)Gca>Aca	p.A490T	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	490						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		ACCTCCTCTGCGTCAATCTCT	0.458																																																	0													119.0	122.0	121.0					6																	139564250		2203	4300	6503	SO:0001583	missense	0				CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1468G>A	6.37:g.139564250C>T	ENSP00000351206:p.Ala490Thr		Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	pfam_Taxilin_fam	p.A490T	ENST00000358430.3	37	c.1468	CCDS34545.1	6	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880748	0.33255	.	.	ENSG00000164440	ENST00000358430	T	0.15718	2.4	6.06	1.15	0.20763	.	0.869260	0.10439	N	0.674536	T	0.02230	0.0069	N	0.19112	0.55	0.09310	N	1	B	0.25312	0.123	B	0.12837	0.008	T	0.47209	-0.9135	9	.	.	.	-1.4245	2.1403	0.03772	0.1204:0.4386:0.1171:0.3239	.	490	Q8N3L3	TXLNB_HUMAN	T	490	ENSP00000351206:A490T	.	A	-	1	0	TXLNB	139605943	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.913000	0.04042	-0.071000	0.12886	-0.176000	0.13171	GCA	TXLNB	-	NULL	ENSG00000164440		0.458	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNB	HGNC	protein_coding	OTTHUMT00000042458.1	-	0.00	80	0	C	NM_153235		139564250	-1	tier1	-	no_errors	ENST00000358430	ensembl	human	known	74_37	missense	11.54	69	9	SNP	0.000	T
ULK4	54986	genome.wustl.edu	37	3	41705161	41705161	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr3:41705161G>C	ENST00000301831.4	-	30	3470	c.3008C>G	c.(3007-3009)cCa>cGa	p.P1003R		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	1003					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TGCTGGTACTGGGTCAGGTTC	0.378																																																	0													131.0	126.0	128.0					3																	41705161		1861	4099	5960	SO:0001583	missense	0			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.3008C>G	3.37:g.41705161G>C	ENSP00000301831:p.Pro1003Arg		A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P1003R	ENST00000301831.4	37	c.3008	CCDS43071.1	3	.	.	.	.	.	.	.	.	.	.	G	18.73	3.685658	0.68157	.	.	ENSG00000168038	ENST00000301831	T	0.64085	-0.08	5.86	5.86	0.93980	Armadillo-type fold (1);	0.000000	0.64402	U	0.000006	T	0.75443	0.3850	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.76545	-0.2920	10	0.87932	D	0	.	15.6865	0.77415	0.0:0.0:1.0:0.0	.	1003	Q96C45	ULK4_HUMAN	R	1003	ENSP00000301831:P1003R	ENSP00000301831:P1003R	P	-	2	0	ULK4	41680165	1.000000	0.71417	0.966000	0.40874	0.716000	0.41182	5.681000	0.68175	2.781000	0.95711	0.650000	0.86243	CCA	ULK4	-	superfamily_ARM-type_fold	ENSG00000168038		0.378	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	-	0.00	54	0	G	XM_929989		41705161	-1	tier1	-	no_errors	ENST00000301831	ensembl	human	known	74_37	missense	10.20	44	5	SNP	0.987	C
UNC13C	440279	genome.wustl.edu	37	15	54786896	54786896	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:54786896T>G	ENST00000260323.11	+	19	5024	c.5024T>G	c.(5023-5025)cTt>cGt	p.L1675R	UNC13C_ENST00000537900.1_Missense_Mutation_p.L1673R|UNC13C_ENST00000545554.1_Missense_Mutation_p.L1675R	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1675	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.L1675R(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GTGCGTGAACTTCCTGCCTTC	0.353																																																	1	Substitution - Missense(1)	large_intestine(1)											167.0	162.0	164.0					15																	54786896		1856	4096	5952	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5024T>G	15.37:g.54786896T>G	ENSP00000260323:p.Leu1675Arg		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.L1675R	ENST00000260323.11	37	c.5024	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382471	0.82792	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;D;T	0.81499	-1.49;-1.5;-1.49	5.87	5.87	0.94306	Munc13 homology 1 (1);	0.000000	0.85682	D	0.000000	D	0.90497	0.7023	M	0.85373	2.75	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.91240	0.5021	10	0.54805	T	0.06	.	15.7569	0.78037	0.0:0.0:0.0:1.0	.	1675	Q8NB66	UN13C_HUMAN	R	1675;1675;1673	ENSP00000260323:L1675R;ENSP00000438156:L1675R;ENSP00000442569:L1673R	ENSP00000260323:L1675R	L	+	2	0	UNC13C	52574188	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.997000	0.88414	2.371000	0.80710	0.533000	0.62120	CTT	UNC13C	-	NULL	ENSG00000137766		0.353	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	77	0	T	NM_173166		54786896	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	11.84	67	9	SNP	1.000	G
