#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA6	23460	genome.wustl.edu	37	17	67079107	67079107	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:67079107T>C	ENST00000284425.2	-	36	4697	c.4523A>G	c.(4522-4524)tAc>tGc	p.Y1508C	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1508	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					CTCTAGAATGTAATCCTTGCC	0.413																																																	0													205.0	209.0	207.0					17																	67079107		2203	4300	6503	SO:0001583	missense	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4523A>G	17.37:g.67079107T>C	ENSP00000284425:p.Tyr1508Cys		Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Y1508C	ENST00000284425.2	37	c.4523	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	T	19.87	3.907331	0.72868	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.95690	-3.78	5.27	5.27	0.74061	ABC transporter-like (1);	0.000000	0.47852	D	0.000209	D	0.97645	0.9228	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98368	1.0552	10	0.87932	D	0	.	14.8217	0.70077	0.0:0.0:0.0:1.0	.	1508	Q8N139	ABCA6_HUMAN	C	1508;368	ENSP00000284425:Y1508C	ENSP00000284425:Y1508C	Y	-	2	0	ABCA6	64590702	1.000000	0.71417	0.998000	0.56505	0.768000	0.43524	7.043000	0.76572	2.340000	0.79590	0.528000	0.53228	TAC	ABCA6	-	superfamily_P-loop_NTPase,pfscan_ABC_transporter-like	ENSG00000154262		0.413	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	-	0.00	61	0	T	NM_080284		67079107	-1	tier1	-	no_errors	ENST00000284425	ensembl	human	known	74_37	missense	18.75	39	9	SNP	1.000	C
ABCA6	23460	genome.wustl.edu	37	17	67081766	67081766	+	Splice_Site	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:67081766C>A	ENST00000284425.2	-	31	4203	c.4029G>T	c.(4027-4029)gaG>gaT	p.E1343D	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1343	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TCCTCACTACCTCTCCAGCAG	0.338																																																	0													93.0	82.0	85.0					17																	67081766		2203	4300	6503	SO:0001630	splice_region_variant	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4029+1G>T	17.37:g.67081766C>A			Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E1343D	ENST00000284425.2	37	c.4029	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967710	0.34754	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.94232	-3.38	4.66	3.69	0.42338	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.552015	0.16220	N	0.224083	D	0.90195	0.6935	L	0.33668	1.02	0.80722	D	1	B	0.30104	0.268	B	0.39339	0.297	D	0.85655	0.1285	9	.	.	.	.	12.2326	0.54497	0.0:0.917:0.0:0.083	.	1343	Q8N139	ABCA6_HUMAN	D	1343;203	ENSP00000284425:E1343D	.	E	-	3	2	ABCA6	64593361	1.000000	0.71417	0.999000	0.59377	0.053000	0.15095	3.961000	0.56759	1.323000	0.45263	-0.142000	0.14014	GAG	ABCA6	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154262		0.338	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1		0.00	23	0	C	NM_080284	Missense_Mutation	67081766	-1			no_errors	ENST00000284425	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
ABCC1	4363	genome.wustl.edu	37	16	16162052	16162052	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:16162052G>T	ENST00000399410.3	+	13	1892	c.1717G>T	c.(1717-1719)Gag>Tag	p.E573*	ABCC1_ENST00000346370.5_Nonsense_Mutation_p.E573*|ABCC1_ENST00000351154.5_Nonsense_Mutation_p.E573*|ABCC1_ENST00000399408.2_Nonsense_Mutation_p.E573*|ABCC1_ENST00000349029.5_Nonsense_Mutation_p.E573*|ABCC1_ENST00000345148.5_Nonsense_Mutation_p.E573*	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	573	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.E573K(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GACCATTGACGAGAACAACAT	0.547																																																	1	Substitution - Missense(1)	large_intestine(1)											191.0	187.0	188.0					16																	16162052		2125	4238	6363	SO:0001587	stop_gained	0			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1717G>T	16.37:g.16162052G>T	ENSP00000382342:p.Glu573*		A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.E573*	ENST00000399410.3	37	c.1717	CCDS42122.1	16	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119287	0.77323	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	.	.	.	4.46	-8.91	0.00778	.	0.699813	0.14910	N	0.291272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-1.5166	16.9821	0.86331	0.6509:0.0:0.3491:0.0	.	.	.	.	X	573;573;573;573;573;573;247	.	ENSP00000263014:E573X	E	+	1	0	ABCC1	16069553	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.809000	0.04510	-2.893000	0.00314	-1.836000	0.00589	GAG	ABCC1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	ENSG00000103222		0.547	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	HGNC	protein_coding	OTTHUMT00000109701.1		0.00	47	0	G	NM_004996		16162052	+1			no_errors	ENST00000399408	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	0.011	T
ACADL	33	genome.wustl.edu	37	2	211082784	211082785	+	Frame_Shift_Ins	INS	-	-	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:211082784_211082785insC	ENST00000233710.3	-	3	502_503	c.275_276insG	c.(274-276)aaafs	p.K92fs	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	92					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		GTTTTCCAGCTTTTTCCCAAAC	0.396																																																	0																																										SO:0001589	frameshift_variant	0			M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.275_276insG	2.37:g.211082784_211082785insC	ENSP00000233710:p.Lys92fs		B2R8T3|Q8IUN8	Frame_Shift_Ins	INS	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.A93fs	ENST00000233710.3	37	c.276_275	CCDS2389.1	2																																																																																			ACADL	-	pfam_AcylCoA_DH/ox_N,superfamily_AcylCoA_DH/oxidase_NM_dom	ENSG00000115361		0.396	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADL	HGNC	protein_coding	OTTHUMT00000256561.2		0.00	52	0	-	NM_001608		211082785	-1	tier1		no_errors	ENST00000233710	ensembl	human	known	74_37	frame_shift_ins	16.67	50	10	INS	1.000:1.000	C
ACADL	33	genome.wustl.edu	37	2	211082785	211082785	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:211082785T>C	ENST00000233710.3	-	3	502	c.275A>G	c.(274-276)aAa>aGa	p.K92R	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	92					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		TTTTCCAGCTTTTTCCCAAAC	0.393																																																	0													138.0	118.0	125.0					2																	211082785		2203	4300	6503	SO:0001583	missense	0			M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.275A>G	2.37:g.211082785T>C	ENSP00000233710:p.Lys92Arg		B2R8T3|Q8IUN8	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.K92R	ENST00000233710.3	37	c.275	CCDS2389.1	2	.	.	.	.	.	.	.	.	.	.	T	19.52	3.843023	0.71488	.	.	ENSG00000115361	ENST00000233710	D	0.99751	-6.63	5.41	5.41	0.78517	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99214	0.9727	M	0.62088	1.915	0.58432	D	0.999997	P	0.40909	0.732	B	0.40038	0.317	D	0.99835	1.1057	10	0.56958	D	0.05	.	15.4411	0.75184	0.0:0.0:0.0:1.0	.	92	P28330	ACADL_HUMAN	R	92	ENSP00000233710:K92R	ENSP00000233710:K92R	K	-	2	0	ACADL	210791030	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.396000	0.66297	2.060000	0.61445	0.455000	0.32223	AAA	ACADL	-	pfam_AcylCoA_DH/ox_N,superfamily_AcylCoA_DH/oxidase_NM_dom	ENSG00000115361		0.393	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADL	HGNC	protein_coding	OTTHUMT00000256561.2		0.00	51	0	T	NM_001608		211082785	-1			no_errors	ENST00000233710	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	C
ACSM5	54988	genome.wustl.edu	37	16	20448395	20448395	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:20448395G>T	ENST00000331849.4	+	11	1477	c.1330G>T	c.(1330-1332)Gca>Tca	p.A444S		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	444					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GAAGACAGCTGCATCAGAACA	0.507																																																	0													117.0	111.0	113.0					16																	20448395		2203	4300	6503	SO:0001583	missense	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1330G>T	16.37:g.20448395G>T	ENSP00000327916:p.Ala444Ser		Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.A444S	ENST00000331849.4	37	c.1330	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	G	2.517	-0.311555	0.05422	.	.	ENSG00000183549	ENST00000331849	T	0.40225	1.04	5.15	1.77	0.24775	AMP-dependent synthetase/ligase (1);	0.565592	0.17072	N	0.188139	T	0.24967	0.0606	L	0.31420	0.93	0.09310	N	1	B	0.10296	0.003	B	0.24155	0.051	T	0.23084	-1.0198	10	0.11485	T	0.65	-2.8661	5.369	0.16129	0.1772:0.0:0.5765:0.2464	.	444	Q6NUN0	ACSM5_HUMAN	S	444	ENSP00000327916:A444S	ENSP00000327916:A444S	A	+	1	0	ACSM5	20355896	0.000000	0.05858	0.001000	0.08648	0.460000	0.32559	0.027000	0.13621	0.610000	0.30035	-0.355000	0.07637	GCA	ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.507	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	-	0.00	91	0	G	NM_017888		20448395	+1	tier1	-	no_errors	ENST00000331849	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.000	T
ADAMTS19	171019	genome.wustl.edu	37	5	129037259	129037259	+	Missense_Mutation	SNP	G	G	A	rs377194418		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:129037259G>A	ENST00000274487.4	+	20	3260	c.3115G>A	c.(3115-3117)Gtg>Atg	p.V1039M	ADAMTS19_ENST00000509467.1_3'UTR|CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1039	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V1039M(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CTGCATGACCGTGTGGGAGGC	0.567																																																	1	Substitution - Missense(1)	kidney(1)						G	MET/VAL	0,4406		0,0,2203	73.0	68.0	69.0		3115	3.1	0.9	5		69	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADAMTS19	NM_133638.3	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1039/1208	129037259	1,13005	2203	4300	6503	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3115G>A	5.37:g.129037259G>A	ENSP00000274487:p.Val1039Met			Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.V1039M	ENST00000274487.4	37	c.3115	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667644	0.67814	0.0	1.16E-4	ENSG00000145808	ENST00000274487	T	0.19394	2.15	4.0	3.11	0.35812	.	0.000000	0.53938	D	0.000043	T	0.29126	0.0724	L	0.43152	1.355	0.46222	D	0.998939	D	0.65815	0.995	P	0.54312	0.748	T	0.03175	-1.1064	9	.	.	.	.	14.5487	0.68050	0.0:0.148:0.852:0.0	.	1039	Q8TE59	ATS19_HUMAN	M	1039	ENSP00000274487:V1039M	.	V	+	1	0	ADAMTS19	129065158	1.000000	0.71417	0.854000	0.33618	0.996000	0.88848	4.525000	0.60559	1.243000	0.43853	0.650000	0.86243	GTG	ADAMTS19	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000145808		0.567	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2		0.00	25	0	G	NM_133638		129037259	+1			no_errors	ENST00000274487	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.986	A
AKAP3	10566	genome.wustl.edu	37	12	4737626	4737626	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:4737626C>T	ENST00000545990.2	-	5	966	c.442G>A	c.(442-444)Gat>Aat	p.D148N	AKAP3_ENST00000228850.1_Missense_Mutation_p.D148N|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	148					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)	p.D148N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						TCAGAGCCATCGATCTTCTCA	0.453																																																	2	Substitution - Missense(2)	lung(2)											196.0	184.0	188.0					12																	4737626		2203	4300	6503	SO:0001583	missense	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.442G>A	12.37:g.4737626C>T	ENSP00000440994:p.Asp148Asn		O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.D148N	ENST00000545990.2	37	c.442	CCDS8531.1	12	.	.	.	.	.	.	.	.	.	.	C	5.244	0.230550	0.09969	.	.	ENSG00000111254	ENST00000228850;ENST00000545990;ENST00000540967	T;T;T	0.34275	3.35;3.35;1.37	4.76	2.89	0.33648	.	0.200393	0.35013	N	0.003501	T	0.25044	0.0608	L	0.36672	1.1	0.19300	N	0.99997	B	0.26195	0.144	B	0.18263	0.021	T	0.16070	-1.0415	10	0.49607	T	0.09	.	7.8469	0.29431	0.0:0.7405:0.169:0.0905	.	148	O75969	AKAP3_HUMAN	N	148	ENSP00000228850:D148N;ENSP00000440994:D148N;ENSP00000442376:D148N	ENSP00000228850:D148N	D	-	1	0	AKAP3	4607887	0.865000	0.29922	0.032000	0.17829	0.103000	0.19146	1.363000	0.34159	0.688000	0.31529	-0.137000	0.14449	GAT	AKAP3	-	smart_AKAP_110	ENSG00000111254		0.453	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2		0.00	53	0	C	NM_006422		4737626	-1			no_errors	ENST00000228850	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.397	T
ANKRD20A1	84210	genome.wustl.edu	37	9	67968379	67968379	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr9:67968379G>A	ENST00000377477.2	+	15	2050	c.1938G>A	c.(1936-1938)atG>atA	p.M646I	RP11-195B21.3_ENST00000417488.1_5'Flank	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1	646						plasma membrane (GO:0005886)		p.M646I(1)		kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						AAGTAGAAATGAGTTCTGCTA	0.343																																																	1	Substitution - Missense(1)	lung(1)											84.0	78.0	80.0					9																	67968379		2202	4292	6494	SO:0001583	missense	0			AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594	ENST00000377477.2:c.1938G>A	9.37:g.67968379G>A	ENSP00000366697:p.Met646Ile		Q9H0H6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.M646I	ENST00000377477.2	37	c.1938	CCDS6620.1	9	.	.	.	.	.	.	.	.	.	.	.	0.670	-0.802394	0.02841	.	.	ENSG00000196774	ENST00000377477	T	0.15603	2.41	1.88	0.916	0.19373	.	.	.	.	.	T	0.12518	0.0304	L	0.55990	1.75	0.19575	N	0.999969	B	0.32409	0.37	B	0.17098	0.017	T	0.26224	-1.0109	9	0.62326	D	0.03	.	3.5063	0.07692	0.4091:0.0:0.5909:0.0	.	646	Q5TYW2	A20A1_HUMAN	I	646	ENSP00000366697:M646I	ENSP00000366697:M646I	M	+	3	0	ANKRD20A1	67558199	0.988000	0.35896	0.073000	0.20177	0.004000	0.04260	0.573000	0.23699	1.071000	0.40834	0.109000	0.15622	ATG	ANKRD20A1	-	NULL	ENSG00000196774		0.343	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A1	HGNC	protein_coding	OTTHUMT00000083800.1	-	0.00	120	0	G			67968379	+1	tier1	-	no_errors	ENST00000377477	ensembl	human	known	74_37	missense	14.04	202	33	SNP	0.846	A
APOC3	345	genome.wustl.edu	37	11	116701311	116701311	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:116701311G>T	ENST00000227667.3	+	2	75	c.13G>T	c.(13-15)Gta>Tta	p.V5L	APOC3_ENST00000375345.1_Missense_Mutation_p.V23L|APOC3_ENST00000470144.1_3'UTR	NM_000040.1	NP_000031.1	P02656	APOC3_HUMAN	apolipoprotein C-III	5					cellular response to glucose stimulus (GO:0071333)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle remodeling (GO:0034375)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of cholesterol import (GO:0060621)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of high-density lipoprotein particle clearance (GO:0010987)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of triglyceride catabolic process (GO:0010897)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	cholesterol binding (GO:0015485)|enzyme regulator activity (GO:0030234)|high-density lipoprotein particle receptor binding (GO:0070653)|lipase inhibitor activity (GO:0055102)|phospholipid binding (GO:0005543)			endometrium(1)|lung(6)	7	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		GCAGCCCCGGGTACTCCTTGT	0.667																																					GBM(81;259 1650 7161 35190)												0													83.0	71.0	75.0					11																	116701311		2201	4296	6497	SO:0001583	missense	0			X01388	CCDS8377.1	11q23.3	2013-01-24			ENSG00000110245	ENSG00000110245		"""Apolipoproteins"""	610	protein-coding gene	gene with protein product		107720					Standard	NM_000040		Approved		uc001ppt.1	P02656	OTTHUMG00000046115	ENST00000227667.3:c.13G>T	11.37:g.116701311G>T	ENSP00000227667:p.Val5Leu		Q08E83|Q6Q786	Missense_Mutation	SNP	pfam_Apo-CIII	p.V5L	ENST00000227667.3	37	c.13	CCDS8377.1	11	.	.	.	.	.	.	.	.	.	.	G	9.563	1.119098	0.20877	.	.	ENSG00000110245	ENST00000433777;ENST00000227667;ENST00000375345	D;D;D	0.90324	-1.53;-2.61;-2.65	4.99	0.83	0.18854	.	0.735374	0.11009	N	0.609678	D	0.83280	0.5220	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.69083	-0.5239	9	0.40728	T	0.16	-13.0788	6.6568	0.22992	0.166:0.4012:0.4327:0.0	.	5	P02656	APOC3_HUMAN	L	5;5;23	ENSP00000410614:V5L;ENSP00000227667:V5L;ENSP00000364494:V23L	ENSP00000227667:V5L	V	+	1	0	APOC3	116206521	0.000000	0.05858	0.170000	0.22879	0.269000	0.26545	-0.054000	0.11826	-0.111000	0.12001	0.561000	0.74099	GTA	APOC3	-	pfam_Apo-CIII	ENSG00000110245		0.667	APOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOC3	HGNC	protein_coding	OTTHUMT00000106284.2	-	0.00	72	0	G	NM_000040		116701311	+1	tier1	-	no_errors	ENST00000227667	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.067	T
ARHGAP15	55843	genome.wustl.edu	37	2	144381722	144381722	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:144381722G>A	ENST00000295095.6	+	12	1191	c.1024G>A	c.(1024-1026)Gac>Aac	p.D342N		NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	342	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		GAATTTGGACGACAGCCAGTG	0.443																																																	0													89.0	85.0	87.0					2																	144381722		2203	4300	6503	SO:0001583	missense	0			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.1024G>A	2.37:g.144381722G>A	ENSP00000295095:p.Asp342Asn		Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.D342N	ENST00000295095.6	37	c.1024	CCDS2184.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.110598	0.97291	.	.	ENSG00000075884	ENST00000295095	T	0.20069	2.1	6.16	6.16	0.99307	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.051970	0.85682	D	0.000000	T	0.39860	0.1094	M	0.74258	2.255	0.58432	D	0.999999	D	0.57899	0.981	P	0.49301	0.606	T	0.19224	-1.0312	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	342	Q53QZ3	RHG15_HUMAN	N	342	ENSP00000295095:D342N	ENSP00000295095:D342N	D	+	1	0	ARHGAP15	144098192	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	GAC	ARHGAP15	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000075884		0.443	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP15	HGNC	protein_coding	OTTHUMT00000254793.2	-	0.00	68	0	G	NM_018460		144381722	+1	tier1	-	no_errors	ENST00000295095	ensembl	human	known	74_37	missense	25.40	47	16	SNP	1.000	A
ARHGAP36	158763	genome.wustl.edu	37	X	130220591	130220591	+	Missense_Mutation	SNP	G	G	A	rs180953681		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:130220591G>A	ENST00000276211.5	+	11	1783	c.1438G>A	c.(1438-1440)Gct>Act	p.A480T	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.A468T|ARHGAP36_ENST00000370921.1_Missense_Mutation_p.A344T	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	480					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GGAAACCTCTGCTGAAGCCCG	0.502																																																	0													100.0	89.0	93.0					X																	130220591		2203	4300	6503	SO:0001583	missense	0				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1438G>A	X.37:g.130220591G>A	ENSP00000276211:p.Ala480Thr		B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A480T	ENST00000276211.5	37	c.1438	CCDS14628.1	X	.	.	.	.	.	.	.	.	.	.	G	5.268	0.234887	0.09969	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.10763	2.84;2.84;2.85;2.86	4.32	3.44	0.39384	.	0.142087	0.32884	N	0.005530	T	0.05364	0.0142	N	0.08118	0	0.30426	N	0.777601	B;B;B	0.19331	0.035;0.035;0.02	B;B;B	0.17722	0.019;0.019;0.008	T	0.22765	-1.0207	10	0.21014	T	0.42	.	10.5637	0.45161	0.0:0.0:0.8059:0.1941	.	449;468;480	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	T	480;468;449;344	ENSP00000276211:A480T;ENSP00000359960:A468T;ENSP00000408515:A449T;ENSP00000359959:A344T	ENSP00000276211:A480T	A	+	1	0	ARHGAP36	130048272	1.000000	0.71417	0.999000	0.59377	0.527000	0.34593	1.716000	0.37981	1.131000	0.42111	0.594000	0.82650	GCT	ARHGAP36	-	NULL	ENSG00000147256		0.502	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP36	HGNC	protein_coding	OTTHUMT00000355073.1	-	0.00	31	0	G	NM_144967		130220591	+1	tier1	-	no_errors	ENST00000276211	ensembl	human	known	74_37	missense	33.33	16	8	SNP	1.000	A
ARHGAP44	9912	genome.wustl.edu	37	17	12823123	12823123	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:12823123C>T	ENST00000379672.5	+	6	739	c.439C>T	c.(439-441)Ctg>Ttg	p.L147L	ARHGAP44_ENST00000340825.3_Silent_p.L147L|MIR1269B_ENST00000580405.1_RNA|ARHGAP44_ENST00000262444.9_Silent_p.L147L	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	147	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						CAAGTTGGTGCTGGACATGGA	0.388																																																	0													109.0	103.0	105.0					17																	12823123		1876	4110	5986	SO:0001819	synonymous_variant	0				CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.439C>T	17.37:g.12823123C>T			A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Silent	SNP	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.L147	ENST00000379672.5	37	c.439	CCDS45616.1	17																																																																																			ARHGAP44	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000006740		0.388	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP44	HGNC	protein_coding	OTTHUMT00000441566.1	-	0.00	81	0	C	NM_014859		12823123	+1	tier1	-	no_errors	ENST00000379672	ensembl	human	known	74_37	silent	5.48	69	4	SNP	1.000	T
ATP6AP2	10159	genome.wustl.edu	37	X	40448252	40448252	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:40448252G>C	ENST00000378438.4	+	2	210	c.52G>C	c.(52-54)Gag>Cag	p.E18Q	ATP6AP2_ENST00000486558.1_Intron|ATP6AP2_ENST00000535539.1_Missense_Mutation_p.E18Q|ATP6AP2_ENST00000535777.1_Missense_Mutation_p.E18Q|ATP6AP2_ENST00000544975.1_Intron	NM_005765.2	NP_005756.2	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 2	18					angiotensin maturation (GO:0002003)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|eye pigmentation (GO:0048069)|head morphogenesis (GO:0060323)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of Wnt signaling pathway (GO:0030177)|proteolysis (GO:0006508)|regulation of MAPK cascade (GO:0043408)|rostrocaudal neural tube patterning (GO:0021903)	cell body (GO:0044297)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(2)	4						TTTGGGGAACGAGTTTAGTAT	0.378																																																	0													67.0	64.0	65.0					X																	40448252		2203	4300	6503	SO:0001583	missense	0			AF248966	CCDS14252.1	Xp11.4	2014-06-17	2003-08-28	2003-08-29	ENSG00000182220	ENSG00000182220			18305	protein-coding gene	gene with protein product	"""prorenin receptor"", ""renin receptor"""	300556	"""ATPase, H+ transporting, lysosomal interacting protein 2"""	ATP6IP2		9556572, 11590366	Standard	NM_005765		Approved	M8-9, APT6M8-9, ATP6M8-9, PRR, RENR	uc004det.3	O75787	OTTHUMG00000024103	ENST00000378438.4:c.52G>C	X.37:g.40448252G>C	ENSP00000367697:p.Glu18Gln		B7Z9I3|Q5QTQ7|Q6T7F5|Q8NBP3|Q8NG15|Q96FV6|Q96LB5|Q9H2P8|Q9UG89	Missense_Mutation	SNP	pfam_Renin_rcpt	p.E18Q	ENST00000378438.4	37	c.52	CCDS14252.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.04|14.04	2.418189|2.418189	0.42918|0.42918	.|.	.|.	ENSG00000182220|ENSG00000182220	ENST00000535539;ENST00000378438;ENST00000436783;ENST00000535777;ENST00000538655|ENST00000423649	T;T;T;T|.	0.74632|.	-0.86;1.38;0.78;-0.86|.	4.99|4.99	4.99|4.99	0.66335|0.66335	.|.	0.135681|.	0.56097|.	D|.	0.000035|.	T|T	0.59838|0.59838	0.2223|0.2223	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	P;P;B|.	0.39551|.	0.649;0.678;0.076|.	B;B;B|.	0.35073|.	0.195;0.145;0.026|.	T|T	0.57757|0.57757	-0.7756|-0.7756	10|5	0.13108|.	T|.	0.6|.	-11.9908|-11.9908	10.4772|10.4772	0.44672|0.44672	0.0923:0.0:0.9077:0.0|0.0923:0.0:0.9077:0.0	.|.	18;18;18|.	B7Z1I9;B7Z9I3;O75787|.	.;.;RENR_HUMAN|.	Q|P	18;18;50;18;18|36	ENSP00000438415:E18Q;ENSP00000367697:E18Q;ENSP00000403969:E50Q;ENSP00000441536:E18Q|.	ENSP00000367697:E18Q|.	E|R	+|+	1|2	0|0	ATP6AP2|ATP6AP2	40333196|40333196	1.000000|1.000000	0.71417|0.71417	0.937000|0.937000	0.37676|0.37676	0.983000|0.983000	0.72400|0.72400	4.096000|4.096000	0.57734|0.57734	2.213000|2.213000	0.71641|0.71641	0.529000|0.529000	0.55759|0.55759	GAG|CGA	ATP6AP2	-	NULL	ENSG00000182220		0.378	ATP6AP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6AP2	HGNC	protein_coding	OTTHUMT00000060679.1	-	0.00	21	0	G	NM_005765		40448252	+1	tier1	-	no_errors	ENST00000378438	ensembl	human	known	74_37	missense	28.95	27	11	SNP	0.990	C
ATXN2	6311	genome.wustl.edu	37	12	111957639	111957639	+	Intron	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:111957639G>C	ENST00000377617.3	-	8	1628				ATXN2_ENST00000550104.1_Intron|ATXN2_ENST00000542287.2_Intron|ATXN2_ENST00000549455.1_5'Flank|ATXN2_ENST00000608853.1_Intron|ATXN2_ENST00000535949.1_Intron|ATXN2_ENST00000389153.4_Intron	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2						cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						CACAGACCTTGAGTTGTGTAT	0.368																																																	0													109.0	99.0	102.0					12																	111957639		2203	4300	6503	SO:0001627	intron_variant	0			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1466+43C>G	12.37:g.111957639G>C			A6NLD4|Q6ZQZ7|Q99493	RNA	SNP	-	NULL	ENST00000377617.3	37	NULL	CCDS31902.1	12																																																																																			ATXN2	-	-	ENSG00000204842		0.368	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	-	0.00	33	0	G	NM_002973		111957639	-1	tier1	-	no_errors	ENST00000481331	ensembl	human	known	74_37	rna	21.88	25	7	SNP	0.671	C
AUH	549	genome.wustl.edu	37	9	93976300	93976300	+	3'UTR	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr9:93976300T>C	ENST00000375731.4	-	0	1373				AUH_ENST00000303617.5_3'UTR	NM_001698.2	NP_001689.1	Q13825	AUHM_HUMAN	AU RNA binding protein/enoyl-CoA hydratase						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enoyl-CoA hydratase activity (GO:0004300)|methylglutaconyl-CoA hydratase activity (GO:0004490)|mRNA 3'-UTR binding (GO:0003730)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11						ACAATCAATATTATTCCCTAG	0.234																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X79888	CCDS6689.1	9q22	2014-09-17	2010-04-30		ENSG00000148090	ENSG00000148090			890	protein-coding gene	gene with protein product		600529	"""AU RNA-binding protein/enoyl-Coenzyme A hydratase"", ""AU RNA binding protein/enoyl-Coenzyme A hydratase"""			7892223	Standard	NM_001698		Approved		uc004arf.4	Q13825	OTTHUMG00000020207	ENST00000375731.4:c.*330A>G	9.37:g.93976300T>C			B1ALV7|B1ALV8|Q8WUE4	RNA	SNP	-	NULL	ENST00000375731.4	37	NULL	CCDS6689.1	9																																																																																			AUH	-	-	ENSG00000148090		0.234	AUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUH	HGNC	protein_coding	OTTHUMT00000053032.1	-	0.00	51	0	T			93976300	-1	tier1	-	no_errors	ENST00000473695	ensembl	human	known	74_37	rna	20.18	87	22	SNP	0.926	C
BAI3	577	genome.wustl.edu	37	6	69646560	69646560	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:69646560G>T	ENST00000370598.1	+	5	1839	c.1018G>T	c.(1018-1020)Gcc>Tcc	p.A340S		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	340	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CAATAACACTGCCCTCTGTCC	0.453																																																	0													99.0	74.0	83.0					6																	69646560		2203	4300	6503	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1018G>T	6.37:g.69646560G>T	ENSP00000359630:p.Ala340Ser		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.A340S	ENST00000370598.1	37	c.1018	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341151	0.60963	.	.	ENSG00000135298	ENST00000370598	T	0.52526	0.66	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.37652	0.1011	L	0.58354	1.805	0.80722	D	1	B	0.25772	0.134	B	0.30179	0.112	T	0.23762	-1.0179	10	0.38643	T	0.18	.	19.2236	0.93808	0.0:0.0:1.0:0.0	.	340	O60242	BAI3_HUMAN	S	340	ENSP00000359630:A340S	ENSP00000359630:A340S	A	+	1	0	BAI3	69703281	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.786000	0.85741	2.545000	0.85829	0.585000	0.79938	GCC	BAI3	-	pfam_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000135298		0.453	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	56	0	G			69646560	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	T
BOD1L1	259282	genome.wustl.edu	37	4	13603449	13603449	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr4:13603449C>T	ENST00000040738.5	-	10	5210	c.5075G>A	c.(5074-5076)aGt>aAt	p.S1692N		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1692						nucleus (GO:0005634)	DNA binding (GO:0003677)										TGTTCCAGCACTTGTAACTGC	0.398																																																	0													204.0	225.0	218.0					4																	13603449		2203	4300	6503	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5075G>A	4.37:g.13603449C>T	ENSP00000040738:p.Ser1692Asn		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.S1692N	ENST00000040738.5	37	c.5075	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	21.7	4.193789	0.78902	.	.	ENSG00000038219	ENST00000040738	T	0.17528	2.27	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000004	T	0.33411	0.0862	L	0.36672	1.1	0.41121	D	0.985814	D	0.71674	0.998	D	0.78314	0.991	T	0.05451	-1.0884	10	0.48119	T	0.1	-7.5439	18.1927	0.89812	0.0:1.0:0.0:0.0	.	1692	Q8NFC6	BOD1L_HUMAN	N	1692	ENSP00000040738:S1692N	ENSP00000040738:S1692N	S	-	2	0	BOD1L	13212547	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.072000	0.64389	2.359000	0.80004	0.555000	0.69702	AGT	BOD1L1	-	NULL	ENSG00000038219		0.398	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	0.00	19	0	C	NM_148894		13603449	-1	tier1	-	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	T
BRAF	673	genome.wustl.edu	37	7	140501350	140501350	+	Missense_Mutation	SNP	G	G	A	rs387906660		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:140501350G>A	ENST00000288602.6	-	6	782	c.722C>T	c.(721-723)aCg>aTg	p.T241M		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	241			T -> M (in a patient with Noonan syndrome). {ECO:0000269|PubMed:19206169}.|T -> P (in CFC1 and LEOPARD3). {ECO:0000269|PubMed:18042262, ECO:0000269|PubMed:19206169}.|T -> R (in a patient with Noonan syndrome). {ECO:0000269|PubMed:19206169}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	GGTGAAAAACGTTTTTCGTAC	0.348		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)			Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	0													37.0	34.0	35.0					7																	140501350		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.722C>T	7.37:g.140501350G>A	ENSP00000288602:p.Thr241Met		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.T241M	ENST00000288602.6	37	c.722	CCDS5863.1	7	.	.	.	.	.	.	.	.	.	.	G	25.2	4.608871	0.87258	.	.	ENSG00000157764	ENST00000288602	D	0.93488	-3.23	5.17	5.17	0.71159	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.85682	D	0.000000	D	0.97651	0.9230	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.98730	1.0712	10	0.87932	D	0	.	18.6773	0.91532	0.0:0.0:1.0:0.0	.	241	P15056	BRAF_HUMAN	M	241	ENSP00000288602:T241M	ENSP00000288602:T241M	T	-	2	0	BRAF	140147819	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.809000	0.99208	2.407000	0.81776	0.561000	0.74099	ACG	BRAF	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_DAG/PE-bd	ENSG00000157764		0.348	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAF	HGNC	protein_coding	OTTHUMT00000348886.1	-	0.00	25	0	G	NM_004333		140501350	-1	tier1	-	no_errors	ENST00000288602	ensembl	human	known	74_37	missense	18.42	31	7	SNP	1.000	A
BSDC1	55108	genome.wustl.edu	37	1	32844434	32844434	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:32844434G>T	ENST00000455895.2	-	6	452	c.419C>A	c.(418-420)cCg>cAg	p.P140Q	BSDC1_ENST00000413080.1_Missense_Mutation_p.P140Q|BSDC1_ENST00000526031.1_Missense_Mutation_p.P45Q|BSDC1_ENST00000449308.1_Missense_Mutation_p.P140Q|BSDC1_ENST00000341071.7_Missense_Mutation_p.P157Q|BSDC1_ENST00000446293.2_Missense_Mutation_p.P157Q|BSDC1_ENST00000419121.2_Missense_Mutation_p.P84Q	NM_001143888.1|NM_018045.6	NP_001137360.1|NP_060515.3	Q9NW68	BSDC1_HUMAN	BSD domain containing 1	140										breast(1)|central_nervous_system(2)|kidney(1)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AAACAATTCCGGGGGCCCTGC	0.552																																																	0													20.0	20.0	20.0					1																	32844434		2194	4274	6468	SO:0001583	missense	0			BX641056	CCDS363.2, CCDS44101.1, CCDS44102.1, CCDS44103.1, CCDS72752.1	1p35.1	2008-02-05			ENSG00000160058	ENSG00000160058			25501	protein-coding gene	gene with protein product						12477932	Standard	XM_005270985		Approved	FLJ10276, RP4-811H24.7	uc010ohg.2	Q9NW68	OTTHUMG00000007588	ENST00000455895.2:c.419C>A	1.37:g.32844434G>T	ENSP00000412173:p.Pro140Gln		B4DMS7|B4DTI7|B4DTP7|B4E2X8|Q49AT8|Q68DY6|Q6IAA3|Q6MZK1|Q6UXS1|Q9HAL9	Missense_Mutation	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.P157Q	ENST00000455895.2	37	c.470	CCDS363.2	1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886633	0.51908	.	.	ENSG00000160058	ENST00000455895;ENST00000413080;ENST00000341071;ENST00000526031;ENST00000419121;ENST00000325745;ENST00000446293;ENST00000449308;ENST00000527163;ENST00000530485	.	.	.	5.75	3.9	0.45041	.	0.092204	0.85682	D	0.000000	T	0.49081	0.1536	L	0.38838	1.175	0.80722	D	1	B;B;B;B;B	0.33345	0.409;0.059;0.304;0.344;0.175	B;B;B;B;B	0.37239	0.244;0.108;0.23;0.166;0.216	T	0.44251	-0.9340	9	0.38643	T	0.18	-8.1257	12.3611	0.55203	0.1367:0.0:0.8633:0.0	.	45;84;157;157;140	Q9NW68-9;Q9NW68-8;Q9NW68-7;Q9NW68-3;Q9NW68	.;.;.;.;BSDC1_HUMAN	Q	140;140;157;45;84;140;157;140;74;101	.	ENSP00000317670:P140Q	P	-	2	0	BSDC1	32617021	0.993000	0.37304	1.000000	0.80357	0.965000	0.64279	2.234000	0.43035	0.927000	0.37143	-0.119000	0.15052	CCG	BSDC1	-	NULL	ENSG00000160058		0.552	BSDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSDC1	HGNC	protein_coding	OTTHUMT00000020056.3		0.00	62	0	G	NM_018045		32844434	-1			no_errors	ENST00000341071	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
C11orf80	79703	genome.wustl.edu	37	11	66555629	66555629	+	Splice_Site	SNP	A	A	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:66555629A>G	ENST00000360962.4	+	5	530		c.e5-1		C11orf80_ENST00000527368.1_Splice_Site|C11orf80_ENST00000346672.4_Splice_Site|C11orf80_ENST00000527634.1_Intron|C11orf80_ENST00000540737.1_Splice_Site|C11orf80_ENST00000532565.2_Splice_Site|C11orf80_ENST00000525449.2_Splice_Site	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80											autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						CTTCTCACACAGAAATACAGT	0.443																																																	0													74.0	69.0	70.0					11																	66555629		1868	4105	5973	SO:0001630	splice_region_variant	0					11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.524-1A>G	11.37:g.66555629A>G			Q9H677	Splice_Site	SNP	-	e5-2	ENST00000360962.4	37	c.524-2	CCDS53664.1	11	.	.	.	.	.	.	.	.	.	.	A	15.44	2.833589	0.50951	.	.	ENSG00000173715	ENST00000525908;ENST00000360962;ENST00000346672;ENST00000528340;ENST00000540737;ENST00000525449	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7953	0.52096	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C11orf80	66312205	0.999000	0.42202	0.974000	0.42286	0.913000	0.54294	4.086000	0.57664	2.053000	0.61076	0.533000	0.62120	.	C11orf80	-	-	ENSG00000173715		0.443	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C11orf80	HGNC	protein_coding			0.00	62	0	A	NM_024650	Intron	66555629	+1			no_errors	ENST00000360962	ensembl	human	known	74_37	splice_site	6.49	72	5	SNP	0.996	G
C16orf45	89927	genome.wustl.edu	37	16	15680909	15680909	+	3'UTR	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:15680909C>T	ENST00000300006.4	+	0	1197				C16orf45_ENST00000566490.1_3'UTR|C16orf45_ENST00000452191.2_3'UTR|C16orf45_ENST00000565913.1_3'UTR	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						CCAGAGCATGCCGAACCCAGG	0.567																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.*223C>T	16.37:g.15680909C>T			O00223|O75769|Q8IZ36|Q96H25	RNA	SNP	-	NULL	ENST00000300006.4	37	NULL	CCDS10561.1	16																																																																																			C16orf45	-	-	ENSG00000166780		0.567	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf45	HGNC	protein_coding	OTTHUMT00000252130.2	-	0.00	86	0	C	NM_033201		15680909	+1	tier1	-	no_errors	ENST00000565913	ensembl	human	known	74_37	rna	13.21	46	7	SNP	0.997	T
C1orf74	148304	genome.wustl.edu	37	1	209956627	209956627	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:209956627G>T	ENST00000294811.1	-	2	609	c.353C>A	c.(352-354)tCc>tAc	p.S118Y		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	118										endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		CTGGCAGCTGGAAACATCCAC	0.537																																																	0													57.0	54.0	55.0					1																	209956627		2203	4300	6503	SO:0001583	missense	0			AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.353C>A	1.37:g.209956627G>T	ENSP00000294811:p.Ser118Tyr			Missense_Mutation	SNP	NULL	p.S118Y	ENST00000294811.1	37	c.353	CCDS1491.1	1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781536	0.49891	.	.	ENSG00000162757	ENST00000294811	T	0.48836	0.8	5.61	5.61	0.85477	.	0.253476	0.39834	N	0.001255	T	0.68174	0.2972	M	0.67953	2.075	0.44771	D	0.997773	D	0.76494	0.999	D	0.69479	0.964	T	0.69881	-0.5025	10	0.72032	D	0.01	-38.5549	19.2273	0.93822	0.0:0.0:1.0:0.0	.	118	Q96LT6	CA074_HUMAN	Y	118	ENSP00000294811:S118Y	ENSP00000294811:S118Y	S	-	2	0	C1orf74	208023250	0.997000	0.39634	0.973000	0.42090	0.208000	0.24298	4.977000	0.63792	2.652000	0.90054	0.655000	0.94253	TCC	C1orf74	-	NULL	ENSG00000162757		0.537	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf74	HGNC	protein_coding	OTTHUMT00000088745.1	-	0.00	30	0	G	NM_152485		209956627	-1	tier1	-	no_errors	ENST00000294811	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.996	T
C4orf26	152816	genome.wustl.edu	37	4	76489432	76489432	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr4:76489432C>A	ENST00000311623.4	+	2	211	c.176C>A	c.(175-177)aCa>aAa	p.T59K	C4orf26_ENST00000435974.2_Missense_Mutation_p.Q74K	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26	59						extracellular region (GO:0005576)				kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AGTCCGGTCACAAGGGCCCAG	0.527																																																	0													96.0	98.0	97.0					4																	76489432		2203	4300	6503	SO:0001583	missense	0			AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.176C>A	4.37:g.76489432C>A	ENSP00000311307:p.Thr59Lys		B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	NULL	p.T59K	ENST00000311623.4	37	c.176	CCDS3569.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.61|10.61	1.399039|1.399039	0.25291|0.25291	.|.	.|.	ENSG00000174792|ENSG00000174792	ENST00000435974|ENST00000311623	T|T	0.44482|0.37752	0.92|1.18	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	.|0.000000	.|0.52532	.|D	.|0.000070	T|T	0.47507|0.47507	0.1449|0.1449	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	P|D	0.38677|0.89917	0.642|1.0	B|D	0.35278|0.87578	0.199|0.998	T|T	0.35748|0.35748	-0.9776|-0.9776	8|10	.|0.87932	.|D	.|0	.|.	13.8181|13.8181	0.63303|0.63303	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	74|59	E7ETQ0|Q17RF5	.|CD026_HUMAN	K|K	74|59	ENSP00000406925:Q74K|ENSP00000311307:T59K	.|ENSP00000311307:T59K	Q|T	+|+	1|2	0|0	C4orf26|C4orf26	76708456|76708456	0.512000|0.512000	0.26186|0.26186	0.079000|0.079000	0.20413|0.20413	0.013000|0.013000	0.08279|0.08279	1.950000|1.950000	0.40323|0.40323	2.720000|2.720000	0.93068|0.93068	0.644000|0.644000	0.83932|0.83932	CAA|ACA	C4orf26	-	NULL	ENSG00000174792		0.527	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf26	HGNC	protein_coding	OTTHUMT00000252410.1	-	0.00	57	0	C	NM_178497		76489432	+1	tier1	-	no_errors	ENST00000311623	ensembl	human	known	74_37	missense	15.00	51	9	SNP	0.152	A
C8orf46	254778	genome.wustl.edu	37	8	67417674	67417674	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:67417674G>A	ENST00000305454.3	+	3	632	c.191G>A	c.(190-192)cGc>cAc	p.R64H	C8orf46_ENST00000482608.2_3'UTR|C8orf46_ENST00000522977.1_Missense_Mutation_p.R64H|C8orf46_ENST00000480005.1_Missense_Mutation_p.R64H|C8orf46_ENST00000521495.1_Missense_Mutation_p.R64H	NM_152765.3	NP_689978.2	Q8TAG6	CH046_HUMAN	chromosome 8 open reading frame 46	64										endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(2)	6			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CGCGGAGACCGCAGGGACCCT	0.721																																																	0													10.0	14.0	13.0					8																	67417674		2166	4220	6386	SO:0001583	missense	0			BC028400	CCDS6191.2	8q13.1	2005-08-09			ENSG00000169085	ENSG00000169085			28498	protein-coding gene	gene with protein product						12477932	Standard	NM_152765		Approved	MGC33510	uc003xwg.3	Q8TAG6	OTTHUMG00000156998	ENST00000305454.3:c.191G>A	8.37:g.67417674G>A	ENSP00000302260:p.Arg64His		B2RDC3|B4DFU4|C9J814|C9JCS3	Missense_Mutation	SNP	NULL	p.R64H	ENST00000305454.3	37	c.191	CCDS6191.2	8	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493101	0.64186	.	.	ENSG00000169085	ENST00000305454;ENST00000521495;ENST00000522977;ENST00000480005	.	.	.	5.62	2.87	0.33458	.	0.261400	0.34268	N	0.004117	T	0.47893	0.1470	L	0.32530	0.975	0.09310	N	1	D;B	0.76494	0.999;0.002	D;B	0.80764	0.994;0.003	T	0.27905	-1.0060	9	0.48119	T	0.1	-0.8901	8.2296	0.31590	0.2503:0.0:0.7497:0.0	.	64;64	Q8TAG6-2;Q8TAG6	.;CH046_HUMAN	H	64	.	ENSP00000302260:R64H	R	+	2	0	C8orf46	67580228	0.035000	0.19736	0.391000	0.26233	0.576000	0.36127	0.621000	0.24418	0.413000	0.25759	0.655000	0.94253	CGC	C8orf46	-	NULL	ENSG00000169085		0.721	C8orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf46	HGNC	protein_coding	OTTHUMT00000347010.1	-	0.00	33	0	G	NM_152765		67417674	+1	tier1	-	no_errors	ENST00000305454	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.029	A
CADPS2	93664	genome.wustl.edu	37	7	122033528	122033528	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:122033528C>G	ENST00000449022.2	-	21	2874	c.2855G>C	c.(2854-2856)aGa>aCa	p.R952T	CADPS2_ENST00000412584.2_Missense_Mutation_p.R946T|RP5-1101C3.1_ENST00000591140.1_RNA|CADPS2_ENST00000334010.7_Missense_Mutation_p.R950T|RP5-1101C3.1_ENST00000593910.1_RNA|CADPS2_ENST00000313070.7_Missense_Mutation_p.R946T	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	952	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						CTCAAAACCTCTGTGAATTGA	0.458																																																	0													154.0	148.0	150.0					7																	122033528		1973	4171	6144	SO:0001583	missense	0				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.2855G>C	7.37:g.122033528C>G	ENSP00000398481:p.Arg952Thr		A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,pfam_Pleckstrin_homology,superfamily_C2_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R952T	ENST00000449022.2	37	c.2855	CCDS55158.1	7	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.86|15.86|15.86	2.959007|2.959007|2.959007	0.53400|0.53400|0.53400	.|.|.	.|.|.	ENSG00000081803|ENSG00000081803|ENSG00000081803	ENST00000462699|ENST00000397721|ENST00000360097;ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022	.|.|T;T;T;T	.|.|0.33438	.|.|1.41;1.41;1.41;1.41	5.63|5.63|5.63	5.63|5.63|5.63	0.86233|0.86233|0.86233	.|.|Munc13 homology 1 (1);	.|.|0.055774	.|.|0.64402	.|.|D	.|.|0.000001	T|T|T	0.34745|0.34745|0.34745	0.0908|0.0908|0.0908	L|L|L	0.59436|0.59436|0.59436	1.845|1.845|1.845	0.49213|0.49213|0.49213	D|D|D	0.999767|0.999767|0.999767	.|.|P;P;P;B	.|.|0.40909	.|.|0.732;0.609;0.732;0.135	.|.|B;B;B;B	.|.|0.41666	.|.|0.283;0.363;0.264;0.059	T|T|T	0.13575|0.13575|0.13575	-1.0504|-1.0504|-1.0504	5|5|10	.|.|0.72032	.|.|D	.|.|0.01	-21.798|-21.798|-21.798	13.2787|13.2787|13.2787	0.60202|0.60202|0.60202	0.0:0.9274:0.0:0.0726|0.0:0.9274:0.0:0.0726|0.0:0.9274:0.0:0.0726	.|.|.	.|.|956;946;952;946	.|.|B7ZM57;Q86UW7-2;Q86UW7;Q86UW7-3	.|.|.;.;CAPS2_HUMAN;.	Q|H|T	146|594|125;946;950;957;913;946;952	.|.|ENSP00000325581:R946T;ENSP00000333940:R950T;ENSP00000400401:R946T;ENSP00000398481:R952T	.|.|ENSP00000325581:R946T	E|Q|R	-|-|-	1|3|2	0|2|0	CADPS2|CADPS2|CADPS2	121820764|121820764|121820764	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.999000|0.999000|0.999000	0.98932|0.98932|0.98932	4.019000|4.019000|4.019000	0.57181|0.57181|0.57181	2.805000|2.805000|2.805000	0.96524|0.96524|0.96524	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAG|CAG|AGA	CADPS2	-	NULL	ENSG00000081803		0.458	CADPS2-001	KNOWN	basic|CCDS	protein_coding	CADPS2	HGNC	protein_coding	OTTHUMT00000347414.2	-	0.00	80	0	C	NM_017954		122033528	-1	tier1	-	no_errors	ENST00000449022	ensembl	human	known	74_37	missense	22.58	48	14	SNP	1.000	G
CAPRIN1	4076	genome.wustl.edu	37	11	34093524	34093524	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:34093524T>C	ENST00000341394.4	+	4	545	c.356T>C	c.(355-357)cTa>cCa	p.L119P	CAPRIN1_ENST00000389645.3_Missense_Mutation_p.L119P|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.L119P|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.L38P|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.L119P	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	119					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TTCATGGCACTAAGTCAAGAT	0.333																																																	0													61.0	64.0	63.0					11																	34093524		2202	4298	6500	SO:0001583	missense	0			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.356T>C	11.37:g.34093524T>C	ENSP00000340329:p.Leu119Pro		A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	pfam_Caprin-1_C	p.L119P	ENST00000341394.4	37	c.356	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	T	21.7	4.186531	0.78789	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000534825;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79;1.79	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.53384	0.1793	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.58901	-0.7554	10	0.87932	D	0	-3.9003	15.6424	0.77016	0.0:0.0:0.0:1.0	.	119;119	Q14444;Q14444-2	CAPR1_HUMAN;.	P	119;119;119;119;119;38	ENSP00000340329:L119P;ENSP00000374296:L119P;ENSP00000431373:L119P;ENSP00000434150:L119P;ENSP00000434204:L119P;ENSP00000431581:L38P	ENSP00000340329:L119P	L	+	2	0	CAPRIN1	34050100	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.621000	0.83083	2.084000	0.62774	0.460000	0.39030	CTA	CAPRIN1	-	NULL	ENSG00000135387		0.333	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2	-	0.00	71	0	T	NM_005898		34093524	+1	tier1	-	no_errors	ENST00000341394	ensembl	human	known	74_37	missense	12.86	122	18	SNP	1.000	C
CATSPERB	79820	genome.wustl.edu	37	14	92191436	92191436	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:92191436G>T	ENST00000256343.3	-	3	312	c.156C>A	c.(154-156)ttC>ttA	p.F52L		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	52					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				AGTTTTCTAAGAAAAGATACA	0.308																																																	0													66.0	60.0	62.0					14																	92191436		2201	4295	6496	SO:0001583	missense	0			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.156C>A	14.37:g.92191436G>T	ENSP00000256343:p.Phe52Leu		A0AV51	Missense_Mutation	SNP	superfamily_Sialidases	p.F52L	ENST00000256343.3	37	c.156	CCDS32142.1	14	.	.	.	.	.	.	.	.	.	.	G	12.00	1.805387	0.31961	.	.	ENSG00000133962	ENST00000256343;ENST00000553329;ENST00000554560;ENST00000556661;ENST00000553676	T	0.40756	1.02	5.0	-0.543	0.11851	.	1.515350	0.04018	N	0.299345	T	0.27063	0.0663	L	0.36672	1.1	0.09310	N	1	B	0.15141	0.012	B	0.16289	0.015	T	0.07712	-1.0758	10	0.11794	T	0.64	-2.0295	0.9022	0.01277	0.2801:0.1594:0.3971:0.1635	.	52	Q9H7T0	CTSRB_HUMAN	L	52	ENSP00000256343:F52L	ENSP00000256343:F52L	F	-	3	2	CATSPERB	91261189	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.184000	0.09698	-0.014000	0.14175	0.650000	0.86243	TTC	CATSPERB	-	NULL	ENSG00000133962		0.308	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	HGNC	protein_coding	OTTHUMT00000411769.1	-	0.00	29	0	G	NM_024764		92191436	-1	tier1	-	no_errors	ENST00000256343	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.001	T
CCDC112	153733	genome.wustl.edu	37	5	114615389	114615389	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:114615389G>T	ENST00000512261.1	-	4	483	c.67C>A	c.(67-69)Cta>Ata	p.L23I	CCDC112_ENST00000395557.4_Missense_Mutation_p.L23I|CCDC112_ENST00000506442.1_Missense_Mutation_p.L23I|CCDC112_ENST00000503027.1_5'UTR|CCDC112_ENST00000379611.5_Missense_Mutation_p.L106I			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	23										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		AATTCTTCTAGCATACTATGC	0.299																																																	0													126.0	114.0	118.0					5																	114615389		2202	4298	6500	SO:0001583	missense	0			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.67C>A	5.37:g.114615389G>T	ENSP00000423712:p.Leu23Ile		Q6A334	Missense_Mutation	SNP	superfamily_Homeodomain-like	p.L106I	ENST00000512261.1	37	c.316	CCDS4117.1	5	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854815	0.71719	.	.	ENSG00000164221	ENST00000379611;ENST00000512261;ENST00000506442;ENST00000395557	T;T;T;T	0.28255	1.94;1.62;1.66;1.62	5.4	3.34	0.38264	.	0.074783	0.53938	D	0.000042	T	0.41534	0.1163	L	0.53249	1.67	0.31058	N	0.714402	D;D;D	0.61697	0.974;0.99;0.99	P;P;P	0.59424	0.747;0.857;0.857	T	0.33979	-0.9847	10	0.40728	T	0.16	-8.1249	10.0981	0.42488	0.0833:0.0:0.775:0.1417	.	23;106;23	D6RF76;Q8NEF3-2;Q8NEF3	.;.;CC112_HUMAN	I	106;23;23;23	ENSP00000368931:L106I;ENSP00000423712:L23I;ENSP00000424876:L23I;ENSP00000378925:L23I	ENSP00000368931:L106I	L	-	1	2	CCDC112	114643288	0.998000	0.40836	1.000000	0.80357	0.981000	0.71138	1.996000	0.40776	2.550000	0.86006	0.460000	0.39030	CTA	CCDC112	-	NULL	ENSG00000164221		0.299	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CCDC112	HGNC	protein_coding	OTTHUMT00000370999.1		0.00	20	0	G	NM_152549		114615389	-1			no_errors	ENST00000379611	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.982	T
CCDC94	55702	genome.wustl.edu	37	19	4262016	4262016	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:4262016C>T	ENST00000262962.7	+	6	681	c.613C>T	c.(613-615)Cga>Tga	p.R205*		NM_018074.4	NP_060544.2	Q9BW85	CCD94_HUMAN	coiled-coil domain containing 94	205										NS(1)|endometrium(1)|lung(2)|ovary(1)|stomach(2)	7				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0348)|STAD - Stomach adenocarcinoma(1328;0.183)		AGCCAGAAAGCGAAGACTGCT	0.622																																																	0													86.0	74.0	78.0					19																	4262016		2203	4300	6503	SO:0001587	stop_gained	0			AK001236	CCDS12124.1	19p13.3	2008-02-05				ENSG00000105248			25518	protein-coding gene	gene with protein product						12477932	Standard	NM_018074		Approved	FLJ10374	uc002lzv.4	Q9BW85		ENST00000262962.7:c.613C>T	19.37:g.4262016C>T	ENSP00000262962:p.Arg205*		O75270|Q9H862|Q9NW16	Nonsense_Mutation	SNP	pfam_CWC16	p.R205*	ENST00000262962.7	37	c.613	CCDS12124.1	19	.	.	.	.	.	.	.	.	.	.	C	17.51	3.406541	0.62399	.	.	ENSG00000105248	ENST00000262962	.	.	.	4.47	-0.395	0.12431	.	0.254049	0.36519	N	0.002555	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-16.0819	3.0543	0.06179	0.4526:0.311:0.1475:0.0889	.	.	.	.	X	205	.	ENSP00000262962:R205X	R	+	1	2	CCDC94	4213016	0.002000	0.14202	0.000000	0.03702	0.098000	0.18820	1.006000	0.29847	-0.092000	0.12417	-0.552000	0.04208	CGA	CCDC94	-	pfam_CWC16	ENSG00000105248		0.622	CCDC94-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC94	HGNC	protein_coding	OTTHUMT00000458007.2		0.00	53	0	C	NM_018074		4262016	+1			no_errors	ENST00000262962	ensembl	human	known	74_37	nonsense	8.33	33	3	SNP	0.000	T
CCDC151	115948	genome.wustl.edu	37	19	11531819	11531819	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:11531819G>A	ENST00000356392.4	-	12	1739	c.1652C>T	c.(1651-1653)gCc>gTc	p.A551V	CCDC151_ENST00000545100.1_Missense_Mutation_p.A497V|CCDC151_ENST00000591179.1_Missense_Mutation_p.A491V|RGL3_ENST00000393423.3_5'Flank|CCDC151_ENST00000586836.1_Missense_Mutation_p.A360V|RGL3_ENST00000380456.3_5'Flank	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	551										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						CTTGGAAGTGGCAAGGGGCAG	0.602																																																	0													49.0	51.0	51.0					19																	11531819		1931	4128	6059	SO:0001583	missense	0				CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.1652C>T	19.37:g.11531819G>A	ENSP00000348757:p.Ala551Val		B4DXT0|Q96CG5	Missense_Mutation	SNP	NULL	p.A551V	ENST00000356392.4	37	c.1652	CCDS42501.1	19	.	.	.	.	.	.	.	.	.	.	G	11.16	1.555743	0.27827	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	T;T	0.15017	2.46;2.67	4.46	-1.43	0.08884	.	0.669254	0.12781	N	0.439655	T	0.10078	0.0247	L	0.37750	1.13	0.09310	N	1	B;B;B	0.20671	0.047;0.047;0.047	B;B;B	0.19946	0.027;0.027;0.027	T	0.31475	-0.9942	10	0.27082	T	0.32	-2.3288	3.1809	0.06584	0.2602:0.0:0.4558:0.2839	.	551;551;531	B3KPH7;A5D8V7;B4DG09	.;CC151_HUMAN;.	V	497;551;530	ENSP00000442987:A497V;ENSP00000348757:A551V	ENSP00000348757:A551V	A	-	2	0	CCDC151	11392819	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.066000	0.14489	0.241000	0.21283	-0.367000	0.07326	GCC	CCDC151	-	NULL	ENSG00000198003		0.602	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC151	HGNC	protein_coding	OTTHUMT00000458800.1	-	0.00	78	0	G	NM_145045		11531819	-1	tier1	-	no_errors	ENST00000356392	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.000	A
CD6	923	genome.wustl.edu	37	11	60783215	60783215	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:60783215C>A	ENST00000313421.7	+	9	1604	c.1418C>A	c.(1417-1419)cCg>cAg	p.P473Q	CD6_ENST00000346437.4_Intron|CD6_ENST00000344028.5_Missense_Mutation_p.P441Q|CD6_ENST00000352009.5_Missense_Mutation_p.P441Q|CD6_ENST00000452451.2_Intron	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	473					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						GTCCAGGCCCCGCCCCCTGAG	0.597																																					Pancreas(169;904 2017 4767 38890 42505)												0													113.0	115.0	114.0					11																	60783215		2203	4299	6502	SO:0001583	missense	0				CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1418C>A	11.37:g.60783215C>A	ENSP00000323280:p.Pro473Gln		A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.P473Q	ENST00000313421.7	37	c.1418	CCDS7999.1	11	.	.	.	.	.	.	.	.	.	.	C	6.698	0.497379	0.12762	.	.	ENSG00000013725	ENST00000344028;ENST00000313421;ENST00000433107;ENST00000352009	T;T;T;T	0.01406	4.95;4.95;5.04;4.93	5.22	1.15	0.20763	.	0.835619	0.09771	N	0.758051	T	0.01765	0.0056	L	0.51422	1.61	0.22666	N	0.998871	B;B;B	0.31503	0.326;0.028;0.219	B;B;B	0.31337	0.128;0.01;0.06	T	0.46317	-0.9200	10	0.45353	T	0.12	.	4.5134	0.11923	0.1653:0.5838:0.0:0.2509	.	441;473;473	P30203-4;P30203;Q8N4Q7	.;CD6_HUMAN;.	Q	441;473;340;441	ENSP00000344108:P441Q;ENSP00000323280:P473Q;ENSP00000410638:P340Q;ENSP00000340628:P441Q	ENSP00000323280:P473Q	P	+	2	0	CD6	60539791	0.000000	0.05858	0.030000	0.17652	0.172000	0.22775	-1.848000	0.01673	-0.046000	0.13446	0.655000	0.94253	CCG	CD6	-	NULL	ENSG00000013725		0.597	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD6	HGNC	protein_coding	OTTHUMT00000396449.1		0.00	39	0	C	NM_006725		60783215	+1			no_errors	ENST00000313421	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.144	A
CEP152	22995	genome.wustl.edu	37	15	49052391	49052391	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr15:49052391G>T	ENST00000380950.2	-	19	2822	c.2635C>A	c.(2635-2637)Ctt>Att	p.L879I	CEP152_ENST00000399334.3_Missense_Mutation_p.L879I|CEP152_ENST00000325747.5_Missense_Mutation_p.L786I	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	879					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		GCCTTCACAAGTGCTTGATAC	0.458																																																	0													150.0	149.0	150.0					15																	49052391		1923	4127	6050	SO:0001583	missense	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.2635C>A	15.37:g.49052391G>T	ENSP00000370337:p.Leu879Ile		E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	NULL	p.L879I	ENST00000380950.2	37	c.2635	CCDS58361.1	15	.	.	.	.	.	.	.	.	.	.	G	6.674	0.492877	0.12702	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.52983	0.64;0.65;0.65	4.66	1.57	0.23409	.	1.046430	0.07436	N	0.896475	T	0.37999	0.1024	L	0.51422	1.61	0.09310	N	1	B;B;P	0.37864	0.302;0.231;0.61	B;B;B	0.33620	0.167;0.082;0.154	T	0.25916	-1.0118	10	0.37606	T	0.19	0.802	5.7933	0.18373	0.1658:0.0:0.6045:0.2298	.	786;879;879	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	I	879;786;879	ENSP00000370337:L879I;ENSP00000321000:L786I;ENSP00000382271:L879I	ENSP00000321000:L786I	L	-	1	0	CEP152	46839683	0.000000	0.05858	0.008000	0.14137	0.593000	0.36681	0.777000	0.26718	0.576000	0.29452	0.655000	0.94253	CTT	CEP152	-	NULL	ENSG00000103995		0.458	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1		0.00	63	0	G	NM_014985		49052391	-1			no_errors	ENST00000380950	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.000	T
CFDP1	10428	genome.wustl.edu	37	16	75327731	75327732	+	3'UTR	INS	-	-	A	rs149574560		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:75327731_75327732insA	ENST00000283882.3	-	0	1150_1151					NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1						cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						CTTCAATGTAGAAAAAAAAAAG	0.307																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.*119->T	16.37:g.75327741_75327741dupA			O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	RNA	INS	-	NULL	ENST00000283882.3	37	NULL	CCDS10916.1	16																																																																																			CFDP1	-	-	ENSG00000153774		0.307	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFDP1	HGNC	protein_coding	OTTHUMT00000269031.2		0.00	20	0	-	NM_006324		75327732	-1	tier1		no_errors	ENST00000570103	ensembl	human	known	74_37	rna	8.89	41	4	INS	0.904:0.940	A
CHRNA4	1137	genome.wustl.edu	37	20	61987390	61987390	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr20:61987390T>C	ENST00000370263.4	-	4	541	c.320A>G	c.(319-321)aAt>aGt	p.N107S	CHRNA4_ENST00000463705.1_Intron	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	107					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GGAGGTGACATTCTCATAGTC	0.622																																																	0													54.0	46.0	49.0					20																	61987390		2201	4296	6497	SO:0001583	missense	0				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.320A>G	20.37:g.61987390T>C	ENSP00000359285:p.Asn107Ser		Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.N107S	ENST00000370263.4	37	c.320	CCDS13517.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.0|25.0	4.591249|4.591249	0.86851|0.86851	.|.	.|.	ENSG00000101204|ENSG00000101204	ENST00000539366|ENST00000370263	.|T	.|0.79247	.|-1.25	4.19|4.19	4.19|4.19	0.49359|0.49359	.|Neurotransmitter-gated ion-channel ligand-binding (3);	.|0.192470	.|0.44902	.|U	.|0.000416	D|D	0.83492|0.83492	0.5266|0.5266	M|M	0.81497|0.81497	2.545|2.545	0.58432|0.58432	D|D	0.999995|0.999995	B|P	0.20261|0.51933	0.043|0.949	B|P	0.19946|0.51777	0.027|0.679	D|D	0.86194|0.86194	0.1614|0.1614	7|10	.|0.72032	.|D	.|0.01	.|.	13.2418|13.2418	0.60002|0.60002	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	3|107	Q4VAQ5|P43681	.|ACHA4_HUMAN	V|S	3|107	.|ENSP00000359285:N107S	.|ENSP00000359285:N107S	M|N	-|-	1|2	0|0	CHRNA4|CHRNA4	61457834|61457834	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.904000|0.904000	0.53231|0.53231	6.013000|6.013000	0.70776|0.70776	1.515000|1.515000	0.48885|0.48885	0.363000|0.363000	0.22086|0.22086	ATG|AAT	CHRNA4	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,tigrfam_Neur_channel	ENSG00000101204		0.622	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	HGNC	protein_coding	OTTHUMT00000080508.3	-	0.00	52	0	T			61987390	-1	tier1	-	no_errors	ENST00000370263	ensembl	human	known	74_37	missense	18.18	63	14	SNP	1.000	C
CLEC14A	161198	genome.wustl.edu	37	14	38724781	38724781	+	Silent	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:38724781G>A	ENST00000342213.2	-	1	793	c.447C>T	c.(445-447)acC>acT	p.T149T		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	149	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		CGACCCCACCGGTGGCCTGGA	0.677																																																	0													31.0	31.0	31.0					14																	38724781		2203	4294	6497	SO:0001819	synonymous_variant	0				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.447C>T	14.37:g.38724781G>A			Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.T149	ENST00000342213.2	37	c.447	CCDS9667.1	14																																																																																			CLEC14A	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000176435		0.677	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC14A	HGNC	protein_coding	OTTHUMT00000276729.1	-	0.00	43	0	G	NM_175060		38724781	-1	tier1	-	no_errors	ENST00000342213	ensembl	human	known	74_37	silent	10.87	41	5	SNP	0.041	A
CLMN	79789	genome.wustl.edu	37	14	95690143	95690143	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:95690143C>T	ENST00000298912.4	-	3	307	c.194G>A	c.(193-195)gGc>gAc	p.G65D		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	65	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		TAGGATTTTGCCATCTTGTAT	0.418																																																	0													110.0	112.0	111.0					14																	95690143		2203	4300	6503	SO:0001583	missense	0			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.194G>A	14.37:g.95690143C>T	ENSP00000298912:p.Gly65Asp		B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.G65D	ENST00000298912.4	37	c.194	CCDS9933.1	14	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685548	0.88639	.	.	ENSG00000165959	ENST00000298912	D	0.95171	-3.63	4.97	4.97	0.65823	Calponin homology domain (5);	0.000000	0.41823	D	0.000804	D	0.98460	0.9487	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99814	1.1043	10	0.87932	D	0	.	18.1818	0.89780	0.0:1.0:0.0:0.0	.	65	Q96JQ2	CLMN_HUMAN	D	65	ENSP00000298912:G65D	ENSP00000298912:G65D	G	-	2	0	CLMN	94759896	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.316000	0.72857	2.451000	0.82905	0.561000	0.74099	GGC	CLMN	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000165959		0.418	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2		0.00	43	0	C			95690143	-1			no_errors	ENST00000298912	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
CMYA5	202333	genome.wustl.edu	37	5	79025904	79025904	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:79025904C>T	ENST00000446378.2	+	2	1347	c.1316C>T	c.(1315-1317)gCg>gTg	p.A439V		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	439					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CTGGAGGCAGCGTCACCAGGT	0.493																																																	0													80.0	80.0	80.0					5																	79025904		2203	4300	6503	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.1316C>T	5.37:g.79025904C>T	ENSP00000394770:p.Ala439Val		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.A439V	ENST00000446378.2	37	c.1316	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	c	10.70	1.423250	0.25639	.	.	ENSG00000164309	ENST00000446378	T	0.36878	1.23	5.38	-10.8	0.00216	.	27.852700	0.00604	N	0.000392	T	0.16300	0.0392	N	0.14661	0.345	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.13737	-1.0498	10	0.44086	T	0.13	.	2.8712	0.05617	0.2047:0.3295:0.0831:0.3827	.	439	Q8N3K9	CMYA5_HUMAN	V	439	ENSP00000394770:A439V	ENSP00000394770:A439V	A	+	2	0	CMYA5	79061660	0.025000	0.19082	0.000000	0.03702	0.013000	0.08279	0.100000	0.15231	-2.874000	0.00322	-2.648000	0.00150	GCG	CMYA5	-	NULL	ENSG00000164309		0.493	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	60	0	C	NM_153610		79025904	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.000	T
COL4A6	1288	genome.wustl.edu	37	X	107422508	107422508	+	Silent	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:107422508G>T	ENST00000372216.4	-	26	2395	c.2295C>A	c.(2293-2295)ggC>ggA	p.G765G	COL4A6_ENST00000545689.1_Silent_p.G764G|COL4A6_ENST00000334504.7_Silent_p.G764G|COL4A6_ENST00000538570.1_Silent_p.G764G|COL4A6_ENST00000394872.2_Silent_p.G765G	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	765	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						ATCCTTGTAGGCCTTGTTCCC	0.493									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												0													109.0	89.0	96.0					X																	107422508		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2295C>A	X.37:g.107422508G>T			Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G765	ENST00000372216.4	37	c.2295	CCDS14541.1	X																																																																																			COL4A6	-	pfam_Collagen	ENSG00000197565		0.493	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	-	0.00	66	0	G			107422508	-1	tier1	-	no_errors	ENST00000372216	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.889	T
CPAMD8	27151	genome.wustl.edu	37	19	17108037	17108037	+	Missense_Mutation	SNP	C	C	A	rs369025323		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:17108037C>A	ENST00000443236.1	-	11	1151	c.1120G>T	c.(1120-1122)Ggg>Tgg	p.G374W	CPAMD8_ENST00000388925.4_Missense_Mutation_p.G327W	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	327						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TGCTGGCTCCCGTCCACACTG	0.642																																																	0													27.0	28.0	27.0					19																	17108037		1905	4069	5974	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1120G>T	19.37:g.17108037C>A	ENSP00000402505:p.Gly374Trp		Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.G374W	ENST00000443236.1	37	c.1120	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	c	14.86	2.660450	0.47572	.	.	ENSG00000160111	ENST00000291440;ENST00000388925	T;T	0.58652	0.32;0.33	3.0	3.0	0.34707	.	0.703445	0.12215	N	0.488942	T	0.78978	0.4369	M	0.86651	2.83	0.51482	D	0.999929	D	0.89917	1.0	D	0.97110	1.0	T	0.81344	-0.0975	10	0.72032	D	0.01	.	14.3086	0.66400	0.0:1.0:0.0:0.0	.	327	Q8IZJ3	CPMD8_HUMAN	W	374;327	ENSP00000291440:G374W;ENSP00000373577:G327W	ENSP00000291440:G374W	G	-	1	0	CPAMD8	16969037	1.000000	0.71417	0.596000	0.28811	0.174000	0.22865	6.398000	0.73244	1.423000	0.47198	0.555000	0.69702	GGG	CPAMD8	-	NULL	ENSG00000160111		0.642	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	-	0.00	34	0	C	NM_015692		17108037	-1	tier1	-	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	A
CTNNA1	1495	genome.wustl.edu	37	5	138145894	138145894	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:138145894G>T	ENST00000302763.7	+	4	558		c.e4+1		CTNNA1_ENST00000355078.5_Splice_Site|CTNNA1_ENST00000518825.1_Splice_Site	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa						adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GCTGAAAGTTGTAAGTATACA	0.423																																																	0													92.0	90.0	90.0					5																	138145894		2203	4300	6503	SO:0001630	splice_region_variant	0			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.468+1G>T	5.37:g.138145894G>T			Q12795|Q8N1C0	Splice_Site	SNP	-	e3+1	ENST00000302763.7	37	c.468+1	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774279	0.90108	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000518910;ENST00000537034;ENST00000541863;ENST00000518245;ENST00000520158;ENST00000518825	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9593	0.92671	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CTNNA1	138173793	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.813000	0.99286	2.645000	0.89757	0.655000	0.94253	.	CTNNA1	-	-	ENSG00000044115		0.423	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	-	0.00	47	0	G	NM_001903	Intron	138145894	+1	tier1	-	no_errors	ENST00000302763	ensembl	human	known	74_37	splice_site	8.51	43	4	SNP	1.000	T
CTSD	1509	genome.wustl.edu	37	11	1780814	1780814	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:1780814A>C	ENST00000236671.2	-	3	416	c.284T>G	c.(283-285)gTc>gGc	p.V95G	AC068580.6_ENST00000449248.1_RNA|RP11-295K3.1_ENST00000427721.1_5'Flank	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	95					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CGTGTCGAAGACGACTGTGAA	0.657																																																	0													64.0	63.0	63.0					11																	1780814		2202	4299	6501	SO:0001583	missense	0			M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.284T>G	11.37:g.1780814A>C	ENSP00000236671:p.Val95Gly		Q6IB57	Missense_Mutation	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.V95G	ENST00000236671.2	37	c.284	CCDS7725.1	11	.	.	.	.	.	.	.	.	.	.	a	19.92	3.915533	0.73098	.	.	ENSG00000117984	ENST00000236671;ENST00000438213;ENST00000367196	T;T;T	0.60548	0.18;0.18;0.18	4.2	3.06	0.35304	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.208574	0.39985	N	0.001211	D	0.82572	0.5066	H	0.98370	4.215	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.86021	0.1507	10	0.87932	D	0	.	9.1828	0.37152	0.9121:0.0:0.0879:0.0	.	95	P07339	CATD_HUMAN	G	95;80;60	ENSP00000236671:V95G;ENSP00000415036:V80G;ENSP00000356164:V60G	ENSP00000236671:V95G	V	-	2	0	CTSD	1737390	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	4.567000	0.60850	1.676000	0.50930	0.398000	0.26397	GTC	CTSD	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	ENSG00000117984		0.657	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSD	HGNC	protein_coding	OTTHUMT00000104272.5	-	0.00	166	0	A	NM_001909		1780814	-1	tier1	-	no_errors	ENST00000236671	ensembl	human	known	74_37	missense	13.10	126	19	SNP	1.000	C
CTNND1	1500	genome.wustl.edu	37	11	57575878	57575878	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:57575878G>T	ENST00000399050.4	+	14	2644	c.2108G>T	c.(2107-2109)cGc>cTc	p.R703L	CTNND1_ENST00000524630.1_Missense_Mutation_p.R697L|CTNND1_ENST00000530748.1_Missense_Mutation_p.R649L|CTNND1_ENST00000529526.1_Missense_Mutation_p.R643L|CTNND1_ENST00000527467.1_Missense_Mutation_p.R380L|CTNND1_ENST00000529873.1_Missense_Mutation_p.R643L|CTNND1_ENST00000426142.2_Missense_Mutation_p.R596L|CTNND1_ENST00000428599.2_Missense_Mutation_p.R697L|CTNND1_ENST00000532245.1_Missense_Mutation_p.R596L|CTNND1_ENST00000361796.4_Missense_Mutation_p.R697L|CTNND1_ENST00000526357.1_Missense_Mutation_p.R643L|CTNND1_ENST00000361332.4_Missense_Mutation_p.R697L|CTNND1_ENST00000528232.1_Missense_Mutation_p.R602L|CTNND1_ENST00000529986.1_Missense_Mutation_p.R596L|CTNND1_ENST00000531014.1_Missense_Mutation_p.R374L|CTNND1_ENST00000534579.1_Missense_Mutation_p.R643L|CTNND1_ENST00000526938.1_Missense_Mutation_p.R703L|CTNND1_ENST00000530094.1_Missense_Mutation_p.R596L|CTNND1_ENST00000529919.1_Missense_Mutation_p.R703L|CTNND1_ENST00000415361.2_Missense_Mutation_p.R602L|CTNND1_ENST00000526772.1_Missense_Mutation_p.R374L|CTNND1_ENST00000525902.1_Missense_Mutation_p.R380L|CTNND1_ENST00000532844.1_Missense_Mutation_p.R649L|CTNND1_ENST00000532649.1_Missense_Mutation_p.R643L|CTNND1_ENST00000528621.1_Missense_Mutation_p.R643L|CTNND1_ENST00000358694.6_Missense_Mutation_p.R697L|CTNND1_ENST00000361391.6_Missense_Mutation_p.R697L|CTNND1_ENST00000532787.1_Missense_Mutation_p.R596L|CTNND1_ENST00000399039.4_Missense_Mutation_p.R703L|CTNND1_ENST00000532463.1_Missense_Mutation_p.R596L|CTNND1_ENST00000360682.6_Missense_Mutation_p.R703L|CTNND1_ENST00000533667.1_Missense_Mutation_p.R374L	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	703					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				CGATACATCCGCTCTGCTCTG	0.448																																																	0													119.0	120.0	120.0					11																	57575878		1996	4176	6172	SO:0001583	missense	0			AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2108G>T	11.37:g.57575878G>T	ENSP00000382004:p.Arg703Leu		A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R703L	ENST00000399050.4	37	c.2108	CCDS44604.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.273104	0.95429	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6	5.44	5.44	0.79542	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83653	0.5301	M	0.68952	2.095	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.999;0.998;0.998;0.998;0.985;0.998;0.999	D	0.85034	0.0919	10	0.87932	D	0	-3.9308	18.8697	0.92308	0.0:0.0:1.0:0.0	.	703;697;703;596;643;643;697;703;703	O60716-3;O60716-2;O60716;O60716-18;O60716-14;O60716-10;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.;.;.;.	L	697;703;703;703;697;643;596;703;697;697;596;596;697;596;374;643;643;649;697;380;602;374;374;643;380;649;643;596;602;596;643;703	ENSP00000436543:R697L;ENSP00000434808:R703L;ENSP00000381996:R703L;ENSP00000353902:R703L;ENSP00000354907:R697L;ENSP00000436323:R643L;ENSP00000409930:R596L;ENSP00000382004:R703L;ENSP00000354785:R697L;ENSP00000354823:R697L;ENSP00000432075:R596L;ENSP00000437156:R596L;ENSP00000351527:R697L;ENSP00000434949:R596L;ENSP00000437051:R374L;ENSP00000435379:R643L;ENSP00000432243:R643L;ENSP00000436744:R649L;ENSP00000413586:R697L;ENSP00000434900:R380L;ENSP00000435266:R602L;ENSP00000432623:R374L;ENSP00000433158:R374L;ENSP00000435494:R643L;ENSP00000434672:R380L;ENSP00000433276:R649L;ENSP00000433334:R643L;ENSP00000437327:R596L;ENSP00000403518:R602L;ENSP00000434017:R596L;ENSP00000435789:R643L;ENSP00000432041:R703L	ENSP00000351527:R697L	R	+	2	0	CTNND1	57332454	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.476000	0.97823	2.570000	0.86706	0.467000	0.42956	CGC	CTNND1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000198561		0.448	CTNND1-006	KNOWN	basic|CCDS	protein_coding	CTNND1	HGNC	protein_coding	OTTHUMT00000393944.1	-	0.00	75	0	G	NM_001331		57575878	+1	tier1	-	no_errors	ENST00000399050	ensembl	human	known	74_37	missense	13.89	61	10	SNP	1.000	T
CTTNBP2	83992	genome.wustl.edu	37	7	117431583	117431583	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:117431583G>T	ENST00000160373.3	-	4	1758	c.1667C>A	c.(1666-1668)cCt>cAt	p.P556H	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	556	Pro-rich.				brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TGGTGGAGAAGGAGTTTGGGA	0.512																																																	0													115.0	124.0	121.0					7																	117431583		2203	4300	6503	SO:0001583	missense	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1667C>A	7.37:g.117431583G>T	ENSP00000160373:p.Pro556His		O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P556H	ENST00000160373.3	37	c.1667	CCDS5774.1	7	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960735	0.74016	.	.	ENSG00000077063	ENST00000160373	T	0.79247	-1.25	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.90452	0.7010	M	0.89478	3.035	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.91668	0.5348	10	0.87932	D	0	0.219	19.6369	0.95737	0.0:0.0:1.0:0.0	.	556	Q8WZ74	CTTB2_HUMAN	H	556	ENSP00000160373:P556H	ENSP00000160373:P556H	P	-	2	0	CTTNBP2	117218819	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.420000	0.97426	2.717000	0.92951	0.563000	0.77884	CCT	CTTNBP2	-	NULL	ENSG00000077063		0.512	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4		0.00	53	0	G	NM_033427		117431583	-1			no_errors	ENST00000160373	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
CUBN	8029	genome.wustl.edu	37	10	17156080	17156080	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr10:17156080G>C	ENST00000377833.4	-	8	894	c.829C>G	c.(829-831)Ctt>Gtt	p.L277V		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	277	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CACTGCACAAGTGTGGAGCAA	0.587																																																	0													70.0	52.0	58.0					10																	17156080		2203	4300	6503	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.829C>G	10.37:g.17156080G>C	ENSP00000367064:p.Leu277Val		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.L277V	ENST00000377833.4	37	c.829	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	10.69	1.420109	0.25552	.	.	ENSG00000107611	ENST00000377833	D	0.91945	-2.94	5.64	4.72	0.59763	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.757763	0.10766	N	0.636603	D	0.89469	0.6724	L	0.31926	0.97	0.32812	D	0.501627	P	0.44521	0.837	B	0.43331	0.416	D	0.89033	0.3443	10	0.41790	T	0.15	.	15.491	0.75605	0.0697:0.0:0.9303:0.0	.	277	O60494	CUBN_HUMAN	V	277	ENSP00000367064:L277V	ENSP00000367064:L277V	L	-	1	0	CUBN	17196086	0.715000	0.27946	0.148000	0.22405	0.130000	0.20726	4.060000	0.57477	2.816000	0.96949	0.563000	0.77884	CTT	CUBN	-	pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000107611		0.587	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	-	0.00	59	0	G	NM_001081		17156080	-1	tier1	-	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	14.63	35	6	SNP	0.170	C
CYP2C9	1559	genome.wustl.edu	37	10	96698578	96698578	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr10:96698578A>G	ENST00000260682.6	+	1	151	c.139A>G	c.(139-141)Att>Gtt	p.I47V	CYP2C9_ENST00000461906.1_3'UTR	NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	47					arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	ACAGATAGGTATTAAGGACAT	0.423																																					Ovarian(54;1266 1406 16072 35076)												0													112.0	112.0	112.0					10																	96698578		2203	4300	6503	SO:0001583	missense	0			M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.139A>G	10.37:g.96698578A>G	ENSP00000260682:p.Ile47Val		P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.I47V	ENST00000260682.6	37	c.139	CCDS7437.1	10	.	.	.	.	.	.	.	.	.	.	.	1.949	-0.441641	0.04604	.	.	ENSG00000138109	ENST00000545448;ENST00000260682	T	0.67523	-0.27	3.7	-4.96	0.03038	.	0.493390	0.17640	U	0.167049	T	0.25232	0.0613	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31668	-0.9935	10	0.12430	T	0.62	.	2.2219	0.03974	0.5308:0.1403:0.1879:0.1411	.	47;47;47	Q5VX92;P11712;Q8WW80	.;CP2C9_HUMAN;.	V	47	ENSP00000260682:I47V	ENSP00000260682:I47V	I	+	1	0	CYP2C9	96688568	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.811000	0.01728	-0.864000	0.04078	0.402000	0.26972	ATT	CYP2C9	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000138109		0.423	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C9	HGNC	protein_coding	OTTHUMT00000049501.1	-	0.00	52	0	A	NM_000771		96698578	+1	tier1	-	no_errors	ENST00000260682	ensembl	human	known	74_37	missense	15.07	62	11	SNP	0.000	G
DAPK2	23604	genome.wustl.edu	37	15	64215512	64215512	+	Intron	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr15:64215512G>A	ENST00000457488.1	-	9	889				DAPK2_ENST00000261891.3_Intron|DAPK2_ENST00000558069.1_Missense_Mutation_p.R297W	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2						anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		TCTGTCTTCCGCTGTTCAGGG	0.532																																																	0																																										SO:0001627	intron_variant	0			AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.858+1502C>T	15.37:g.64215512G>A			E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R297W	ENST00000457488.1	37	c.889	CCDS10188.1	15																																																																																			DAPK2	-	superfamily_Kinase-like_dom	ENSG00000035664		0.532	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK2	HGNC	protein_coding	OTTHUMT00000256479.1	-	0.00	25	0	G	NM_014326		64215512	-1	tier1	-	no_errors	ENST00000558069	ensembl	human	putative	74_37	missense	26.32	14	5	SNP	0.003	A
DAZAP2	9802	genome.wustl.edu	37	12	51634498	51634498	+	Intron	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:51634498T>C	ENST00000412716.3	+	3	748				DAZAP2_ENST00000549555.1_Intron|DAZAP2_ENST00000449723.3_Intron|DAZAP2_ENST00000549732.2_Intron|DAZAP2_ENST00000439799.2_Intron|DAZAP2_ENST00000551313.1_Intron|DAZAP2_ENST00000604900.1_Intron|DAZAP2_ENST00000551534.1_Intron|DAZAP2_ENST00000425012.2_Intron			Q15038	DAZP2_HUMAN	DAZ associated protein 2							cytoplasm (GO:0005737)|nucleus (GO:0005634)	WW domain binding (GO:0050699)			haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)	6						TAGCAGAAAGTGATCCAGGAG	0.368																																																	0																																										SO:0001627	intron_variant	0			D31767	CCDS8809.1, CCDS44884.1, CCDS44885.1, CCDS44886.1, CCDS44887.1, CCDS44888.1	12q13.13	2012-04-04			ENSG00000183283	ENSG00000183283			2684	protein-coding gene	gene with protein product		607431				10857750, 7584044	Standard	NM_014764		Approved	KIAA0058	uc010snd.2	Q15038	OTTHUMG00000169649	ENST00000412716.3:c.133-157T>C	12.37:g.51634498T>C			A8K254|B4DDT5|B4E1G3|C9JA96|C9JP84|E9PB45|F8VU62	RNA	SNP	-	NULL	ENST00000412716.3	37	NULL	CCDS8809.1	12																																																																																			DAZAP2	-	-	ENSG00000183283		0.368	DAZAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAZAP2	HGNC	protein_coding	OTTHUMT00000405259.2	-	0.00	22	0	T	NM_014764		51634498	+1	tier1	-	no_errors	ENST00000552173	ensembl	human	known	74_37	rna	23.53	13	4	SNP	0.856	C