URB1	9875	genome.wustl.edu	37	21	33717703	33717703	+	Silent	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr21:33717703G>A	ENST00000382751.3	-	23	4165	c.4050C>T	c.(4048-4050)caC>caT	p.H1350H	RN7SL109P_ENST00000493105.2_RNA	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	1350						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						TGCTTGGGGTGTGAAGCAAGC	0.502																																																	0													71.0	69.0	70.0					21																	33717703		692	1591	2283	SO:0001819	synonymous_variant	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.4050C>T	21.37:g.33717703G>A			D3DSE5|Q96NX1|Q9NYQ1	Silent	SNP	pfam_Npa1_N,superfamily_ARM-type_fold	p.H1350	ENST00000382751.3	37	c.4050	CCDS46645.1	21																																																																																			URB1	-	NULL	ENSG00000142207		0.502	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	-	0.00	52	0	G			33717703	-1	tier1	-	no_errors	ENST00000382751	ensembl	human	known	74_37	silent	17.50	33	7	SNP	0.023	A
WDR3	10885	genome.wustl.edu	37	1	118499808	118499808	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:118499808C>G	ENST00000349139.5	+	25	2618	c.2571C>G	c.(2569-2571)ttC>ttG	p.F857L	SPAG17_ENST00000336338.5_Intron	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	857						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		GGTGCCTCTTCTTCCTCCTTA	0.413																																																	0													221.0	211.0	214.0					1																	118499808		2203	4300	6503	SO:0001583	missense	0			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.2571C>G	1.37:g.118499808C>G	ENSP00000308179:p.Phe857Leu			Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.F857L	ENST00000349139.5	37	c.2571	CCDS898.1	1	.	.	.	.	.	.	.	.	.	.	C	5.737	0.320449	0.10845	.	.	ENSG00000065183	ENST00000349139	T	0.54866	0.55	5.8	3.92	0.45320	.	0.091464	0.85682	D	0.000000	T	0.15262	0.0368	L	0.33668	1.02	0.80722	D	1	B	0.14805	0.011	B	0.16289	0.015	T	0.13072	-1.0523	10	0.07813	T	0.8	-18.0311	5.8075	0.18448	0.0:0.6356:0.14:0.2244	.	857	Q9UNX4	WDR3_HUMAN	L	857	ENSP00000308179:F857L	ENSP00000308179:F857L	F	+	3	2	WDR3	118301331	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.577000	0.46042	0.777000	0.33496	-0.192000	0.12808	TTC	WDR3	-	pfam_SSU_processome_Utp12	ENSG00000065183		0.413	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	HGNC	protein_coding	OTTHUMT00000033720.2		0.00	39	0	C	NM_006784		118499808	+1			no_errors	ENST00000349139	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	G
WDR87	83889	genome.wustl.edu	37	19	38382211	38382211	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:38382211T>G	ENST00000303868.5	-	5	3482	c.3258A>C	c.(3256-3258)caA>caC	p.Q1086H	WDR87_ENST00000447313.2_Missense_Mutation_p.Q1125H	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1086										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TGACCCCTGCTTGGCCTCGTC	0.483																																																	0													43.0	36.0	38.0					19																	38382211		692	1591	2283	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3258A>C	19.37:g.38382211T>G	ENSP00000368025:p.Gln1086His		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1125H	ENST00000303868.5	37	c.3375	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	T	3.683	-0.065161	0.07273	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.10763	2.84;2.84	3.79	1.67	0.24075	.	0.394172	0.18543	N	0.138142	T	0.07279	0.0184	L	0.34521	1.04	0.09310	N	1	B;B	0.28512	0.214;0.214	B;B	0.22386	0.039;0.039	T	0.28522	-1.0041	10	0.62326	D	0.03	-0.5349	5.2512	0.15522	0.0:0.2476:0.0:0.7524	.	1086;1125	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	H	1125;1086	ENSP00000405012:Q1125H;ENSP00000368025:Q1086H	ENSP00000368025:Q1086H	Q	-	3	2	WDR87	43074051	0.002000	0.14202	0.002000	0.10522	0.003000	0.03518	-0.193000	0.09573	0.176000	0.19873	0.368000	0.22195	CAA	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.483	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	98	0	T	XM_940478		38382211	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	missense	12.64	76	11	SNP	0.002	G