DDR1	780	genome.wustl.edu	37	6	30864562	30864562	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:30864562G>A	ENST00000324771.8	+	15	2337	c.1789G>A	c.(1789-1791)Ggg>Agg	p.G597R	DDR1_ENST00000376569.3_Missense_Mutation_p.G560R|DDR1_ENST00000513240.1_Missense_Mutation_p.G597R|DDR1_ENST00000376567.2_Missense_Mutation_p.G560R|DDR1_ENST00000376568.3_Missense_Mutation_p.G597R|DDR1_ENST00000452441.1_Missense_Mutation_p.G597R|DDR1_ENST00000446312.1_3'UTR|DDR1_ENST00000508312.1_Missense_Mutation_p.G578R|DDR1_ENST00000376575.3_Missense_Mutation_p.G597R|DDR1_ENST00000418800.2_Missense_Mutation_p.G560R|DDR1_ENST00000376570.4_Missense_Mutation_p.G560R|DDR1_ENST00000361741.4_Missense_Mutation_p.G264R|DDR1_ENST00000454612.2_Missense_Mutation_p.G560R			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	597	Gly/Pro-rich.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	AGGGGCAGTCGGGGATGGGCC	0.632																																																	0													50.0	58.0	55.0					6																	30864562		2203	4300	6503	SO:0001583	missense	0			X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.1789G>A	6.37:g.30864562G>A	ENSP00000318217:p.Gly597Arg		B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G597R	ENST00000324771.8	37	c.1789	CCDS34385.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.59|14.59	2.579924|2.579924	0.46006|0.46006	.|.	.|.	ENSG00000204580|ENSG00000204580	ENST00000324771;ENST00000418800;ENST00000454612;ENST00000376569;ENST00000376575;ENST00000376570;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000376567;ENST00000513240;ENST00000417521;ENST00000361741|ENST00000514434	D;D;D;D;D;D;D;D;D;D;D;T;T|.	0.85171|.	-1.83;-1.81;-1.81;-1.81;-1.95;-1.81;-1.83;-1.83;-1.82;-1.81;-1.95;-1.23;-1.3|.	5.21|5.21	5.21|5.21	0.72293|0.72293	Protein kinase-like domain (1);|.	0.127995|.	0.51477|.	D|.	0.000099|.	T|T	0.25005|0.25005	0.0607|0.0607	L|L	0.31926|0.31926	0.97|0.97	0.28043|0.28043	N|N	0.933672|0.933672	D;D;D;D|.	0.89917|.	1.0;0.994;0.996;1.0|.	D;P;P;D|.	0.72075|.	0.976;0.468;0.873;0.933|.	T|T	0.14924|0.14924	-1.0455|-1.0455	10|5	0.26408|.	T|.	0.33|.	.|.	14.2567|14.2567	0.66058|0.66058	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	578;329;597;597|.	B7Z2K0;A2ABM8;Q08345-5;Q08345|.	.;.;.;DDR1_HUMAN|.	R|Q	597;560;560;560;597;560;597;597;578;560;597;329;264|88	ENSP00000318217:G597R;ENSP00000407699:G560R;ENSP00000406091:G560R;ENSP00000365753:G560R;ENSP00000365759:G597R;ENSP00000365754:G560R;ENSP00000365752:G597R;ENSP00000405039:G597R;ENSP00000422442:G578R;ENSP00000365751:G560R;ENSP00000427552:G597R;ENSP00000398682:G329R;ENSP00000354844:G264R|.	ENSP00000318217:G597R|.	G|R	+|+	1|2	0|0	DDR1|DDR1	30972541|30972541	1.000000|1.000000	0.71417|0.71417	0.888000|0.888000	0.34837|0.34837	0.860000|0.860000	0.49131|0.49131	4.765000|4.765000	0.62271|0.62271	2.430000|2.430000	0.82344|0.82344	0.561000|0.561000	0.74099|0.74099	GGG|CGG	DDR1	-	superfamily_Kinase-like_dom	ENSG00000204580		0.632	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DDR1	HGNC	protein_coding	OTTHUMT00000076494.3	-	0.00	25	0	G	NM_013994		30864562	+1	tier1	-	no_errors	ENST00000376575	ensembl	human	known	74_37	missense	23.81	16	5	SNP	0.517	A
DDX25	29118	genome.wustl.edu	37	11	125780362	125780362	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:125780362G>A	ENST00000263576.6	+	7	766	c.611G>A	c.(610-612)cGa>cAa	p.R204Q	RP11-680F20.9_ENST00000533033.2_RNA|DDX25_ENST00000525943.1_3'UTR	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	204	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		TATGCCATTCGAGGGAATCGA	0.438																																																	0													196.0	186.0	190.0					11																	125780362		1935	4156	6091	SO:0001583	missense	0			AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.611G>A	11.37:g.125780362G>A	ENSP00000263576:p.Arg204Gln		B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R204Q	ENST00000263576.6	37	c.611	CCDS44766.1	11	.	.	.	.	.	.	.	.	.	.	G	19.22	3.784846	0.70222	.	.	ENSG00000109832	ENST00000525943;ENST00000263576;ENST00000526875	T	0.04917	3.53	5.82	5.82	0.92795	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.185200	0.37178	N	0.002215	T	0.19366	0.0465	L	0.45228	1.405	0.58432	D	0.999999	D;D	0.89917	0.998;1.0	D;D	0.75484	0.964;0.986	T	0.00984	-1.1491	10	0.26408	T	0.33	-15.5445	19.7036	0.96065	0.0:0.0:1.0:0.0	.	204;204	B4DHI6;Q9UHL0	.;DDX25_HUMAN	Q	90;204;90	ENSP00000263576:R204Q	ENSP00000263576:R204Q	R	+	2	0	DDX25	125285572	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.312000	0.72840	2.747000	0.94245	0.655000	0.94253	CGA	DDX25	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000109832		0.438	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX25	HGNC	protein_coding	OTTHUMT00000386736.3	-	0.00	62	0	G	NM_013264		125780362	+1	tier1	-	no_errors	ENST00000263576	ensembl	human	known	74_37	missense	13.16	66	10	SNP	1.000	A
DHX38	9785	genome.wustl.edu	37	16	72138403	72138403	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:72138403G>T	ENST00000268482.3	+	15	2538	c.2029G>T	c.(2029-2031)Gac>Tac	p.D677Y	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	677	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				TCGGCGCTCAGACCTGAAGCT	0.617																																					Melanoma(97;711 1442 7855 13832 28836)												0													113.0	88.0	97.0					16																	72138403		2198	4300	6498	SO:0001583	missense	0			AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2029G>T	16.37:g.72138403G>T	ENSP00000268482:p.Asp677Tyr		B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D677Y	ENST00000268482.3	37	c.2029	CCDS10907.1	16	.	.	.	.	.	.	.	.	.	.	G	28.1	4.894566	0.91962	.	.	ENSG00000140829	ENST00000268482	T	0.27720	1.65	4.87	4.87	0.63330	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75125	0.3807	H	0.99555	4.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86862	0.2030	10	0.87932	D	0	.	18.5547	0.91080	0.0:0.0:1.0:0.0	.	677	Q92620	PRP16_HUMAN	Y	677	ENSP00000268482:D677Y	ENSP00000268482:D677Y	D	+	1	0	DHX38	70695904	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.601000	0.98297	2.677000	0.91161	0.655000	0.94253	GAC	DHX38	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000140829		0.617	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX38	HGNC	protein_coding	OTTHUMT00000269004.3	-	0.00	61	0	G	NM_014003		72138403	+1	tier1	-	no_errors	ENST00000268482	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	31525458	31525458	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:31525458C>T	ENST00000357033.4	-	56	8536	c.8330G>A	c.(8329-8331)aGa>aAa	p.R2777K	DMD_ENST00000343523.2_Missense_Mutation_p.R317K|DMD_ENST00000359836.1_Missense_Mutation_p.R317K|DMD_ENST00000445312.1_5'UTR|DMD_ENST00000474231.1_Missense_Mutation_p.R317K|DMD_ENST00000541735.1_Missense_Mutation_p.R317K|DMD_ENST00000378677.2_Missense_Mutation_p.R2773K|DMD_ENST00000378707.3_Missense_Mutation_p.R317K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2777					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATCCAAACGTCTTTGTAACAG	0.403																																																	0													185.0	150.0	162.0					X																	31525458		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8330G>A	X.37:g.31525458C>T	ENSP00000354923:p.Arg2777Lys		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.R2777K	ENST00000357033.4	37	c.8330	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	13.36	2.212803	0.39102	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	T;T;T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42;1.42;1.42	5.68	5.68	0.88126	.	0.000000	0.39475	U	0.001357	T	0.45216	0.1331	L	0.35341	1.055	0.44539	D	0.99749	B;P;D;B;B;B;B;B;B;B;B	0.57257	0.022;0.543;0.979;0.219;0.219;0.007;0.004;0.004;0.122;0.1;0.151	B;B;D;B;B;B;B;B;B;B;B	0.74023	0.078;0.306;0.982;0.191;0.113;0.02;0.015;0.015;0.064;0.038;0.108	T	0.15150	-1.0447	10	0.22109	T	0.4	.	18.7631	0.91860	0.0:1.0:0.0:0.0	.	2769;2777;2773;1436;1433;317;317;317;317;317;2654	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3	.;DMD_HUMAN;.;.;.;.;.;.;.;.;.	K	2769;1436;1433;473;2773;2777;317;317;2777;2654;317;317;317	ENSP00000350765:R473K;ENSP00000367948:R2773K;ENSP00000354923:R2777K;ENSP00000352894:R317K;ENSP00000340057:R317K;ENSP00000367979:R317K;ENSP00000444119:R317K;ENSP00000417123:R317K	ENSP00000340057:R317K	R	-	2	0	DMD	31435379	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.049000	0.64244	2.377000	0.81083	0.594000	0.82650	AGA	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.403	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	16	0	C	NM_004006		31525458	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	34.21	25	13	SNP	1.000	T
DMKN	93099	genome.wustl.edu	37	19	35991478	35991478	+	Missense_Mutation	SNP	G	G	A	rs149828471		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:35991478G>A	ENST00000339686.3	-	12	1420	c.1244C>T	c.(1243-1245)gCg>gTg	p.A415V	DMKN_ENST00000480502.1_Missense_Mutation_p.A109V|DMKN_ENST00000419602.1_Missense_Mutation_p.A404V|DMKN_ENST00000414866.2_Missense_Mutation_p.A128V|DMKN_ENST00000492341.2_Missense_Mutation_p.A62V|DMKN_ENST00000602781.1_Missense_Mutation_p.A128V|DMKN_ENST00000467637.1_Missense_Mutation_p.A140V|DMKN_ENST00000436012.1_Missense_Mutation_p.A111V|DMKN_ENST00000472252.2_Missense_Mutation_p.A62V|DMKN_ENST00000429837.1_Missense_Mutation_p.A374V|DMKN_ENST00000408915.2_Missense_Mutation_p.A29V|DMKN_ENST00000402589.2_Missense_Mutation_p.A128V|DMKN_ENST00000443640.1_Missense_Mutation_p.A178V|DMKN_ENST00000462126.1_5'UTR	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	415			A -> S (in dbSNP:rs2293696).			extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.A415V(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TGACGCGTCCGCACCCTGAAA	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18636	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)						G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	71.0	48.0	56.0		86,1211,383,1121,1244	-2.4	0.0	19	dbSNP_134	56	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	DMKN	NM_001035516.3,NM_001126056.2,NM_001126059.2,NM_001190347.1,NM_033317.4	64,64,64,64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign,benign	29/91,404/466,128/190,374/450,415/477	35991478	1,13005	2203	4300	6503	SO:0001583	missense	0			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.1244C>T	19.37:g.35991478G>A	ENSP00000342012:p.Ala415Val		A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	NULL	p.A415V	ENST00000339686.3	37	c.1244	CCDS12463.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.20|11.20	1.569077|1.569077	0.28003|0.28003	2.27E-4|2.27E-4	0.0|0.0	ENSG00000161249|ENSG00000161249	ENST00000408915;ENST00000402589;ENST00000339686;ENST00000436012;ENST00000414866;ENST00000429837;ENST00000419602;ENST00000443640|ENST00000443857	T;T;T;T;T;T;T;T|.	0.34072|.	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38|.	3.96|3.96	-2.41|-2.41	0.06562|0.06562	.|.	1.172480|.	0.06548|.	N|.	0.744470|.	T|T	0.13457|0.13457	0.0326|0.0326	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;P;B;B;B;B;B|.	0.38745|.	0.003;0.003;0.017;0.003;0.012;0.022;0.645;0.433;0.007;0.001;0.001;0.003|.	B;B;B;B;B;B;B;B;B;B;B;B|.	0.32533|.	0.001;0.001;0.004;0.001;0.002;0.005;0.147;0.049;0.003;0.001;0.001;0.001|.	T|T	0.24404|0.24404	-1.0161|-1.0161	10|5	0.52906|.	T|.	0.07|.	0.6512|0.6512	2.8777|2.8777	0.05636|0.05636	0.2958:0.0:0.3719:0.3323|0.2958:0.0:0.3719:0.3323	.|.	111;62;71;71;91;109;404;374;415;128;178;29|.	B4E3D1;B7ZB10;Q6E0U4-12;Q6E0U4-11;Q6E0U4-10;Q6E0U4-9;C9J4P6;Q6E0U4-4;Q6E0U4;Q6E0U4-8;C9IYI1;Q6E0U4-15|.	.;.;.;.;.;.;.;.;DMKN_HUMAN;.;.;.|.	V|W	29;128;415;111;128;374;404;178|119	ENSP00000386225:A29V;ENSP00000384509:A128V;ENSP00000342012:A415V;ENSP00000412075:A111V;ENSP00000392222:A128V;ENSP00000405503:A374V;ENSP00000391036:A404V;ENSP00000406864:A178V|.	ENSP00000342012:A415V|.	A|R	-|-	2|1	0|2	DMKN|DMKN	40683318|40683318	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.024000|0.024000	0.10985|0.10985	0.123000|0.123000	0.15708|0.15708	-0.411000|-0.411000	0.07530|0.07530	-0.477000|-0.477000	0.04895|0.04895	GCG|CGG	DMKN	-	NULL	ENSG00000161249		0.617	DMKN-001	KNOWN	basic|CCDS	protein_coding	DMKN	HGNC	protein_coding	OTTHUMT00000109461.2		0.00	50	0	G	NM_033317		35991478	-1			no_errors	ENST00000339686	ensembl	human	known	74_37	missense	5.56	33	2	SNP	0.000	A
DNAH11	8701	genome.wustl.edu	37	7	21654793	21654793	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:21654793delT	ENST00000409508.3	+	21	3945	c.3914delT	c.(3913-3915)cttfs	p.L1305fs	DNAH11_ENST00000328843.6_Frame_Shift_Del_p.L1305fs	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1305	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TCTACTCGTCTTTTTGAAGTG	0.398									Kartagener syndrome																																								0													125.0	118.0	120.0					7																	21654793		1851	4095	5946	SO:0001589	frameshift_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.3914delT	7.37:g.21654793delT	ENSP00000475939:p.Leu1305fs		Q9UJ82	Frame_Shift_Del	DEL	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F1306fs	ENST00000409508.3	37	c.3914		7																																																																																			DNAH11	-	NULL	ENSG00000105877		0.398	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6		0.00	21	0	T	NM_003777		21654793	+1	tier1		no_errors	ENST00000328843	ensembl	human	known	74_37	frame_shift_del	24.32	28	9	DEL	1.000	-
DNAH14	127602	genome.wustl.edu	37	1	225334896	225334896	+	Intron	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:225334896G>T	ENST00000445597.2	+	18	3537				DNAH14_ENST00000439375.2_Missense_Mutation_p.V1612F|DNAH14_ENST00000430092.1_Missense_Mutation_p.V1612F			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AGTTCTCTCTGTCATTGCCTC	0.338																																																	0													223.0	194.0	202.0					1																	225334896		692	1591	2283	SO:0001627	intron_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3537+2566G>T	1.37:g.225334896G>T			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.V1612F	ENST00000445597.2	37	c.4834		1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882851	0.72410	.	.	ENSG00000185842	ENST00000430092;ENST00000439375;ENST00000328556	T;T;T	0.14640	2.49;2.49;2.49	5.4	5.4	0.78164	.	0.000000	0.42294	U	0.000736	T	0.20861	0.0502	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.66351	0.943	T	0.01484	-1.1343	10	0.87932	D	0	.	12.1213	0.53893	0.0828:0.0:0.9172:0.0	.	1612	Q0VDD8-4	.	F	1612;1612;707	ENSP00000414402:V1612F;ENSP00000392061:V1612F;ENSP00000332424:V707F	ENSP00000332424:V707F	V	+	1	0	DNAH14	223401519	1.000000	0.71417	0.165000	0.22776	0.985000	0.73830	6.376000	0.73141	2.533000	0.85409	0.609000	0.83330	GTC	DNAH14	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000185842		0.338	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	40	0	G	XM_059166		225334896	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	8.20	56	5	SNP	0.779	T
DNAH6	1768	genome.wustl.edu	37	2	84930679	84930679	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:84930679C>T	ENST00000237449.6	+	49	8230	c.8222C>T	c.(8221-8223)gCc>gTc	p.A2741V	DNAH6_ENST00000389394.3_Missense_Mutation_p.A2741V			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2741	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CAAGAAAGTGCCGATCAGGTA	0.368																																																	0													66.0	58.0	60.0					2																	84930679		692	1591	2283	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.8222C>T	2.37:g.84930679C>T	ENSP00000237449:p.Ala2741Val		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A2741V	ENST00000237449.6	37	c.8222	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.098109	0.94197	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.67523	-0.27;-0.27	5.79	5.79	0.91817	Dynein heavy chain, coiled coil stalk (1);	.	.	.	.	T	0.77532	0.4144	L	0.55990	1.75	0.80722	D	1	D	0.64830	0.994	P	0.61477	0.889	T	0.76531	-0.2925	9	0.49607	T	0.09	.	18.8083	0.92047	0.0:1.0:0.0:0.0	.	2741	Q9C0G6	DYH6_HUMAN	V	2741	ENSP00000374045:A2741V;ENSP00000237449:A2741V	ENSP00000237449:A2741V	A	+	2	0	DNAH6	84784190	1.000000	0.71417	0.960000	0.40013	0.978000	0.69477	6.340000	0.72973	2.735000	0.93741	0.563000	0.77884	GCC	DNAH6	-	superfamily_P-loop_NTPase	ENSG00000115423		0.368	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	-	0.00	36	0	C	NM_001370		84930679	+1	tier1	-	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
DNAH8	1769	genome.wustl.edu	37	6	38838224	38838224	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:38838224C>A	ENST00000359357.3	+	47	6479	c.6225C>A	c.(6223-6225)ttC>ttA	p.F2075L	DNAH8_ENST00000449981.2_Missense_Mutation_p.F2292L|DNAH8_ENST00000441566.1_Missense_Mutation_p.F2039L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2075					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ATGACCTGTTCCCAGGACTGC	0.408																																																	0													117.0	111.0	113.0					6																	38838224		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6225C>A	6.37:g.38838224C>A	ENSP00000352312:p.Phe2075Leu		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F2075L	ENST00000359357.3	37	c.6225		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.38|16.38	3.106041|3.106041	0.56291|0.56291	.|.	.|.	ENSG00000124721|ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566|ENST00000394393	T;T;T|.	0.22945|.	1.93;1.93;1.93|.	6.06|6.06	2.19|2.19	0.27852|0.27852	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.82061|0.82061	0.4955|0.4955	H|H	0.97564|0.97564	4.03|4.03	0.58432|0.58432	D|D	0.999998|0.999998	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.84408|0.84408	0.0564|0.0564	10|5	0.72032|.	D|.	0.01|.	.|.	10.1206|10.1206	0.42618|0.42618	0.0:0.2554:0.0:0.7446|0.0:0.2554:0.0:0.7446	.|.	2075|.	Q96JB1|.	DYH8_HUMAN|.	L|Y	2280;2280;2075;2039|121	ENSP00000333363:F2280L;ENSP00000352312:F2075L;ENSP00000402294:F2039L|.	ENSP00000333363:F2280L|.	F|S	+|+	3|2	2|0	DNAH8|DNAH8	38946202|38946202	0.992000|0.992000	0.36948|0.36948	0.999000|0.999000	0.59377|0.59377	0.277000|0.277000	0.26821|0.26821	0.282000|0.282000	0.18829|0.18829	0.178000|0.178000	0.19917|0.19917	-1.105000|-1.105000	0.02106|0.02106	TTC|TCC	DNAH8	-	superfamily_P-loop_NTPase	ENSG00000124721		0.408	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	-	0.00	43	0	C	NM_001206927		38838224	+1	tier1	-	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
DNAJC17	55192	genome.wustl.edu	37	15	41065993	41065993	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr15:41065993G>C	ENST00000220496.4	-	10	754	c.724C>G	c.(724-726)Ctg>Gtg	p.L242V		NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	242	RRM.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GAAATCTTCAGAGGGTTATCC	0.587																																																	0													43.0	37.0	39.0					15																	41065993		2203	4300	6503	SO:0001583	missense	0			AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.724C>G	15.37:g.41065993G>C	ENSP00000220496:p.Leu242Val			Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_RRM_dom,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.L242V	ENST00000220496.4	37	c.724	CCDS10065.1	15	.	.	.	.	.	.	.	.	.	.	G	18.28	3.588503	0.66105	.	.	ENSG00000104129	ENST00000220496	T	0.24908	1.83	5.17	3.04	0.35103	Nucleotide-binding, alpha-beta plait (1);	0.148390	0.47093	D	0.000251	T	0.50684	0.1630	M	0.87682	2.9	0.58432	D	0.999997	D	0.89917	1.0	D	0.75020	0.985	T	0.49679	-0.8914	10	0.40728	T	0.16	.	9.4953	0.38984	0.1964:0.0:0.8036:0.0	.	242	Q9NVM6	DJC17_HUMAN	V	242	ENSP00000220496:L242V	ENSP00000220496:L242V	L	-	1	2	DNAJC17	38853285	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	1.272000	0.33109	0.587000	0.29643	0.561000	0.74099	CTG	DNAJC17	-	NULL	ENSG00000104129		0.587	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC17	HGNC	protein_coding	OTTHUMT00000252356.2	-	0.00	92	0	G	NM_018163		41065993	-1	tier1	-	no_errors	ENST00000220496	ensembl	human	known	74_37	missense	16.46	66	13	SNP	1.000	C
DNAJC6	9829	genome.wustl.edu	37	1	65871646	65871647	+	Frame_Shift_Ins	INS	-	-	TA	rs373611651		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:65871646_65871647insTA	ENST00000395325.3	+	16	2307_2308	c.2150_2151insTA	c.(2149-2154)cctatgfs	p.M718fs	DNAJC6_ENST00000371069.4_Frame_Shift_Ins_p.M775fs|DNAJC6_ENST00000263441.7_Frame_Shift_Ins_p.M705fs	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	718	Pro-rich.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TCTCCCCAGCCTATGGGTGGCG	0.614																																																	0																																										SO:0001589	frameshift_variant	0			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2151_2152dupTA	1.37:g.65871647_65871648dupTA	ENSP00000378735:p.Met718fs		B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Frame_Shift_Ins	INS	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_C2_dom,smart_DnaJ_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.M775fs	ENST00000395325.3	37	c.2321_2322	CCDS30739.1	1																																																																																			DNAJC6	-	NULL	ENSG00000116675		0.614	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	HGNC	protein_coding	OTTHUMT00000025134.1		0.00	65	0	-			65871647	+1	tier1		no_errors	ENST00000371069	ensembl	human	known	74_37	frame_shift_ins	24.62	49	16	INS	0.993:0.111	TA
EDNRB	1910	genome.wustl.edu	37	13	78493709	78493709	+	5'Flank	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr13:78493709G>T	ENST00000334286.5	-	0	0				EDNRB_ENST00000475537.1_5'Flank|RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000377211.4_Missense_Mutation_p.S14R|EDNRB_ENST00000446573.1_5'Flank	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B						aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TCCACCGTTTGCTCGGGGTCT	0.602																																																	0													34.0	32.0	33.0					13																	78493709		876	1991	2867	SO:0001631	upstream_gene_variant	0			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111		13.37:g.78493709G>T	Exception_encountered		A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ETB_rcpt,prints_Endthln_rcpt,prints_GPCR_Rhodpsn,prints_Bombsn_rcpt	p.S14R	ENST00000334286.5	37	c.42	CCDS9461.1	13	.	.	.	.	.	.	.	.	.	.	G	5.970	0.362868	0.11296	.	.	ENSG00000136160	ENST00000377211	T	0.74315	-0.83	4.64	1.61	0.23674	.	0.462526	0.18401	N	0.142378	T	0.60586	0.2280	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.53287	-0.8460	9	0.66056	D	0.02	.	6.4107	0.21690	0.3551:0.0:0.6449:0.0	.	14	P24530-3	.	R	14	ENSP00000366416:S14R	ENSP00000366416:S14R	S	-	3	2	EDNRB	77391710	0.103000	0.21917	0.000000	0.03702	0.010000	0.07245	1.588000	0.36633	0.123000	0.18342	0.644000	0.83932	AGC	EDNRB	-	NULL	ENSG00000136160		0.602	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	HGNC	protein_coding	OTTHUMT00000276505.1	-	0.00	49	0	G			78493709	-1	tier1	-	no_errors	ENST00000377211	ensembl	human	putative	74_37	missense	7.41	50	4	SNP	0.000	T
EIF4EBP2	1979	genome.wustl.edu	37	10	72179687	72179687	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr10:72179687G>T	ENST00000373218.4	+	2	186	c.163G>T	c.(163-165)Gac>Tac	p.D55Y		NM_004096.4	NP_004087.1	Q13542	4EBP2_HUMAN	eukaryotic translation initiation factor 4E binding protein 2	55					cAMP-mediated signaling (GO:0019933)|insulin receptor signaling pathway (GO:0008286)|negative regulation of translational initiation (GO:0045947)|translation (GO:0006412)					large_intestine(1)	1						AATCATTTATGACAGAAAGTT	0.428																																																	0													100.0	102.0	101.0					10																	72179687		2203	4300	6503	SO:0001583	missense	0				CCDS7303.1	10q21-q22	2008-08-01			ENSG00000148730	ENSG00000148730			3289	protein-coding gene	gene with protein product		602224				7935836, 8975712	Standard	NM_004096		Approved		uc001jrb.3	Q13542	OTTHUMG00000018409	ENST00000373218.4:c.163G>T	10.37:g.72179687G>T	ENSP00000362314:p.Asp55Tyr			Missense_Mutation	SNP	pfam_EIF4EBP	p.D55Y	ENST00000373218.4	37	c.163	CCDS7303.1	10	.	.	.	.	.	.	.	.	.	.	G	25.7	4.662647	0.88251	.	.	ENSG00000148730	ENST00000373218	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.77384	0.4122	M	0.84219	2.685	0.80722	D	1	D	0.57899	0.981	P	0.54815	0.761	T	0.80185	-0.1487	9	0.62326	D	0.03	-13.1135	18.6601	0.91469	0.0:0.0:1.0:0.0	.	55	Q13542	4EBP2_HUMAN	Y	55	.	ENSP00000362314:D55Y	D	+	1	0	EIF4EBP2	71849693	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.117000	0.94347	2.781000	0.95711	0.650000	0.86243	GAC	EIF4EBP2	-	pfam_EIF4EBP	ENSG00000148730		0.428	EIF4EBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4EBP2	HGNC	protein_coding	OTTHUMT00000048513.1		0.00	40	0	G	NM_004096		72179687	+1			no_errors	ENST00000373218	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
UPK3B	80761	genome.wustl.edu	37	7	76642997	76642997	+	Intron	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:76642997G>A	ENST00000419923.2	+	6	1408				DTX2P1-UPK3BP1-PMS2P11_ENST00000584900.1_RNA|Y_RNA_ENST00000365015.1_RNA|UPK3B_ENST00000443097.2_Intron			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				cttgactagTGTAAGGAAAAA	0.328																																																	0																																										SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.961-5144G>A	7.37:g.76642997G>A			A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	RNA	SNP	-	NULL	ENST00000419923.2	37	NULL	CCDS5588.1	7																																																																																			Y_RNA	-	-	ENSG00000201885		0.328	UPK3B-201	KNOWN	basic|CCDS	protein_coding	ENSG00000201885	RFAM	protein_coding			0.00	17	0	G	NM_030570		76642997	+1			no_errors	ENST00000365015	ensembl	human	novel	74_37	rna	6.98	40	3	SNP	0.003	A
AC092965.1	0	genome.wustl.edu	37	3	166743251	166743252	+	RNA	DEL	AC	AC	-	rs373486571		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:166743251_166743252delAC	ENST00000401103.1	+	0	51_52																											ATATATGTATacacacacacac	0.322																																																	0																																												0																															3.37:g.166743261_166743262delAC				RNA	DEL	-	NULL	ENST00000401103.1	37	NULL		3																																																																																			AC092965.1	-	-	ENSG00000215922		0.322	AC092965.1-201	NOVEL	basic	miRNA	ENSG00000215922	Clone_based_ensembl_gene	miRNA			0.00	26	0	AC			166743252	+1	tier1		no_errors	ENST00000401103	ensembl	human	novel	74_37	rna	11.86	52	7	DEL	0.018:0.022	-
FSTL4	23105	genome.wustl.edu	37	5	132559802	132559802	+	Intron	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:132559802G>T	ENST00000265342.7	-	11	1589				CTB-49A3.2_ENST00000509051.1_RNA|FSTL4_ENST00000507112.1_Intron|CTB-49A3.2_ENST00000502776.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4							extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAAGCTGGTGGCAGATCATGG	0.458																																																	0													103.0	102.0	102.0					5																	132559802		692	1591	2283	SO:0001627	intron_variant	0			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.1339+79C>A	5.37:g.132559802G>T			Q8TBU0|Q9UPU1	RNA	SNP	-	NULL	ENST00000265342.7	37	NULL	CCDS34238.1	5																																																																																			CTB-49A3.2	-	-	ENSG00000248245		0.458	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248245	Clone_based_vega_gene	protein_coding	OTTHUMT00000370212.1	-	0.00	30	0	G	XM_048786		132559802	+1	tier1	-	no_errors	ENST00000502776	ensembl	human	known	74_37	rna	16.67	15	3	SNP	0.012	T
RP11-597A11.6	0	genome.wustl.edu	37	14	20145989	20145989	+	lincRNA	SNP	G	G	C	rs200742985		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:20145989G>C	ENST00000555580.1	-	0	376				RP11-597A11.1_ENST00000548261.1_RNA																							CATTGAAACCGGCAGCCATGG	0.542																																																	0																																												0																															14.37:g.20145989G>C				RNA	SNP	-	NULL	ENST00000555580.1	37	NULL		14																																																																																			RP11-597A11.1	-	-	ENSG00000258027		0.542	RP11-597A11.6-001	KNOWN	basic	lincRNA	ENSG00000258027	Clone_based_vega_gene	lincRNA	OTTHUMT00000409767.1	-	0.00	11	0	G			20145989	+1	tier1	rs200742985	no_errors	ENST00000548217	ensembl	human	known	74_37	rna	40.00	6	4	SNP	0.895	C
EPHA1	2041	genome.wustl.edu	37	7	143094701	143094701	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:143094701C>T	ENST00000275815.3	-	9	1751	c.1665G>A	c.(1663-1665)ctG>ctA	p.L555L		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	555					activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CACCAAGCAGCAGCCCAAAGA	0.592																																																	0													85.0	82.0	83.0					7																	143094701		2203	4300	6503	SO:0001819	synonymous_variant	0			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1665G>A	7.37:g.143094701C>T			A1L3V3|B5A966|B5A967|Q15405	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.L555	ENST00000275815.3	37	c.1665	CCDS5884.1	7																																																																																			EPHA1	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000146904		0.592	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	HGNC	protein_coding	OTTHUMT00000342154.1	-	0.00	51	0	C			143094701	-1	tier1	-	no_errors	ENST00000275815	ensembl	human	known	74_37	silent	8.33	55	5	SNP	0.917	T
EPHA5	2044	genome.wustl.edu	37	4	66467595	66467595	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr4:66467595G>T	ENST00000273854.3	-	3	1274	c.674C>A	c.(673-675)tCt>tAt	p.S225Y	EPHA5_ENST00000354839.4_Missense_Mutation_p.S225Y|EPHA5_ENST00000432638.2_Missense_Mutation_p.S225Y|EPHA5_ENST00000511294.1_Missense_Mutation_p.S225Y	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	225	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TACACGCACAGAAACCAGAGC	0.433										TSP Lung(17;0.13)																																							0													71.0	69.0	69.0					4																	66467595		2203	4300	6503	SO:0001583	missense	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.674C>A	4.37:g.66467595G>T	ENSP00000273854:p.Ser225Tyr		Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S225Y	ENST00000273854.3	37	c.674	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418647	0.83559	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	5.83	5.83	0.93111	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000014	T	0.50786	0.1636	M	0.92412	3.305	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.97110	1.0;0.996;0.999;0.999	T	0.60984	-0.7154	10	0.87932	D	0	.	20.1208	0.97960	0.0:0.0:1.0:0.0	.	225;225;225;225	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Y	225	ENSP00000273854:S225Y;ENSP00000389208:S225Y;ENSP00000346899:S225Y;ENSP00000427638:S225Y	ENSP00000273854:S225Y	S	-	2	0	EPHA5	66150190	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.869000	0.99810	2.758000	0.94735	0.655000	0.94253	TCT	EPHA5	-	pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom,pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000145242		0.433	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2		0.00	25	0	G	NM_004439		66467595	-1			no_errors	ENST00000273854	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	T
EPHX2	2053	genome.wustl.edu	37	8	27373843	27373843	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:27373843G>T	ENST00000521400.1	+	8	1268	c.838G>T	c.(838-840)Gct>Tct	p.A280S	EPHX2_ENST00000518379.1_Missense_Mutation_p.A248S|EPHX2_ENST00000380476.3_Missense_Mutation_p.A227S|EPHX2_ENST00000521780.1_Missense_Mutation_p.A214S|EPHX2_ENST00000517536.1_Missense_Mutation_p.A97S	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	280	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)	p.A280S(1)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		CTAGATCCCTGCTCTGGCCCA	0.542											OREG0018668	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	lung(1)											367.0	311.0	330.0					8																	27373843		2203	4300	6503	SO:0001583	missense	0			L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.838G>T	8.37:g.27373843G>T	ENSP00000430269:p.Ala280Ser	793	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_HAD-like_dom,superfamily_HAD-like_dom,prints_Epox_hydrolase-like,prints_HAD-SF_hydro_IA,prints_AB_hydrolase_1,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA	p.A280S	ENST00000521400.1	37	c.838	CCDS6060.1	8	.	.	.	.	.	.	.	.	.	.	G	18.00	3.524441	0.64747	.	.	ENSG00000120915	ENST00000521400;ENST00000517536;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T;T	0.04317	3.65;3.65;3.65;3.65;3.65	5.67	5.67	0.87782	.	0.044847	0.85682	D	0.000000	T	0.10723	0.0262	L	0.60845	1.875	0.51482	D	0.999926	P;P;P	0.45902	0.668;0.868;0.801	B;B;P	0.45881	0.318;0.446;0.496	T	0.01084	-1.1457	10	0.46703	T	0.11	-9.8483	17.2762	0.87116	0.0:0.0:1.0:0.0	.	248;280;280	E5RFU2;E7ETW9;P34913	.;.;HYES_HUMAN	S	280;97;214;227;284;248	ENSP00000430269:A280S;ENSP00000428875:A97S;ENSP00000430302:A214S;ENSP00000369843:A227S;ENSP00000427956:A248S	ENSP00000369843:A227S	A	+	1	0	EPHX2	27429760	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.425000	0.66470	2.677000	0.91161	0.561000	0.74099	GCT	EPHX2	-	prints_Epox_hydrolase-like	ENSG00000120915		0.542	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX2	HGNC	protein_coding	OTTHUMT00000219954.4		0.00	47	0	G			27373843	+1			no_errors	ENST00000521400	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	T
ERAP2	64167	genome.wustl.edu	37	5	96215729	96215729	+	Missense_Mutation	SNP	G	G	T	rs149963216	byFrequency	TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:96215729G>T	ENST00000437043.3	+	2	1051	c.340G>T	c.(340-342)Gat>Tat	p.D114Y	CTD-2260A17.2_ENST00000501338.1_Intron|ERAP2_ENST00000379904.4_Missense_Mutation_p.D114Y|ERAP2_ENST00000510309.1_Missense_Mutation_p.D114Y	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2	114					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		GCACAGCAAAGATCTTGAAAT	0.433													G|||	4	0.000798722	0.0023	0.0014	5008	,	,		23565	0.0		0.0	False		,,,				2504	0.0																0								G	TYR/ASP,TYR/ASP	25,4381	31.7+/-61.6	0,25,2178	78.0	69.0	72.0		340,340	2.7	1.0	5	dbSNP_134	72	0,8600		0,0,4300	yes	missense,missense	ERAP2	NM_001130140.1,NM_022350.3	160,160	0,25,6478	TT,TG,GG		0.0,0.5674,0.1922	benign,benign	114/961,114/961	96215729	25,12981	2203	4300	6503	SO:0001583	missense	0			AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.340G>T	5.37:g.96215729G>T	ENSP00000400376:p.Asp114Tyr		Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.D114Y	ENST00000437043.3	37	c.340	CCDS4086.1	5	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	G	10.72	1.428326	0.25726	0.005674	0.0	ENSG00000164308	ENST00000437043;ENST00000510373;ENST00000513084;ENST00000379904;ENST00000510309	T;T;T;T;T	0.05199	3.48;3.48;3.48;3.48;3.48	4.67	2.74	0.32292	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.444786	0.21932	N	0.067012	T	0.05364	0.0142	L	0.58302	1.8	0.33845	D	0.631906	B;B	0.20988	0.04;0.05	B;B	0.28305	0.078;0.088	T	0.03249	-1.1056	10	0.54805	T	0.06	.	6.6842	0.23136	0.0:0.2847:0.4549:0.2603	.	114;114	Q6P179-3;Q6P179	.;ERAP2_HUMAN	Y	114	ENSP00000400376:D114Y;ENSP00000421175:D114Y;ENSP00000421849:D114Y;ENSP00000369235:D114Y;ENSP00000425758:D114Y	ENSP00000369235:D114Y	D	+	1	0	ERAP2	96241485	0.007000	0.16637	0.953000	0.39169	0.975000	0.68041	0.112000	0.15479	2.315000	0.78130	0.563000	0.77884	GAT	ERAP2	-	pfam_Peptidase_M1_N	ENSG00000164308		0.433	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP2	HGNC	protein_coding	OTTHUMT00000250623.2		0.00	46	0	G	NM_022350		96215729	+1			no_errors	ENST00000437043	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.981	T
EXD2	55218	genome.wustl.edu	37	14	69702803	69702803	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:69702803G>A	ENST00000409018.3	+	6	1218	c.1090G>A	c.(1090-1092)Gat>Aat	p.D364N	EXD2_ENST00000409675.1_Missense_Mutation_p.D239N|EXD2_ENST00000409949.1_Missense_Mutation_p.D239N|EXD2_ENST00000409014.1_Missense_Mutation_p.D239N|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000449989.1_Missense_Mutation_p.D239N|EXD2_ENST00000409242.1_Missense_Mutation_p.D239N|EXD2_ENST00000312994.5_Missense_Mutation_p.D364N	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	364							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CCATGCTCCTGATGGACAGCC	0.438																																																	0													164.0	160.0	161.0					14																	69702803		2203	4300	6503	SO:0001583	missense	0			AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1090G>A	14.37:g.69702803G>A	ENSP00000387331:p.Asp364Asn		B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.D364N	ENST00000409018.3	37	c.1090	CCDS53902.1	14	.	.	.	.	.	.	.	.	.	.	G	37	6.029919	0.97216	.	.	ENSG00000081177	ENST00000409018;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000449989	T;T;T;T;T;T;T	0.72505	-0.35;-0.66;-0.66;-0.66;-0.66;-0.35;-0.66	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.85588	0.5731	M	0.83012	2.62	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;P;P	0.66602	0.945;0.882;0.882	D	0.84761	0.0762	10	0.49607	T	0.09	-18.6274	20.6721	0.99693	0.0:0.0:1.0:0.0	.	364;239;239	G5E947;B3KP95;Q9NVH0	.;.;EXD2_HUMAN	N	364;239;239;239;239;364;239	ENSP00000387331:D364N;ENSP00000386915:D239N;ENSP00000386762:D239N;ENSP00000386632:D239N;ENSP00000386839:D239N;ENSP00000313140:D364N;ENSP00000392177:D239N	ENSP00000313140:D364N	D	+	1	0	EXD2	68772556	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.542000	0.98086	2.894000	0.99253	0.591000	0.81541	GAT	EXD2	-	NULL	ENSG00000081177		0.438	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	HGNC	protein_coding	OTTHUMT00000335504.1	-	0.00	41	0	G			69702803	+1	tier1	-	no_errors	ENST00000312994	ensembl	human	known	74_37	missense	32.43	25	12	SNP	1.000	A
FAM120C	54954	genome.wustl.edu	37	X	54114227	54114227	+	Silent	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:54114227G>T	ENST00000375180.2	-	12	2654	c.2598C>A	c.(2596-2598)ggC>ggA	p.G866G	FAM120C_ENST00000328235.4_Intron	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	866							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CTCGCTCTCGGCCTGCTTTAA	0.527																																																	0													90.0	77.0	82.0					X																	54114227		2203	4300	6503	SO:0001819	synonymous_variant	0			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.2598C>A	X.37:g.54114227G>T			B2RMT7	Silent	SNP	NULL	p.G866	ENST00000375180.2	37	c.2598	CCDS14356.1	X																																																																																			FAM120C	-	NULL	ENSG00000184083		0.527	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	-	0.00	24	0	G	NM_017848		54114227	-1	tier1	-	no_errors	ENST00000375180	ensembl	human	known	74_37	silent	17.65	14	3	SNP	0.979	T
FAM154A	158297	genome.wustl.edu	37	9	18928632	18928632	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr9:18928632C>A	ENST00000380534.4	-	4	1122	c.843G>T	c.(841-843)tgG>tgT	p.W281C	FAM154A_ENST00000380530.1_3'UTR|FAM154A_ENST00000542071.1_Missense_Mutation_p.W89C	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A	281										breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		GGGGCATTGGCCAAGCTTGGT	0.542																																																	0													110.0	107.0	108.0					9																	18928632		2203	4300	6503	SO:0001583	missense	0			BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.843G>T	9.37:g.18928632C>A	ENSP00000369907:p.Trp281Cys		Q5VY58	Missense_Mutation	SNP	NULL	p.W281C	ENST00000380534.4	37	c.843	CCDS6487.1	9	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620945	0.66787	.	.	ENSG00000155875	ENST00000380534;ENST00000542071	T;T	0.19394	2.15;2.15	5.09	5.09	0.68999	.	0.000000	0.53938	D	0.000060	T	0.49355	0.1552	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.44802	-0.9304	10	0.38643	T	0.18	-12.1837	17.2336	0.86991	0.0:1.0:0.0:0.0	.	281	Q8IYX7	F154A_HUMAN	C	281;89	ENSP00000369907:W281C;ENSP00000438823:W89C	ENSP00000369907:W281C	W	-	3	0	FAM154A	18918632	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.678000	0.54627	2.640000	0.89533	0.650000	0.86243	TGG	FAM154A	-	NULL	ENSG00000155875		0.542	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM154A	HGNC	protein_coding	OTTHUMT00000051811.1	-	0.00	69	0	C	NM_153707		18928632	-1	tier1	-	no_errors	ENST00000380534	ensembl	human	known	74_37	missense	23.33	45	14	SNP	1.000	A