XKR7	343702	genome.wustl.edu	37	20	30584921	30584921	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr20:30584921C>T	ENST00000562532.2	+	3	1575	c.1401C>T	c.(1399-1401)gaC>gaT	p.D467D		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	467						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CACCCGCTGACGCCATCACGA	0.667																																																	0													39.0	40.0	40.0					20																	30584921		2203	4300	6503	SO:0001819	synonymous_variant	0			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1401C>T	20.37:g.30584921C>T			Q9NUG5	Silent	SNP	pfam_Transport_prot_XK	p.D467	ENST00000562532.2	37	c.1401	CCDS33459.1	20																																																																																			XKR7	-	NULL	ENSG00000260903		0.667	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	HGNC	protein_coding	OTTHUMT00000078597.3	-	0.00	32	0	C	NM_001011718		30584921	+1	tier1	-	no_errors	ENST00000562532	ensembl	human	known	74_37	silent	18.52	22	5	SNP	0.971	T
ZBTB4	57659	genome.wustl.edu	37	17	7369066	7369066	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr17:7369066C>T	ENST00000311403.4	-	3	1394	c.1055G>A	c.(1054-1056)cGc>cAc	p.R352H	ZBTB4_ENST00000380599.4_Missense_Mutation_p.R352H	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	352					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		ATGCTTCGTGCGGTACTCCGC	0.602																																																	0													55.0	47.0	49.0					17																	7369066		2203	4300	6503	SO:0001583	missense	0			AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.1055G>A	17.37:g.7369066C>T	ENSP00000307858:p.Arg352His		B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R352H	ENST00000311403.4	37	c.1055	CCDS11107.1	17	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782610	0.90282	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.60548	0.18;0.18	5.63	5.63	0.86233	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.067836	0.64402	D	0.000016	T	0.67915	0.2944	L	0.31476	0.935	0.52099	D	0.999943	D	0.89917	1.0	D	0.91635	0.999	T	0.70490	-0.4857	10	0.72032	D	0.01	-15.5389	18.4556	0.90720	0.0:1.0:0.0:0.0	.	352	Q9P1Z0	ZBTB4_HUMAN	H	352	ENSP00000307858:R352H;ENSP00000369973:R352H	ENSP00000307858:R352H	R	-	2	0	ZBTB4	7309790	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.381000	0.79718	2.651000	0.90000	0.650000	0.86243	CGC	ZBTB4	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000174282		0.602	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB4	HGNC	protein_coding	OTTHUMT00000226940.2	-	0.00	42	0	C	NM_020899		7369066	-1	tier1	-	no_errors	ENST00000311403	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	T
ZBTB48	3104	genome.wustl.edu	37	1	6649261	6649262	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:6649261_6649262delTG	ENST00000377674.4	+	11	2214_2215	c.2056_2057delTG	c.(2056-2058)tgtfs	p.C686fs		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	686					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		CCCCGAGGACTGTGACACATAG	0.604																																					Esophageal Squamous(125;1449 1657 4031 29866 49542)												0																																										SO:0001589	frameshift_variant	0			BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.2056_2057delTG	1.37:g.6649263_6649264delTG	ENSP00000366902:p.Cys686fs		Q5SY19	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C686fs	ENST00000377674.4	37	c.2056_2057	CCDS84.1	1																																																																																			ZBTB48	-	NULL	ENSG00000204859		0.604	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB48	HGNC	protein_coding	OTTHUMT00000004193.1		0.00	25	0	TG	NM_005341		6649262	+1	tier1		no_errors	ENST00000377674	ensembl	human	known	74_37	frame_shift_del	25.81	23	8	DEL	0.977:0.997	-