FAM230B	642633	genome.wustl.edu	37	22	21538027	21538027	+	RNA	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr22:21538027G>A	ENST00000451257.1	+	0	1013									family with sequence similarity 230, member B (non-protein coding)																		CATCGCTAACGAGGCCGCCGA	0.731																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538027G>A				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.731	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1	-	0.00	258	0	G	NR_108107		21538027	+1	tier1	-	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	5.00	190	10	SNP	0.001	A
FAM63B	54629	genome.wustl.edu	37	15	59064348	59064348	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr15:59064348G>T	ENST00000559228.1	+	1	836	c.754G>T	c.(754-756)Gaa>Taa	p.E252*	RP11-30K9.6_ENST00000500929.2_lincRNA|FAM63B_ENST00000450403.2_Nonsense_Mutation_p.E252*			Q8NBR6	FA63B_HUMAN	family with sequence similarity 63, member B	252										central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						CCAGTGGAAGGAAGAGAACAC	0.572																																																	0													90.0	99.0	96.0					15																	59064348		2109	4236	6345	SO:0001587	stop_gained	0			AK075319	CCDS42046.1, CCDS45268.1	15q21.3	2005-08-09							26954	protein-coding gene	gene with protein product						10574461	Standard	NM_001040450		Approved	KIAA1164	uc002afj.3	Q8NBR6		ENST00000559228.1:c.754G>T	15.37:g.59064348G>T	ENSP00000452885:p.Glu252*		B2RTT8|Q9ULQ6	Nonsense_Mutation	SNP	pfam_DUF544	p.E252*	ENST00000559228.1	37	c.754	CCDS42046.1	15	.	.	.	.	.	.	.	.	.	.	G	39	7.813780	0.98504	.	.	ENSG00000128923	ENST00000316848;ENST00000450403	.	.	.	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-26.7496	17.9721	0.89116	0.0:0.0:1.0:0.0	.	.	.	.	X	252	.	ENSP00000326194:E252X	E	+	1	0	FAM63B	56851640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.701000	0.98710	2.221000	0.72209	0.585000	0.79938	GAA	FAM63B	-	NULL	ENSG00000128923		0.572	FAM63B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM63B	HGNC	protein_coding	OTTHUMT00000416230.1	-	0.00	59	0	G	NM_019092		59064348	+1	tier1	-	no_errors	ENST00000559228	ensembl	human	known	74_37	nonsense	19.23	42	10	SNP	1.000	T
FANK1	92565	genome.wustl.edu	37	10	127693499	127693499	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr10:127693499C>T	ENST00000368693.1	+	7	690	c.586C>T	c.(586-588)Ctc>Ttc	p.L196F	FANK1_ENST00000477963.1_3'UTR|FANK1_ENST00000368695.1_Missense_Mutation_p.L190F			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	196						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				TGTGAAATATCTCCGAAGACA	0.517																																																	0													172.0	163.0	166.0					10																	127693499		2203	4300	6503	SO:0001583	missense	0			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.586C>T	10.37:g.127693499C>T	ENSP00000357682:p.Leu196Phe		Q6UXY9|Q6X7T6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3,prints_Ankyrin_rpt	p.L196F	ENST00000368693.1	37	c.586	CCDS31309.1	10	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940403	0.73557	.	.	ENSG00000203780	ENST00000368695;ENST00000368693;ENST00000368691;ENST00000368692	T;T;T	0.80393	-1.37;-1.37;-1.37	5.79	5.79	0.91817	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000013	D	0.90741	0.7094	M	0.90483	3.12	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	D	0.91689	0.5364	10	0.66056	D	0.02	-21.3551	12.1794	0.54204	0.0:0.9213:0.0:0.0787	.	222;196;196	Q8TC84-3;Q8TC84-2;Q8TC84	.;.;FANK1_HUMAN	F	190;196;174;222	ENSP00000357684:L190F;ENSP00000357682:L196F;ENSP00000357680:L174F	ENSP00000357680:L174F	L	+	1	0	FANK1	127683489	0.997000	0.39634	0.970000	0.41538	0.687000	0.40016	3.593000	0.54001	2.733000	0.93635	0.655000	0.94253	CTC	FANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000203780		0.517	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FANK1	HGNC	protein_coding		-	0.00	79	0	C	NM_145235		127693499	+1	tier1	-	no_errors	ENST00000368693	ensembl	human	known	74_37	missense	17.39	57	12	SNP	0.994	T
FBXO25	26260	genome.wustl.edu	37	8	408445	408445	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:408445G>T	ENST00000276326.5	+	8	856	c.737G>T	c.(736-738)gGa>gTa	p.G246V	FBXO25_ENST00000352684.2_Missense_Mutation_p.G179V|FBXO25_ENST00000382824.1_Missense_Mutation_p.G179V|FBXO25_ENST00000350302.3_Missense_Mutation_p.G246V|FBXO25_ENST00000519376.1_3'UTR	NM_183421.1	NP_904357.1	Q8TCJ0	FBX25_HUMAN	F-box protein 25	246	F-box.				protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		TTCTCAGACGGATGGGACATC	0.483																																																	0													210.0	165.0	180.0					8																	408445		2203	4300	6503	SO:0001583	missense	0			AF174605	CCDS5952.1, CCDS5953.1, CCDS5954.1	8p23.3	2007-03-30	2004-06-15		ENSG00000147364	ENSG00000147364		"""F-boxes /  ""other"""""	13596	protein-coding gene	gene with protein product		609098	"""F-box only protein 25"""			10531035, 10531037	Standard	NM_012173		Approved	FBX25	uc003wox.3	Q8TCJ0	OTTHUMG00000090341	ENST00000276326.5:c.737G>T	8.37:g.408445G>T	ENSP00000276326:p.Gly246Val		Q6PJ83|Q7Z4V4|Q9UKB8	Missense_Mutation	SNP	superfamily_F-box_dom	p.G246V	ENST00000276326.5	37	c.737	CCDS5953.1	8	.	.	.	.	.	.	.	.	.	.	G	15.37	2.813424	0.50527	.	.	ENSG00000147364	ENST00000350302;ENST00000352684;ENST00000276326;ENST00000382824	T;T;T;T	0.19938	2.11;2.11;2.11;2.11	4.32	4.32	0.51571	F-box domain, Skp2-like (1);	0.052813	0.64402	D	0.000001	T	0.30947	0.0781	L	0.52573	1.65	0.80722	D	1	P;D;D	0.61080	0.775;0.989;0.989	B;P;P	0.56700	0.436;0.804;0.804	T	0.01557	-1.1325	10	0.39692	T	0.17	-27.8126	10.6767	0.45789	0.0:0.1952:0.8048:0.0	.	179;246;246	Q8TCJ0-3;Q8TCJ0-2;Q8TCJ0	.;.;FBX25_HUMAN	V	246;179;246;179	ENSP00000342077:G246V;ENSP00000341345:G179V;ENSP00000276326:G246V;ENSP00000372274:G179V	ENSP00000276326:G246V	G	+	2	0	FBXO25	398445	1.000000	0.71417	0.612000	0.29024	0.929000	0.56500	4.568000	0.60857	2.089000	0.63090	0.591000	0.81541	GGA	FBXO25	-	superfamily_F-box_dom	ENSG00000147364		0.483	FBXO25-001	KNOWN	basic|CCDS	protein_coding	FBXO25	HGNC	protein_coding	OTTHUMT00000206710.2		0.00	52	0	G	NM_012173		408445	+1			no_errors	ENST00000276326	ensembl	human	known	74_37	missense	5.17	54	3	SNP	0.999	T
FCN1	2219	genome.wustl.edu	37	9	137801649	137801649	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr9:137801649C>T	ENST00000371806.3	-	9	1067	c.976G>A	c.(976-978)Gcc>Acc	p.A326T		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	326	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.|P domain.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)	p.A326T(1)		endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		CCCGTCTAGGCGGGCCGCACC	0.597																																																	1	Substitution - Missense(1)	endometrium(1)											59.0	61.0	60.0					9																	137801649		2203	4300	6503	SO:0001583	missense	0			D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.976G>A	9.37:g.137801649C>T	ENSP00000360871:p.Ala326Thr		Q5VYV5|Q92596	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Collagen,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.A326T	ENST00000371806.3	37	c.976	CCDS6985.1	9	.	.	.	.	.	.	.	.	.	.	C	8.112	0.779109	0.16120	.	.	ENSG00000085265	ENST00000371806	D	0.84873	-1.91	3.13	-3.57	0.04612	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (3);	.	.	.	.	T	0.63283	0.2498	N	0.04245	-0.25	0.09310	N	1	B	0.22346	0.068	B	0.15052	0.012	T	0.48917	-0.8992	9	0.33141	T	0.24	.	6.3362	0.21296	0.0:0.5338:0.1717:0.2945	.	326	O00602	FCN1_HUMAN	T	326	ENSP00000360871:A326T	ENSP00000360871:A326T	A	-	1	0	FCN1	136941470	0.000000	0.05858	0.005000	0.12908	0.308000	0.27856	-0.449000	0.06812	-0.902000	0.03886	-0.492000	0.04666	GCC	FCN1	-	superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000085265		0.597	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCN1	HGNC	protein_coding	OTTHUMT00000054963.1	-	0.00	39	0	C	NM_002003		137801649	-1	tier1	-	no_errors	ENST00000371806	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.113	T
FGD5	152273	genome.wustl.edu	37	3	14860755	14860755	+	Silent	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:14860755G>A	ENST00000285046.5	+	1	287	c.177G>A	c.(175-177)tcG>tcA	p.S59S	FGD5_ENST00000543601.1_5'Flank	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	59	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GCTCTGAGTCGGAGACCGACG	0.607																																																	0													41.0	43.0	42.0					3																	14860755		692	1591	2283	SO:0001819	synonymous_variant	0			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.177G>A	3.37:g.14860755G>A			B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S59	ENST00000285046.5	37	c.177	CCDS46767.1	3																																																																																			FGD5	-	NULL	ENSG00000154783		0.607	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	-	0.00	17	0	G	NM_152536		14860755	+1	tier1	-	no_errors	ENST00000285046	ensembl	human	known	74_37	silent	22.22	14	4	SNP	0.000	A
FLT3	2322	genome.wustl.edu	37	13	28623601	28623601	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr13:28623601G>T	ENST00000241453.7	-	8	1037	c.956C>A	c.(955-957)tCa>tAa	p.S319*	FLT3_ENST00000537084.1_Nonsense_Mutation_p.S319*|FLT3_ENST00000380982.4_Nonsense_Mutation_p.S319*	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	319	Ig-like C2-type.				B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTTGCCACTGATGATACAAA	0.413			"""Mis, O"""		"""AML, ALL"""																																			Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													190.0	170.0	177.0					13																	28623601		2203	4300	6503	SO:0001587	stop_gained	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.956C>A	13.37:g.28623601G>T	ENSP00000241453:p.Ser319*		A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S319*	ENST00000241453.7	37	c.956	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	G	38	6.673468	0.97751	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	.	.	.	5.62	5.62	0.85841	.	0.106952	0.42682	D	0.000679	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.1787	0.86849	0.0:0.0:1.0:0.0	.	.	.	.	X	319	.	ENSP00000241453:S319X	S	-	2	0	FLT3	27521601	1.000000	0.71417	0.997000	0.53966	0.903000	0.53119	5.769000	0.68865	2.809000	0.96659	0.655000	0.94253	TCA	FLT3	-	pfam_Immunoglobulin,pfscan_Ig-like_dom	ENSG00000122025		0.413	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	-	0.00	58	0	G			28623601	-1	tier1	-	no_errors	ENST00000380982	ensembl	human	known	74_37	nonsense	9.52	38	4	SNP	1.000	T
FMN2	56776	genome.wustl.edu	37	1	240519208	240519208	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:240519208G>T	ENST00000319653.9	+	14	5088	c.4858G>T	c.(4858-4860)Gcc>Tcc	p.A1620S	FMN2_ENST00000545751.1_Splice_Site_p.A216S	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1620	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TATTATTCAAGGTAAATTCCA	0.308																																																	0													63.0	58.0	60.0					1																	240519208		2203	4300	6503	SO:0001630	splice_region_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4858+1G>T	1.37:g.240519208G>T			B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.A1620S	ENST00000319653.9	37	c.4858	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488918	0.64074	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355;ENST00000406993	T;T	0.24723	1.84;1.84	5.93	5.93	0.95920	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.56097	D	0.000022	T	0.50514	0.1620	L	0.58510	1.815	0.80722	D	1	B;B;D	0.64830	0.136;0.136;0.994	B;B;D	0.74023	0.049;0.049;0.982	T	0.40961	-0.9535	10	0.66056	D	0.02	.	19.9643	0.97261	0.0:0.0:1.0:0.0	.	216;249;1620	B4DP05;B4DN09;Q9NZ56	.;.;FMN2_HUMAN	S	1620;216;247;96	ENSP00000318884:A1620S;ENSP00000437918:A216S	ENSP00000318884:A1620S	A	+	1	0	FMN2	238585831	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.618000	0.74214	2.826000	0.97356	0.655000	0.94253	GCC	FMN2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000155816		0.308	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2		0.00	19	0	G	XM_371352	Missense_Mutation	240519208	+1			no_errors	ENST00000319653	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	T
FOXP1	27086	genome.wustl.edu	37	3	71008341	71008342	+	3'UTR	INS	-	-	T	rs543490335|rs398062446|rs112773801|rs202147567	byFrequency	TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:71008341_71008342insT	ENST00000318789.4	-	0	2615_2616				FOXP1_ENST00000475937.1_3'UTR|FOXP1_ENST00000491238.1_Intron	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		CTTTTGACGTGTTTTTTTTTTT	0.411			T	PAX5	ALL								|||unknown(HR)	1601	0.319688	0.4236	0.1859	5008	,	,		19556	0.4514		0.1342	False		,,,				2504	0.3292							Dom	yes		3	3p14.1	27086	forkhead box P1		L	0																																										SO:0001624	3_prime_UTR_variant	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.*57->A	3.37:g.71008352_71008352dupT			A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	RNA	INS	-	NULL	ENST00000318789.4	37	NULL	CCDS2914.1	3																																																																																			FOXP1	-	-	ENSG00000114861		0.411	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1		0.00	39	0	-	NM_032682		71008342	-1	tier1		no_errors	ENST00000460805	ensembl	human	known	74_37	rna	16.67	25	5	INS	0.616:0.439	T
FOXR1	283150	genome.wustl.edu	37	11	118849880	118849880	+	Missense_Mutation	SNP	G	G	A	rs144422939		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:118849880G>A	ENST00000317011.3	+	3	575	c.350G>A	c.(349-351)cGg>cAg	p.R117Q		NM_181721.2	NP_859072.1	Q6PIV2	FOXR1_HUMAN	forkhead box R1	117					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		TCTCCCCCTCGGAAGCGGTTT	0.617																																																	0								G	GLN/ARG	1,4399	2.1+/-5.4	0,1,2199	56.0	54.0	55.0		350	-8.5	0.0	11	dbSNP_134	55	0,8586		0,0,4293	no	missense	FOXR1	NM_181721.2	43	0,1,6492	AA,AG,GG		0.0,0.0227,0.0077	benign	117/293	118849880	1,12985	2200	4293	6493	SO:0001583	missense	0			AB094092	CCDS31688.1	11q23.3	2008-02-05			ENSG00000176302	ENSG00000176302		"""Forkhead boxes"""	29980	protein-coding gene	gene with protein product		615755				15067358	Standard	XM_005271514		Approved	DLNB13, FOXN5	uc001pui.3	Q6PIV2	OTTHUMG00000166347	ENST00000317011.3:c.350G>A	11.37:g.118849880G>A	ENSP00000314806:p.Arg117Gln		B0YJ15|Q08AS8|Q86UT9|Q8IXX2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R117Q	ENST00000317011.3	37	c.350	CCDS31688.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.094|4.094	0.015464|0.015464	0.07959|0.07959	2.27E-4|2.27E-4	0.0|0.0	ENSG00000176302|ENSG00000176302	ENST00000533282|ENST00000317011	.|D	.|0.94497	.|-3.44	4.25|4.25	-8.51|-8.51	0.00923|0.00923	.|.	.|4.066770	.|0.00166	.|N	.|0.000015	D|D	0.84768|0.84768	0.5545|0.5545	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.79971|0.79971	-0.1578|-0.1578	5|10	.|0.02654	.|T	.|1	.|.	3.2509|3.2509	0.06814|0.06814	0.4594:0.2969:0.1437:0.0999|0.4594:0.2969:0.1437:0.0999	.|.	.|117	.|Q6PIV2	.|FOXR1_HUMAN	R|Q	98|117	.|ENSP00000314806:R117Q	.|ENSP00000314806:R117Q	G|R	+|+	1|2	0|0	FOXR1|FOXR1	118355090|118355090	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	-2.703000|-2.703000	0.00822|0.00822	-2.408000|-2.408000	0.00573|0.00573	-1.267000|-1.267000	0.01435|0.01435	GGA|CGG	FOXR1	-	NULL	ENSG00000176302		0.617	FOXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXR1	HGNC	protein_coding	OTTHUMT00000389312.1	-	0.00	56	0	G	NM_181721		118849880	+1	tier1	rs144422939	no_errors	ENST00000317011	ensembl	human	known	74_37	missense	14.55	47	8	SNP	0.000	A
FOXR1	283150	genome.wustl.edu	37	11	118850345	118850345	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:118850345G>C	ENST00000317011.3	+	4	803	c.578G>C	c.(577-579)gGc>gCc	p.G193A		NM_181721.2	NP_859072.1	Q6PIV2	FOXR1_HUMAN	forkhead box R1	193					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		TCCCCCTGTGGCCTCAACGTG	0.622																																																	0													64.0	70.0	68.0					11																	118850345		2200	4295	6495	SO:0001583	missense	0			AB094092	CCDS31688.1	11q23.3	2008-02-05			ENSG00000176302	ENSG00000176302		"""Forkhead boxes"""	29980	protein-coding gene	gene with protein product		615755				15067358	Standard	XM_005271514		Approved	DLNB13, FOXN5	uc001pui.3	Q6PIV2	OTTHUMG00000166347	ENST00000317011.3:c.578G>C	11.37:g.118850345G>C	ENSP00000314806:p.Gly193Ala		B0YJ15|Q08AS8|Q86UT9|Q8IXX2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G193A	ENST00000317011.3	37	c.578	CCDS31688.1	11	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174155	0.78452	.	.	ENSG00000176302	ENST00000317011	D	0.95307	-3.67	5.74	5.74	0.90152	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.156453	0.56097	D	0.000023	D	0.94751	0.8306	L	0.33093	0.98	0.49915	D	0.999836	D	0.76494	0.999	D	0.73708	0.981	D	0.91747	0.5409	10	0.11485	T	0.65	.	17.4244	0.87522	0.0:0.0:1.0:0.0	.	193	Q6PIV2	FOXR1_HUMAN	A	193	ENSP00000314806:G193A	ENSP00000314806:G193A	G	+	2	0	FOXR1	118355555	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.461000	0.80834	2.728000	0.93425	0.650000	0.86243	GGC	FOXR1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000176302		0.622	FOXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXR1	HGNC	protein_coding	OTTHUMT00000389312.1	-	0.00	75	0	G	NM_181721		118850345	+1	tier1	-	no_errors	ENST00000317011	ensembl	human	known	74_37	missense	22.54	55	16	SNP	1.000	C
FREM2	341640	genome.wustl.edu	37	13	39265254	39265254	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr13:39265254T>C	ENST00000280481.7	+	1	3989	c.3773T>C	c.(3772-3774)aTa>aCa	p.I1258T		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1258					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GATCAGATCATAGAGAGTTCC	0.423																																																	0													206.0	201.0	203.0					13																	39265254		2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3773T>C	13.37:g.39265254T>C	ENSP00000280481:p.Ile1258Thr		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.I1258T	ENST00000280481.7	37	c.3773	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	T	1.719	-0.497129	0.04291	.	.	ENSG00000150893	ENST00000280481	T	0.37584	1.19	6.01	4.85	0.62838	Cadherin (1);	0.314346	0.38959	N	0.001512	T	0.14874	0.0359	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.06409	-1.0828	10	0.29301	T	0.29	.	1.2266	0.01934	0.1667:0.1267:0.1751:0.5315	.	1258	Q5SZK8	FREM2_HUMAN	T	1258	ENSP00000280481:I1258T	ENSP00000280481:I1258T	I	+	2	0	FREM2	38163254	0.004000	0.15560	1.000000	0.80357	0.994000	0.84299	0.053000	0.14184	2.306000	0.77630	0.533000	0.62120	ATA	FREM2	-	superfamily_Cadherin-like	ENSG00000150893		0.423	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	54	0	T	NM_207361		39265254	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	10.00	63	7	SNP	0.078	C
FRK	2444	genome.wustl.edu	37	6	116277717	116277717	+	Missense_Mutation	SNP	G	G	T	rs369393469		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:116277717G>T	ENST00000606080.1	-	5	1302	c.856C>A	c.(856-858)Cat>Aat	p.H286N	FRK_ENST00000538210.1_Missense_Mutation_p.H144N	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	286	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	AGCTTTGGATGTCTTAGGTTC	0.378																																																	0													145.0	153.0	150.0					6																	116277717		2203	4300	6503	SO:0001583	missense	0			U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.856C>A	6.37:g.116277717G>T	ENSP00000476145:p.His286Asn		B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.H286N	ENST00000606080.1	37	c.856	CCDS5103.1	6	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677767	0.88445	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	T;T	0.53206	0.63;0.63	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.66577	0.2803	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68903	-0.5286	10	0.87932	D	0	.	19.9189	0.97077	0.0:0.0:1.0:0.0	.	286	P42685	FRK_HUMAN	N	286;144	ENSP00000357615:H286N;ENSP00000443075:H144N	ENSP00000357615:H286N	H	-	1	0	FRK	116384410	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.707000	0.92482	0.655000	0.94253	CAT	FRK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000111816		0.378	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRK	HGNC	protein_coding	OTTHUMT00000041924.2	-	0.00	40	0	G	NM_002031		116277717	-1	tier1	-	no_errors	ENST00000606080	ensembl	human	known	74_37	missense	5.49	86	5	SNP	1.000	T
FRMD6	122786	genome.wustl.edu	37	14	52174919	52174919	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:52174919G>A	ENST00000344768.5	+	7	878	c.682G>A	c.(682-684)Gac>Aac	p.D228N	FRMD6_ENST00000395718.2_Missense_Mutation_p.D220N|FRMD6_ENST00000554167.1_Missense_Mutation_p.D151N|FRMD6_ENST00000356218.4_Missense_Mutation_p.D220N			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	228	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					CCGACTGGATGACGTCGCTGT	0.398																																																	0													89.0	77.0	81.0					14																	52174919		2203	4300	6503	SO:0001583	missense	0			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.682G>A	14.37:g.52174919G>A	ENSP00000343899:p.Asp228Asn		D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.D228N	ENST00000344768.5	37	c.682	CCDS58318.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.352482	0.95830	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000557405	D;D;D;D;T	0.82081	-1.57;-1.57;-1.57;-1.57;-1.27	5.57	5.57	0.84162	Band 4.1 domain (1);FERM central domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.91216	0.7232	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.87578	0.982;0.994;0.998	D	0.90931	0.4790	10	0.52906	T	0.07	.	19.5302	0.95226	0.0:0.0:1.0:0.0	.	151;228;220	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	N	220;220;228;151;118	ENSP00000348550:D220N;ENSP00000379068:D220N;ENSP00000343899:D228N;ENSP00000451977:D151N;ENSP00000450667:D118N	ENSP00000343899:D228N	D	+	1	0	FRMD6	51244669	1.000000	0.71417	0.909000	0.35828	0.757000	0.42996	9.869000	0.99810	2.633000	0.89246	0.591000	0.81541	GAC	FRMD6	-	pfam_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000139926		0.398	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	HGNC	protein_coding	OTTHUMT00000276881.1	-	0.00	41	0	G	NM_152330		52174919	+1	tier1	-	no_errors	ENST00000344768	ensembl	human	known	74_37	missense	36.00	15	9	SNP	1.000	A
FZD9	8326	genome.wustl.edu	37	7	72849811	72849811	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:72849811G>A	ENST00000344575.3	+	1	1703	c.1474G>A	c.(1474-1476)Gga>Aga	p.G492R		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	492					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				CGCGGGGCCCGGAGGCCGGAG	0.652																																					Pancreas(144;909 1878 36867 38226 39554)												0													28.0	31.0	30.0					7																	72849811		2198	4297	6495	SO:0001583	missense	0			U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.1474G>A	7.37:g.72849811G>A	ENSP00000345785:p.Gly492Arg			Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.G492R	ENST00000344575.3	37	c.1474	CCDS5548.1	7	.	.	.	.	.	.	.	.	.	.	G	7.667	0.686159	0.14973	.	.	ENSG00000188763	ENST00000344575	D	0.81908	-1.55	4.88	4.88	0.63580	GPCR, family 2-like (1);	0.239110	0.19239	U	0.119218	T	0.75102	0.3804	L	0.40543	1.245	0.48696	D	0.999698	B	0.23185	0.081	B	0.16722	0.016	T	0.69168	-0.5216	10	0.17369	T	0.5	.	13.553	0.61743	0.0:0.1692:0.8308:0.0	.	492	O00144	FZD9_HUMAN	R	492	ENSP00000345785:G492R	ENSP00000345785:G492R	G	+	1	0	FZD9	72487747	0.973000	0.33851	0.434000	0.26772	0.534000	0.34807	2.663000	0.46774	2.261000	0.74972	0.563000	0.77884	GGA	FZD9	-	pfam_Frizzled,pfscan_GPCR_2-like	ENSG00000188763		0.652	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD9	HGNC	protein_coding	OTTHUMT00000252120.1		0.00	40	0	G			72849811	+1			no_errors	ENST00000344575	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.962	A
G6PC3	92579	genome.wustl.edu	37	17	42153234	42153234	+	Silent	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:42153234G>T	ENST00000269097.4	+	6	1095	c.864G>T	c.(862-864)gtG>gtT	p.V288V		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	288					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)			endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCTGCCTTGTGCTGGCCATGG	0.622																																																	0													64.0	62.0	63.0					17																	42153234		2203	4300	6503	SO:0001819	synonymous_variant	0			BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.864G>T	17.37:g.42153234G>T			Q8WU15	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase,pirsf_Glucose-6-phosphatase	p.V288	ENST00000269097.4	37	c.864	CCDS11476.1	17																																																																																			G6PC3	-	pirsf_Glucose-6-phosphatase	ENSG00000141349		0.622	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G6PC3	HGNC	protein_coding	OTTHUMT00000457675.1	-	0.00	77	0	G	NM_138387		42153234	+1	tier1	-	no_errors	ENST00000269097	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.995	T
GCSAML	148823	genome.wustl.edu	37	1	247737631	247737631	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:247737631A>T	ENST00000366488.4	+	5	459	c.355A>T	c.(355-357)Agg>Tgg	p.R119W	GCSAML_ENST00000463359.1_Missense_Mutation_p.R87W|GCSAML_ENST00000527084.1_Missense_Mutation_p.R87W|GCSAML_ENST00000366491.2_Missense_Mutation_p.R99W|GCSAML_ENST00000527541.1_Missense_Mutation_p.R87W|GCSAML_ENST00000536561.1_Missense_Mutation_p.R99W|GCSAML_ENST00000366489.1_Missense_Mutation_p.R99W|RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001281836.1|NM_001281837.1|NM_001281853.1|NM_145278.3	NP_001268765.1|NP_001268766.1|NP_001268782.1|NP_660321.1	Q5JQS6	GSAML_HUMAN	germinal center-associated, signaling and motility-like	119																	TTCTGTTAGTAGGCCTTGTTC	0.428																																																	0													157.0	132.0	141.0					1																	247737631		2203	4300	6503	SO:0001583	missense	0			AK126682	CCDS1635.1, CCDS60470.1, CCDS73058.1	1q44	2012-08-23	2012-08-23	2012-08-23	ENSG00000169224	ENSG00000169224			29583	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 150"""	C1orf150			Standard	NM_001281834		Approved	FLJ44728	uc001idf.3	Q5JQS6	OTTHUMG00000040648	ENST00000366488.4:c.355A>T	1.37:g.247737631A>T	ENSP00000355444:p.Arg119Trp		B2R4Y5|B3KX46|Q5JQT3	Missense_Mutation	SNP	NULL	p.R119W	ENST00000366488.4	37	c.355	CCDS1635.1	1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.814629	0.50527	.	.	ENSG00000169224	ENST00000527084;ENST00000527541;ENST00000366491;ENST00000366489;ENST00000463359;ENST00000366488;ENST00000536561	.	.	.	3.91	-3.22	0.05125	.	0.941962	0.08722	N	0.903241	T	0.42899	0.1223	M	0.61703	1.905	0.09310	N	1	D	0.69078	0.997	P	0.60173	0.87	T	0.39035	-0.9633	9	0.72032	D	0.01	0.4192	0.9076	0.01288	0.3249:0.1772:0.3249:0.173	.	119	Q5JQS6	CA150_HUMAN	W	87;87;99;99;87;119;99	.	ENSP00000355444:R119W	R	+	1	2	C1orf150	245804254	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.026000	0.12392	-0.369000	0.08028	0.482000	0.46254	AGG	GCSAML	-	NULL	ENSG00000169224		0.428	GCSAML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCSAML	HGNC	protein_coding	OTTHUMT00000097745.4	-	0.00	65	0	A	NM_145278		247737631	+1	tier1	-	no_errors	ENST00000366488	ensembl	human	known	74_37	missense	21.15	41	11	SNP	0.000	T
GLIPR1L1	256710	genome.wustl.edu	37	12	75728663	75728663	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:75728663C>T	ENST00000378695.4	+	1	245	c.155C>T	c.(154-156)gCg>gTg	p.A52V	GLIPR1L1_ENST00000312442.2_Missense_Mutation_p.A52V|CAPS2_ENST00000442339.2_Intron			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	52	SCP.				binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)		p.A52V(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						AACCCTCCCGCGGCCGACATG	0.483											OREG0021998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	prostate(1)											75.0	74.0	74.0					12																	75728663		2203	4300	6503	SO:0001583	missense	0			BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755	ENST00000378695.4:c.155C>T	12.37:g.75728663C>T	ENSP00000367967:p.Ala52Val	1162	Q96L06	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.A52V	ENST00000378695.4	37	c.155		12	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584112	0.65992	.	.	ENSG00000173401	ENST00000378695;ENST00000312442	T;T	0.62232	0.04;0.04	4.81	3.88	0.44766	CAP domain (3);	0.067701	0.64402	D	0.000018	D	0.83599	0.5289	H	0.95365	3.66	0.36857	D	0.888194	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.948	D	0.89785	0.3964	10	0.87932	D	0	.	12.292	0.54823	0.0:0.8296:0.1704:0.0	.	52;52	Q6UWM5;Q6UWM5-2	GPRL1_HUMAN;.	V	52	ENSP00000367967:A52V;ENSP00000310770:A52V	ENSP00000310770:A52V	A	+	2	0	GLIPR1L1	74014930	0.896000	0.30565	0.060000	0.19600	0.055000	0.15305	2.747000	0.47475	2.225000	0.72522	0.563000	0.77884	GCG	GLIPR1L1	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000173401		0.483	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	GLIPR1L1	HGNC	protein_coding	OTTHUMT00000405714.1		0.00	93	0	C	NM_152779		75728663	+1			no_errors	ENST00000378695	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.417	T
GNAQ	2776	genome.wustl.edu	37	9	80409502	80409502	+	Silent	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr9:80409502G>A	ENST00000286548.4	-	5	834	c.612C>T	c.(610-612)gtC>gtT	p.V204V	GNAQ_ENST00000397476.3_Silent_p.V2V	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	204					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.V204V(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						CCCCTACATCGACCATTCTGC	0.333			Mis		uveal melanoma																																			Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	1	Substitution - coding silent(1)	endometrium(1)											88.0	87.0	87.0					9																	80409502		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.612C>T	9.37:g.80409502G>A			O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Silent	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q,prints_Fungi_Gprotein_alpha	p.V204	ENST00000286548.4	37	c.612	CCDS6658.1	9																																																																																			GNAQ	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su	ENSG00000156052		0.333	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAQ	HGNC	protein_coding	OTTHUMT00000052761.1		0.00	17	0	G	NM_002072		80409502	-1			no_errors	ENST00000286548	ensembl	human	known	74_37	silent	6.06	30	2	SNP	1.000	A
GOLGB1	2804	genome.wustl.edu	37	3	121448073	121448073	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:121448073G>C	ENST00000340645.5	-	4	489	c.364C>G	c.(364-366)Ctg>Gtg	p.L122V	GOLGB1_ENST00000472829.1_5'UTR|GOLGB1_ENST00000393667.3_Missense_Mutation_p.L122V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	122					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCTGTAGGCAGAACAGTCCCT	0.373																																																	0													149.0	137.0	141.0					3																	121448073		2203	4300	6503	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.364C>G	3.37:g.121448073G>C	ENSP00000341848:p.Leu122Val		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.L122V	ENST00000340645.5	37	c.364	CCDS3004.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.27|10.27	1.303293|1.303293	0.23736|0.23736	.|.	.|.	ENSG00000173230|ENSG00000173230	ENST00000489400|ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	.|T;T;T	.|0.26067	.|2.44;2.44;1.76	5.48|5.48	0.335|0.335	0.15953|0.15953	.|.	.|1.215190	.|0.06176	.|N	.|0.678550	T|T	0.17365|0.17365	0.0417|0.0417	L|L	0.28740|0.28740	0.885|0.885	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.12630	.|0.006;0.006;0.006;0.006;0.006	.|B;B;B;B;B	.|0.13407	.|0.009;0.009;0.009;0.009;0.009	T|T	0.30765|0.30765	-0.9967|-0.9967	5|10	.|0.30078	.|T	.|0.28	.|.	4.7928|4.7928	0.13257|0.13257	0.3324:0.0:0.5248:0.1428|0.3324:0.0:0.5248:0.1428	.|.	.|83;122;122;122;122	.|F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.|.;.;.;.;GOGB1_HUMAN	L|V	67|122;122;122;9	.|ENSP00000341848:L122V;ENSP00000377275:L122V;ENSP00000418231:L122V	.|ENSP00000341848:L122V	F|L	-|-	3|1	2|2	GOLGB1|GOLGB1	122930763|122930763	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.494000|0.494000	0.33585|0.33585	-0.899000|-0.899000	0.04101|0.04101	0.059000|0.059000	0.16252|0.16252	0.591000|0.591000	0.81541|0.81541	TTC|CTG	GOLGB1	-	NULL	ENSG00000173230		0.373	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	-	0.00	40	0	G	NM_004487		121448073	-1	tier1	-	no_errors	ENST00000340645	ensembl	human	known	74_37	missense	12.86	61	9	SNP	0.000	C
GPR110	266977	genome.wustl.edu	37	6	46984422	46984422	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:46984422C>A	ENST00000371253.2	-	8	909	c.694G>T	c.(694-696)Gag>Tag	p.E232*	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Nonsense_Mutation_p.E35*	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	232	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						TTAGCCTTCTCGGCAACATGT	0.483																																																	0													105.0	89.0	94.0					6																	46984422		2203	4300	6503	SO:0001587	stop_gained	0			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.694G>T	6.37:g.46984422C>A	ENSP00000360299:p.Glu232*		Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.E232*	ENST00000371253.2	37	c.694	CCDS34471.1	6	.	.	.	.	.	.	.	.	.	.	C	3.754	-0.050962	0.07407	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	.	.	.	5.71	1.96	0.26148	.	0.758879	0.11938	N	0.515016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-1.6264	10.6501	0.45642	0.0:0.7074:0.0:0.2926	.	.	.	.	X	232;232;35	.	ENSP00000283297:E35X	E	-	1	0	GPR110	47092381	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.235000	0.17948	-0.104000	0.12154	-1.814000	0.00607	GAG	GPR110	-	pfam_SEA_dom	ENSG00000153292		0.483	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	HGNC	protein_coding	OTTHUMT00000040810.2	-	0.00	39	0	C	NM_153840		46984422	-1	tier1	-	no_errors	ENST00000371253	ensembl	human	known	74_37	nonsense	10.26	35	4	SNP	0.000	A
GPR12	2835	genome.wustl.edu	37	13	27333602	27333602	+	Silent	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr13:27333602G>A	ENST00000381436.2	-	1	825	c.363C>T	c.(361-363)gtC>gtT	p.V121V	GPR12_ENST00000405846.3_Silent_p.V121V			P47775	GPR12_HUMAN	G protein-coupled receptor 12	121					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		AGAAAGAGGCGACAATGAGGC	0.537																																																	0													118.0	106.0	110.0					13																	27333602		2203	4300	6503	SO:0001819	synonymous_variant	0			U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.363C>T	13.37:g.27333602G>A			Q5T8P3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR_3/6/12_orphan,prints_GPR12,prints_GPCR_Rhodpsn	p.V121	ENST00000381436.2	37	c.363	CCDS9319.1	13																																																																																			GPR12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000132975		0.537	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR12	HGNC	protein_coding	OTTHUMT00000044257.2	-	0.00	29	0	G			27333602	-1	tier1	-	no_errors	ENST00000381436	ensembl	human	known	74_37	silent	19.23	21	5	SNP	0.984	A
GRB7	2886	genome.wustl.edu	37	17	37902406	37902407	+	Frame_Shift_Ins	INS	-	-	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:37902406_37902407insC	ENST00000309156.4	+	14	1660_1661	c.1403_1404insC	c.(1402-1407)gtcctcfs	p.L469fs	GRB7_ENST00000445327.2_Frame_Shift_Ins_p.L492fs|GRB7_ENST00000394211.3_Frame_Shift_Ins_p.L469fs|GRB7_ENST00000309185.3_Frame_Shift_Ins_p.S439fs|GRB7_ENST00000394209.2_Frame_Shift_Ins_p.L469fs|GRB7_ENST00000394204.1_Frame_Shift_Ins_p.S439fs	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	469	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CAGGGCTTTGTCCTCTCTTTGT	0.594																																																	0																																										SO:0001589	frameshift_variant	0			D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.1405dupC	17.37:g.37902408_37902408dupC	ENSP00000310771:p.Leu469fs		B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Frame_Shift_Ins	INS	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.L492fs	ENST00000309156.4	37	c.1472_1473	CCDS11345.1	17																																																																																			GRB7	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000141738		0.594	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB7	HGNC	protein_coding	OTTHUMT00000257024.2		0.00	46	0	-	NM_005310		37902407	+1	tier1		no_errors	ENST00000445327	ensembl	human	known	74_37	frame_shift_ins	10.53	68	8	INS	1.000:0.998	C
GREB1L	80000	genome.wustl.edu	37	18	19024311	19024311	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr18:19024311G>T	ENST00000580732.2	+	11	1715	c.1334G>T	c.(1333-1335)aGc>aTc	p.S445I	GREB1L_ENST00000431264.1_Missense_Mutation_p.S445I|GREB1L_ENST00000424526.1_Missense_Mutation_p.S445I|GREB1L_ENST00000269218.6_Missense_Mutation_p.S445I|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000400483.4_Missense_Mutation_p.S445I			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	445						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						TTGACCGGCAGCCAATTTCTG	0.418																																																	0													226.0	188.0	200.0					18																	19024311		692	1591	2283	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.1334G>T	18.37:g.19024311G>T	ENSP00000464162:p.Ser445Ile		A4QN17|Q9H8F1	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.S445I	ENST00000580732.2	37	c.1334	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594876	0.28445	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.12465	3.41;3.43;2.68;2.68	6.08	5.19	0.71726	.	.	.	.	.	T	0.09862	0.0242	N	0.16166	0.38	0.31163	N	0.70417	B;B	0.28998	0.23;0.23	B;B	0.33521	0.165;0.106	T	0.07849	-1.0751	9	0.06494	T	0.89	-2.1924	17.1705	0.86828	0.0:0.1263:0.8737:0.0	.	445;445	Q9C091;Q9C091-2	GRB1L_HUMAN;.	I	445	ENSP00000412060:S445I;ENSP00000269218:S445I;ENSP00000383331:S445I;ENSP00000393125:S445I	ENSP00000269218:S445I	S	+	2	0	GREB1L	17278309	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	2.868000	0.48436	1.525000	0.49052	0.655000	0.94253	AGC	GREB1L	-	NULL	ENSG00000141449		0.418	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	-	0.00	82	0	G	NM_024935		19024311	+1	tier1	-	no_errors	ENST00000424526	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
H19	283120	genome.wustl.edu	37	11	2018528	2018528	+	RNA	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:2018528C>T	ENST00000390168.4	-	0	0					NR_030533.1				H19, imprinted maternally expressed transcript (non-protein coding)																		TCCTGCCCCTCTGCTGGGAGG	0.637									Beckwith-Wiedemann syndrome		OREG0003761	type=REGULATORY REGION|Gene=H19|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0																																												0	Familial Cancer Database	BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AF087017		11p15.5	2012-10-19	2008-06-04		ENSG00000130600	ENSG00000130600		"""Long non-coding RNAs"", ""-"""	4713	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 8"", ""long intergenic non-protein coding RNA 8"""	103280	"""H19, imprinted maternally expressed untranslated mRNA"""			2595451, 1688465	Standard	NR_002196		Approved	D11S813E, ASM, ASM1, NCRNA00008, LINC00008	uc021qby.1		OTTHUMG00000012477		11.37:g.2018528C>T		600		RNA	SNP	-	NULL	ENST00000390168.4	37	NULL		11																																																																																			H19	-	-	ENSG00000130600		0.637	H19-201	KNOWN	basic	miRNA	H19	HGNC	processed_transcript		-	0.00	10	0	C	NR_002196		2018528	-1	tier1	-	no_errors	ENST00000412788	ensembl	human	known	74_37	rna	30.77	9	4	SNP	0.001	T