ZDHHC11B	653082	genome.wustl.edu	37	5	716924	716924	+	Silent	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr5:716924C>T	ENST00000382776.4	-	10	1114	c.1115G>A	c.(1114-1116)tGa>tAa	p.*372*	ZDHHC11B_ENST00000522356.1_5'UTR|ZDHHC11B_ENST00000508859.2_Silent_p.*383*|ZDHHC11_ENST00000424784.2_Intron			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	0						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						ACCCGAATCTCAGTCTTCACT	0.408																																																	0																																										SO:0001819	synonymous_variant	0					5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.1115G>A	5.37:g.716924C>T			A6NHR3	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.*372	ENST00000382776.4	37	c.1115		5																																																																																			ZDHHC11B	-	NULL	ENSG00000206077		0.408	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	HGNC	protein_coding		-	0.00	280	0	C	XM_926053		716924	-1	tier1	-	no_errors	ENST00000382776	ensembl	human	known	74_37	silent	12.55	223	32	SNP	0.000	T
ZDHHC8	29801	genome.wustl.edu	37	22	20131087	20131087	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr22:20131087C>T	ENST00000334554.7	+	10	2075	c.1934C>T	c.(1933-1935)tCc>tTc	p.S645F	ZDHHC8_ENST00000405930.3_Missense_Mutation_p.S645F|ZDHHC8_ENST00000320602.7_Missense_Mutation_p.S553F	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	645					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					TCGTCCTCCTCCCTGCAGGCT	0.741																																																	0													21.0	22.0	22.0					22																	20131087		2184	4296	6480	SO:0001583	missense	0			AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.1934C>T	22.37:g.20131087C>T	ENSP00000334490:p.Ser645Phe		Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.S645F	ENST00000334554.7	37	c.1934	CCDS13776.1	22	.	.	.	.	.	.	.	.	.	.	.	14.75	2.627467	0.46944	.	.	ENSG00000099904	ENST00000334554;ENST00000320602;ENST00000405930	T;T;T	0.78126	0.89;-1.15;0.99	4.71	3.69	0.42338	.	0.688999	0.14052	N	0.344627	D	0.85801	0.5781	M	0.63843	1.955	0.58432	D	0.999999	P;B;D	0.76494	0.683;0.023;0.999	P;B;D	0.85130	0.469;0.032;0.997	D	0.84799	0.0783	10	0.72032	D	0.01	.	12.7128	0.57100	0.0:0.9194:0.0:0.0806	.	553;645;645	Q9ULC8-2;Q9ULC8-3;Q9ULC8	.;.;ZDHC8_HUMAN	F	645;553;645	ENSP00000334490:S645F;ENSP00000317804:S553F;ENSP00000384716:S645F	ENSP00000317804:S553F	S	+	2	0	ZDHHC8	18511087	1.000000	0.71417	0.987000	0.45799	0.094000	0.18550	7.411000	0.80078	0.973000	0.38340	0.467000	0.42956	TCC	ZDHHC8	-	NULL	ENSG00000099904		0.741	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC8	HGNC	protein_coding	OTTHUMT00000318564.1	-	0.00	73	0	C	NM_013373		20131087	+1	tier1	-	no_errors	ENST00000405930	ensembl	human	known	74_37	missense	13.21	46	7	SNP	1.000	T
ZFHX2	85446	genome.wustl.edu	37	14	23993569	23993569	+	Missense_Mutation	SNP	C	C	T	rs370465817		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr14:23993569C>T	ENST00000419474.3	-	9	5937	c.5582G>A	c.(5581-5583)cGc>cAc	p.R1861H	ZFHX2_ENST00000606808.1_5'Flank|RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1861					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						GATGGTGGTGCGCAGGCGCTT	0.612																																																	0																																										SO:0001583	missense	0			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.5582G>A	14.37:g.23993569C>T	ENSP00000413418:p.Arg1861His		Q9UPU6	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.R1861H	ENST00000419474.3	37	c.5582	CCDS55907.1	14	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115142	0.56505	.	.	ENSG00000136367	ENST00000419474	D	0.99167	-5.51	4.32	3.42	0.39159	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.159805	0.29830	N	0.011093	D	0.99468	0.9811	H	0.97214	3.96	0.40318	D	0.978791	D	0.89917	1.0	D	0.67103	0.949	D	0.98701	1.0700	10	0.72032	D	0.01	.	12.3901	0.55355	0.1701:0.8299:0.0:0.0	.	1861	Q9C0A1	ZFHX2_HUMAN	H	1861	ENSP00000413418:R1861H	ENSP00000413418:R1861H	R	-	2	0	ZFHX2	23063409	1.000000	0.71417	0.939000	0.37840	0.761000	0.43186	7.604000	0.82830	1.017000	0.39495	0.462000	0.41574	CGC	ZFHX2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000136367		0.612	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3		0.00	39	0	C	NM_014894		23993569	-1			no_errors	ENST00000419474	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.997	T