HAS3	3038	genome.wustl.edu	37	16	69147378	69147378	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:69147378G>A	ENST00000306560.1	+	3	827	c.671G>A	c.(670-672)tGc>tAc	p.C224Y	HAS3_ENST00000219322.3_Missense_Mutation_p.C224Y|HAS3_ENST00000569188.1_Missense_Mutation_p.C224Y	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	224					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GATCCAGCCTGCACCATCGAG	0.612											OREG0023905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													112.0	101.0	104.0					16																	69147378		2198	4300	6498	SO:0001583	missense	0			BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.671G>A	16.37:g.69147378G>A	ENSP00000304440:p.Cys224Tyr	1112	A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.C224Y	ENST00000306560.1	37	c.671	CCDS10871.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.111767	0.94339	.	.	ENSG00000103044	ENST00000219322;ENST00000306560	D;T	0.84146	-1.81;0.36	5.65	5.65	0.86999	.	0.039308	0.85682	D	0.000000	D	0.90259	0.6954	L	0.55990	1.75	0.80722	D	1	D;P	0.53462	0.96;0.741	P;P	0.61003	0.882;0.717	D	0.90470	0.4452	10	0.87932	D	0	-14.9051	19.6915	0.96002	0.0:0.0:1.0:0.0	.	224;224	O00219;O00219-2	HAS3_HUMAN;.	Y	224	ENSP00000219322:C224Y;ENSP00000304440:C224Y	ENSP00000219322:C224Y	C	+	2	0	HAS3	67704879	0.999000	0.42202	1.000000	0.80357	0.978000	0.69477	2.800000	0.47900	2.824000	0.97209	0.655000	0.94253	TGC	HAS3	-	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	ENSG00000103044		0.612	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS3	HGNC	protein_coding	OTTHUMT00000268898.2	-	0.00	25	0	G	NM_138612		69147378	+1	tier1	-	no_errors	ENST00000306560	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	A
HAUS4	54930	genome.wustl.edu	37	14	23417124	23417124	+	Nonsense_Mutation	SNP	T	T	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:23417124T>A	ENST00000206474.7	-	7	913	c.661A>T	c.(661-663)Aag>Tag	p.K221*	HAUS4_ENST00000490506.1_Nonsense_Mutation_p.K97*|HAUS4_ENST00000342454.8_Nonsense_Mutation_p.K176*|HAUS4_ENST00000554446.1_Intron|HAUS4_ENST00000555986.1_Nonsense_Mutation_p.K176*|HAUS4_ENST00000397409.4_Intron|HAUS4_ENST00000347758.2_Intron|RP11-298I3.1_ENST00000548322.1_RNA|RP11-298I3.5_ENST00000555074.1_Missense_Mutation_p.E50V|HAUS4_ENST00000555367.1_Nonsense_Mutation_p.K176*|RP11-298I3.1_ENST00000548819.1_RNA|HAUS4_ENST00000541587.1_Nonsense_Mutation_p.K221*			Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	221					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|cervix(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)	14						ATCTGCTCCTTCTGCTGGCTC	0.557																																																	0													98.0	85.0	89.0					14																	23417124		2203	4300	6503	SO:0001587	stop_gained	0			AK000431	CCDS9580.1, CCDS53886.1	14q11.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000092036	ENSG00000092036		"""HAUS augmin-like complex subunits"""	20163	protein-coding gene	gene with protein product		613431	"""chromosome 14 open reading frame 94"""	C14orf94		19427217	Standard	NM_017815		Approved	FLJ20424	uc001wht.3	Q9H6D7	OTTHUMG00000028710	ENST00000206474.7:c.661A>T	14.37:g.23417124T>A	ENSP00000206474:p.Lys221*		B7WP17|D3DS34|Q86T15|Q86T16|Q86U43|Q9NX59	Nonsense_Mutation	SNP	NULL	p.K221*	ENST00000206474.7	37	c.661	CCDS9580.1	14	.	.	.	.	.	.	.	.	.	.	T	37	6.490991	0.97612	.	.	ENSG00000092036	ENST00000206474;ENST00000490506;ENST00000541587;ENST00000342454;ENST00000555367;ENST00000555986;ENST00000555040	.	.	.	5.24	-2.42	0.06542	.	0.437567	0.26899	N	0.021931	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.7745	8.5638	0.33527	0.0:0.0816:0.5634:0.355	.	.	.	.	X	221;97;221;176;176;176;221	.	ENSP00000206474:K221X	K	-	1	0	HAUS4	22486964	0.968000	0.33430	0.979000	0.43373	0.991000	0.79684	-0.123000	0.10611	-0.703000	0.05049	0.477000	0.44152	AAG	HAUS4	-	NULL	ENSG00000092036		0.557	HAUS4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS4	HGNC	protein_coding	OTTHUMT00000071680.3		0.00	30	0	T			23417124	-1			no_errors	ENST00000206474	ensembl	human	known	74_37	nonsense	17.86	23	5	SNP	0.993	A
HECW1	23072	genome.wustl.edu	37	7	43360233	43360233	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:43360233G>T	ENST00000395891.2	+	5	957		c.e5-1		HECW1_ENST00000453890.1_Splice_Site	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TGGGAATATAGATGAGGTCTT	0.428																																																	0													95.0	90.0	92.0					7																	43360233		1862	4104	5966	SO:0001630	splice_region_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.353-1G>T	7.37:g.43360233G>T			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Splice_Site	SNP	-	e3-1	ENST00000395891.2	37	c.353-1	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016374	0.93404	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3736	0.98901	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HECW1	43326758	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.696000	0.98695	2.820000	0.97059	0.650000	0.86243	.	HECW1	-	-	ENSG00000002746		0.428	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2		0.00	59	0	G	NM_015052	Intron	43360233	+1			no_errors	ENST00000395891	ensembl	human	known	74_37	splice_site	5.26	36	2	SNP	1.000	T
HORMAD2	150280	genome.wustl.edu	37	22	30572086	30572086	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr22:30572086G>T	ENST00000336726.6	+	11	1209	c.854G>T	c.(853-855)aGt>aTt	p.S285I	HORMAD2_ENST00000403975.1_Missense_Mutation_p.S285I	NM_152510.2	NP_689723.1	Q8N7B1	HORM2_HUMAN	HORMA domain containing 2	285					meiotic nuclear division (GO:0007126)|meiotic sister chromatid cohesion (GO:0051177)	chromosome (GO:0005694)|nucleus (GO:0005634)				large_intestine(1)|lung(1)	2			Epithelial(10;0.125)			AGTCAGCAAAGTTCTGAGTGC	0.383																																																	0													83.0	84.0	84.0					22																	30572086		1876	4121	5997	SO:0001583	missense	0			AK098703	CCDS46683.1	22q12.2	2014-01-21			ENSG00000176635	ENSG00000176635			28383	protein-coding gene	gene with protein product						12477932	Standard	NM_152510		Approved	MGC26710, CT46.2	uc003agy.3	Q8N7B1	OTTHUMG00000150881	ENST00000336726.6:c.854G>T	22.37:g.30572086G>T	ENSP00000336984:p.Ser285Ile		B5MEB2|Q8NHR2	Missense_Mutation	SNP	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	p.S285I	ENST00000336726.6	37	c.854	CCDS46683.1	22	.	.	.	.	.	.	.	.	.	.	G	8.522	0.868927	0.17322	.	.	ENSG00000176635	ENST00000336726;ENST00000403975;ENST00000481990	T;T	0.31510	1.49;1.49	5.86	-2.8	0.05823	.	1.027090	0.07674	N	0.935862	T	0.14657	0.0354	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.27872	-1.0061	10	0.40728	T	0.16	2.3319	0.3393	0.00331	0.3113:0.1327:0.2837:0.2723	.	285	Q8N7B1	HORM2_HUMAN	I	285;285;25	ENSP00000336984:S285I;ENSP00000385055:S285I	ENSP00000336984:S285I	S	+	2	0	HORMAD2	28902086	0.039000	0.19947	0.000000	0.03702	0.920000	0.55202	0.504000	0.22626	-0.370000	0.08016	-0.913000	0.02753	AGT	HORMAD2	-	NULL	ENSG00000176635		0.383	HORMAD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HORMAD2	HGNC	protein_coding	OTTHUMT00000320416.2	-	0.00	55	0	G	NM_152510		30572086	+1	tier1	-	no_errors	ENST00000336726	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.000	T
IDI1	3422	genome.wustl.edu	37	10	1089949	1089949	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr10:1089949G>T	ENST00000381344.3	-	2	469	c.303C>A	c.(301-303)aaC>aaA	p.N101K	RNU7-163P_ENST00000459467.1_RNA|IDI2-AS1_ENST00000420381.1_RNA|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI1_ENST00000491735.1_Intron|IDI2-AS1_ENST00000437374.1_RNA	NM_004508.2	NP_004499.2	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase 1	44	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.			A -> T (in Ref. 8; AAH19227). {ECO:0000305}.	cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isoprenoid biosynthetic process (GO:0008299)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)			large_intestine(3)|lung(2)|prostate(1)	6		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		CTTTCTCAATGTTCTCGTTCA	0.413																																																	0													157.0	144.0	149.0					10																	1089949		2203	4300	6503	SO:0001583	missense	0			BC006999	CCDS7056.1	10p15.3	2003-11-12	2005-07-25		ENSG00000067064	ENSG00000067064	5.3.3.2		5387	protein-coding gene	gene with protein product	"""IPP isomerase"""	604055	"""isopentenyl-diphosphate delta isomerase"""			8020941	Standard	NM_004508		Approved		uc001iga.3	Q13907	OTTHUMG00000017536	ENST00000381344.3:c.303C>A	10.37:g.1089949G>T	ENSP00000370748:p.Asn101Lys		B4E155|Q32Q13|Q53GQ6|Q86U81|Q8WUX8|Q96IZ4|Q9BQ74	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1	p.N101K	ENST00000381344.3	37	c.303	CCDS7056.1	10	.	.	.	.	.	.	.	.	.	.	G	14.29	2.492607	0.44352	.	.	ENSG00000067064	ENST00000381344;ENST00000429642	.	.	.	4.49	2.58	0.30949	.	0.000000	0.85682	D	0.000000	T	0.39572	0.1083	L	0.46614	1.455	0.58432	D	0.999999	P	0.39737	0.685	B	0.33890	0.172	T	0.31052	-0.9957	9	0.49607	T	0.09	-25.4578	8.7956	0.34876	0.2478:0.0:0.7522:0.0	.	101	Q13907-2	.	K	101;44	.	ENSP00000370748:N101K	N	-	3	2	IDI1	1079949	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.850000	0.48294	0.984000	0.38629	0.591000	0.81541	AAC	IDI1	-	superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1	ENSG00000067064		0.413	IDI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IDI1	HGNC	protein_coding	OTTHUMT00000046409.2	-	0.00	44	0	G	NM_004508		1089949	-1	tier1	-	no_errors	ENST00000381344	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
IDO1	3620	genome.wustl.edu	37	8	39771476	39771476	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:39771476G>T	ENST00000518237.1	+	1	674	c.35G>T	c.(34-36)aGt>aTt	p.S12I	RP11-44K6.3_ENST00000517623.1_RNA|RP11-44K6.2_ENST00000520185.1_RNA|IDO1_ENST00000522495.1_Missense_Mutation_p.S12I	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	12					cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	TGGACAATCAGTAAAGAGTAC	0.428																																																	0													83.0	82.0	83.0					8																	39771476		1939	4141	6080	SO:0001583	missense	0			M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.35G>T	8.37:g.39771476G>T	ENSP00000430950:p.Ser12Ile		Q540B4	Missense_Mutation	SNP	pfam_Indolamine_dOase	p.S12I	ENST00000518237.1	37	c.35	CCDS47847.1	8	.	.	.	.	.	.	.	.	.	.	G	9.045	0.990757	0.18966	.	.	ENSG00000131203	ENST00000518804;ENST00000519154;ENST00000522495;ENST00000522840;ENST00000518237	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.51	-10.5	0.00291	.	4.187620	0.00616	N	0.000436	T	0.18467	0.0443	N	0.17474	0.49	0.09310	N	1	B	0.17465	0.022	B	0.12837	0.008	T	0.09907	-1.0653	9	.	.	.	3.1058	1.6506	0.02771	0.4295:0.0937:0.2718:0.205	.	12	P14902	I23O1_HUMAN	I	12	ENSP00000429297:S12I;ENSP00000428716:S12I;ENSP00000430505:S12I;ENSP00000429933:S12I;ENSP00000430950:S12I	.	S	+	2	0	IDO1	39890633	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.736000	0.04882	-1.676000	0.01457	-0.353000	0.07706	AGT	IDO1	-	pfam_Indolamine_dOase	ENSG00000131203		0.428	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDO1	HGNC	protein_coding	OTTHUMT00000376987.1		0.00	70	0	G	NM_002164		39771476	+1			no_errors	ENST00000518237	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.000	T
IGFL4	444882	genome.wustl.edu	37	19	46544204	46544204	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:46544204G>A	ENST00000377697.1	-	1	70	c.17C>T	c.(16-18)tCt>tTt	p.S6F	IGFL4_ENST00000595006.1_Intron|IGFL4_ENST00000601672.1_Intron	NM_001002923.1	NP_001002923.1	Q6B9Z1	IGFL4_HUMAN	IGF-like family member 4	6						extracellular space (GO:0005615)				cervix(1)|kidney(1)|lung(1)	3		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		CTCCTTACCAGAAATTCTGGG	0.438																																																	0													55.0	51.0	52.0					19																	46544204		2203	4300	6503	SO:0001583	missense	0			AY672114	CCDS33057.1	19q13.32	2006-07-14							32931	protein-coding gene	gene with protein product		610547				14702039	Standard	NM_001002923		Approved		uc002pdy.1	Q6B9Z1		ENST00000377697.1:c.17C>T	19.37:g.46544204G>A	ENSP00000366926:p.Ser6Phe			Missense_Mutation	SNP	NULL	p.S6F	ENST00000377697.1	37	c.17	CCDS33057.1	19	.	.	.	.	.	.	.	.	.	.	A	2.352	-0.348563	0.05208	.	.	ENSG00000204869	ENST00000377697	T	0.21361	2.01	2.0	0.851	0.18989	.	.	.	.	.	T	0.06416	0.0165	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39663	-0.9603	9	0.08381	T	0.77	.	2.5419	0.04728	0.533:0.2868:0.1802:0.0	.	6	Q6B9Z1	IGFL4_HUMAN	F	6	ENSP00000366926:S6F	ENSP00000366926:S6F	S	-	2	0	IGFL4	51236044	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.019000	0.13444	-0.155000	0.11098	-0.720000	0.03607	TCT	IGFL4	-	NULL	ENSG00000204869		0.438	IGFL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IGFL4	HGNC	protein_coding	OTTHUMT00000461698.1		0.00	36	0	G	NM_001002923		46544204	-1			no_errors	ENST00000377697	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	A
IQCA1	79781	genome.wustl.edu	37	2	237406090	237406090	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:237406090C>T	ENST00000409907.3	-	2	326	c.52G>A	c.(52-54)Ggt>Agt	p.G18S	IQCA1_ENST00000309507.5_Missense_Mutation_p.G14S|IQCA1_ENST00000431676.2_Missense_Mutation_p.G18S	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	18							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						AGTAAAGCACCGAGGGCTTCT	0.373																																																	0													41.0	40.0	41.0					2																	237406090		1831	4081	5912	SO:0001583	missense	0			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.52G>A	2.37:g.237406090C>T	ENSP00000387347:p.Gly18Ser		B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.G18S	ENST00000409907.3	37	c.52	CCDS46549.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	2.007|2.007	-0.427912|-0.427912	0.04701|0.04701	.|.	.|.	ENSG00000132321|ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437|ENST00000418802	D;D;D|.	0.93426|.	-3.08;-3.07;-3.22|.	5.52|5.52	0.0505|0.0505	0.14293|0.14293	.|.	0.858042|.	0.10385|.	N|.	0.681127|.	T|T	0.07999|0.07999	0.0200|0.0200	N|N	0.01352|0.01352	-0.895|-0.895	0.09310|0.09310	N|N	1|1	B;B;B|.	0.06786|.	0.0;0.001;0.001|.	B;B;B|.	0.06405|.	0.001;0.002;0.002|.	T|T	0.32824|0.32824	-0.9892|-0.9892	10|5	0.08179|.	T|.	0.78|.	.|.	2.7466|2.7466	0.05268|0.05268	0.1097:0.2102:0.1129:0.5671|0.1097:0.2102:0.1129:0.5671	.|.	18;25;18|.	E7EWQ0;E9PH78;Q86XH1|.	.;.;IQCA1_HUMAN|.	S|Q	18;25;14;18;14|36	ENSP00000387347:G18S;ENSP00000311951:G14S;ENSP00000407213:G18S|.	ENSP00000254653:G18S|.	G|R	-|-	1|2	0|0	IQCA1|IQCA1	237070829|237070829	0.002000|0.002000	0.14202|0.14202	0.110000|0.110000	0.21437|0.21437	0.547000|0.547000	0.35210|0.35210	0.208000|0.208000	0.17415|0.17415	-0.165000|-0.165000	0.10908|0.10908	-1.088000|-1.088000	0.02184|0.02184	GGT|CGG	IQCA1	-	NULL	ENSG00000132321		0.373	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	HGNC	protein_coding	OTTHUMT00000329266.1	-	0.00	46	0	C	NM_024726		237406090	-1	tier1	-	no_errors	ENST00000409907	ensembl	human	known	74_37	missense	31.48	37	17	SNP	0.001	T
IRS4	8471	genome.wustl.edu	37	X	107976118	107976118	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:107976118C>A	ENST00000372129.2	-	1	3533	c.3457G>T	c.(3457-3459)Gct>Tct	p.A1153S	RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1153	Ala-rich.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TCAAATCCAGCAGCTGCGGCT	0.642																																																	0													30.0	37.0	35.0					X																	107976118		2128	4136	6264	SO:0001583	missense	0			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3457G>T	X.37:g.107976118C>A	ENSP00000361202:p.Ala1153Ser			Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.A1153S	ENST00000372129.2	37	c.3457	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	C	6.213	0.407434	0.11754	.	.	ENSG00000133124	ENST00000372129	T	0.31247	1.5	5.25	2.38	0.29361	.	0.855610	0.10007	N	0.727703	T	0.20941	0.0504	L	0.27053	0.805	0.09310	N	1	B	0.20550	0.046	B	0.12837	0.008	T	0.23154	-1.0196	10	0.46703	T	0.11	0.0893	7.1753	0.25740	0.3806:0.4615:0.1579:0.0	.	1153	O14654	IRS4_HUMAN	S	1153	ENSP00000361202:A1153S	ENSP00000361202:A1153S	A	-	1	0	IRS4	107862774	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.021000	0.12504	0.226000	0.20979	-0.237000	0.12165	GCT	IRS4	-	NULL	ENSG00000133124		0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	-	0.00	14	0	C	NM_003604		107976118	-1	tier1	-	no_errors	ENST00000372129	ensembl	human	known	74_37	missense	28.57	10	4	SNP	0.005	A
ISL2	64843	genome.wustl.edu	37	15	76633522	76633522	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr15:76633522C>T	ENST00000290759.4	+	5	1003	c.843C>T	c.(841-843)atC>atT	p.I281I	RP11-685G9.2_ENST00000559539.1_RNA|RP11-685G9.4_ENST00000602530.1_lincRNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	281	LIM-binding domain (LID). {ECO:0000250}.				negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						GCAGTCCCATCCGCCATGAGA	0.657																																					GBM(97;953 1391 16164 31496 36951)												0													28.0	29.0	29.0					15																	76633522		2197	4294	6491	SO:0001819	synonymous_variant	0			AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.843C>T	15.37:g.76633522C>T			B3KM37	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.P194S	ENST00000290759.4	37	c.580	CCDS10290.1	15																																																																																			ISL2	-	NULL	ENSG00000159556		0.657	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISL2	HGNC	protein_coding	OTTHUMT00000289779.1		0.00	52	0	C			76633522	+1			no_errors	ENST00000558656	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
ISM2	145501	genome.wustl.edu	37	14	77951088	77951088	+	Silent	SNP	G	G	T	rs140785058		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:77951088G>T	ENST00000342219.4	-	2	372	c.316C>A	c.(316-318)Cgg>Agg	p.R106R	ISM2_ENST00000493585.1_Silent_p.R106R|ISM2_ENST00000393684.3_Silent_p.R18R|ISM2_ENST00000412904.1_Silent_p.R106R|ISM2_ENST00000429906.1_Intron	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	106						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						AGCTCCAGCCGCAACGGAGTA	0.617																																																	0													60.0	61.0	61.0					14																	77951088		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.316C>A	14.37:g.77951088G>T			A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.R106	ENST00000342219.4	37	c.316	CCDS9864.1	14																																																																																			ISM2	-	NULL	ENSG00000100593		0.617	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ISM2	HGNC	protein_coding	OTTHUMT00000351309.1		0.00	66	0	G	NM_182509		77951088	-1			no_errors	ENST00000342219	ensembl	human	known	74_37	silent	7.89	34	3	SNP	0.326	T
ITGB2	3689	genome.wustl.edu	37	21	46320388	46320388	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr21:46320388C>T	ENST00000397850.2	-	8	1196	c.744G>A	c.(742-744)gaG>gaA	p.E248E	ITGB2_ENST00000397854.3_Silent_p.E191E|ITGB2_ENST00000355153.4_Silent_p.E248E|ITGB2_ENST00000302347.5_Silent_p.E248E|ITGB2_ENST00000397857.1_Silent_p.E248E|ITGB2_ENST00000397852.1_Silent_p.E248E			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	248	VWFA.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	AGCCGATTTCCTCCTGAGAAG	0.657																																																	0													41.0	45.0	44.0					21																	46320388		2203	4300	6503	SO:0001819	synonymous_variant	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.744G>A	21.37:g.46320388C>T			B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.E248	ENST00000397850.2	37	c.744	CCDS13716.1	21																																																																																			ITGB2	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,prints_Integrin_bsu	ENSG00000160255		0.657	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	-	0.00	149	0	C	NM_000211		46320388	-1	tier1	-	no_errors	ENST00000302347	ensembl	human	known	74_37	silent	7.34	101	8	SNP	0.998	T
IWS1	55677	genome.wustl.edu	37	2	128238661	128238661	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:128238661C>T	ENST00000295321.4	-	14	2678	c.2419G>A	c.(2419-2421)Gca>Aca	p.A807T	AC010976.2_ENST00000454503.2_RNA|AC010976.2_ENST00000596439.1_RNA|AC010976.2_ENST00000599001.1_RNA|AC010976.2_ENST00000598065.1_RNA|AC010976.2_ENST00000595561.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	807	Interaction with SUPT6H and ALYREF.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		ATTTTCACTGCGTGTGCAGAT	0.438																																																	0													259.0	229.0	239.0					2																	128238661		2203	4300	6503	SO:0001583	missense	0			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.2419G>A	2.37:g.128238661C>T	ENSP00000295321:p.Ala807Thr		Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.A807T	ENST00000295321.4	37	c.2419	CCDS2146.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.271387	0.95429	.	.	ENSG00000163166	ENST00000295321;ENST00000433551	T	0.52526	0.66	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.72645	0.3486	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.76591	-0.2903	10	0.87932	D	0	-28.8702	19.4441	0.94840	0.0:1.0:0.0:0.0	.	807	Q96ST2	IWS1_HUMAN	T	807;760	ENSP00000295321:A807T	ENSP00000295321:A807T	A	-	1	0	IWS1	127955131	1.000000	0.71417	0.990000	0.47175	0.886000	0.51366	7.512000	0.81728	2.671000	0.90904	0.650000	0.86243	GCA	IWS1	-	NULL	ENSG00000163166		0.438	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2		0.00	27	0	C	NM_017969		128238661	-1			no_errors	ENST00000295321	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
JUN	3725	genome.wustl.edu	37	1	59248515	59248516	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:59248515_59248516insAG	ENST00000371222.2	-	1	1269_1270	c.227_228insCT	c.(226-228)ctgfs	p.L76fs	RP4-794H19.2_ENST00000419531.2_lincRNA	NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	76					aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	TCAGGCGCTCCAGCTCGGGCGA	0.668			A		sarcoma																																			Dom	yes		1	1p32-p31	3725	jun oncogene		M	0																																										SO:0001589	frameshift_variant	0			AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.226_227dupCT	1.37:g.59248516_59248517dupAG	ENSP00000360266:p.Leu76fs		Q6FHM7|Q96G93	Frame_Shift_Ins	INS	pfam_JNK,pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.E77fs	ENST00000371222.2	37	c.228_227	CCDS610.1	1																																																																																			JUN	-	pfam_JNK	ENSG00000177606		0.668	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUN	HGNC	protein_coding	OTTHUMT00000023042.1		0.00	70	0	-	NM_002228		59248516	-1	tier1		no_errors	ENST00000371222	ensembl	human	known	74_37	frame_shift_ins	34.55	36	19	INS	1.000:1.000	AG
KATNAL2	83473	genome.wustl.edu	37	18	44593476	44593476	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr18:44593476G>A	ENST00000245121.5	+	8	789	c.595G>A	c.(595-597)Gtg>Atg	p.V199M	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Missense_Mutation_p.V271M	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2											central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						AGAAGCTGTTGTGTATCCTAT	0.423																																																	0													104.0	94.0	97.0					18																	44593476		2203	4300	6503	SO:0001583	missense	0			BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.595G>A	18.37:g.44593476G>A	ENSP00000245121:p.Val199Met			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.V199M	ENST00000245121.5	37	c.595	CCDS32828.1	18	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123434	0.77436	.	.	ENSG00000167216	ENST00000356157;ENST00000245121;ENST00000454462	D;D	0.94966	-3.57;-3.57	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.96608	0.8893	M	0.67569	2.06	0.80722	D	1	.	.	.	.	.	.	D	0.96459	0.9340	8	0.87932	D	0	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	.	.	.	M	271;199;39	ENSP00000348478:V271M;ENSP00000245121:V199M	ENSP00000245121:V199M	V	+	1	0	KATNAL2	42847474	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	8.990000	0.93510	2.826000	0.97356	0.655000	0.94253	GTG	KATNAL2	-	superfamily_P-loop_NTPase	ENSG00000167216		0.423	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	KATNAL2	HGNC	protein_coding	OTTHUMT00000446138.2	-	0.00	69	0	G	NM_031303		44593476	+1	tier1	-	no_errors	ENST00000245121	ensembl	human	known	74_37	missense	16.67	60	12	SNP	1.000	A
KCNA5	3741	genome.wustl.edu	37	12	5153934	5153934	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:5153934C>T	ENST00000252321.3	+	1	850	c.621C>T	c.(619-621)gaC>gaT	p.D207D		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	207					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	AGCTGGGGGACGAGGCCATGG	0.622																																																	0													46.0	50.0	48.0					12																	5153934		2203	4300	6503	SO:0001819	synonymous_variant	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.621C>T	12.37:g.5153934C>T			Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.D207	ENST00000252321.3	37	c.621	CCDS8536.1	12																																																																																			KCNA5	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv1	ENSG00000130037		0.622	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	-	0.00	116	0	C	NM_002234		5153934	+1	tier1	-	no_errors	ENST00000252321	ensembl	human	known	74_37	silent	9.68	84	9	SNP	0.537	T
KCNIP1	30820	genome.wustl.edu	37	5	170145823	170145823	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:170145823G>T	ENST00000411494.1	+	3	156	c.156G>T	c.(154-156)caG>caT	p.Q52H	KCNIP1_ENST00000434108.1_Missense_Mutation_p.Q41H|KCNIP1_ENST00000328939.4_Missense_Mutation_p.Q41H|KCNIP1_ENST00000520740.1_Missense_Mutation_p.Q13H|KCNIP1_ENST00000390656.4_Missense_Mutation_p.Q41H|KCNIP1_ENST00000377360.4_Missense_Mutation_p.Q50H			Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1	52	EF-hand 1; degenerate. {ECO:0000255|PROSITE-ProRule:PRU00448}.				detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)			autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GACTGGAGCAGCTCGAGGCCC	0.552																																																	0													62.0	58.0	60.0					5																	170145823		2203	4300	6503	SO:0001583	missense	0			AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000411494.1:c.156G>T	5.37:g.170145823G>T	ENSP00000395323:p.Gln52His		B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Missense_Mutation	SNP	pfam_EF_hand_dom,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.Q52H	ENST00000411494.1	37	c.156	CCDS34286.1	5	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619313	0.66787	.	.	ENSG00000182132	ENST00000377360;ENST00000328939;ENST00000390656;ENST00000520740;ENST00000434108;ENST00000411494	T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88	5.59	1.85	0.25348	EF-hand-like domain (1);	0.106093	0.64402	D	0.000003	T	0.43722	0.1260	M	0.77820	2.39	0.53005	D	0.999969	D;D;P;B	0.65815	0.995;0.975;0.526;0.285	P;P;B;B	0.61800	0.894;0.715;0.083;0.051	T	0.21655	-1.0239	9	.	.	.	.	9.2612	0.37614	0.2874:0.0:0.7126:0.0	.	41;41;52;50	Q3YAD0;Q3YAD2;Q9NZI2;Q3YAD3	.;.;KCIP1_HUMAN;.	H	50;41;41;13;41;52	ENSP00000366577:Q50H;ENSP00000329686:Q41H;ENSP00000375071:Q41H;ENSP00000431102:Q13H;ENSP00000414886:Q41H;ENSP00000395323:Q52H	.	Q	+	3	2	KCNIP1	170078401	1.000000	0.71417	0.978000	0.43139	0.977000	0.68977	2.111000	0.41883	0.053000	0.16036	0.655000	0.94253	CAG	KCNIP1	-	prints_Recoverin	ENSG00000182132		0.552	KCNIP1-004	KNOWN	basic|CCDS	protein_coding	KCNIP1	HGNC	protein_coding	OTTHUMT00000371760.1	-	0.00	55	0	G			170145823	+1	tier1	-	no_errors	ENST00000411494	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.998	T
KCNJ1	3758	genome.wustl.edu	37	11	128709220	128709220	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:128709220C>T	ENST00000392664.2	-	2	1092	c.976G>A	c.(976-978)Gct>Act	p.A326T	KCNJ1_ENST00000440599.2_Missense_Mutation_p.A307T|KCNJ1_ENST00000324036.3_Missense_Mutation_p.A307T|KCNJ1_ENST00000392666.1_Missense_Mutation_p.A307T|KCNJ1_ENST00000392665.2_Missense_Mutation_p.A307T	NM_000220.4	NP_000211.1	P48048	KCNJ1_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 1	326					cardiovascular system development (GO:0072358)|excretion (GO:0007588)|kidney development (GO:0001822)|post-embryonic development (GO:0009791)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of G-protein activated inward rectifier potassium channel activity (GO:1900128)|renal sodium ion absorption (GO:0070294)|synaptic transmission (GO:0007268)|tissue homeostasis (GO:0001894)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)	23	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Bethanidine(DB00217)|Glimepiride(DB00222)|Glyburide(DB01016)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Tolazamide(DB00839)|Tolbutamide(DB01124)|Yohimbine(DB01392)	ACTATGGGAGCAAAACGGTAG	0.502																																																	0													83.0	80.0	81.0					11																	128709220		2201	4297	6498	SO:0001583	missense	0			BC063109	CCDS8476.1, CCDS8477.1	11q24	2011-07-05			ENSG00000151704	ENSG00000151704		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6255	protein-coding gene	gene with protein product		600359				7680431, 8190102, 16382105	Standard	NM_153765		Approved	Kir1.1, ROMK1	uc001qeo.2	P48048	OTTHUMG00000048247	ENST00000392664.2:c.976G>A	11.37:g.128709220C>T	ENSP00000376432:p.Ala326Thr		B2RMR4|Q6LD67	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.1,prints_K_chnl_inward-rec_Kir	p.A326T	ENST00000392664.2	37	c.976	CCDS8476.1	11	.	.	.	.	.	.	.	.	.	.	C	10.26	1.300783	0.23650	.	.	ENSG00000151704	ENST00000392665;ENST00000392666;ENST00000440599;ENST00000324036;ENST00000392664	D;D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89;-2.89	5.63	4.71	0.59529	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.303330	0.36268	N	0.002686	D	0.86456	0.5937	L	0.31664	0.95	0.33265	D	0.560297	B	0.29136	0.234	B	0.27715	0.082	D	0.84347	0.0530	10	0.13470	T	0.59	.	16.7346	0.85444	0.0:0.8709:0.1291:0.0	.	326	P48048	IRK1_HUMAN	T	307;307;307;307;326	ENSP00000376433:A307T;ENSP00000376434:A307T;ENSP00000406320:A307T;ENSP00000316233:A307T;ENSP00000376432:A326T	ENSP00000316233:A307T	A	-	1	0	KCNJ1	128214430	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.781000	0.47750	1.343000	0.45638	0.563000	0.77884	GCT	KCNJ1	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.1,prints_K_chnl_inward-rec_Kir	ENSG00000151704		0.502	KCNJ1-004	KNOWN	basic|CCDS	protein_coding	KCNJ1	HGNC	protein_coding	OTTHUMT00000386233.1		0.00	34	0	C	NM_000220		128709220	-1			no_errors	ENST00000392664	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
KIAA0895	23366	genome.wustl.edu	37	7	36397154	36397154	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:36397154A>G	ENST00000297063.6	-	3	274	c.224T>C	c.(223-225)cTa>cCa	p.L75P	KIAA0895_ENST00000338533.5_Missense_Mutation_p.L62P|KIAA0895_ENST00000436884.1_5'UTR|KIAA0895_ENST00000317020.6_Missense_Mutation_p.L24P|KIAA0895_ENST00000453212.1_Intron|KIAA0895_ENST00000415803.2_Missense_Mutation_p.L62P|KIAA0895_ENST00000480192.1_Intron|KIAA0895_ENST00000440378.1_Missense_Mutation_p.L24P	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	75										breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						TTCTGCATTTAGAATAGACTT	0.353																																																	0													91.0	81.0	84.0					7																	36397154		1844	4092	5936	SO:0001583	missense	0			BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.224T>C	7.37:g.36397154A>G	ENSP00000297063:p.Leu75Pro		B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Missense_Mutation	SNP	pfam_DUF1704	p.L75P	ENST00000297063.6	37	c.224	CCDS43570.1	7	.	.	.	.	.	.	.	.	.	.	A	21.7	4.190286	0.78789	.	.	ENSG00000164542	ENST00000297063;ENST00000338533;ENST00000317020;ENST00000440378;ENST00000415803	.	.	.	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000001	T	0.75975	0.3923	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999	T	0.78229	-0.2285	9	0.87932	D	0	-5.0875	16.1146	0.81295	1.0:0.0:0.0:0.0	.	24;24;62;75;62;24	B4DGN6;B7ZLT4;Q8NCT3-4;Q8NCT3;Q8NCT3-2;Q8NCT3-3	.;.;.;K0895_HUMAN;.;.	P	75;62;24;24;62	.	ENSP00000297063:L75P	L	-	2	0	KIAA0895	36363679	1.000000	0.71417	0.988000	0.46212	0.968000	0.65278	8.355000	0.90083	2.200000	0.70718	0.460000	0.39030	CTA	KIAA0895	-	NULL	ENSG00000164542		0.353	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	KIAA0895	HGNC	protein_coding	OTTHUMT00000337717.1	-	0.00	34	0	A	NM_015314		36397154	-1	tier1	-	no_errors	ENST00000297063	ensembl	human	known	74_37	missense	24.62	49	16	SNP	1.000	G
KIF16B	55614	genome.wustl.edu	37	20	16254017	16254017	+	Missense_Mutation	SNP	C	C	T	rs369549554		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr20:16254017C>T	ENST00000354981.2	-	26	3992	c.3835G>A	c.(3835-3837)Gca>Aca	p.A1279T	KIF16B_ENST00000378003.2_Missense_Mutation_p.A464T|KIF16B_ENST00000355755.3_Missense_Mutation_p.A1249T	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1279	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)	p.A1279P(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GGAGATGTTGCGGACTGGAGC	0.473																																																	1	Substitution - Missense(1)	lung(1)						C	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	117.0	110.0	112.0		3682,3835	3.8	0.0	20		112	0,8600		0,0,4300	no	missense,missense	KIF16B	NM_001199865.1,NM_024704.4	58,58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	1228/1267,1279/1318	16254017	1,13005	2203	4300	6503	SO:0001583	missense	0			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3835G>A	20.37:g.16254017C>T	ENSP00000347076:p.Ala1279Thr		A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Phox,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,superfamily_Phox,smart_Kinesin_motor_dom,smart_Phox,pfscan_Phox,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A1279T	ENST00000354981.2	37	c.3835	CCDS13122.1	20	.	.	.	.	.	.	.	.	.	.	C	8.014	0.758097	0.15846	2.27E-4	0.0	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000378003	T;T;T	0.70164	-0.46;-0.46;2.55	5.87	3.78	0.43462	Phox homologous domain (2);	.	.	.	.	T	0.37945	0.1022	N	0.03608	-0.345	0.09310	N	1	P;P	0.37176	0.531;0.586	B;B	0.28784	0.057;0.094	T	0.21655	-1.0239	9	0.72032	D	0.01	.	7.8763	0.29595	0.0:0.6445:0.2616:0.0939	.	1238;1279	Q96L93-6;Q96L93	.;KI16B_HUMAN	T	1279;1249;1123;464	ENSP00000347076:A1279T;ENSP00000347995:A1249T;ENSP00000367242:A464T	ENSP00000347076:A1279T	A	-	1	0	KIF16B	16202017	0.788000	0.28762	0.006000	0.13384	0.732000	0.41865	1.540000	0.36115	1.426000	0.47256	0.655000	0.94253	GCA	KIF16B	-	smart_Phox,pfscan_Phox	ENSG00000089177		0.473	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	HGNC	protein_coding	OTTHUMT00000078104.2		0.00	50	0	C	NM_017683		16254017	-1			no_errors	ENST00000354981	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.021	T
KRT73	319101	genome.wustl.edu	37	12	53009084	53009084	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:53009084A>T	ENST00000305748.3	-	3	736	c.702T>A	c.(700-702)aaT>aaA	p.N234K	RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	234	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCACAAATTCATTCTCAGCAG	0.507																																																	0													202.0	173.0	183.0					12																	53009084		2203	4300	6503	SO:0001583	missense	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.702T>A	12.37:g.53009084A>T	ENSP00000307014:p.Asn234Lys		Q32MB2	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.N234K	ENST00000305748.3	37	c.702	CCDS8834.1	12	.	.	.	.	.	.	.	.	.	.	A	18.70	3.679967	0.68042	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	T;T	0.76316	-0.93;-1.01	4.7	-0.281	0.12882	Filament (1);	0.000000	0.51477	D	0.000095	D	0.89518	0.6738	H	0.96080	3.765	0.30861	N	0.733477	D	0.89917	1.0	D	0.97110	1.0	D	0.86125	0.1571	10	0.87932	D	0	.	9.1395	0.36894	0.7019:0.0:0.2981:0.0	.	234	Q86Y46	K2C73_HUMAN	K	234;11	ENSP00000307014:N234K;ENSP00000449081:N11K	ENSP00000307014:N234K	N	-	3	2	KRT73	51295351	0.760000	0.28428	0.999000	0.59377	0.733000	0.41908	0.007000	0.13174	0.056000	0.16144	0.455000	0.32223	AAT	KRT73	-	pfam_IF,prints_Keratin_II	ENSG00000186049		0.507	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	HGNC	protein_coding	OTTHUMT00000405700.1	-	0.00	36	0	A	NM_175068		53009084	-1	tier1	-	no_errors	ENST00000305748	ensembl	human	known	74_37	missense	22.58	24	7	SNP	1.000	T
KRTAP3-2	83897	genome.wustl.edu	37	17	39156016	39156016	+	Silent	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:39156016G>C	ENST00000391587.1	-	1	122	c.90C>G	c.(88-90)gtC>gtG	p.V30V		NM_031959.2	NP_114165.1	Q9BYR7	KRA32_HUMAN	keratin associated protein 3-2	30	3 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)	3		Breast(137;0.00043)				TGGGCAGGCAGACTCCACAGC	0.627																																																	0													73.0	83.0	79.0					17																	39156016		2203	4296	6499	SO:0001819	synonymous_variant	0			AJ406932	CCDS32644.1	17q21.2	2013-06-25			ENSG00000212900	ENSG00000212900		"""Keratin associated proteins"""	16779	protein-coding gene	gene with protein product						11279113	Standard	NM_031959		Approved	KAP3.2	uc002hvs.3	Q9BYR7	OTTHUMG00000133581	ENST00000391587.1:c.90C>G	17.37:g.39156016G>C				Silent	SNP	pfam_Keratin_matx	p.V30	ENST00000391587.1	37	c.90	CCDS32644.1	17																																																																																			KRTAP3-2	-	pfam_Keratin_matx	ENSG00000212900		0.627	KRTAP3-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP3-2	HGNC	protein_coding	OTTHUMT00000257685.1	-	0.00	93	0	G			39156016	-1	tier1	-	no_errors	ENST00000391587	ensembl	human	known	74_37	silent	10.28	358	41	SNP	1.000	C
KRTAP2-2	728279	genome.wustl.edu	37	17	39211148	39211148	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:39211148A>G	ENST00000398477.1	-	1	334	c.316T>C	c.(316-318)Tcc>Ccc	p.S106P	KRTAP2-2_ENST00000542910.1_Missense_Mutation_p.S106P	NM_033032.2	NP_149021.2	Q9BYT5	KRA22_HUMAN	keratin associated protein 2-2	106	11 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											CCGCAGGGGGACTGCACAGAC	0.701																																																	0													1.0	3.0	2.0					17																	39211148		57	463	520	SO:0001583	missense	0			AJ302536	CCDS32648.1, CCDS54122.1	17q21.2	2013-06-25			ENSG00000214518	ENSG00000214518		"""Keratin associated proteins"""	18905	protein-coding gene	gene with protein product							Standard	NM_033032		Approved	KAP2.2	uc010cxj.3	Q9BYT5	OTTHUMG00000133593	ENST00000398477.1:c.316T>C	17.37:g.39211148A>G	ENSP00000381494:p.Ser106Pro		A8MTN3|A8MXM4	Missense_Mutation	SNP	pfam_Keratin-assoc	p.S106P	ENST00000398477.1	37	c.316	CCDS54122.1	17	.	.	.	.	.	.	.	.	.	.	.	7.735	0.700067	0.15106	.	.	ENSG00000214518	ENST00000398477;ENST00000542910	.	.	.	5.45	-4.17	0.03857	.	0.906801	0.09038	N	0.857735	T	0.32556	0.0833	L	0.33189	0.99	0.21697	N	0.999586	P	0.43169	0.8	B	0.41860	0.368	T	0.29882	-0.9997	9	0.16420	T	0.52	.	17.3684	0.87369	0.8131:0.1869:0.0:0.0	.	106	A8MTN3	KRA2X_HUMAN	P	106	.	ENSP00000381494:S106P	S	-	1	0	KRTAP2-2	36464674	0.393000	0.25237	0.686000	0.30086	0.545000	0.35147	-0.550000	0.06034	-0.344000	0.08338	-0.449000	0.05564	TCC	KRTAP2-2	-	NULL	ENSG00000214518		0.701	KRTAP2-2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRTAP2-2	HGNC	protein_coding	OTTHUMT00000257697.1		0.00	20	0	A			39211148	-1			no_errors	ENST00000542910	ensembl	human	known	74_37	missense	6.49	143	10	SNP	0.895	G