ZFP28	140612	genome.wustl.edu	37	19	57066743	57066743	+	Silent	SNP	C	C	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:57066743C>G	ENST00000301318.3	+	8	2660	c.2589C>G	c.(2587-2589)tcC>tcG	p.S863S	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	863					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GGAATCCATCCTCCCTCCCAT	0.458																																					Ovarian(124;554 1662 19430 21141 52494)												0													303.0	290.0	294.0					19																	57066743		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.2589C>G	19.37:g.57066743C>G			A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S863	ENST00000301318.3	37	c.2589	CCDS12946.1	19																																																																																			ZFP28	-	NULL	ENSG00000196867		0.458	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP28	HGNC	protein_coding	OTTHUMT00000458409.1	-	0.00	45	0	C	NM_020828		57066743	+1	tier1	-	no_errors	ENST00000301318	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.185	G
ZMYM6	9204	genome.wustl.edu	37	1	35496333	35496333	+	Intron	SNP	C	C	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr1:35496333C>A	ENST00000357182.4	-	2	154				ZMYM6_ENST00000317538.5_Intron|ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000487874.1_Intron|ZMYM6_ENST00000373333.1_Intron|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6						cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				CATACTCAGGCTTATTCTTTT	0.373																																																	0																																										SO:0001627	intron_variant	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.74-19G>T	1.37:g.35496333C>A			B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	RNA	SNP	-	NULL	ENST00000357182.4	37	NULL	CCDS387.2	1																																																																																			ZMYM6	-	-	ENSG00000163867		0.373	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	39	0	C	NM_007167		35496333	-1	tier1	-	no_errors	ENST00000493328	ensembl	human	known	74_37	rna	45.61	31	26	SNP	0.069	A
ZNF138	7697	genome.wustl.edu	37	7	64293635	64293635	+	3'UTR	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr7:64293635A>C	ENST00000359735.3	+	0	2191				ZNF138_ENST00000397136.2_3'UTR|ZNF138_ENST00000440598.1_3'UTR|ZNF138_ENST00000437743.1_3'UTR|ZNF138_ENST00000430838.2_3'UTR	NM_001271637.1|NM_001271639.1	NP_001258566.1|NP_001258568.1	P52744	ZN138_HUMAN	zinc finger protein 138						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(2)|stomach(1)	7		Lung NSC(55;0.0795)|all_lung(88;0.18)				ACAAATATGAAGAATGTGGTA	0.279																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U09847	CCDS34645.1, CCDS34645.2, CCDS55115.1, CCDS64659.1, CCDS64660.1, CCDS64661.1, CCDS75607.1	7q11.21	2013-01-08	2005-07-11		ENSG00000197008	ENSG00000197008		"""Zinc fingers, C2H2-type"", ""-"""	12922	protein-coding gene	gene with protein product		604080	"""zinc finger protein 138 (clone pHZ-32)"""				Standard	NM_006524		Approved	pHZ-32	uc031sxl.1	P52744	OTTHUMG00000156603	ENST00000359735.3:c.*1055A>C	7.37:g.64293635A>C			B4DFX2|B4DP87|E9PHI7|E9PHK7	RNA	SNP	-	NULL	ENST00000359735.3	37	NULL		7																																																																																			ZNF138	-	-	ENSG00000197008		0.279	ZNF138-201	KNOWN	basic	protein_coding	ZNF138	HGNC	protein_coding		-	0.00	36	0	A	NM_006524		64293635	+1	tier1	-	no_errors	ENST00000430838	ensembl	human	known	74_37	rna	20.75	42	11	SNP	0.003	C