L3MBTL4	91133	genome.wustl.edu	37	18	6301916	6301916	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr18:6301916G>T	ENST00000284898.6	-	4	313	c.113C>A	c.(112-114)aCc>aAc	p.T38N	L3MBTL4_ENST00000317931.7_Missense_Mutation_p.T38N|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.T38N|L3MBTL4_ENST00000400105.2_Missense_Mutation_p.T38N	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	38					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				ACTCAAAGGGGTTGTGCTATC	0.353																																					Esophageal Squamous(41;748 902 17366 28959 43175)												0													289.0	275.0	279.0					18																	6301916		2203	4300	6503	SO:0001583	missense	0			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.113C>A	18.37:g.6301916G>T	ENSP00000284898:p.Thr38Asn		A8MTL8|Q8IXS3	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_Znf_C2HC,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.T38N	ENST00000284898.6	37	c.113	CCDS11839.2	18	.	.	.	.	.	.	.	.	.	.	.	2.863	-0.235694	0.05944	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000400104	T;T;T;T	0.14516	2.5;2.5;2.5;2.72	5.0	3.13	0.36017	.	1.768200	0.03328	N	0.192898	T	0.12646	0.0307	L	0.38175	1.15	0.09310	N	1	B	0.24675	0.109	B	0.23018	0.043	T	0.41378	-0.9512	10	0.08599	T	0.76	.	9.6776	0.40050	0.0863:0.1424:0.7713:0.0	.	38	Q8NA19	LMBL4_HUMAN	N	38	ENSP00000382976:T38N;ENSP00000318543:T38N;ENSP00000284898:T38N;ENSP00000382975:T38N	ENSP00000284898:T38N	T	-	2	0	L3MBTL4	6291916	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.861000	0.01654	0.215000	0.20761	-1.128000	0.01989	ACC	L3MBTL4	-	NULL	ENSG00000154655		0.353	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL4	HGNC	protein_coding	OTTHUMT00000254448.2	-	0.00	86	0	G	NM_173464		6301916	-1	tier1	-	no_errors	ENST00000284898	ensembl	human	known	74_37	missense	6.93	94	7	SNP	0.000	T
LINC00957	255031	genome.wustl.edu	37	7	44080840	44080840	+	lincRNA	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:44080840G>T	ENST00000441052.1	+	0	1525				RASA4CP_ENST00000446874.1_RNA					long intergenic non-protein coding RNA 957																		ATTCatgaatgaatgaatgag	0.537																																																	0																																												0			BC014556		7p13	2013-06-04			ENSG00000235314	ENSG00000235314		"""Long non-coding RNAs"""	22332	non-coding RNA	RNA, long non-coding							Standard	NR_015401		Approved				OTTHUMG00000155351		7.37:g.44080840G>T				RNA	SNP	-	NULL	ENST00000441052.1	37	NULL		7																																																																																			LINC00957	-	-	ENSG00000235314		0.537	LINC00957-001	KNOWN	basic	lincRNA	LINC00957	HGNC	lincRNA	OTTHUMT00000339589.1	-	0.00	40	0	G			44080840	+1	tier1	-	no_errors	ENST00000441052	ensembl	human	known	74_37	rna	33.33	26	13	SNP	0.076	T
LMF2	91289	genome.wustl.edu	37	22	50942048	50942048	+	Silent	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr22:50942048G>T	ENST00000474879.2	-	14	1911	c.1896C>A	c.(1894-1896)ccC>ccA	p.P632P	LMF2_ENST00000505981.1_5'Flank|LMF2_ENST00000380796.3_Silent_p.P519P|LMF2_ENST00000216080.5_Silent_p.P607P	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	632						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGGCCTCCAGGGGAGACAGCT	0.687																																																	0													13.0	18.0	16.0					22																	50942048		2179	4270	6449	SO:0001819	synonymous_variant	0			BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.1896C>A	22.37:g.50942048G>T			A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Silent	SNP	pfam_LMF	p.P632	ENST00000474879.2	37	c.1896	CCDS14093.2	22	.	.	.	.	.	.	.	.	.	.	G	0.829	-0.745791	0.03065	.	.	ENSG00000100258	ENST00000487499	.	.	.	5.22	-4.86	0.03132	.	0.439418	0.24991	N	0.033985	T	0.35770	0.0943	.	.	.	0.43642	D	0.996046	.	.	.	.	.	.	T	0.16158	-1.0412	6	0.26408	T	0.33	3.5558	1.4851	0.02445	0.2892:0.1058:0.3899:0.2151	.	.	.	.	T	639	.	ENSP00000424764:P639T	P	-	1	0	LMF2	49288914	0.035000	0.19736	0.056000	0.19401	0.035000	0.12851	-0.026000	0.12392	-0.862000	0.04089	-0.797000	0.03246	CCT	LMF2	-	NULL	ENSG00000100258		0.687	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMF2	HGNC	protein_coding	OTTHUMT00000316833.2	-	0.00	53	0	G	NM_033200		50942048	-1	tier1	-	no_errors	ENST00000474879	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.082	T
DSG1	1828	genome.wustl.edu	37	18	28923621	28923621	+	Intron	SNP	G	G	A	rs112958941		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr18:28923621G>A	ENST00000257192.4	+	12	2033				DSG1_ENST00000462981.2_5'UTR|RP11-534N16.1_ENST00000581856.1_RNA|RNU6-167P_ENST00000384292.1_RNA|RP11-534N16.1_ENST00000578119.1_RNA	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1						apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			CAAGATGGCCGCCATCACTCA	0.428																																																	0																																										SO:0001627	intron_variant	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1821+75G>A	18.37:g.28923621G>A			B7Z845	RNA	SNP	-	NULL	ENST00000257192.4	37	NULL	CCDS11896.1	18																																																																																			RP11-534N16.1	-	-	ENSG00000266729		0.428	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927718	Clone_based_vega_gene	protein_coding	OTTHUMT00000254947.1	-	0.00	57	0	G	NM_001942		28923621	-1	tier1	rs112958941	no_errors	ENST00000578119	ensembl	human	known	74_37	rna	31.03	40	18	SNP	0.000	A
TNFRSF10C	8794	genome.wustl.edu	37	8	22939069	22939069	+	5'Flank	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:22939069G>A	ENST00000397703.2	+	0	0				RP11-875O11.2_ENST00000501897.1_RNA			O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain						apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		TAATTTTTATGAAATATTGTG	0.368																																																	0																																										SO:0001631	upstream_gene_variant	0			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844		8.37:g.22939069G>A	Exception_encountered		O14755|Q08AS6|Q6FH98|Q6UXM5	RNA	SNP	-	NULL	ENST00000397703.2	37	NULL		8																																																																																			RP11-875O11.2	-	-	ENSG00000246130		0.368	TNFRSF10C-002	PUTATIVE	basic	protein_coding	LOC286059	Clone_based_vega_gene	protein_coding	OTTHUMT00000375321.2		0.00	13	0	G			22939069	+1			no_errors	ENST00000501897	ensembl	human	known	74_37	rna	23.53	13	4	SNP	0.000	A
LPA	4018	genome.wustl.edu	37	6	160969601	160969601	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:160969601G>T	ENST00000316300.5	-	31	5108	c.5064C>A	c.(5062-5064)tgC>tgA	p.C1688*	LPA_ENST00000447678.1_Nonsense_Mutation_p.C1688*			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4196	Kringle 15. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GCGTCAGGTTGCAGTACTCCC	0.537																																																	0													87.0	94.0	92.0					6																	160969601		2203	4300	6503	SO:0001587	stop_gained	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5064C>A	6.37:g.160969601G>T	ENSP00000321334:p.Cys1688*		Q5VTD7|Q9UD88	Nonsense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1	p.C1688*	ENST00000316300.5	37	c.5064	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	g	41	9.032644	0.99042	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.71	-1.2	0.09554	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5515	0.27800	0.5503:0.0:0.4497:0.0	.	.	.	.	X	1688	.	ENSP00000321334:C1688X	C	-	3	2	LPA	160889591	0.997000	0.39634	0.975000	0.42487	0.583000	0.36354	0.150000	0.16263	-0.165000	0.10908	0.436000	0.28706	TGC	LPA	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000198670		0.537	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	-	0.00	144	0	G	NM_005577		160969601	-1	tier1	-	no_errors	ENST00000316300	ensembl	human	known	74_37	nonsense	18.80	108	25	SNP	1.000	T
LRIF1	55791	genome.wustl.edu	37	1	111494956	111494956	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:111494956G>A	ENST00000369763.4	-	2	940	c.550C>T	c.(550-552)Cat>Tat	p.H184Y	LRIF1_ENST00000494675.1_Intron|LRIF1_ENST00000485275.2_Intron|RP11-96K19.2_ENST00000440689.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	184					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						ATCTGTAAATGATGCCCAGAA	0.453																																																	0													61.0	59.0	60.0					1																	111494956		2203	4300	6503	SO:0001583	missense	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.550C>T	1.37:g.111494956G>A	ENSP00000358778:p.His184Tyr		Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	NULL	p.H184Y	ENST00000369763.4	37	c.550	CCDS30800.1	1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.503238	0.44558	.	.	ENSG00000121931	ENST00000369763	T	0.28895	1.59	5.08	5.08	0.68730	.	0.231528	0.37623	N	0.002018	T	0.25005	0.0607	L	0.29908	0.895	0.80722	D	1	P	0.51240	0.943	P	0.51582	0.674	T	0.02371	-1.1169	10	0.62326	D	0.03	-2.3658	16.3294	0.83004	0.0:0.0:1.0:0.0	.	184	Q5T3J3	LRIF1_HUMAN	Y	184	ENSP00000358778:H184Y	ENSP00000358778:H184Y	H	-	1	0	LRIF1	111296479	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.653000	0.67967	2.524000	0.85096	0.467000	0.42956	CAT	LRIF1	-	NULL	ENSG00000121931		0.453	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRIF1	HGNC	protein_coding	OTTHUMT00000032932.2	-	0.00	47	0	G	NM_018372		111494956	-1	tier1	-	no_errors	ENST00000369763	ensembl	human	known	74_37	missense	17.95	32	7	SNP	1.000	A
LRRC16A	55604	genome.wustl.edu	37	6	25605048	25605048	+	Silent	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:25605048G>A	ENST00000329474.6	+	34	3929	c.3561G>A	c.(3559-3561)ggG>ggA	p.G1187G		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1187					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						AGAAGCTTGGGAATGATGCCG	0.463																																																	0													14.0	13.0	14.0					6																	25605048		876	1991	2867	SO:0001819	synonymous_variant	0			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3561G>A	6.37:g.25605048G>A			B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.G1187	ENST00000329474.6	37	c.3561	CCDS54973.1	6																																																																																			LRRC16A	-	NULL	ENSG00000079691		0.463	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	-	0.00	58	0	G	NM_017640		25605048	+1	tier1	-	no_errors	ENST00000329474	ensembl	human	novel	74_37	silent	23.73	45	14	SNP	1.000	A
MAB21L3	126868	genome.wustl.edu	37	1	116675886	116675886	+	Missense_Mutation	SNP	G	G	A	rs145242444		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:116675886G>A	ENST00000369500.3	+	7	1254	c.989G>A	c.(988-990)cGg>cAg	p.R330Q		NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)	330								p.H326fs*11(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						TATTTCGTCCGGAACAGCAAC	0.547																																																	1	Deletion - Frameshift(1)	breast(1)						G	GLN/ARG	0,4406		0,0,2203	99.0	85.0	90.0		989	-4.9	0.0	1	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	missense	MAB21L3	NM_152367.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	330/363	116675886	1,13005	2203	4300	6503	SO:0001583	missense	0			AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.989G>A	1.37:g.116675886G>A	ENSP00000358512:p.Arg330Gln		Q5TDL7	Missense_Mutation	SNP	pfam_Mab-21_dom	p.R330Q	ENST00000369500.3	37	c.989	CCDS886.1	1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166733	0.57476	0.0	1.16E-4	ENSG00000173212	ENST00000369500	T	0.07688	3.17	5.37	-4.95	0.03048	.	1.362290	0.04782	N	0.430008	T	0.03783	0.0107	L	0.50919	1.6	0.09310	N	1	P	0.48407	0.91	B	0.43809	0.432	T	0.39901	-0.9591	10	0.51188	T	0.08	1.1135	10.2217	0.43201	0.2471:0.5382:0.2148:0.0	.	330	Q8N8X9	MB213_HUMAN	Q	330	ENSP00000358512:R330Q	ENSP00000358512:R330Q	R	+	2	0	MAB21L3	116477409	0.001000	0.12720	0.003000	0.11579	0.131000	0.20780	0.156000	0.16382	-0.464000	0.06963	-0.176000	0.13171	CGG	MAB21L3	-	pfam_Mab-21_dom	ENSG00000173212		0.547	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L3	HGNC	protein_coding	OTTHUMT00000033486.1	-	0.00	80	0	G	NM_152367		116675886	+1	tier1	rs145242444	no_errors	ENST00000369500	ensembl	human	known	74_37	missense	45.71	38	32	SNP	0.000	A
MAD2L1BP	9587	genome.wustl.edu	37	6	43608158	43608158	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:43608158G>T	ENST00000372171.4	+	3	770	c.713G>T	c.(712-714)gGc>gTc	p.G238V	MAD2L1BP_ENST00000451025.2_Missense_Mutation_p.G270V	NM_014628.2	NP_055443.1	Q15013	MD2BP_HUMAN	MAD2L1 binding protein	238					mitotic cell cycle checkpoint (GO:0007093)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(3)	5	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000351)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			CCCAGCCGGGGCCATAAACTG	0.557																																																	0													50.0	44.0	46.0					6																	43608158		2203	4300	6503	SO:0001583	missense	0			BC002904	CCDS4904.1, CCDS47431.1	6p21.1	2003-06-23			ENSG00000124688	ENSG00000124688			21059	protein-coding gene	gene with protein product						7788527, 12456649	Standard	NM_014628		Approved	CMT2, KIAA0110, dJ261G23.1	uc003ovu.3	Q15013	OTTHUMG00000014747	ENST00000372171.4:c.713G>T	6.37:g.43608158G>T	ENSP00000361244:p.Gly238Val		B4DLV3|E9PAT7|Q6IBB1	Missense_Mutation	SNP	pfam_MAD1/Cdc20-bound-Mad2-bd	p.G270V	ENST00000372171.4	37	c.809	CCDS4904.1	6	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655266	0.67472	.	.	ENSG00000124688	ENST00000451025;ENST00000372171	T	0.48836	0.8	5.09	5.09	0.68999	.	0.062135	0.64402	D	0.000004	T	0.43919	0.1269	N	0.24115	0.695	0.80722	D	1	D;D	0.67145	0.996;0.991	P;P	0.60541	0.873;0.876	T	0.51926	-0.8643	10	0.87932	D	0	-0.0685	16.7112	0.85386	0.0:0.0:1.0:0.0	.	238;270	Q15013;E9PAT7	MD2BP_HUMAN;.	V	270;238	ENSP00000410818:G270V	ENSP00000361244:G238V	G	+	2	0	MAD2L1BP	43716136	1.000000	0.71417	0.991000	0.47740	0.915000	0.54546	6.930000	0.75858	2.365000	0.80145	0.555000	0.69702	GGC	MAD2L1BP	-	pfam_MAD1/Cdc20-bound-Mad2-bd	ENSG00000124688		0.557	MAD2L1BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAD2L1BP	HGNC	protein_coding	OTTHUMT00000040692.2		0.00	33	0	G	NM_014628		43608158	+1			no_errors	ENST00000451025	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
MAGEB5	347541	genome.wustl.edu	37	X	26235844	26235844	+	Silent	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:26235844G>C	ENST00000602297.1	+	2	673	c.426G>C	c.(424-426)ctG>ctC	p.L142L	MAGEB5_ENST00000379029.2_Silent_p.L142L	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	142	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									lung(1)|ovary(1)	2						TGATCTTCCTGAAAGGCAACT	0.448																																																	0																																										SO:0001819	synonymous_variant	0			AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.426G>C	X.37:g.26235844G>C				Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L142	ENST00000602297.1	37	c.426		X																																																																																			MAGEB5	-	pfam_MAGE,pfscan_MAGE	ENSG00000188408		0.448	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	MAGEB5	HGNC	protein_coding	OTTHUMT00000056126.2	-	0.00	12	0	G	XM_293407		26235844	+1	tier1	-	no_errors	ENST00000379029	ensembl	human	known	74_37	silent	31.58	13	6	SNP	0.001	C
MAGEA8	4107	genome.wustl.edu	37	X	149013844	149013844	+	Silent	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:149013844C>A	ENST00000542674.1	+	3	1319	c.798C>A	c.(796-798)ggC>ggA	p.G266G	MAGEA8_ENST00000535454.1_Silent_p.G266G|MAGEA8_ENST00000286482.1_Silent_p.G266G	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	266	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					AGGCGCCCGGCAGTGATCCTG	0.572																																																	0													113.0	108.0	110.0					X																	149013844		2203	4298	6501	SO:0001819	synonymous_variant	0				CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.798C>A	X.37:g.149013844C>A			Q9BUN9	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.G266	ENST00000542674.1	37	c.798	CCDS14692.1	X																																																																																			MAGEA8	-	pfam_MAGE,pfscan_MAGE	ENSG00000156009		0.572	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA8	HGNC	protein_coding	OTTHUMT00000058728.1	-	0.00	58	0	C	NM_005364		149013844	+1	tier1	-	no_errors	ENST00000286482	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.102	A
MAGI2	9863	genome.wustl.edu	37	7	77797250	77797250	+	Missense_Mutation	SNP	C	C	G	rs375028312		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:77797250C>G	ENST00000354212.4	-	15	2832	c.2579G>C	c.(2578-2580)aGa>aCa	p.R860T	MAGI2_ENST00000419488.1_Missense_Mutation_p.R846T|MAGI2_ENST00000522391.1_Missense_Mutation_p.R860T	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	860	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TAGCACCTTTCTTCTCACAGT	0.517																																																	0													236.0	219.0	225.0					7																	77797250		2203	4300	6503	SO:0001583	missense	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2579G>C	7.37:g.77797250C>G	ENSP00000346151:p.Arg860Thr		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.R860T	ENST00000354212.4	37	c.2579	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768046	0.90020	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.58210	0.35;0.55;0.55	5.96	5.96	0.96718	PDZ/DHR/GLGF (3);	0.000000	0.39985	U	0.001218	T	0.81941	0.4929	H	0.96633	3.855	0.80722	D	1	P;D;P	0.65815	0.546;0.995;0.799	B;D;B	0.63957	0.202;0.92;0.202	D	0.87264	0.2281	10	0.87932	D	0	.	19.4074	0.94653	0.0:1.0:0.0:0.0	.	860;846;860	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	T	846;860;860;860	ENSP00000405766:R846T;ENSP00000346151:R860T;ENSP00000428389:R860T	ENSP00000346151:R860T	R	-	2	0	MAGI2	77635186	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.456000	0.80751	2.831000	0.97527	0.650000	0.86243	AGA	MAGI2	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000187391		0.517	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	-	0.00	79	0	C	NM_012301		77797250	-1	tier1	-	no_errors	ENST00000354212	ensembl	human	known	74_37	missense	21.88	50	14	SNP	1.000	G
MALAT1	378938	genome.wustl.edu	37	11	65267000	65267000	+	lincRNA	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:65267000G>C	ENST00000534336.1	+	0	1768				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AAAAGACCTTGAAATCCATGA	0.338																																																	0													8.0	8.0	8.0					11																	65267000		868	1974	2842			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65267000G>C				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.338	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	44	0	G	NR_002819		65267000	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	13.95	74	12	SNP	0.000	C
MALAT1	378938	genome.wustl.edu	37	11	65268522	65268522	+	lincRNA	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:65268522G>C	ENST00000534336.1	+	0	3290				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AAATGAATTTGATAGCCAAAT	0.348																																																	0													102.0	111.0	108.0					11																	65268522		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268522G>C				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.348	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	28	0	G	NR_002819		65268522	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	22.73	34	10	SNP	0.000	C
MAP1B	4131	genome.wustl.edu	37	5	71482533	71482533	+	Silent	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:71482533C>A	ENST00000296755.7	+	4	760	c.462C>A	c.(460-462)tcC>tcA	p.S154S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	154					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TTCTCCAGTCCGGCTCTTTCT	0.493																																					Melanoma(17;367 822 11631 31730 47712)												0													105.0	106.0	106.0					5																	71482533		2203	4300	6503	SO:0001819	synonymous_variant	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.462C>A	5.37:g.71482533C>A			A2BDK5	Silent	SNP	pfam_MAP1B_neuraxin	p.S154	ENST00000296755.7	37	c.462	CCDS4012.1	5																																																																																			MAP1B	-	NULL	ENSG00000131711		0.493	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	-	0.00	35	0	C	NM_005909		71482533	+1	tier1	-	no_errors	ENST00000296755	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.175	A
MCM9	254394	genome.wustl.edu	37	6	119136219	119136219	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:119136219G>T	ENST00000316316.6	-	13	3486	c.3200C>A	c.(3199-3201)tCg>tAg	p.S1067*		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	1067					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		TTTGGATTCCGATGGGGGAGT	0.498																																																	0																																										SO:0001587	stop_gained	0			BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.3200C>A	6.37:g.119136219G>T	ENSP00000314505:p.Ser1067*		B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,prints_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase	p.S1067*	ENST00000316316.6	37	c.3200	CCDS56447.1	6	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606337	0.66445	.	.	ENSG00000111877	ENST00000316316;ENST00000243218	.	.	.	5.7	1.99	0.26369	.	1024.330000	0.00447	U	0.000081	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.0524	0.53513	0.197:0.0:0.803:0.0	.	.	.	.	X	1067;686	.	ENSP00000243218:S686X	S	-	2	0	MCM9	119242922	0.359000	0.24955	0.001000	0.08648	0.003000	0.03518	1.166000	0.31834	0.077000	0.16863	-0.940000	0.02684	TCG	MCM9	-	NULL	ENSG00000111877		0.498	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	HGNC	protein_coding	OTTHUMT00000042005.4		0.00	22	0	G	NM_153255		119136219	-1			no_errors	ENST00000316316	ensembl	human	known	74_37	nonsense	7.69	36	3	SNP	0.013	T
MEP1B	4225	genome.wustl.edu	37	18	29787385	29787385	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr18:29787385G>T	ENST00000269202.6	+	8	765	c.718G>T	c.(718-720)Gat>Tat	p.D240Y	MEP1B_ENST00000581447.1_Missense_Mutation_p.D240Y	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	240	Metalloprotease.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CCAACGAATGGATTTCAGTGA	0.388																																																	0													56.0	53.0	54.0					18																	29787385		1915	4127	6042	SO:0001583	missense	0			X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.718G>T	18.37:g.29787385G>T	ENSP00000269202:p.Asp240Tyr		B7ZM35|B9EGL6|Q670J1	Missense_Mutation	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MAM_dom,pfam_MATH,superfamily_TRAF-like,superfamily_ConA-like_lec_gl_sf,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.D240Y	ENST00000269202.6	37	c.718	CCDS45846.1	18	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081130	0.76528	.	.	ENSG00000141434	ENST00000269202	T	0.64803	-0.12	5.75	5.75	0.90469	Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.044265	0.85682	D	0.000000	T	0.76870	0.4048	L	0.53249	1.67	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.77595	-0.2529	10	0.87932	D	0	-29.3307	19.9319	0.97122	0.0:0.0:1.0:0.0	.	240	Q16820	MEP1B_HUMAN	Y	240	ENSP00000269202:D240Y	ENSP00000269202:D240Y	D	+	1	0	MEP1B	28041383	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.728000	0.93425	0.591000	0.81541	GAT	MEP1B	-	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A	ENSG00000141434		0.388	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MEP1B	HGNC	protein_coding	OTTHUMT00000447755.1		0.00	37	0	G	NM_005925		29787385	+1			no_errors	ENST00000269202	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
MGAT3	4248	genome.wustl.edu	37	22	39884528	39884528	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr22:39884528C>T	ENST00000341184.6	+	2	1391	c.1176C>T	c.(1174-1176)ttC>ttT	p.F392F		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	392					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					TGCCCAACTTCAGACAGTATG	0.657																																																	0													45.0	45.0	45.0					22																	39884528		2203	4299	6502	SO:0001819	synonymous_variant	0			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.1176C>T	22.37:g.39884528C>T			A6NGD0|Q14CK5|Q6IC49|Q9UH32	Silent	SNP	pfam_Glyco_trans_17	p.F392	ENST00000341184.6	37	c.1176	CCDS13994.2	22																																																																																			MGAT3	-	pfam_Glyco_trans_17	ENSG00000128268		0.657	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT3	HGNC	protein_coding	OTTHUMT00000075039.2	-	0.00	62	0	C	NM_002409		39884528	+1	tier1	-	no_errors	ENST00000341184	ensembl	human	known	74_37	silent	14.29	48	8	SNP	1.000	T
MIR363	574031	genome.wustl.edu	37	X	133303464	133303464	+	RNA	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:133303464C>T	ENST00000384840.1	-	0	18				MIR92A2_ENST00000385299.1_RNA|MIR20B_ENST00000384977.1_RNA|MIR18B_ENST00000454574.2_RNA|MIR19B2_ENST00000385077.2_RNA|MIR106A_ENST00000384870.1_RNA	NR_029852.1				microRNA 363																		AAAATTGCATCGTGATCCACC	0.383																																																	0													88.0	73.0	78.0					X																	133303464		1568	3582	5150			0					Xq26.2	2012-03-12		2008-12-18	ENSG00000207572	ENSG00000207572		"""ncRNAs / Micro RNAs"""	32023	non-coding RNA	RNA, micro				MIRN363			Standard	NR_029852		Approved	hsa-mir-363, MIR-363	uc022ceb.1				X.37:g.133303464C>T				RNA	SNP	-	NULL	ENST00000384840.1	37	NULL		X																																																																																			MIR363	-	-	ENSG00000207572		0.383	MIR363-201	KNOWN	basic	miRNA	MIR363	HGNC	miRNA			0.00	48	0	C	NR_029852		133303464	-1			no_errors	ENST00000384840	ensembl	human	known	74_37	rna	7.14	52	4	SNP	1.000	T
NELFA	7469	genome.wustl.edu	37	4	1988154	1988154	+	Intron	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr4:1988154G>A	ENST00000411638.2	-	5	650				MIR943_ENST00000401286.1_RNA|NELFA_ENST00000382882.3_Intron|NELFA_ENST00000542778.1_Intron	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A						gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										CAGTCAGGGCGCCAGCAGCAG	0.677																																																	0													34.0	35.0	35.0					4																	1988154		2201	4298	6499	SO:0001627	intron_variant	0			AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.635-25C>T	4.37:g.1988154G>A			A2A2T1|O95392	RNA	SNP	-	NULL	ENST00000411638.2	37	NULL		4																																																																																			MIR943	-	-	ENSG00000216105		0.677	NELFA-015	NOVEL	basic|appris_principal	protein_coding	MIR943	HGNC	protein_coding	OTTHUMT00000473007.1	-	0.00	68	0	G	NM_005663		1988154	-1	tier1	-	no_errors	ENST00000401286	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.001	A
MKL2	57496	genome.wustl.edu	37	16	14311145	14311145	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:14311145G>T	ENST00000341243.5	+	5	481		c.e5+1		MKL2_ENST00000573051.1_Splice_Site|MKL2_ENST00000572567.1_Splice_Site|MKL2_ENST00000574045.1_Splice_Site|MKL2_ENST00000571589.1_Splice_Site|MKL2_ENST00000318282.5_Splice_Site			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2						blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCAATTATAGGCAAGACTCTA	0.363																																																	0													92.0	108.0	103.0					16																	14311145		2197	4300	6497	SO:0001630	splice_region_variant	0			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.481+1G>T	16.37:g.14311145G>T			A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Splice_Site	SNP	-	e5+1	ENST00000341243.5	37	c.481+1		16	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751993	0.89753	.	.	ENSG00000186260	ENST00000318282;ENST00000389126;ENST00000341243	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2924	0.94105	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MKL2	14218646	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.751000	0.98889	2.878000	0.98634	0.650000	0.86243	.	MKL2	-	-	ENSG00000186260		0.363	MKL2-202	KNOWN	basic	protein_coding	MKL2	HGNC	protein_coding			0.00	61	0	G	NM_014048	Intron	14311145	+1			no_errors	ENST00000341243	ensembl	human	known	74_37	splice_site	8.33	66	6	SNP	1.000	T
MPRIP	23164	genome.wustl.edu	37	17	17000134	17000134	+	Intron	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:17000134G>T	ENST00000341712.4	+	3	267				MPRIP_ENST00000395807.2_3'UTR|MPRIP_ENST00000395811.5_Intron|MPRIP_ENST00000395804.3_Intron|MPRIP_ENST00000444976.1_Intron			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						AGGGAGCTTGGATTCATTCAC	0.493																																																	0																																										SO:0001627	intron_variant	0			BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.267+18744G>T	17.37:g.17000134G>T			Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	RNA	SNP	-	NULL	ENST00000341712.4	37	NULL	CCDS32578.1	17																																																																																			MPRIP	-	-	ENSG00000133030		0.493	MPRIP-002	KNOWN	basic|CCDS	protein_coding	MPRIP	HGNC	protein_coding	OTTHUMT00000131587.1	-	0.00	81	0	G	NM_015134		17000134	+1	tier1	-	no_errors	ENST00000395807	ensembl	human	known	74_37	rna	7.35	63	5	SNP	0.004	T
MRGPRF	116535	genome.wustl.edu	37	11	68772956	68772956	+	Silent	SNP	G	G	A	rs144312357		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:68772956G>A	ENST00000309099.6	-	3	1204	c.822C>T	c.(820-822)taC>taT	p.Y274Y	RP11-554A11.5_ENST00000562506.1_RNA|MRGPRF_ENST00000441623.1_Silent_p.Y274Y	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	274						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GGTCAGTGACGTACTCGGGGA	0.617																																																	0								G	,	0,4392		0,0,2196	38.0	28.0	31.0		822,822	-0.0	1.0	11	dbSNP_134	31	1,8579		0,1,4289	no	coding-synonymous,coding-synonymous	MRGPRF	NM_001098515.1,NM_145015.4	,	0,1,6485	AA,AG,GG		0.0117,0.0,0.0077	,	274/344,274/344	68772956	1,12971	2196	4290	6486	SO:0001819	synonymous_variant	0			AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.822C>T	11.37:g.68772956G>A			B3KV43|Q8NBK8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.Y274	ENST00000309099.6	37	c.822	CCDS8188.1	11																																																																																			MRGPRF	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172935		0.617	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRF	HGNC	protein_coding	OTTHUMT00000396875.1	-	0.00	34	0	G	NM_145015		68772956	-1	tier1	rs144312357	no_errors	ENST00000309099	ensembl	human	known	74_37	silent	23.33	23	7	SNP	0.992	A
MROH2B	133558	genome.wustl.edu	37	5	41018510	41018510	+	Nonsense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:41018510G>C	ENST00000399564.4	-	27	3146	c.2696C>G	c.(2695-2697)tCa>tGa	p.S899*	MROH2B_ENST00000506092.2_Nonsense_Mutation_p.S454*	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	899																	CTCTTTTTGTGAAACAAGCCA	0.353																																																	0													75.0	70.0	71.0					5																	41018510		1848	4092	5940	SO:0001587	stop_gained	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2696C>G	5.37:g.41018510G>C	ENSP00000382476:p.Ser899*		Q68DM1|Q7Z4U4|Q8N7X3	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.S899*	ENST00000399564.4	37	c.2696	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	G	41	8.543436	0.98857	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	.	.	.	5.96	5.96	0.96718	.	0.000000	0.47852	D	0.000205	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.9221	0.79583	0.0:0.0:1.0:0.0	.	.	.	.	X	454;604;899	.	ENSP00000296803:S604X	S	-	2	0	HEATR7B2	41054267	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	4.489000	0.60309	2.832000	0.97577	0.655000	0.94253	TCA	MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.353	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	-	0.00	41	0	G	NM_173489		41018510	-1	tier1	-	no_errors	ENST00000399564	ensembl	human	known	74_37	nonsense	15.00	34	6	SNP	0.994	C
MST1L	11223	genome.wustl.edu	37	1	17083485	17083485	+	RNA	SNP	A	A	G	rs371742490		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:17083485A>G	ENST00000455405.2	-	0	1103							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										acttgtattgataaggcaaaa	0.373																																																	0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083485A>G			B7WPB1|Q13209	RNA	SNP	-	NULL	ENST00000455405.2	37	NULL		1																																																																																			MST1L	-	-	ENSG00000186715		0.373	MST1L-002	KNOWN	basic	processed_transcript	MST1L	HGNC	pseudogene	OTTHUMT00000400328.1		0.00	8	0	A	NM_001271733		17083485	-1			no_errors	ENST00000455405	ensembl	human	known	74_37	rna	19.05	17	4	SNP	0.000	G
MT-CO1	4512	genome.wustl.edu	37	M	6666	6666	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrM:6666T>C	ENST00000361624.2	+	1	763	c.763T>C	c.(763-765)Tcc>Ccc	p.S255P	MT-TW_ENST00000387382.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	255					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCGGAATAATCTCCCATATTG	0.423																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.763T>C	M.37:g.6666T>C	ENSP00000354499:p.Ser255Pro		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.S255P	ENST00000361624.2	37	c.763		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	ENSG00000198804		0.423	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	14	0	T	YP_003024028		6666	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	63.64	4	7	SNP	NULL	C
MT-ND5	4540	genome.wustl.edu	37	M	13787	13787	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrM:13787T>C	ENST00000361567.2	+	1	1451	c.1451T>C	c.(1450-1452)cTc>cCc	p.L484P	MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	484					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AACAATCCCCCTCTACCTAAA	0.468																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1451T>C	M.37:g.13787T>C	ENSP00000354813:p.Leu484Pro		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.L484P	ENST00000361567.2	37	c.1451		MT																																																																																			MT-ND5	-	pfam_NADH_DH_su5_C,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.468	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	8	0	T	YP_003024036		13787	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	77.78	2	7	SNP	NULL	C
MTMR14	64419	genome.wustl.edu	37	3	9724868	9724868	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:9724868G>T	ENST00000296003.4	+	10	1026	c.904G>T	c.(904-906)Gat>Tat	p.D302Y	MTMR14_ENST00000351233.5_Missense_Mutation_p.D302Y|MTMR14_ENST00000420925.1_Missense_Mutation_p.D56Y|MTMR14_ENST00000353332.5_Missense_Mutation_p.D302Y	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	302					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					ACAGTGTTGGGATCTGGTGCA	0.418																																																	0													98.0	99.0	99.0					3																	9724868		1899	4123	6022	SO:0001583	missense	0			BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.904G>T	3.37:g.9724868G>T	ENSP00000296003:p.Asp302Tyr		Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	NULL	p.D302Y	ENST00000296003.4	37	c.904	CCDS43043.1	3	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581513	0.86748	.	.	ENSG00000163719	ENST00000353332;ENST00000420925;ENST00000296003;ENST00000351233;ENST00000419048;ENST00000431250	D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.95971	0.8688	M	0.83223	2.63	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.998	D	0.95721	0.8766	10	0.87932	D	0	-0.2104	20.4084	0.99013	0.0:0.0:1.0:0.0	.	56;302;302;302	C9JSR1;Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;.;MTMRE_HUMAN	Y	302;56;302;302;302;74	ENSP00000323462:D302Y;ENSP00000401993:D56Y;ENSP00000296003:D302Y;ENSP00000334070:D302Y;ENSP00000388746:D74Y	ENSP00000296003:D302Y	D	+	1	0	MTMR14	9699868	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	8.564000	0.90726	2.833000	0.97629	0.650000	0.86243	GAT	MTMR14	-	NULL	ENSG00000163719		0.418	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR14	HGNC	protein_coding	OTTHUMT00000338435.1		0.00	61	0	G	NM_022485		9724868	+1			no_errors	ENST00000296003	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
LINC01317	104355287	genome.wustl.edu	37	2	33952553	33952553	+	lincRNA	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:33952553C>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							CTTCAGCAGCCCCAGCTCGGA	0.627																																																	0																																												0																															2.37:g.33952553C>T				RNA	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-	ENSG00000239649		0.627	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1		0.00	36	0	C			33952553	-1			no_errors	ENST00000474610	ensembl	human	known	74_37	rna	21.05	15	4	SNP	1.000	T
MYSM1	114803	genome.wustl.edu	37	1	59137558	59137558	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:59137558G>A	ENST00000472487.1	-	12	1684	c.1645C>T	c.(1645-1647)Cca>Tca	p.P549S	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	549					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					GTTGGTCTTGGCACTTTTAAA	0.318																																																	0													123.0	114.0	117.0					1																	59137558		1816	4090	5906	SO:0001583	missense	0			AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.1645C>T	1.37:g.59137558G>A	ENSP00000418734:p.Pro549Ser		A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	pfam_SWIRM,pfam_JAB_MPN_dom,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,smart_JAB_MPN_dom,pfscan_SWIRM,pfscan_Myb-like_dom	p.P549S	ENST00000472487.1	37	c.1645	CCDS41343.1	1	.	.	.	.	.	.	.	.	.	.	G	2.856	-0.237296	0.05944	.	.	ENSG00000162601	ENST00000472487	T	0.20738	2.05	4.69	3.72	0.42706	.	0.327537	0.34025	N	0.004340	T	0.08268	0.0206	N	0.16307	0.4	0.09310	N	0.999993	B	0.06786	0.001	B	0.04013	0.001	T	0.38373	-0.9664	10	0.02654	T	1	-0.3121	2.6302	0.04941	0.274:0.0:0.5:0.226	.	549	Q5VVJ2	MYSM1_HUMAN	S	549	ENSP00000418734:P549S	ENSP00000418734:P549S	P	-	1	0	MYSM1	58910146	0.995000	0.38212	0.975000	0.42487	0.997000	0.91878	2.181000	0.42547	1.050000	0.40346	0.650000	0.86243	CCA	MYSM1	-	NULL	ENSG00000162601		0.318	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYSM1	HGNC	protein_coding	OTTHUMT00000026343.2		0.00	36	0	G	XM_055481		59137558	-1			no_errors	ENST00000472487	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.361	A
NCKAP5	344148	genome.wustl.edu	37	2	133540699	133540699	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:133540699G>T	ENST00000409261.1	-	14	4058	c.3685C>A	c.(3685-3687)Cta>Ata	p.L1229I	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.L1229I|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1229										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GGCTCTTGTAGTGCTGTTTCC	0.507																																																	0													117.0	113.0	114.0					2																	133540699		1937	4158	6095	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3685C>A	2.37:g.133540699G>T	ENSP00000387128:p.Leu1229Ile		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.L1229I	ENST00000409261.1	37	c.3685	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098264	0.37048	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.10860	2.83;2.83	5.5	2.51	0.30379	.	4.412020	0.01228	U	0.008265	T	0.08537	0.0212	N	0.14661	0.345	0.09310	N	1	B	0.22003	0.063	B	0.21917	0.037	T	0.31613	-0.9937	10	0.36615	T	0.2	.	6.9309	0.24442	0.0921:0.0:0.5038:0.4041	.	1229	O14513	NCKP5_HUMAN	I	1229	ENSP00000387128:L1229I;ENSP00000380603:L1229I	ENSP00000380603:L1229I	L	-	1	2	NCKAP5	133257169	0.000000	0.05858	0.000000	0.03702	0.244000	0.25665	0.036000	0.13819	0.317000	0.23160	0.655000	0.94253	CTA	NCKAP5	-	NULL	ENSG00000176771		0.507	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	-	0.00	47	0	G	NM_207481		133540699	-1	tier1	-	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.000	T