ZNF280D	54816	genome.wustl.edu	37	15	56946582	56946582	+	Splice_Site	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr15:56946582C>T	ENST00000267807.7	-	18	2393		c.e18+1		ZNF280D_ENST00000559237.1_Splice_Site|ZNF280D_ENST00000559000.1_Splice_Site	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		CATATACGTACCTTTCTGCAT	0.323																																																	0													97.0	89.0	92.0					15																	56946582		2191	4290	6481	SO:0001630	splice_region_variant	0			AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.2176+1G>A	15.37:g.56946582C>T			A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Splice_Site	SNP	-	e16+1	ENST00000267807.7	37	c.2176+1	CCDS32245.1	15	.	.	.	.	.	.	.	.	.	.	C	10.60	1.395935	0.25205	.	.	ENSG00000137871	ENST00000267807;ENST00000455329	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6646	0.91485	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF280D	54733874	1.000000	0.71417	0.987000	0.45799	0.133000	0.20885	5.502000	0.66956	2.660000	0.90430	0.655000	0.94253	.	ZNF280D	-	-	ENSG00000137871		0.323	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF280D	HGNC	protein_coding	OTTHUMT00000418891.2	-	0.00	31	0	C	XM_370867	Intron	56946582	-1	tier1	-	no_errors	ENST00000267807	ensembl	human	known	74_37	splice_site	15.38	33	6	SNP	1.000	T
ZNF439	90594	genome.wustl.edu	37	19	11978920	11978920	+	Silent	SNP	A	A	C			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:11978920A>C	ENST00000304030.2	+	3	1236	c.1036A>C	c.(1036-1038)Aga>Cga	p.R346R	ZNF439_ENST00000592534.1_Intron|ZNF439_ENST00000455282.1_Silent_p.R210R	NM_152262.2	NP_689475.1	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	346					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						AACACACATAAGAATGCACTC	0.378																																																	0													92.0	93.0	92.0					19																	11978920		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000304030.2:c.1036A>C	19.37:g.11978920A>C			Q8IYZ7|Q96SU1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R346	ENST00000304030.2	37	c.1036	CCDS12268.1	19																																																																																			ZNF439	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171291		0.378	ZNF439-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF439	HGNC	protein_coding	OTTHUMT00000344513.1	-	0.00	80	0	A			11978920	+1	tier1	-	no_errors	ENST00000304030	ensembl	human	known	74_37	silent	17.74	51	11	SNP	0.027	C
ZNF44	51710	genome.wustl.edu	37	19	12384613	12384613	+	Missense_Mutation	SNP	G	G	A	rs375321557	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:12384613G>A	ENST00000356109.5	-	5	719	c.601C>T	c.(601-603)Cgc>Tgc	p.R201C	ZNF44_ENST00000355684.5_Missense_Mutation_p.R153C	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		AAGGAGTGGCGATAACTTAAG	0.428													G|||	2	0.000399361	0.0	0.0	5008	,	,		21613	0.0		0.0	False		,,,				2504	0.002																0								G	CYS/ARG,CYS/ARG	0,4398		0,0,2199	109.0	110.0	110.0		601,457	0.6	0.0	19		110	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense	ZNF44	NM_001164276.1,NM_016264.3	180,180	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	201/664,153/616	12384613	1,12991	2199	4297	6496	SO:0001583	missense	0			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.601C>T	19.37:g.12384613G>A	ENSP00000348419:p.Arg201Cys		B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R201C	ENST00000356109.5	37	c.601	CCDS54223.1	19	.	.	.	.	.	.	.	.	.	.	G	3.671	-0.067512	0.07273	0.0	1.16E-4	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.29917	1.55;1.55;3.2	0.645	0.645	0.17782	Zinc finger, C2H2 (1);	.	.	.	.	T	0.25269	0.0614	L	0.48362	1.52	.	.	.	B;P	0.47962	0.001;0.903	B;P	0.45138	0.001;0.471	T	0.24657	-1.0154	8	0.36615	T	0.2	.	3.6996	0.08378	0.0:0.0:0.5685:0.4315	.	201;153	P15621;F8W7T7	ZNF44_HUMAN;.	C	201;201;153;153	ENSP00000377008:R201C;ENSP00000348419:R201C;ENSP00000347910:R153C	ENSP00000347910:R153C	R	-	1	0	ZNF44	12245613	0.001000	0.12720	0.019000	0.16419	0.037000	0.13140	-0.304000	0.08199	0.641000	0.30601	0.205000	0.17691	CGC	ZNF44	-	pfscan_Znf_C2H2	ENSG00000197857		0.428	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	ZNF44	HGNC	protein_coding	OTTHUMT00000344132.1	-	0.00	115	0	G	NM_016264		12384613	-1	tier1	-	no_errors	ENST00000393337	ensembl	human	known	74_37	missense	8.87	113	11	SNP	0.004	A