NCL	4691	genome.wustl.edu	37	2	232321441	232321441	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:232321441C>T	ENST00000322723.4	-	11	1846	c.1606G>A	c.(1606-1608)Gct>Act	p.A536T	SNORA75_ENST00000384158.1_RNA|SNORD20_ENST00000384550.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	536	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)	p.A536T(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		GCTTCTTTAGCGTCTTCGAAT	0.443																																																	1	Substitution - Missense(1)	central_nervous_system(1)											104.0	102.0	103.0					2																	232321441		2203	4300	6503	SO:0001583	missense	0				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.1606G>A	2.37:g.232321441C>T	ENSP00000318195:p.Ala536Thr		Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.A536T	ENST00000322723.4	37	c.1606	CCDS33397.1	2	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842648	0.91197	.	.	ENSG00000115053	ENST00000322723;ENST00000392033;ENST00000322732;ENST00000356936	D;T	0.84442	-1.85;1.52	5.6	5.6	0.85130	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.145267	0.64402	D	0.000008	D	0.93887	0.8044	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.94689	0.7872	10	0.87932	D	0	-25.1157	18.6624	0.91475	0.0:1.0:0.0:0.0	.	536	P19338	NUCL_HUMAN	T	536;428;308;161	ENSP00000318195:A536T;ENSP00000349410:A161T	ENSP00000318195:A536T	A	-	1	0	NCL	232029685	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	5.197000	0.65141	2.651000	0.90000	0.551000	0.68910	GCT	NCL	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000115053		0.443	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCL	HGNC	protein_coding	OTTHUMT00000332731.1		0.00	42	0	C	NM_005381		232321441	-1			no_errors	ENST00000322723	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
NELL1	4745	genome.wustl.edu	37	11	20907087	20907087	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:20907087G>T	ENST00000357134.5	+	5	755		c.e5+1		NELL1_ENST00000298925.5_Splice_Site|NELL1_ENST00000325319.5_Splice_Site|NELL1_ENST00000532434.1_Splice_Site	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)						cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CTTATTCAAAGTAAGCACTAA	0.403																																																	0													72.0	66.0	68.0					11																	20907087		2203	4300	6503	SO:0001630	splice_region_variant	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.603+1G>T	11.37:g.20907087G>T			B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Splice_Site	SNP	-	e5+1	ENST00000357134.5	37	c.603+1	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281141	0.80692	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8059	0.92037	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NELL1	20863663	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.783000	0.85696	2.526000	0.85167	0.591000	0.81541	.	NELL1	-	-	ENSG00000165973		0.403	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1		0.00	37	0	G	NM_006157	Intron	20907087	+1			no_errors	ENST00000357134	ensembl	human	known	74_37	splice_site	5.00	38	2	SNP	1.000	T
NF2	4771	genome.wustl.edu	37	22	30057296	30057296	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr22:30057296G>T	ENST00000338641.4	+	8	1219	c.778G>T	c.(778-780)Gaa>Taa	p.E260*	NF2_ENST00000361166.4_Nonsense_Mutation_p.E260*|NF2_ENST00000347330.5_Nonsense_Mutation_p.E101*|NF2_ENST00000403435.1_Nonsense_Mutation_p.E260*|NF2_ENST00000403999.3_Nonsense_Mutation_p.E260*|NF2_ENST00000361676.4_Nonsense_Mutation_p.E218*|NF2_ENST00000334961.7_Nonsense_Mutation_p.E177*|NF2_ENST00000397789.3_Nonsense_Mutation_p.E260*|NF2_ENST00000361452.4_Nonsense_Mutation_p.E219*|NF2_ENST00000353887.4_Nonsense_Mutation_p.E177*|NF2_ENST00000413209.2_Intron	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	260	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.D245fs*31(1)|p.N226_E270del(1)|p.K253_S265del(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CCCGTGGAATGAAATCCGAAA	0.532			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																														yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	6	Unknown(3)|Deletion - In frame(2)|Complex - frameshift(1)	soft_tissue(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)	GRCh37	CI084935	NF2	I							127.0	118.0	121.0					22																	30057296		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.778G>T	22.37:g.30057296G>T	ENSP00000344666:p.Glu260*		O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Nonsense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,smart_Band_41_domain,pfscan_FERM_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,prints_Tropomyosin	p.E260*	ENST00000338641.4	37	c.778	CCDS13861.1	22	.	.	.	.	.	.	.	.	.	.	G	41	8.687139	0.98914	.	.	ENSG00000186575	ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0795	0.97766	0.0:0.0:1.0:0.0	.	.	.	.	X	101;260;260;219;260;260;177;177;260;218;260	.	.	E	+	1	0	NF2	28387296	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.864000	0.99589	2.747000	0.94245	0.650000	0.86243	GAA	NF2	-	pirsf_ERM,pfam_FERM_PH-like_C,pfscan_FERM_domain	ENSG00000186575		0.532	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NF2	HGNC	protein_coding	OTTHUMT00000075615.3		0.00	78	0	G	NM_000268		30057296	+1			no_errors	ENST00000338641	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	1.000	T
NFAT5	10725	genome.wustl.edu	37	16	69726422	69726422	+	Silent	SNP	G	G	A	rs369235958		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:69726422G>A	ENST00000354436.2	+	12	2958	c.2640G>A	c.(2638-2640)caG>caA	p.Q880Q	NFAT5_ENST00000566899.1_Silent_p.Q804Q|NFAT5_ENST00000432919.1_Silent_p.Q898Q|NFAT5_ENST00000567239.1_Silent_p.Q897Q|NFAT5_ENST00000349945.1_Silent_p.Q804Q|NFAT5_ENST00000393742.2_Silent_p.Q804Q	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	880	Poly-Gln.				cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q804Q(1)|p.Q898Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CTAATcaacagcagcagcagc	0.478																																																	2	Substitution - coding silent(2)	endometrium(2)											44.0	43.0	43.0					16																	69726422		2198	4300	6498	SO:0001819	synonymous_variant	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2640G>A	16.37:g.69726422G>A			A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Silent	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.Q898	ENST00000354436.2	37	c.2694	CCDS10881.1	16																																																																																			NFAT5	-	NULL	ENSG00000102908		0.478	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2		0.00	27	0	G	NM_138714		69726422	+1			no_errors	ENST00000432919	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.988	A
NKPD1	284353	genome.wustl.edu	37	19	45662002	45662002	+	5'Flank	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:45662002G>C	ENST00000438936.2	-	0	0				NKPD1_ENST00000317951.4_Missense_Mutation_p.L150V			Q17RQ9	NKPD1_HUMAN	NTPase, KAP family P-loop domain containing 1							integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|prostate(2)|urinary_tract(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GGCTTCAGGAGGACGCCAGCC	0.711																																																	0													17.0	23.0	21.0					19																	45662002		692	1591	2283	SO:0001631	upstream_gene_variant	0			AK090919		19q13.32	2012-07-02		2012-07-02	ENSG00000179846	ENSG00000179846			24739	protein-coding gene	gene with protein product						14702039	Standard	NM_198478		Approved	FLJ33600	uc010xxi.2	Q17RQ9	OTTHUMG00000160521		19.37:g.45662002G>C	Exception_encountered		B7ZLG6|D6RH15|Q8N2A2	Missense_Mutation	SNP	pfam_KAP_NTPase	p.L150V	ENST00000438936.2	37	c.448		19	.	.	.	.	.	.	.	.	.	.	G	7.015	0.557615	0.13436	.	.	ENSG00000179846	ENST00000317951	T	0.60171	0.21	4.13	-0.947	0.10382	.	.	.	.	.	T	0.53965	0.1829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49273	-0.8957	5	.	.	.	.	8.1112	0.30916	0.1832:0.1348:0.682:0.0	.	.	.	.	V	150	ENSP00000321976:L150V	.	L	-	1	0	NKPD1	50353842	0.970000	0.33590	0.795000	0.32087	0.085000	0.17905	0.298000	0.19120	0.139000	0.18822	-1.149000	0.01842	CTC	NKPD1	-	NULL	ENSG00000179846		0.711	NKPD1-001	KNOWN	basic	protein_coding	NKPD1	HGNC	protein_coding	OTTHUMT00000360950.2	-	0.00	12	0	G	NM_198478		45662002	-1	tier1	-	no_errors	ENST00000317951	ensembl	human	known	74_37	missense	40.00	6	4	SNP	0.792	C
NLRP1	22861	genome.wustl.edu	37	17	5440193	5440193	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:5440193G>T	ENST00000572272.1	-	8	2937	c.2938C>A	c.(2938-2940)Cag>Aag	p.Q980K	NLRP1_ENST00000577119.1_Intron|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000354411.3_Intron|NLRP1_ENST00000345221.3_Missense_Mutation_p.Q980K|NLRP1_ENST00000269280.4_Missense_Mutation_p.Q980K|NLRP1_ENST00000262467.5_Missense_Mutation_p.Q980K			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	980					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				ATGAGCAGCTGAGGTTTCTCC	0.612																																																	0													80.0	66.0	71.0					17																	5440193		2203	4300	6503	SO:0001583	missense	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.2938C>A	17.37:g.5440193G>T	ENSP00000460475:p.Gln980Lys		E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.Q980K	ENST00000572272.1	37	c.2938	CCDS42246.1	17	.	.	.	.	.	.	.	.	.	.	G	7.492	0.650958	0.14516	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000345221;ENST00000537069	T;T;T;T	0.69806	-0.43;-0.43;-0.41;-0.41	3.37	-2.43	0.06522	.	0.739778	0.11126	N	0.596938	T	0.36413	0.0966	N	0.11201	0.11	0.09310	N	1	B;B;B;B	0.11235	0.002;0.001;0.004;0.001	B;B;B;B	0.17722	0.019;0.003;0.005;0.001	T	0.35425	-0.9789	10	0.02654	T	1	.	7.0092	0.24853	0.0:0.5195:0.2901:0.1904	.	246;980;980;980	F5H042;Q9C000;Q9C000-2;E9PE50	.;NALP1_HUMAN;.;.	K	980;980;980;980;246	ENSP00000442029:Q980K;ENSP00000262467:Q980K;ENSP00000269280:Q980K;ENSP00000324366:Q980K	ENSP00000262467:Q980K	Q	-	1	0	NLRP1	5380917	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.290000	0.08354	-0.125000	0.11703	-0.189000	0.12847	CAG	NLRP1	-	NULL	ENSG00000091592		0.612	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1	-	0.00	26	0	G	NM_033004		5440193	-1	tier1	-	no_errors	ENST00000572272	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.000	T
NLRP7	199713	genome.wustl.edu	37	19	55450533	55450533	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:55450533G>A	ENST00000590030.1	-	3	1694	c.1654C>T	c.(1654-1656)Caa>Taa	p.Q552*	NLRP7_ENST00000588756.1_Nonsense_Mutation_p.Q552*|NLRP7_ENST00000446217.1_Nonsense_Mutation_p.Q580*|NLRP7_ENST00000448121.2_Nonsense_Mutation_p.Q552*|NLRP7_ENST00000340844.2_Nonsense_Mutation_p.Q552*|NLRP7_ENST00000328092.5_Nonsense_Mutation_p.Q552*|NLRP7_ENST00000592784.1_Nonsense_Mutation_p.Q552*			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	552							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GCTTTGCATTGCAGCAATTCC	0.527																																																	0													87.0	86.0	87.0					19																	55450533		2203	4300	6503	SO:0001587	stop_gained	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1654C>T	19.37:g.55450533G>A	ENSP00000465520:p.Gln552*		E9PE16|Q32MH8|Q7RTR1	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Q580*	ENST00000590030.1	37	c.1738	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546044	0.65198	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	.	.	.	1.74	-2.97	0.05530	.	3.036110	0.01504	N	0.017615	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	3.9581	0.09399	0.0:0.4615:0.2433:0.2952	.	.	.	.	X	552;552;552;580;319	.	ENSP00000329568:Q552X	Q	-	1	0	NLRP7	60142345	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.904000	0.04080	-0.982000	0.03515	-0.521000	0.04368	CAA	NLRP7	-	NULL	ENSG00000167634		0.527	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1		0.00	33	0	G	NM_139176		55450533	-1			no_errors	ENST00000446217	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	0.002	A
NSL1	25936	genome.wustl.edu	37	1	212911901	212911901	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:212911901G>T	ENST00000366977.3	-	6	713	c.695C>A	c.(694-696)cCt>cAt	p.P232H	NSL1_ENST00000366975.6_Missense_Mutation_p.P191H|NSL1_ENST00000366978.1_Intron|NSL1_ENST00000422588.2_3'UTR|NSL1_ENST00000366976.1_3'UTR	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	232					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		AAAGTTCTCAGGTTTAGCATC	0.443																																																	0													169.0	172.0	171.0					1																	212911901		2203	4300	6503	SO:0001583	missense	0			AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.695C>A	1.37:g.212911901G>T	ENSP00000355944:p.Pro232His		E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	pfam_Kinetochore_Mis14	p.P232H	ENST00000366977.3	37	c.695	CCDS1509.1	1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839946	0.32513	.	.	ENSG00000117697	ENST00000366977;ENST00000366975	T;T	0.34667	1.35;1.36	5.25	4.34	0.51931	.	0.669453	0.14180	N	0.336082	T	0.52837	0.1759	M	0.61703	1.905	0.20926	N	0.999822	D;D	0.76494	0.999;0.998	D;P	0.69479	0.964;0.87	T	0.40384	-0.9566	10	0.66056	D	0.02	-4.0E-4	8.033	0.30476	0.1925:0.0:0.8075:0.0	.	191;232	B4E071;Q96IY1	.;NSL1_HUMAN	H	232;191	ENSP00000355944:P232H;ENSP00000355942:P191H	ENSP00000355942:P191H	P	-	2	0	NSL1	210978524	0.371000	0.25056	0.015000	0.15790	0.446000	0.32137	2.050000	0.41297	1.349000	0.45751	-0.266000	0.10368	CCT	NSL1	-	NULL	ENSG00000117697		0.443	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSL1	HGNC	protein_coding	OTTHUMT00000089398.2	-	0.00	51	0	G	NM_015471		212911901	-1	tier1	-	no_errors	ENST00000366977	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.051	T
NSUN6	221078	genome.wustl.edu	37	10	18835047	18835047	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr10:18835047T>C	ENST00000377304.4	-	11	1643	c.1225A>G	c.(1225-1227)Agg>Ggg	p.R409G	RP11-499P20.2_ENST00000436485.1_RNA|RP11-499P20.2_ENST00000425669.1_RNA|NSUN6_ENST00000493816.1_5'UTR	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	409							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.R409W(1)		endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						CCAGCTCCCCTCATTCCTTCT	0.463																																																	1	Substitution - Missense(1)	lung(1)											152.0	149.0	150.0					10																	18835047		2203	4300	6503	SO:0001583	missense	0			BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.1225A>G	10.37:g.18835047T>C	ENSP00000366519:p.Arg409Gly		B0YJ54	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_PUA,superfamily_PUA-like_domain,pfscan_PUA,prints_RCMT	p.R409G	ENST00000377304.4	37	c.1225	CCDS7130.1	10	.	.	.	.	.	.	.	.	.	.	T	13.93	2.385178	0.42308	.	.	ENSG00000241058	ENST00000377304	T	0.23950	1.88	5.5	-9.27	0.00659	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (1);	1.027660	0.07621	N	0.927031	T	0.08358	0.0208	N	0.05124	-0.11	0.26044	N	0.981579	B	0.09022	0.002	B	0.09377	0.004	T	0.29150	-1.0021	10	0.22706	T	0.39	.	5.7691	0.18243	0.0967:0.2292:0.5213:0.1528	.	409	Q8TEA1	NSUN6_HUMAN	G	409	ENSP00000366519:R409G	ENSP00000366519:R409G	R	-	1	2	NSUN6	18875053	0.112000	0.22096	0.801000	0.32222	0.833000	0.47200	-0.872000	0.04219	-1.430000	0.01985	-0.316000	0.08728	AGG	NSUN6	-	pfam_Fmu/NOL1/Nop2p	ENSG00000241058		0.463	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN6	HGNC	protein_coding	OTTHUMT00000047083.1		0.00	34	0	T	NM_182543		18835047	-1			no_errors	ENST00000377304	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.481	C
NTM	50863	genome.wustl.edu	37	11	132206283	132206283	+	3'UTR	DEL	A	A	-	rs542763858	byFrequency	TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:132206283delA	ENST00000374786.1	+	0	2757				NTM_ENST00000374791.3_3'UTR|NTM_ENST00000474900.1_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GTGAAAGGATAAAAAAAAAAA	0.418													|||unknown(HR)	650	0.129792	0.1263	0.0793	5008	,	,		12492	0.1071		0.1441	False		,,,				2504	0.1789																0																																										SO:0001624	3_prime_UTR_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*1243A>-	11.37:g.132206283delA			A0MTT2|Q6UXJ3|Q86VJ9	RNA	DEL	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			NTM	-	-	ENSG00000182667		0.418	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1		0.00	12	0	A	NM_016522		132206283	+1	tier1		no_errors	ENST00000474900	ensembl	human	known	74_37	rna	23.08	10	3	DEL	0.023	-
NUDT7	283927	genome.wustl.edu	37	16	77759424	77759424	+	Silent	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:77759424G>A	ENST00000268533.5	+	2	201	c.132G>A	c.(130-132)ttG>ttA	p.L44L	NUDT7_ENST00000563839.1_Intron|NUDT7_ENST00000564085.1_Silent_p.L44L|NUDT7_ENST00000568787.1_Silent_p.L44L|NUDT7_ENST00000437314.3_Silent_p.L44L	NM_001105663.2	NP_001099133.1	P0C024	NUDT7_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 7	44	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				acetyl-CoA catabolic process (GO:0046356)|brown fat cell differentiation (GO:0050873)|coenzyme A catabolic process (GO:0015938)|nucleoside diphosphate metabolic process (GO:0009132)	peroxisome (GO:0005777)	acetyl-CoA hydrolase activity (GO:0003986)|hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides (GO:0016818)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|receptor binding (GO:0005102)|snoRNA binding (GO:0030515)			breast(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|skin(1)	18						CCGTCCTTTTGCCATTGGTGG	0.418																																																	0													111.0	110.0	110.0					16																	77759424		1851	4085	5936	SO:0001819	synonymous_variant	0			AA227330	CCDS42195.1, CCDS58480.1, CCDS58479.1, CCDS73916.1	16q23.1	2007-06-15				ENSG00000140876		"""Nudix motif containing"""	8054	protein-coding gene	gene with protein product		609231				11415433	Standard	NM_001105663		Approved		uc010chd.3	P0C024		ENST00000268533.5:c.132G>A	16.37:g.77759424G>A			B4DLE5|H3BUB8	Silent	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.L44	ENST00000268533.5	37	c.132	CCDS42195.1	16																																																																																			NUDT7	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	ENSG00000140876		0.418	NUDT7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT7	HGNC	protein_coding	OTTHUMT00000433873.1	-	0.00	51	0	G			77759424	+1	tier1	-	no_errors	ENST00000268533	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.108	A
NUMB	8650	genome.wustl.edu	37	14	73750834	73750834	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:73750834G>T	ENST00000355058.3	-	10	1182	c.904C>A	c.(904-906)Cct>Act	p.P302T	NUMB_ENST00000556772.1_Missense_Mutation_p.P158T|NUMB_ENST00000557597.1_Missense_Mutation_p.P291T|NUMB_ENST00000454166.4_Intron|NUMB_ENST00000555238.1_Missense_Mutation_p.P302T|NUMB_ENST00000359560.3_Missense_Mutation_p.P291T|NUMB_ENST00000559312.1_Intron|NUMB_ENST00000535282.1_Missense_Mutation_p.P291T|NUMB_ENST00000555738.2_Intron|NUMB_ENST00000555394.1_Missense_Mutation_p.P302T|NUMB_ENST00000554546.1_Missense_Mutation_p.P291T|NUMB_ENST00000560335.1_Intron|NUMB_ENST00000356296.4_Missense_Mutation_p.P302T|NUMB_ENST00000554521.2_Intron|NUMB_ENST00000544991.3_Intron			P49757	NUMB_HUMAN	numb homolog (Drosophila)	302					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		ATAGTGGAAGGCAACTCATTG	0.473																																																	0													151.0	134.0	140.0					14																	73750834		2203	4300	6503	SO:0001583	missense	0			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.904C>A	14.37:g.73750834G>T	ENSP00000347169:p.Pro302Thr		B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.P302T	ENST00000355058.3	37	c.904	CCDS32116.1	14	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678306	0.88542	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000535282	T;T;T;T;T;T;T;T;T	0.67698	-0.17;-0.28;0.26;0.24;0.48;0.24;0.26;-0.28;0.26	5.26	5.26	0.73747	NUMB domain (1);	0.000000	0.85682	D	0.000000	T	0.80727	0.4678	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D	0.89917	0.986;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.958;0.998;0.999;0.999;0.994;0.999	T	0.80681	-0.1274	10	0.54805	T	0.06	-12.2309	19.0619	0.93096	0.0:0.0:1.0:0.0	.	48;291;291;302;291;302	B1P2N9;B2RCI6;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;NUMB_HUMAN	T	291;302;291;302;158;302;291;302;291	ENSP00000452416:P291T;ENSP00000348644:P302T;ENSP00000451117:P291T;ENSP00000451300:P302T;ENSP00000451513:P158T;ENSP00000347169:P302T;ENSP00000352563:P291T;ENSP00000451625:P302T;ENSP00000441258:P291T	ENSP00000347169:P302T	P	-	1	0	NUMB	72820587	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.615000	0.98356	2.744000	0.94065	0.650000	0.86243	CCT	NUMB	-	pfam_Numb_domain,pirsf_Numb/numb-like	ENSG00000133961		0.473	NUMB-201	KNOWN	basic|CCDS	protein_coding	NUMB	HGNC	protein_coding	OTTHUMT00000414416.1	-	0.00	76	0	G			73750834	-1	tier1	-	no_errors	ENST00000355058	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
NUP107	57122	genome.wustl.edu	37	12	69126365	69126366	+	Intron	INS	-	-	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:69126365_69126366insA	ENST00000229179.4	+	23	2330				NUP107_ENST00000539906.1_Intron|NUP107_ENST00000378905.2_Intron|NUP107_ENST00000401003.3_3'UTR	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			AGAATATCTTTAAAAAAAAAAC	0.287																																																	0																																										SO:0001627	intron_variant	0			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.1999-51->A	12.37:g.69126375_69126375dupA			B4DZ67|Q6PJE1	RNA	INS	-	NULL	ENST00000229179.4	37	NULL	CCDS8985.1	12																																																																																			NUP107	-	-	ENSG00000111581		0.287	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1		0.00	33	0	-	NM_020401		69126366	+1	tier1		no_errors	ENST00000401003	ensembl	human	known	74_37	rna	12.00	44	6	INS	0.000:0.000	A
NWD1	284434	genome.wustl.edu	37	19	16923594	16923594	+	Silent	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:16923594C>G	ENST00000552788.1	+	17	4326	c.4326C>G	c.(4324-4326)tcC>tcG	p.S1442S	NWD1_ENST00000523826.1_Silent_p.S1236S|NWD1_ENST00000549814.1_Silent_p.S1400S|NWD1_ENST00000379808.3_Intron|NWD1_ENST00000339803.6_Silent_p.S1307S|NWD1_ENST00000524140.2_Intron			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1442							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTTGCTTCTCCAAGGATGACA	0.418																																																	0													283.0	234.0	251.0					19																	16923594		2203	4300	6503	SO:0001819	synonymous_variant	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.4326C>G	19.37:g.16923594C>G			C9J021|Q68CT3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1307	ENST00000552788.1	37	c.3921		19																																																																																			NWD1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000188039		0.418	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	-	0.00	63	0	C	NM_001007525		16923594	+1	tier1	-	no_errors	ENST00000339803	ensembl	human	known	74_37	silent	25.93	40	14	SNP	1.000	G
OR4A5	81318	genome.wustl.edu	37	11	51411621	51411621	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:51411621C>A	ENST00000319760.6	-	1	827	c.775G>T	c.(775-777)Gtt>Ttt	p.V259F		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AAGTTTGAAACAGGTCTAACA	0.393																																																	0													51.0	51.0	51.0					11																	51411621		2201	4296	6497	SO:0001583	missense	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.775G>T	11.37:g.51411621C>A	ENSP00000367664:p.Val259Phe		Q6IF84	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V259F	ENST00000319760.6	37	c.775	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	4.309	0.056661	0.08291	.	.	ENSG00000221840	ENST00000319760	T	0.00107	8.72	2.2	0.053	0.14305	GPCR, rhodopsin-like superfamily (1);	1.428610	0.05236	N	0.511237	T	0.00210	0.0006	N	0.20445	0.575	0.09310	N	1	D	0.52996	0.957	D	0.64687	0.928	T	0.49716	-0.8910	10	0.27785	T	0.31	.	5.2396	0.15464	0.0:0.5253:0.0:0.4747	.	259	Q8NH83	OR4A5_HUMAN	F	259	ENSP00000367664:V259F	ENSP00000367664:V259F	V	-	1	0	OR4A5	51268197	0.000000	0.05858	0.131000	0.22000	0.056000	0.15407	-1.344000	0.02639	0.028000	0.15324	0.162000	0.16502	GTT	OR4A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221840		0.393	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	-	0.00	61	0	C	NM_001005272		51411621	-1	tier1	-	no_errors	ENST00000319760	ensembl	human	known	74_37	missense	11.11	56	7	SNP	0.159	A
OR7E24	26648	genome.wustl.edu	37	19	9362188	9362188	+	Missense_Mutation	SNP	C	C	T	rs201669790		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:9362188C>T	ENST00000456448.1	+	1	583	c.469C>T	c.(469-471)Cgc>Tgc	p.R157C		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R157C(1)		endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						CATGAACCCACGCCTCTGTGG	0.453																																																	1	Substitution - Missense(1)	large_intestine(1)						C	CYS/ARG	0,4382		0,0,2191	129.0	142.0	138.0		469	-4.8	0.0	19		138	2,8586		0,2,4292	yes	missense	OR7E24	NM_001079935.1	180	0,2,6483	TT,TC,CC		0.0233,0.0,0.0154	benign	157/340	9362188	2,12968	2191	4294	6485	SO:0001583	missense	0			Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.469C>T	19.37:g.9362188C>T	ENSP00000387523:p.Arg157Cys		B9EJD9|Q9UPJ1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R157C	ENST00000456448.1	37	c.469	CCDS45955.1	19	.	.	.	.	.	.	.	.	.	.	N	1.408	-0.576377	0.03882	0.0	2.33E-4	ENSG00000237521	ENST00000456448	T	0.43294	0.95	2.39	-4.79	0.03200	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.24661	0.0598	L	0.33293	1	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.15178	-1.0446	9	0.42905	T	0.14	.	3.6635	0.08247	0.3628:0.24:0.0:0.3972	.	157	Q6IFN5	O7E24_HUMAN	C	157	ENSP00000387523:R157C	ENSP00000387523:R157C	R	+	1	0	OR7E24	9223188	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.599000	0.00893	-1.556000	0.01695	-2.560000	0.00174	CGC	OR7E24	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000237521		0.453	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7E24	HGNC	protein_coding	OTTHUMT00000449006.1	-	0.00	79	0	C			9362188	+1	tier1	rs201669790	no_errors	ENST00000456448	ensembl	human	known	74_37	missense	29.23	46	19	SNP	0.000	T
OXSM	54995	genome.wustl.edu	37	3	25833286	25833286	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:25833286G>T	ENST00000280701.3	+	2	874	c.775G>T	c.(775-777)Gat>Tat	p.D259Y	NGLY1_ENST00000417874.2_5'Flank|OXSM_ENST00000420173.2_Intron|OXSM_ENST00000449808.1_3'UTR	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	259					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)	p.D259H(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CACAAACTCAGATCCCAAGTT	0.483																																																	1	Substitution - Missense(1)	lung(1)											76.0	78.0	77.0					3																	25833286		2203	4300	6503	SO:0001583	missense	0			BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.775G>T	3.37:g.25833286G>T	ENSP00000280701:p.Asp259Tyr			Missense_Mutation	SNP	pfam_Ketoacyl_synth_N,pfam_Ketoacyl_synth_C,pfam_Thiolase_N,superfamily_Thiolase-like,smart_PKS_Beta-ketoAc_synthase_dom,tigrfam_3-oxoacyl-ACP_synth-2	p.D259Y	ENST00000280701.3	37	c.775	CCDS2643.1	3	.	.	.	.	.	.	.	.	.	.	G	15.16	2.749565	0.49257	.	.	ENSG00000151093	ENST00000280701	.	.	.	6.16	6.16	0.99307	Beta-ketoacyl synthase, N-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (2);	0.335103	0.37304	N	0.002152	T	0.63803	0.2542	M	0.83118	2.625	0.80722	D	1	P	0.42203	0.773	P	0.44921	0.464	T	0.69569	-0.5110	9	0.87932	D	0	-34.1207	8.1268	0.31003	0.1802:0.0:0.8198:0.0	.	259	Q9NWU1	OXSM_HUMAN	Y	259	.	ENSP00000280701:D259Y	D	+	1	0	OXSM	25808290	0.997000	0.39634	0.976000	0.42696	0.986000	0.74619	2.942000	0.49018	2.937000	0.99478	0.650000	0.86243	GAT	OXSM	-	pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,smart_PKS_Beta-ketoAc_synthase_dom,tigrfam_3-oxoacyl-ACP_synth-2	ENSG00000151093		0.483	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXSM	HGNC	protein_coding	OTTHUMT00000252876.2		0.00	38	0	G	NM_017897		25833286	+1			no_errors	ENST00000280701	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.922	T
PATL1	219988	genome.wustl.edu	37	11	59423454	59423454	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:59423454C>G	ENST00000300146.9	-	7	872	c.788G>C	c.(787-789)aGa>aCa	p.R263T		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	263	Involved in RNA-binding.|Involved in nuclear foci localization.|Pro-rich.|Region N; interaction with decapping machinery.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						AAGCTGTGCTCTCTGGAGGGG	0.428																																																	0													14.0	14.0	14.0					11																	59423454		1831	4074	5905	SO:0001583	missense	0			AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.788G>C	11.37:g.59423454C>G	ENSP00000300146:p.Arg263Thr		B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Missense_Mutation	SNP	pfam_Topo_II-assoc_PAT1	p.R263T	ENST00000300146.9	37	c.788	CCDS44613.1	11	.	.	.	.	.	.	.	.	.	.	C	15.71	2.915117	0.52546	.	.	ENSG00000166889	ENST00000300146	T	0.47869	0.83	4.91	4.91	0.64330	.	0.114681	0.56097	D	0.000025	T	0.59676	0.2211	L	0.43152	1.355	0.53688	D	0.999972	D	0.62365	0.991	D	0.76071	0.987	T	0.52555	-0.8560	10	0.15952	T	0.53	-8.1191	17.6742	0.88226	0.0:1.0:0.0:0.0	.	263	Q86TB9	PATL1_HUMAN	T	263	ENSP00000300146:R263T	ENSP00000300146:R263T	R	-	2	0	PATL1	59180030	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.219000	0.72231	2.253000	0.74438	0.655000	0.94253	AGA	PATL1	-	pfam_Topo_II-assoc_PAT1	ENSG00000166889		0.428	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL1	HGNC	protein_coding	OTTHUMT00000394559.1	-	0.00	96	0	C	NM_152716		59423454	-1	tier1	-	no_errors	ENST00000300146	ensembl	human	known	74_37	missense	24.42	65	21	SNP	1.000	G
PCDHA2	56146	genome.wustl.edu	37	5	140174555	140174555	+	Silent	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:140174555G>A	ENST00000526136.1	+	1	6	c.6G>A	c.(4-6)gcG>gcA	p.A2A	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Silent_p.A2A|PCDHA2_ENST00000378132.1_Silent_p.A2A	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	2					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTAATGGCGTCTTCTATCA	0.502																																																	0													42.0	50.0	47.0					5																	140174555		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.6G>A	5.37:g.140174555G>A			O75287|Q9BTV3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A2	ENST00000526136.1	37	c.6	CCDS54914.1	5																																																																																			PCDHA2	-	NULL	ENSG00000204969		0.502	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	-	0.00	75	0	G	NM_018905		140174555	+1	tier1	-	no_errors	ENST00000526136	ensembl	human	known	74_37	silent	15.00	51	9	SNP	0.003	A
PCDHGB1	56104	genome.wustl.edu	37	5	140731471	140731471	+	Silent	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:140731471G>A	ENST00000523390.1	+	1	1644	c.1644G>A	c.(1642-1644)gtG>gtA	p.V548V	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	548	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGTGTTGGTGGGCGACCTCA	0.697																																																	0													43.0	53.0	50.0					5																	140731471		2148	4255	6403	SO:0001819	synonymous_variant	0			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1644G>A	5.37:g.140731471G>A			Q3SY75|Q9Y5C8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V548	ENST00000523390.1	37	c.1644	CCDS54923.1	5																																																																																			PCDHGB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000254221		0.697	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	-	0.00	74	0	G	NM_018922		140731471	+1	tier1	-	no_errors	ENST00000523390	ensembl	human	known	74_37	silent	19.64	45	11	SNP	0.999	A
PCDHGA6	56109	genome.wustl.edu	37	5	140755185	140755185	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:140755185G>A	ENST00000517434.1	+	1	1535	c.1535G>A	c.(1534-1536)gGg>gAg	p.G512E	PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	512	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCGACACTGGGATTCTGTAC	0.612																																																	0													102.0	119.0	113.0					5																	140755185		2167	4278	6445	SO:0001583	missense	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1535G>A	5.37:g.140755185G>A	ENSP00000429601:p.Gly512Glu		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G512E	ENST00000517434.1	37	c.1535	CCDS54926.1	5	.	.	.	.	.	.	.	.	.	.	.	14.78	2.638336	0.47153	.	.	ENSG00000253731	ENST00000517434	D	0.91464	-2.85	5.0	5.0	0.66597	Cadherin (5);Cadherin-like (1);	0.000000	0.31370	U	0.007761	D	0.97851	0.9294	H	0.99740	4.74	0.47778	D	0.999516	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99293	1.0899	10	0.87932	D	0	.	18.851	0.92230	0.0:0.0:1.0:0.0	.	512;512	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	E	512	ENSP00000429601:G512E	ENSP00000429601:G512E	G	+	2	0	PCDHGA6	140735369	1.000000	0.71417	0.227000	0.23927	0.012000	0.07955	7.695000	0.84257	2.757000	0.94681	0.563000	0.77884	GGG	PCDHGA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253731		0.612	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1	-	0.00	95	0	G	NM_018919		140755185	+1	tier1	-	no_errors	ENST00000517434	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
PCDHGA12	26025	genome.wustl.edu	37	5	140812130	140812130	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:140812130G>A	ENST00000252085.3	+	1	1946	c.1804G>A	c.(1804-1806)Gcc>Acc	p.A602T	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	602	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCCAGAACGCCTGGCTGTC	0.697																																																	0													38.0	46.0	43.0					5																	140812130		2198	4294	6492	SO:0001583	missense	0			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.1804G>A	5.37:g.140812130G>A	ENSP00000252085:p.Ala602Thr		O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A602T	ENST00000252085.3	37	c.1804	CCDS4260.1	5	.	.	.	.	.	.	.	.	.	.	g	26.6	4.751392	0.89753	.	.	ENSG00000253159	ENST00000252085	T	0.60797	0.16	4.89	4.89	0.63831	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.82047	0.4952	M	0.92268	3.29	0.39099	D	0.961242	D;D	0.89917	1.0;1.0	D;D	0.79784	0.988;0.993	D	0.87852	0.2658	9	0.87932	D	0	.	18.4792	0.90806	0.0:0.0:1.0:0.0	.	602;602	O60330-2;O60330	.;PCDGC_HUMAN	T	602	ENSP00000252085:A602T	ENSP00000252085:A602T	A	+	1	0	PCDHGA12	140792314	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.612000	0.67681	2.432000	0.82394	0.556000	0.70494	GCC	PCDHGA12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253159		0.697	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA12	HGNC	protein_coding	OTTHUMT00000251806.2		0.00	117	0	G	NM_003735		140812130	+1			no_errors	ENST00000252085	ensembl	human	known	74_37	missense	5.94	94	6	SNP	1.000	A
PDZRN4	29951	genome.wustl.edu	37	12	41966630	41966630	+	Silent	SNP	C	C	A	rs138663536		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:41966630C>A	ENST00000402685.2	+	10	2057	c.2049C>A	c.(2047-2049)atC>atA	p.I683I	PDZRN4_ENST00000539469.2_Silent_p.I425I|PDZRN4_ENST00000298919.7_Silent_p.I423I	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	683							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GTCAGAATATCATGCAGGCTC	0.453																																																	0													99.0	91.0	94.0					12																	41966630		2203	4300	6503	SO:0001819	synonymous_variant	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2049C>A	12.37:g.41966630C>A			Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Silent	SNP	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.I683	ENST00000402685.2	37	c.2049	CCDS53777.1	12																																																																																			PDZRN4	-	NULL	ENSG00000165966		0.453	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1	-	0.00	55	0	C	NM_013377		41966630	+1	tier1	-	no_errors	ENST00000402685	ensembl	human	known	74_37	silent	13.73	44	7	SNP	1.000	A
PCED1B	91523	genome.wustl.edu	37	12	47628922	47628922	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:47628922C>T	ENST00000546455.1	+	4	807	c.76C>T	c.(76-78)Cat>Tat	p.H26Y	RP11-493L12.3_ENST00000547748.1_RNA|PCED1B_ENST00000432328.1_Missense_Mutation_p.H26Y			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	26							hydrolase activity (GO:0016787)										GGACTCTGTGCATAGGGCAGT	0.592																																																	0													75.0	73.0	74.0					12																	47628922		2203	4300	6503	SO:0001583	missense	0			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.76C>T	12.37:g.47628922C>T	ENSP00000446688:p.His26Tyr		Q96B20	Missense_Mutation	SNP	NULL	p.H26Y	ENST00000546455.1	37	c.76	CCDS8752.1	12	.	.	.	.	.	.	.	.	.	.	C	16.09	3.025150	0.54683	.	.	ENSG00000179715	ENST00000546455;ENST00000432328;ENST00000549500;ENST00000549630;ENST00000551777	T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3	4.06	4.06	0.47325	Esterase, SGNH hydrolase-type (1);	0.286062	0.28006	N	0.016974	T	0.20981	0.0505	L	0.44542	1.39	0.37397	D	0.912706	D	0.54601	0.967	P	0.48840	0.592	T	0.04811	-1.0925	10	0.87932	D	0	-13.0074	12.0477	0.53489	0.0:1.0:0.0:0.0	.	26	Q96HM7	F113B_HUMAN	Y	26	ENSP00000446688:H26Y;ENSP00000396040:H26Y;ENSP00000449680:H26Y;ENSP00000448000:H26Y;ENSP00000448926:H26Y	ENSP00000396040:H26Y	H	+	1	0	FAM113B	45915189	1.000000	0.71417	0.978000	0.43139	0.249000	0.25844	4.787000	0.62432	2.567000	0.86603	0.655000	0.94253	CAT	PCED1B	-	NULL	ENSG00000179715		0.592	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCED1B	HGNC	protein_coding	OTTHUMT00000405079.1	-	0.00	68	0	C	NM_138371		47628922	+1	tier1	-	no_errors	ENST00000432328	ensembl	human	known	74_37	missense	19.51	33	8	SNP	1.000	T
PHF8	23133	genome.wustl.edu	37	X	54040952	54040952	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:54040952G>T	ENST00000357988.5	-	7	1107	c.749C>A	c.(748-750)tCa>tAa	p.S250*	PHF8_ENST00000338946.6_Nonsense_Mutation_p.S214*|PHF8_ENST00000338154.6_Nonsense_Mutation_p.S214*|PHF8_ENST00000322659.8_Nonsense_Mutation_p.S214*	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	250	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						TTCGACCCATGACAGCTTTCG	0.468																																																	0													129.0	84.0	99.0					X																	54040952		2203	4300	6503	SO:0001587	stop_gained	0			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.749C>A	X.37:g.54040952G>T	ENSP00000350676:p.Ser250*		B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Nonsense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.S250*	ENST00000357988.5	37	c.749	CCDS55420.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	45|45	11.367772|11.367772	0.99552|0.99552	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000396282|ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659	.|.	.|.	.|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|0.128522	.|0.53938	.|D	.|0.000043	T|.	0.45558|.	0.1348|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.42916|.	-0.9423|.	3|.	.|0.05620	.|T	.|0.96	-9.0493|-9.0493	16.8548|16.8548	0.86003|0.86003	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	N|X	118|250;214;214;244;214	.|.	.|ENSP00000319473:S214X	H|S	-|-	1|2	0|0	PHF8|PHF8	54057677|54057677	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	9.833000|9.833000	0.99426|0.99426	2.241000|2.241000	0.73720|0.73720	0.494000|0.494000	0.49563|0.49563	CAT|TCA	PHF8	-	smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000172943		0.468	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	HGNC	protein_coding	OTTHUMT00000056784.2	-	0.00	34	0	G	NM_015107		54040952	-1	tier1	-	no_errors	ENST00000357988	ensembl	human	known	74_37	nonsense	6.78	55	4	SNP	1.000	T