ZNF521	25925	genome.wustl.edu	37	18	22804397	22804397	+	Missense_Mutation	SNP	C	C	T	rs146072050		TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr18:22804397C>T	ENST00000361524.3	-	4	3633	c.3485G>A	c.(3484-3486)cGa>cAa	p.R1162Q	ZNF521_ENST00000584787.1_Missense_Mutation_p.R942Q|ZNF521_ENST00000538137.2_Missense_Mutation_p.R1162Q	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1162					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.R1162L(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CACGAGCTCTCGGTGGATGGT	0.532			T	PAX5	ALL								C|||	1	0.000199681	0.0008	0.0	5008	,	,		19500	0.0		0.0	False		,,,				2504	0.0							Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	1	Substitution - Missense(1)	lung(1)						C	GLN/ARG	5,4401	9.9+/-24.2	0,5,2198	167.0	151.0	157.0		3485	6.0	1.0	18	dbSNP_134	157	0,8600		0,0,4300	yes	missense	ZNF521	NM_015461.2	43	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	probably-damaging	1162/1312	22804397	5,13001	2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3485G>A	18.37:g.22804397C>T	ENSP00000354794:p.Arg1162Gln		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1162Q	ENST00000361524.3	37	c.3485	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633548	0.47049	0.001135	0.0	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.09350	3.06;2.99	5.98	5.98	0.97165	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.11410	0.0278	N	0.24115	0.695	0.43835	D	0.996417	P	0.52692	0.955	B	0.43082	0.407	T	0.04360	-1.0957	10	0.37606	T	0.19	-14.8633	20.4581	0.99154	0.0:1.0:0.0:0.0	.	1162	Q96K83	ZN521_HUMAN	Q	1162;1196;1162	ENSP00000354794:R1162Q;ENSP00000382352:R1162Q	ENSP00000354794:R1162Q	R	-	2	0	ZNF521	21058395	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	5.713000	0.68415	2.835000	0.97688	0.650000	0.86243	CGA	ZNF521	-	pfscan_Znf_C2H2	ENSG00000198795		0.532	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	36	0	C	NM_015461		22804397	-1	tier1	rs146072050	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	33.33	30	15	SNP	1.000	T
ZNF536	9745	genome.wustl.edu	37	19	31038964	31038964	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:31038964C>T	ENST00000355537.3	+	4	2585	c.2438C>T	c.(2437-2439)tCt>tTt	p.S813F		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	813					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGGCCGCTGTCTGGGCAACCC	0.567																																																	0													68.0	75.0	73.0					19																	31038964		2203	4300	6503	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2438C>T	19.37:g.31038964C>T	ENSP00000347730:p.Ser813Phe		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S813F	ENST00000355537.3	37	c.2438	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	13.35	2.212306	0.39102	.	.	ENSG00000198597	ENST00000355537	T	0.10382	2.88	5.98	5.98	0.97165	.	0.103678	0.64402	D	0.000002	T	0.14743	0.0356	L	0.29908	0.895	0.50039	D	0.999844	D;D	0.53885	0.963;0.963	P;P	0.46585	0.521;0.521	T	0.00324	-1.1817	10	0.56958	D	0.05	-4.8845	20.4366	0.99092	0.0:1.0:0.0:0.0	.	813;813	A7E228;O15090	.;ZN536_HUMAN	F	813	ENSP00000347730:S813F	ENSP00000347730:S813F	S	+	2	0	ZNF536	35730804	1.000000	0.71417	0.586000	0.28679	0.045000	0.14185	7.455000	0.80726	2.837000	0.97791	0.591000	0.81541	TCT	ZNF536	-	NULL	ENSG00000198597		0.567	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	-	0.00	40	0	C	NM_014717		31038964	+1	tier1	-	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	18.42	31	7	SNP	1.000	T
ZNF720	124411	genome.wustl.edu	37	16	31766921	31766921	+	Intron	SNP	C	C	T	rs74726181	byFrequency	TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr16:31766921C>T	ENST00000316491.9	+	4	560				ZNF720_ENST00000534369.1_Intron|ZNF720_ENST00000531864.2_Intron|ZNF720_ENST00000539915.1_Intron|ZNF720_ENST00000399681.3_Nonsense_Mutation_p.R437*	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						AAACCTTAGACGACATCAGAT	0.368													C|||	13	0.00259585	0.0038	0.0029	5008	,	,		19285	0.0		0.005	False		,,,				2504	0.001																0																																										SO:0001627	intron_variant	0			AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.361+1700C>T	16.37:g.31766921C>T			Q6ZQX1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R437*	ENST00000316491.9	37	c.1309	CCDS45473.1	16	9	0.004120879120879121	3	0.006097560975609756	2	0.0055248618784530384	0	0.0	4	0.005277044854881266	c	23.3	4.394067	0.83011	.	.	ENSG00000197302	ENST00000399681	.	.	.	0.836	0.836	0.18891	.	.	.	.	.	.	.	.	.	.	.	0.39859	D	0.973348	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	3.0966	0.06312	0.0:0.6896:0.0:0.3104	.	.	.	.	X	437	.	ENSP00000440701:R437X	R	+	1	2	ZNF720	31674422	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-5.806000	0.00097	0.764000	0.33197	0.462000	0.41574	CGA	ZNF720	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197302		0.368	ZNF720-001	KNOWN	basic|CCDS	protein_coding	ZNF720	HGNC	protein_coding	OTTHUMT00000394883.3		0.00	39	0	C	NM_001004300		31766921	+1			no_errors	ENST00000399681	ensembl	human	known	74_37	nonsense	7.89	35	3	SNP	0.000	T
ZNF823	55552	genome.wustl.edu	37	19	11833223	11833223	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:11833223G>A	ENST00000341191.6	-	4	1279	c.1126C>T	c.(1126-1128)Cga>Tga	p.R376*	ZNF823_ENST00000545749.1_Nonsense_Mutation_p.R194*	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						ATGTGACTTCGAAAGCTCGAG	0.423										HNSCC(68;0.2)																																							0													107.0	112.0	110.0					19																	11833223		2203	4300	6503	SO:0001587	stop_gained	0			X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.1126C>T	19.37:g.11833223G>A	ENSP00000340683:p.Arg376*		A0PJL4|B7Z8D4|Q6P4A9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R376*	ENST00000341191.6	37	c.1126	CCDS45981.1	19	.	.	.	.	.	.	.	.	.	.	N	39	7.624046	0.98396	.	.	ENSG00000197933	ENST00000545749;ENST00000341191;ENST00000431998	.	.	.	0.632	0.632	0.17705	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	7.1241	0.25461	1.0E-4:0.0:0.9999:0.0	.	.	.	.	X	194;376;332	.	ENSP00000340683:R376X	R	-	1	2	ZNF823	11694223	0.000000	0.05858	0.005000	0.12908	0.793000	0.44817	0.502000	0.22594	0.618000	0.30179	0.298000	0.19748	CGA	ZNF823	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197933		0.423	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF823	HGNC	protein_coding	OTTHUMT00000344516.2	-	0.00	111	0	G	NM_001080493		11833223	-1	tier1	-	no_errors	ENST00000341191	ensembl	human	known	74_37	nonsense	19.39	77	19	SNP	0.001	A
ZNF814	730051	genome.wustl.edu	37	19	58385788	58385788	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FW-01A-31D-A31U-09	TCGA-Q9-A6FW-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bd8ca45f-20bb-436a-a6a2-352ecab2a6f9	dc525144-6ff0-4091-af35-bce44d680e37	g.chr19:58385788A>G	ENST00000435989.2	-	3	1204	c.970T>C	c.(970-972)Tat>Cat	p.Y324H	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	324					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CCACATTCATAAGGTCTTTTC	0.358																																																	0													15.0	12.0	13.0					19																	58385788		688	1564	2252	SO:0001583	missense	0				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.970T>C	19.37:g.58385788A>G	ENSP00000410545:p.Tyr324His		A6NF35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y324H	ENST00000435989.2	37	c.970	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	8.644	0.896732	0.17686	.	.	ENSG00000204514	ENST00000435989	T	0.21734	1.99	2.27	-1.27	0.09347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13970	0.0338	L	0.33485	1.01	0.09310	N	1	B	0.27498	0.18	B	0.22386	0.039	T	0.24368	-1.0162	9	0.72032	D	0.01	.	7.1587	0.25652	0.6135:0.0:0.3865:0.0	.	324	B7Z6K7	ZN814_HUMAN	H	324	ENSP00000410545:Y324H	ENSP00000410545:Y324H	Y	-	1	0	ZNF814	63077600	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	0.130000	0.15850	-0.181000	0.10619	0.113000	0.15668	TAT	ZNF814	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204514		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	-	0.00	115	0	A	XM_001725708		58385788	-1	tier1	-	no_errors	ENST00000435989	ensembl	human	known	74_37	missense	6.80	96	7	SNP	0.063	G