PHYHD1	254295	genome.wustl.edu	37	9	131702926	131702926	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr9:131702926G>T	ENST00000372592.3	+	11	1568	c.635G>T	c.(634-636)gGt>gTt	p.G212V	RP11-101E3.5_ENST00000482796.1_5'Flank|PHYHD1_ENST00000487504.1_3'UTR|PHYHD1_ENST00000421063.2_Missense_Mutation_p.G191V|PHYHD1_ENST00000353176.5_Missense_Mutation_p.G191V|PHYHD1_ENST00000308941.5_Missense_Mutation_p.V205L	NM_001100876.1	NP_001094346.1	Q5SRE7	PHYD1_HUMAN	phytanoyl-CoA dioxygenase domain containing 1	212							dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(1)|stomach(3)	10						TCAGCGCCTGGTACCAGCTTC	0.607																																																	0													78.0	71.0	73.0					9																	131702926		2203	4300	6503	SO:0001583	missense	0			BC051300	CCDS6914.1, CCDS43885.1, CCDS43886.1	9q34.13	2010-08-13			ENSG00000175287	ENSG00000175287			23396	protein-coding gene	gene with protein product						12477932	Standard	NM_174933		Approved	MGC16638	uc004bwp.2	Q5SRE7	OTTHUMG00000020764	ENST00000372592.3:c.635G>T	9.37:g.131702926G>T	ENSP00000361673:p.Gly212Val		A6PWN9|A6PWP0|B3KT57|B4E3X8|Q5SRE9|Q5SRF0|Q7Z623|Q7Z7P9|Q96GM4	Missense_Mutation	SNP	pfam_Phytyl_CoA_dOase	p.V205L	ENST00000372592.3	37	c.613	CCDS43885.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.322|1.322	-0.599194|-0.599194	0.03744|0.03744	.|.	.|.	ENSG00000175287|ENSG00000175287	ENST00000372592;ENST00000353176;ENST00000421063|ENST00000308941	D;D;D|.	0.89746|.	-2.56;-2.56;-2.56|.	4.6|4.6	2.74|2.74	0.32292|0.32292	.|.	.|.	.|.	.|.	.|.	T|T	0.17323|0.17323	0.0416|0.0416	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999998|0.999998	B;B|B	0.25351|0.09022	0.014;0.124|0.002	B;B|B	0.21708|0.10450	0.009;0.036|0.005	T|T	0.32851|0.32851	-0.9891|-0.9891	8|7	0.12766|0.10377	T|T	0.61|0.69	-3.3126|-3.3126	6.4725|6.4725	0.22015|0.22015	0.0849:0.0:0.5939:0.3212|0.0849:0.0:0.5939:0.3212	.|.	191;212|205	Q5SRE7-2;Q5SRE7|Q5SRE7-3	.;PHYD1_HUMAN|.	V|L	212;191;191|205	ENSP00000361673:G212V;ENSP00000340945:G191V;ENSP00000409928:G191V|.	ENSP00000340945:G191V|ENSP00000309515:V205L	G|V	+|+	2|1	0|0	PHYHD1|PHYHD1	130742747|130742747	0.516000|0.516000	0.26218|0.26218	0.110000|0.110000	0.21437|0.21437	0.019000|0.019000	0.09904|0.09904	1.792000|1.792000	0.38754|0.38754	0.383000|0.383000	0.24910|0.24910	0.555000|0.555000	0.69702|0.69702	GGT|GTA	PHYHD1	-	NULL	ENSG00000175287		0.607	PHYHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYHD1	HGNC	protein_coding	OTTHUMT00000054506.2	-	0.00	76	0	G	NM_174933		131702926	+1	tier1	-	no_errors	ENST00000308941	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.001	T
PIK3R3	8503	genome.wustl.edu	37	1	46511589	46511589	+	Splice_Site	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:46511589C>A	ENST00000262741.5	-	9	1877		c.e9+1		RP4-533D7.4_ENST00000450004.1_RNA|PIK3R3_ENST00000340332.6_Splice_Site|PIK3R3_ENST00000420542.1_Splice_Site|PIK3R3_ENST00000423209.1_Splice_Site|PIK3R3_ENST00000372006.1_Splice_Site|PIK3R3_ENST00000488808.1_Splice_Site|PIK3R3_ENST00000354242.4_Splice_Site|PIK3R3_ENST00000540385.1_Splice_Site	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)						insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	AGAAGACTTACACCACAGAGC	0.363																																																	0													162.0	150.0	154.0					1																	46511589		2203	4300	6503	SO:0001630	splice_region_variant	0			BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.1187+1G>T	1.37:g.46511589C>A			B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	Splice_Site	SNP	-	e9+1	ENST00000262741.5	37	c.1325+1	CCDS529.1	1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506860	0.85282	.	.	ENSG00000117461	ENST00000372006;ENST00000262741;ENST00000420542;ENST00000354242;ENST00000340332;ENST00000540385;ENST00000423209	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.433	0.94779	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PIK3R3	46284176	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.818000	0.86416	2.779000	0.95612	0.655000	0.94253	.	PIK3R3	-	-	ENSG00000117461		0.363	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R3	HGNC	protein_coding	OTTHUMT00000022171.1		0.00	27	0	C	NM_003629	Intron	46511589	-1			no_errors	ENST00000540385	ensembl	human	known	74_37	splice_site	9.09	40	4	SNP	1.000	A
PLBD1	79887	genome.wustl.edu	37	12	14664493	14664493	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:14664493C>A	ENST00000240617.5	-	7	1649	c.997G>T	c.(997-999)Gca>Tca	p.A333S		NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	333					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						CCACTATCTGCCATCATATTG	0.443																																																	0													169.0	163.0	165.0					12																	14664493		2203	4300	6503	SO:0001583	missense	0			BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.997G>T	12.37:g.14664493C>A	ENSP00000240617:p.Ala333Ser		A8K4E9|Q9BVV3|Q9H625	Missense_Mutation	SNP	pfam_PLipase_B-like	p.A333S	ENST00000240617.5	37	c.997	CCDS31751.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.156360	0.94686	.	.	ENSG00000121316	ENST00000240617	T	0.19806	2.12	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.41581	0.1165	L	0.48935	1.535	0.80722	D	1	D	0.69078	0.997	D	0.71414	0.973	T	0.07829	-1.0752	10	0.62326	D	0.03	-16.2522	18.2436	0.89977	0.0:1.0:0.0:0.0	.	333	Q6P4A8	PLBL1_HUMAN	S	333	ENSP00000240617:A333S	ENSP00000240617:A333S	A	-	1	0	PLBD1	14555760	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	7.299000	0.78831	2.735000	0.93741	0.655000	0.94253	GCA	PLBD1	-	pfam_PLipase_B-like	ENSG00000121316		0.443	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	HGNC	protein_coding	OTTHUMT00000401203.1		0.00	56	0	C	NM_024829		14664493	-1			no_errors	ENST00000240617	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	A
PLEKHG4B	153478	genome.wustl.edu	37	5	140666	140666	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:140666C>T	ENST00000283426.6	+	1	294	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W	CTD-2231H16.1_ENST00000512035.1_lincRNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	82							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CAGGAGATCTCGGTCCTGGGA	0.672																																																	0													16.0	21.0	19.0					5																	140666		2169	4279	6448	SO:0001583	missense	0			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.244C>T	5.37:g.140666C>T	ENSP00000283426:p.Arg82Trp			Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R82W	ENST00000283426.6	37	c.244	CCDS34124.1	5	.	.	.	.	.	.	.	.	.	.	.	9.239	1.037873	0.19669	.	.	ENSG00000153404	ENST00000283426	T	0.25414	1.8	2.59	0.325	0.15903	.	.	.	.	.	T	0.18299	0.0439	N	0.19112	0.55	0.09310	N	1	D	0.76494	0.999	P	0.47941	0.562	T	0.14062	-1.0486	9	0.48119	T	0.1	.	6.3254	0.21240	0.5227:0.4773:0.0:0.0	.	82	Q96PX9	PKH4B_HUMAN	W	82	ENSP00000283426:R82W	ENSP00000283426:R82W	R	+	1	2	PLEKHG4B	193666	0.000000	0.05858	0.066000	0.19879	0.110000	0.19582	-0.832000	0.04400	0.054000	0.16065	0.298000	0.19748	CGG	PLEKHG4B	-	NULL	ENSG00000153404		0.672	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4B	HGNC	protein_coding	OTTHUMT00000365359.1	-	0.00	123	0	C	NM_052909		140666	+1	tier1	-	no_errors	ENST00000283426	ensembl	human	known	74_37	missense	8.14	79	7	SNP	0.189	T
PPIL4	85313	genome.wustl.edu	37	6	149856809	149856809	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:149856809C>T	ENST00000253329.2	-	5	419	c.387G>A	c.(385-387)gtG>gtA	p.V129V		NM_139126.3	NP_624311.1	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 4	129	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	13		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		TGCCTTCTGTCACCTCACCAA	0.348																																																	0													138.0	123.0	128.0					6																	149856809		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS34550.1	6q25.1	2013-02-12			ENSG00000131013	ENSG00000131013		"""RNA binding motif (RRM) containing"""	15702	protein-coding gene	gene with protein product		607609					Standard	NM_139126		Approved		uc003qmo.2	Q8WUA2	OTTHUMG00000015788	ENST00000253329.2:c.387G>A	6.37:g.149856809C>T			B2RD34|Q7Z3Q5	Silent	SNP	pfam_Cyclophilin-like_PPIase_dom,pfam_RRM_dom,superfamily_Cyclophilin-like_PPIase_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.V129	ENST00000253329.2	37	c.387	CCDS34550.1	6																																																																																			PPIL4	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	ENSG00000131013		0.348	PPIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL4	HGNC	protein_coding	OTTHUMT00000042642.1	-	0.00	51	0	C			149856809	-1	tier1	-	no_errors	ENST00000253329	ensembl	human	known	74_37	silent	23.61	55	17	SNP	0.999	T
PPP1R3D	5509	genome.wustl.edu	37	20	58514148	58514148	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr20:58514148C>T	ENST00000370996.3	-	1	1204	c.839G>A	c.(838-840)cGc>cAc	p.R280H	FAM217B_ENST00000360816.3_5'Flank|FAM217B_ENST00000358293.3_Intron	NM_006242.3	NP_006233.1	O95685	PPR3D_HUMAN	protein phosphatase 1, regulatory subunit 3D	280					dephosphorylation (GO:0016311)|glycogen metabolic process (GO:0005977)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)	glycogen granule (GO:0042587)|intracellular membrane-bounded organelle (GO:0043231)	protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|urinary_tract(1)	13	all_lung(29;0.00391)		BRCA - Breast invasive adenocarcinoma(7;5.12e-09)			CGCGTGGTTGCGACATGTGAG	0.652																																																	0													50.0	50.0	50.0					20																	58514148		2203	4300	6503	SO:0001583	missense	0			Y18206	CCDS13483.1	20q13.3	2012-04-17	2011-10-04	2001-08-01	ENSG00000132825	ENSG00000132825		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9294	protein-coding gene	gene with protein product		603326	"""protein phosphatase 1, regulatory (inhibitor) subunit 3D"""	PPP1R6		9414128, 9275233	Standard	NM_006242		Approved		uc002ybb.3	O95685	OTTHUMG00000032876	ENST00000370996.3:c.839G>A	20.37:g.58514148C>T	ENSP00000360035:p.Arg280His		Q6DK02	Missense_Mutation	SNP	pfam_CBM_21,pirsf_Pase-1_Glycogen_target-su_met,pfscan_CBM_21	p.R280H	ENST00000370996.3	37	c.839	CCDS13483.1	20	.	.	.	.	.	.	.	.	.	.	C	14.21	2.468816	0.43839	.	.	ENSG00000132825	ENST00000370996	T	0.56776	0.44	5.22	4.07	0.47477	.	0.210667	0.31199	N	0.008070	T	0.38931	0.1059	L	0.33485	1.01	0.36304	D	0.857222	B	0.25312	0.123	B	0.16289	0.015	T	0.39542	-0.9609	10	0.16896	T	0.51	-21.7536	14.671	0.68945	0.0:0.9178:0.0:0.0822	.	280	O95685	PPR3D_HUMAN	H	280	ENSP00000360035:R280H	ENSP00000360035:R280H	R	-	2	0	PPP1R3D	57947543	1.000000	0.71417	0.998000	0.56505	0.697000	0.40408	3.072000	0.50049	2.451000	0.82905	0.561000	0.74099	CGC	PPP1R3D	-	pirsf_Pase-1_Glycogen_target-su_met	ENSG00000132825		0.652	PPP1R3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3D	HGNC	protein_coding	OTTHUMT00000079940.2	-	0.00	28	0	C	NM_006242		58514148	-1	tier1	-	no_errors	ENST00000370996	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	T
PQLC1	80148	genome.wustl.edu	37	18	77679354	77679354	+	Nonsense_Mutation	SNP	G	G	T	rs570486466		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr18:77679354G>T	ENST00000397778.2	-	5	620	c.438C>A	c.(436-438)taC>taA	p.Y146*	PQLC1_ENST00000590381.1_Intron|PQLC1_ENST00000357575.4_Nonsense_Mutation_p.Y128*|PQLC1_ENST00000409073.1_Nonsense_Mutation_p.Y63*	NM_025078.4	NP_079354.2	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1	146						integral component of membrane (GO:0016021)		p.Y146*(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	9		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		CGCACTGCACGTAGTCCGAGA	0.622																																																	1	Substitution - Nonsense(1)	kidney(1)											82.0	67.0	72.0					18																	77679354		2203	4300	6503	SO:0001587	stop_gained	0			AK123870	CCDS12020.1, CCDS54192.1, CCDS54193.1	18q23	2004-01-14			ENSG00000122490	ENSG00000122490			26188	protein-coding gene	gene with protein product						12477932	Standard	NM_025078		Approved	FLJ22378	uc002lnl.2	Q8N2U9	OTTHUMG00000132921	ENST00000397778.2:c.438C>A	18.37:g.77679354G>T	ENSP00000380880:p.Tyr146*		B7Z7D9|G5E989|Q9H6D0	Nonsense_Mutation	SNP	smart_CTNS	p.Y146*	ENST00000397778.2	37	c.438	CCDS12020.1	18	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725947	0.69074	.	.	ENSG00000122490	ENST00000397778;ENST00000409073;ENST00000357575	.	.	.	4.97	-1.26	0.09376	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.8849	7.6774	0.28494	0.4875:0.1096:0.4029:0.0	.	.	.	.	X	146;63;128	.	ENSP00000350188:Y128X	Y	-	3	2	PQLC1	75780342	0.002000	0.14202	0.965000	0.40720	0.744000	0.42396	-1.209000	0.03002	-0.535000	0.06307	-0.797000	0.03246	TAC	PQLC1	-	NULL	ENSG00000122490		0.622	PQLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PQLC1	HGNC	protein_coding	OTTHUMT00000256434.1		0.00	58	0	G	NM_025078		77679354	-1			no_errors	ENST00000397778	ensembl	human	known	74_37	nonsense	5.08	56	3	SNP	0.995	T
PRG2	5553	genome.wustl.edu	37	11	57157401	57157401	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:57157401A>C	ENST00000311862.5	-	2	90	c.17T>G	c.(16-18)cTt>cGt	p.L6R	PRG2_ENST00000525955.1_Missense_Mutation_p.L6R|RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.L111R|PRG2_ENST00000533605.1_Missense_Mutation_p.L6R	NM_001243245.1|NM_002728.4	NP_001230174.1|NP_002719.3	P13727	PRG2_HUMAN	proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)	6					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	AAGAGCCAGAAGTAAGGGGAG	0.413																																																	0													181.0	168.0	172.0					11																	57157401		2201	4296	6497	SO:0001583	missense	0			BC005929	CCDS7955.1, CCDS58133.1	11q12	2005-11-25				ENSG00000186652			9362	protein-coding gene	gene with protein product		605601				1565101	Standard	NM_001243245		Approved	MBP, BMPG		P13727		ENST00000311862.5:c.17T>G	11.37:g.57157401A>C	ENSP00000312134:p.Leu6Arg		A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Eosinophil_major_basic	p.L6R	ENST00000311862.5	37	c.17	CCDS7955.1	11	.	.	.	.	.	.	.	.	.	.	A	14.93	2.680944	0.47886	.	.	ENSG00000186652;ENSG00000186652;ENSG00000186652;ENSG00000254979	ENST00000311862;ENST00000533605;ENST00000525955;ENST00000529411	T;T;T;D	0.83250	2.4;2.24;2.4;-1.7	3.97	3.97	0.46021	.	0.437666	0.16841	N	0.197353	D	0.87962	0.6310	M	0.63843	1.955	0.24263	N	0.995275	D;D	0.89917	1.0;1.0	D;D	0.68192	0.956;0.956	T	0.78765	-0.2076	10	0.87932	D	0	2.2461	9.8132	0.40835	1.0:0.0:0.0:0.0	.	6;6	A6XMW0;P13727	.;PRG2_HUMAN	R	6;6;6;111	ENSP00000312134:L6R;ENSP00000433231:L6R;ENSP00000433016:L6R;ENSP00000431536:L111R	ENSP00000312134:L6R	L	-	2	0	RP11-872D17.8;PRG2	56913977	0.547000	0.26465	0.974000	0.42286	0.990000	0.78478	1.460000	0.35244	1.726000	0.51525	0.533000	0.62120	CTT	PRG2	-	prints_Eosinophil_major_basic	ENSG00000186652		0.413	PRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRG2	HGNC	protein_coding	OTTHUMT00000392468.1		0.00	17	0	A	NM_002728		57157401	-1			no_errors	ENST00000311862	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.950	C
PRSS55	203074	genome.wustl.edu	37	8	10396231	10396231	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:10396231G>T	ENST00000328655.3	+	5	1027	c.987G>T	c.(985-987)gaG>gaT	p.E329D	PRSS55_ENST00000522210.1_Intron|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	329						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						GAGTCCCAGAGCCAGGCAGCC	0.512																																																	0													98.0	111.0	106.0					8																	10396231		2203	4300	6503	SO:0001583	missense	0			AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.987G>T	8.37:g.10396231G>T	ENSP00000333003:p.Glu329Asp		E5RJX5	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.E329D	ENST00000328655.3	37	c.987	CCDS5976.1	8	.	.	.	.	.	.	.	.	.	.	G	10.22	1.290522	0.23478	.	.	ENSG00000184647	ENST00000328655	D	0.88586	-2.4	3.64	-0.133	0.13485	.	1.413030	0.05311	N	0.524725	T	0.76601	0.4010	N	0.24115	0.695	0.09310	N	1	P	0.35011	0.48	B	0.30855	0.121	T	0.64394	-0.6418	10	0.20519	T	0.43	.	1.7349	0.02940	0.1123:0.1798:0.3829:0.325	.	329	Q6UWB4	PRS55_HUMAN	D	329	ENSP00000333003:E329D	ENSP00000333003:E329D	E	+	3	2	PRSS55	10433641	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.281000	0.18810	-0.035000	0.13691	-0.127000	0.14921	GAG	PRSS55	-	NULL	ENSG00000184647		0.512	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS55	HGNC	protein_coding	OTTHUMT00000251493.3		0.00	35	0	G	NM_198464		10396231	+1			no_errors	ENST00000328655	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.006	T
PRUNE2	158471	genome.wustl.edu	37	9	79465525	79465525	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr9:79465525G>T	ENST00000376718.3	-	3	321	c.198C>A	c.(196-198)ttC>ttA	p.F66L	PRUNE2_ENST00000428286.1_5'UTR|PRUNE2_ENST00000376713.3_Missense_Mutation_p.F66L	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	66					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TGAAGTAGTTGAATTCAGTTC	0.398																																																	0													140.0	146.0	144.0					9																	79465525		2203	4300	6503	SO:0001583	missense	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.198C>A	9.37:g.79465525G>T	ENSP00000365908:p.Phe66Leu		B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,pfam_DHHA2,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.F66L	ENST00000376718.3	37	c.198	CCDS47982.1	9	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218339	0.58560	.	.	ENSG00000106772	ENST00000376718;ENST00000422033;ENST00000376713	T	0.39787	1.06	5.78	4.88	0.63580	.	0.064903	0.64402	D	0.000007	T	0.48804	0.1520	L	0.38953	1.18	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.83275	0.996;0.97	T	0.29336	-1.0015	10	0.02654	T	1	.	15.1162	0.72404	0.0686:0.0:0.9314:0.0	.	66;66	Q8WUY3;D6RTK6	PRUN2_HUMAN;.	L	66;65;66	ENSP00000365908:F66L	ENSP00000365903:F66L	F	-	3	2	PRUNE2	78655345	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.992000	0.40737	2.730000	0.93505	0.650000	0.86243	TTC	PRUNE2	-	NULL	ENSG00000106772		0.398	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	-	0.00	56	0	G	NM_138818		79465525	-1	tier1	-	no_errors	ENST00000376718	ensembl	human	novel	74_37	missense	5.88	64	4	SNP	1.000	T
PSG6	5675	genome.wustl.edu	37	19	43407843	43407843	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:43407843C>G	ENST00000292125.2	-	6	1315	c.1271G>C	c.(1270-1272)gGt>gCt	p.G424A	PSG6_ENST00000187910.2_Intron|PSG6_ENST00000402603.4_Intron	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	424					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				ggtgtttggaccagcataggt	0.438																																																	0													55.0	51.0	53.0					19																	43407843		1326	2309	3635	SO:0001583	missense	0				CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.1271G>C	19.37:g.43407843C>G	ENSP00000292125:p.Gly424Ala		O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G424A	ENST00000292125.2	37	c.1271	CCDS12613.1	19	.	.	.	.	.	.	.	.	.	.	c	0.037	-1.303080	0.01353	.	.	ENSG00000170848	ENST00000292125	T	0.27890	1.64	0.331	0.331	0.15933	.	.	.	.	.	T	0.13157	0.0319	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32322	-0.9911	8	0.19590	T	0.45	.	.	.	.	.	424	Q00889	PSG6_HUMAN	A	424	ENSP00000292125:G424A	ENSP00000292125:G424A	G	-	2	0	PSG6	48099683	0.001000	0.12720	0.004000	0.12327	0.016000	0.09150	-1.172000	0.03112	0.434000	0.26340	0.134000	0.15878	GGT	PSG6	-	NULL	ENSG00000170848		0.438	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG6	HGNC	protein_coding	OTTHUMT00000321436.1	-	0.00	116	0	C	NM_002782		43407843	-1	tier1	-	no_errors	ENST00000292125	ensembl	human	known	74_37	missense	11.01	97	12	SNP	0.005	G
PTPRC	5788	genome.wustl.edu	37	1	198687417	198687417	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:198687417G>T	ENST00000367376.2	+	14	1810	c.1639G>T	c.(1639-1641)Gac>Tac	p.D547Y	PTPRC_ENST00000594404.1_Missense_Mutation_p.D386Y|PTPRC_ENST00000352140.3_Missense_Mutation_p.D499Y|PTPRC_ENST00000348564.6_Missense_Mutation_p.D388Y|PTPRC_ENST00000442510.2_Missense_Mutation_p.D549Y	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	547	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						ATATTCAACAGACTACACTTT	0.328																																																	0													52.0	50.0	51.0					1																	198687417		2202	4300	6502	SO:0001583	missense	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1639G>T	1.37:g.198687417G>T	ENSP00000356346:p.Asp547Tyr		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.D549Y	ENST00000367376.2	37	c.1645		1	.	.	.	.	.	.	.	.	.	.	g	3.009	-0.204255	0.06180	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.58210	0.35	4.52	-9.04	0.00734	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.959790	0.02323	N	0.073205	T	0.23451	0.0567	N	0.02391	-0.57	0.09310	N	1	B;B;B;B;B	0.10296	0.003;0.003;0.003;0.001;0.002	B;B;B;B;B	0.19391	0.012;0.025;0.006;0.006;0.006	T	0.38972	-0.9636	10	0.66056	D	0.02	.	4.5056	0.11885	0.5134:0.169:0.2316:0.086	.	483;483;388;499;547	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	Y	549;483;499;499;433;547;481;386	ENSP00000193532:D499Y	ENSP00000306782:D386Y	D	+	1	0	PTPRC	196954040	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.417000	0.02464	-3.012000	0.00272	-4.551000	0.00004	GAC	PTPRC	-	pirsf_Leukocyte_common_ag,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000081237		0.328	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding			0.00	30	0	G			198687417	+1			no_errors	ENST00000442510	ensembl	human	known	74_37	missense	5.36	52	3	SNP	0.000	T
PTPRH	5794	genome.wustl.edu	37	19	55697635	55697635	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:55697635G>T	ENST00000376350.3	-	16	2758	c.2736C>A	c.(2734-2736)agC>agA	p.S912R	PTPRH_ENST00000263434.5_Missense_Mutation_p.S734R	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	912	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CCAGGGTGTGGCTCTGCTGTT	0.632																																																	0													45.0	45.0	45.0					19																	55697635		2203	4300	6503	SO:0001583	missense	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.2736C>A	19.37:g.55697635G>T	ENSP00000365528:p.Ser912Arg		C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S912R	ENST00000376350.3	37	c.2736	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	G	15.94	2.981864	0.53827	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	D;D	0.84516	-1.86;-1.86	4.97	2.84	0.33178	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.42682	D	0.000676	D	0.91928	0.7444	M	0.87180	2.865	0.42552	D	0.993115	D;D	0.76494	0.999;0.999	D;D	0.87578	0.995;0.998	D	0.91349	0.5103	10	0.56958	D	0.05	.	10.432	0.44413	0.163:0.0:0.837:0.0	.	734;912	C9JCH2;Q9HD43	.;PTPRH_HUMAN	R	912;734	ENSP00000365528:S912R;ENSP00000263434:S734R	ENSP00000263434:S734R	S	-	3	2	PTPRH	60389447	0.262000	0.24073	0.991000	0.47740	0.671000	0.39405	1.427000	0.34881	0.649000	0.30751	-0.145000	0.13849	AGC	PTPRH	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000080031		0.632	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1		0.00	83	0	G			55697635	-1			no_errors	ENST00000376350	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.902	T
PTPRT	11122	genome.wustl.edu	37	20	40877452	40877452	+	Silent	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr20:40877452G>T	ENST00000373187.1	-	14	2186	c.2187C>A	c.(2185-2187)acC>acA	p.T729T	PTPRT_ENST00000373198.4_Silent_p.T748T|PTPRT_ENST00000373193.3_Silent_p.T729T|PTPRT_ENST00000373190.1_Silent_p.T729T|PTPRT_ENST00000373184.1_Silent_p.T729T|PTPRT_ENST00000356100.2_Silent_p.T748T|PTPRT_ENST00000373201.1_Silent_p.T729T			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	729					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TAGAATTCTGGGTGGAGGCAC	0.493																																																	0													63.0	66.0	65.0					20																	40877452		2093	4214	6307	SO:0001819	synonymous_variant	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2187C>A	20.37:g.40877452G>T			A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.T748	ENST00000373187.1	37	c.2244	CCDS42874.1	20																																																																																			PTPRT	-	NULL	ENSG00000196090		0.493	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	-	0.00	45	0	G			40877452	-1	tier1	-	no_errors	ENST00000373198	ensembl	human	known	74_37	silent	37.50	25	15	SNP	0.067	T
PURA	5813	genome.wustl.edu	37	5	139494597	139494597	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:139494597G>T	ENST00000331327.3	+	1	890	c.831G>T	c.(829-831)gaG>gaT	p.E277D		NM_005859.4	NP_005850.1	Q00577	PURA_HUMAN	purine-rich element binding protein A	277					DNA replication initiation (GO:0006270)|DNA unwinding involved in DNA replication (GO:0006268)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|DNA replication factor A complex (GO:0005662)|neuronal cell body (GO:0043025)|nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)	double-stranded telomeric DNA binding (GO:0003691)|poly(A) RNA binding (GO:0044822)|purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCGGAGGAGATGAAGAAGA	0.592																																																	0													62.0	60.0	61.0					5																	139494597		2203	4300	6503	SO:0001583	missense	0			BC036087	CCDS4220.1	5q31	2008-02-05			ENSG00000185129	ENSG00000185129			9701	protein-coding gene	gene with protein product		600473				1448097	Standard	NM_005859		Approved	PURALPHA, PUR1, PUR-ALPHA	uc003lfa.3	Q00577	OTTHUMG00000129242	ENST00000331327.3:c.831G>T	5.37:g.139494597G>T	ENSP00000332706:p.Glu277Asp			Missense_Mutation	SNP	pfam_PUR_DNA_RNA-bd,smart_PUR_DNA_RNA-bd	p.E277D	ENST00000331327.3	37	c.831	CCDS4220.1	5	.	.	.	.	.	.	.	.	.	.	G	12.85	2.060416	0.36373	.	.	ENSG00000185129	ENST00000331327	T	0.33438	1.41	5.19	1.38	0.22167	.	0.058796	0.64402	D	0.000003	T	0.48187	0.1486	M	0.73598	2.24	0.50171	D	0.999859	D	0.64830	0.994	D	0.71414	0.973	T	0.33292	-0.9874	10	0.28530	T	0.3	-8.8043	9.6064	0.39637	0.2881:0.0:0.7119:0.0	.	277	Q00577	PURA_HUMAN	D	277	ENSP00000332706:E277D	ENSP00000332706:E277D	E	+	3	2	PURA	139474781	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	1.744000	0.38268	0.067000	0.16545	-0.808000	0.03180	GAG	PURA	-	pfam_PUR_DNA_RNA-bd,smart_PUR_DNA_RNA-bd	ENSG00000185129		0.592	PURA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PURA	HGNC	protein_coding	OTTHUMT00000251341.3	-	0.00	55	0	G	NM_005859		139494597	+1	tier1	-	no_errors	ENST00000331327	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
PWWP2A	114825	genome.wustl.edu	37	5	159520354	159520354	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:159520354C>T	ENST00000307063.7	-	2	1337	c.1303G>A	c.(1303-1305)Gcc>Acc	p.A435T	PWWP2A_ENST00000456329.3_Missense_Mutation_p.A435T|PWWP2A_ENST00000523662.1_Missense_Mutation_p.A435T	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	435										kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTTTCTTTGGCAATTTTTAAC	0.383																																																	0													81.0	72.0	75.0					5																	159520354		1840	4097	5937	SO:0001583	missense	0				CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.1303G>A	5.37:g.159520354C>T	ENSP00000305151:p.Ala435Thr		G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Missense_Mutation	SNP	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	p.A435T	ENST00000307063.7	37	c.1303	CCDS47332.1	5	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099533	0.76983	.	.	ENSG00000170234	ENST00000456329;ENST00000523662;ENST00000307063	T;T;T	0.21031	2.03;2.03;2.03	5.54	5.54	0.83059	.	0.110686	0.64402	D	0.000011	T	0.36441	0.0967	L	0.29908	0.895	0.80722	D	1	P;D;D	0.89917	0.63;1.0;1.0	B;D;D	0.79784	0.123;0.993;0.993	T	0.03175	-1.1064	10	0.37606	T	0.19	-12.6177	19.1388	0.93439	0.0:1.0:0.0:0.0	.	435;435;435	Q96N64;G5EA07;Q96N64-2	PWP2A_HUMAN;.;.	T	435	ENSP00000390462:A435T;ENSP00000428143:A435T;ENSP00000305151:A435T	ENSP00000305151:A435T	A	-	1	0	PWWP2A	159452932	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.351000	0.66022	2.625000	0.88918	0.558000	0.71614	GCC	PWWP2A	-	NULL	ENSG00000170234		0.383	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PWWP2A	HGNC	protein_coding	OTTHUMT00000374092.1	-	0.00	48	0	C			159520354	-1	tier1	-	no_errors	ENST00000307063	ensembl	human	known	74_37	missense	12.77	41	6	SNP	1.000	T
QRICH2	84074	genome.wustl.edu	37	17	74286138	74286138	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:74286138C>T	ENST00000262765.5	-	5	3414	c.3235G>A	c.(3235-3237)Gaa>Aaa	p.E1079K		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1079										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TCCTGCAGTTCAGGAGGTATG	0.458																																																	0													122.0	135.0	130.0					17																	74286138		2203	4300	6503	SO:0001583	missense	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3235G>A	17.37:g.74286138C>T	ENSP00000262765:p.Glu1079Lys		A2RRE1|Q96LM3	Missense_Mutation	SNP	NULL	p.E1079K	ENST00000262765.5	37	c.3235	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	C	12.17	1.857518	0.32791	.	.	ENSG00000129646	ENST00000262765;ENST00000447564;ENST00000301613	T;T	0.47869	3.03;0.83	4.47	4.47	0.54385	.	.	.	.	.	T	0.30479	0.0766	N	0.08118	0	0.25826	N	0.984227	B;B	0.32467	0.372;0.372	B;B	0.32677	0.15;0.114	T	0.26744	-1.0094	9	0.66056	D	0.02	-13.7778	12.8348	0.57767	0.0:1.0:0.0:0.0	.	1079;1079	B5MD94;Q9H0J4	.;QRIC2_HUMAN	K	1079;87;1079	ENSP00000262765:E1079K;ENSP00000394461:E87K	ENSP00000262765:E1079K	E	-	1	0	QRICH2	71797733	0.982000	0.34865	0.941000	0.38009	0.046000	0.14306	3.269000	0.51592	2.478000	0.83669	0.655000	0.94253	GAA	QRICH2	-	NULL	ENSG00000129646		0.458	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1	-	0.00	22	0	C	NM_032134		74286138	-1	tier1	-	no_errors	ENST00000262765	ensembl	human	known	74_37	missense	57.14	6	8	SNP	0.953	T
RAB11FIP3	9727	genome.wustl.edu	37	16	560667	560667	+	Missense_Mutation	SNP	G	G	A	rs146319300		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:560667G>A	ENST00000262305.4	+	9	1895	c.1507G>A	c.(1507-1509)Gcc>Acc	p.A503T	RAB11FIP3_ENST00000457159.1_Missense_Mutation_p.A548T|RAB11FIP3_ENST00000450428.1_Missense_Mutation_p.A207T	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	503	ARF-binding domain (ABD).				cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				AAGAGCAAACGCCCTGGAGGA	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18137	0.0		0.0	False		,,,				2504	0.001				Melanoma(160;2366 2595 4474 8099)												0								G	THR/ALA,THR/ALA	0,4400		0,0,2200	39.0	37.0	38.0		619,1507	5.2	1.0	16	dbSNP_134	38	2,8590	1.2+/-3.3	0,2,4294	no	missense,missense	RAB11FIP3	NM_001142272.1,NM_014700.3	58,58	0,2,6494	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	207/461,503/757	560667	2,12990	2200	4296	6496	SO:0001583	missense	0			AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.1507G>A	16.37:g.560667G>A	ENSP00000262305:p.Ala503Thr		B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfscan_EF_hand_dom	p.A548T	ENST00000262305.4	37	c.1642	CCDS32351.1	16	.	.	.	.	.	.	.	.	.	.	G	10.69	1.422054	0.25639	0.0	2.33E-4	ENSG00000090565	ENST00000262305;ENST00000457159;ENST00000434585;ENST00000450428;ENST00000448401	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	T	0.72415	0.3457	L	0.48362	1.52	0.80722	D	1	D;D;D	0.89917	1.0;0.981;0.998	D;P;P	0.67548	0.952;0.574;0.739	T	0.68610	-0.5363	8	0.30854	T	0.27	-33.0937	17.6777	0.88235	0.0:0.0:1.0:0.0	.	548;207;503	O75154-3;O75154-2;O75154	.;.;RFIP3_HUMAN	T	503;548;424;207;207	.	ENSP00000262305:A503T	A	+	1	0	RAB11FIP3	500668	1.000000	0.71417	0.984000	0.44739	0.306000	0.27790	9.237000	0.95368	2.581000	0.87130	0.655000	0.94253	GCC	RAB11FIP3	-	NULL	ENSG00000090565		0.607	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	RAB11FIP3	HGNC	protein_coding	OTTHUMT00000109066.4		0.00	25	0	G	NM_014700		560667	+1			no_errors	ENST00000457159	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	A
RARB	5915	genome.wustl.edu	37	3	25216047	25216047	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:25216047C>T	ENST00000404969.1	+	1	159	c.159C>T	c.(157-159)tgC>tgT	p.C53C	AC133680.1_ENST00000455576.1_lincRNA			P10826	RARB_HUMAN	retinoic acid receptor, beta	53	Modulating.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CGAGTGGATGCAGCACCCCGT	0.552																																																	0													66.0	59.0	61.0					3																	25216047		876	1991	2867	SO:0001819	synonymous_variant	0			Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.159C>T	3.37:g.25216047C>T			P12891|Q00989|Q15298|Q9UN48	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.C53	ENST00000404969.1	37	c.159		3																																																																																			RARB	-	NULL	ENSG00000077092		0.552	RARB-201	KNOWN	basic	protein_coding	RARB	HGNC	protein_coding		-	0.00	38	0	C	NM_000965, NM_016152		25216047	+1	tier1	-	no_errors	ENST00000404969	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	T
RARG	5916	genome.wustl.edu	37	12	53606933	53606933	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:53606933G>T	ENST00000425354.2	-	9	1600	c.1113C>A	c.(1111-1113)agC>agA	p.S371R	RARG_ENST00000543726.1_Missense_Mutation_p.S349R|RARG_ENST00000338561.5_Missense_Mutation_p.S360R|RARG_ENST00000543762.1_5'UTR|RARG_ENST00000394426.1_Missense_Mutation_p.S371R|RARG_ENST00000327550.3_Missense_Mutation_p.S299R	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	371	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	TGTAGGGCTGGCTGGGCCGCC	0.612											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													58.0	55.0	56.0					12																	53606933		2203	4300	6503	SO:0001583	missense	0			M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.1113C>A	12.37:g.53606933G>T	ENSP00000388510:p.Ser371Arg	993	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.S371R	ENST00000425354.2	37	c.1113	CCDS8850.1	12	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337145	0.81801	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000327550;ENST00000338561;ENST00000543726	T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24	5.42	3.61	0.41365	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.147481	0.64402	D	0.000010	T	0.24160	0.0585	N	0.21583	0.68	0.46798	D	0.999206	P;P;B	0.38473	0.575;0.633;0.135	B;B;B	0.35353	0.156;0.184;0.201	T	0.05767	-1.0865	10	0.72032	D	0.01	.	11.2659	0.49110	0.1513:0.0:0.8487:0.0	.	349;371;360	B7Z4F1;P13631;F1D8P1	.;RARG_HUMAN;.	R	371;371;299;360;349	ENSP00000388510:S371R;ENSP00000377947:S371R;ENSP00000332695:S299R;ENSP00000343698:S360R;ENSP00000444335:S349R	ENSP00000332695:S299R	S	-	3	2	RARG	51893200	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.714000	0.68422	0.791000	0.33826	0.563000	0.77884	AGC	RARG	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000172819		0.612	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARG	HGNC	protein_coding	OTTHUMT00000109404.2	-	0.00	47	0	G	NM_000966		53606933	-1	tier1	-	no_errors	ENST00000394426	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
RBBP6	5930	genome.wustl.edu	37	16	24583538	24583538	+	Silent	SNP	T	T	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:24583538T>C	ENST00000319715.4	+	18	5583	c.5151T>C	c.(5149-5151)agT>agC	p.S1717S	RBBP6_ENST00000381039.3_Silent_p.S877S|RBBP6_ENST00000348022.2_Silent_p.S1683S	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1717					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		ACAGTAGCAGTGCCAgctcag	0.483																																																	0													50.0	50.0	50.0					16																	24583538		2197	4300	6497	SO:0001819	synonymous_variant	0				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.5151T>C	16.37:g.24583538T>C			Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Silent	SNP	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.S1717	ENST00000319715.4	37	c.5151	CCDS10621.1	16																																																																																			RBBP6	-	NULL	ENSG00000122257		0.483	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	HGNC	protein_coding	OTTHUMT00000214067.2		0.00	35	0	T	NM_006910		24583538	+1			no_errors	ENST00000319715	ensembl	human	known	74_37	silent	7.32	38	3	SNP	1.000	C
RBM39	9584	genome.wustl.edu	37	20	34297108	34297108	+	Intron	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr20:34297108C>G	ENST00000253363.6	-	13	1249				RBM39_ENST00000407261.4_Intron|RBM39_ENST00000361162.6_Intron|RBM39_ENST00000528062.3_Intron			Q14498	RBM39_HUMAN	RNA binding motif protein 39						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					AATTCTATTTCAAAGACAAAA	0.299																																																	0													44.0	46.0	46.0					20																	34297108		2203	4299	6502	SO:0001627	intron_variant	0			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1225+37G>C	20.37:g.34297108C>G			A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	RNA	SNP	-	NULL	ENST00000253363.6	37	NULL	CCDS13266.1	20																																																																																			RBM39	-	-	ENSG00000131051		0.299	RBM39-002	KNOWN	basic|CCDS	protein_coding	RBM39	HGNC	protein_coding	OTTHUMT00000078931.2	-	0.00	34	0	C	NM_184237		34297108	-1	tier1	-	no_errors	ENST00000475651	ensembl	human	putative	74_37	rna	8.85	103	10	SNP	0.017	G
RBMS1	5937	genome.wustl.edu	37	2	161349870	161349870	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:161349870C>T	ENST00000348849.3	-	1	435	c.5G>A	c.(4-6)gGc>gAc	p.G2D	RBMS1_ENST00000474820.1_5'UTR|RBMS1_ENST00000392753.3_Missense_Mutation_p.G2D	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	2					DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								CCACACTTTGCCCATGAAGCT	0.622																																																	0													67.0	55.0	59.0					2																	161349870		2203	4300	6503	SO:0001583	missense	0			D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.5G>A	2.37:g.161349870C>T	ENSP00000294904:p.Gly2Asp		Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.G2D	ENST00000348849.3	37	c.5	CCDS2213.1	2	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852190	0.71719	.	.	ENSG00000153250	ENST00000348849;ENST00000392753	T;T	0.27890	1.64;1.73	3.95	3.95	0.45737	.	0.000000	0.51477	D	0.000086	T	0.47948	0.1473	L	0.44542	1.39	0.36726	D	0.881428	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79108	0.959;0.982;0.992	T	0.60424	-0.7266	10	0.87932	D	0	.	16.3265	0.82983	0.0:1.0:0.0:0.0	.	2;2;2	P29558;P29558-2;B4DN88	RBMS1_HUMAN;.;.	D	2	ENSP00000294904:G2D;ENSP00000376508:G2D	ENSP00000294904:G2D	G	-	2	0	RBMS1	161058116	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.926000	0.56491	1.913000	0.55393	0.305000	0.20034	GGC	RBMS1	-	NULL	ENSG00000153250		0.622	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMS1	HGNC	protein_coding	OTTHUMT00000255043.4	-	0.00	108	0	C	NM_016836		161349870	-1	tier1	-	no_errors	ENST00000392753	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
RECQL5	9400	genome.wustl.edu	37	17	73662603	73662603	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:73662603G>A	ENST00000317905.5	-	2	194	c.35C>T	c.(34-36)cCt>cTt	p.P12L	RECQL5_ENST00000423245.2_Missense_Mutation_p.P12L|RECQL5_ENST00000584999.1_Missense_Mutation_p.P12L|SAP30BP_ENST00000355423.3_5'Flank|SAP30BP_ENST00000584667.1_5'Flank|RECQL5_ENST00000340830.5_Missense_Mutation_p.P12L|RECQL5_ENST00000420326.2_Missense_Mutation_p.P12L	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	12					chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TCGCCGCTCAGGGTCAAAAGG	0.498								Other identified genes with known or suspected DNA repair function																																									0													77.0	72.0	74.0					17																	73662603		2203	4300	6503	SO:0001583	missense	0			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.35C>T	17.37:g.73662603G>A	ENSP00000317636:p.Pro12Leu		Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	pfam_RecQ_helicase-like_5,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.P12L	ENST00000317905.5	37	c.35	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	G	13.35	2.211355	0.39102	.	.	ENSG00000108469	ENST00000423245;ENST00000317905;ENST00000420326;ENST00000340830	T;T;T;T	0.60424	0.19;0.5;0.82;0.8	5.54	0.847	0.18961	.	0.588543	0.17993	N	0.155149	T	0.42494	0.1205	L	0.43152	1.355	0.36865	D	0.88859	B;B;B	0.26195	0.144;0.003;0.001	B;B;B	0.19391	0.025;0.002;0.002	T	0.37384	-0.9708	10	0.51188	T	0.08	-1.8219	5.1634	0.15073	0.0888:0.3981:0.3847:0.1284	.	12;12;12	O94762;Q6P4G0;O94762-3	RECQ5_HUMAN;.;.	L	12	ENSP00000394820:P12L;ENSP00000317636:P12L;ENSP00000414933:P12L;ENSP00000341983:P12L	ENSP00000317636:P12L	P	-	2	0	RECQL5	71174198	0.989000	0.36119	0.998000	0.56505	0.896000	0.52359	0.842000	0.27627	0.335000	0.23614	0.655000	0.94253	CCT	RECQL5	-	NULL	ENSG00000108469		0.498	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	RECQL5	HGNC	protein_coding	OTTHUMT00000448207.1	-	0.00	70	0	G	NM_004259		73662603	-1	tier1	-	no_errors	ENST00000317905	ensembl	human	known	74_37	missense	22.58	48	14	SNP	0.995	A
RERE	473	genome.wustl.edu	37	1	8416274	8416274	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:8416274G>T	ENST00000337907.3	-	22	5006	c.4372C>A	c.(4372-4374)Ccc>Acc	p.P1458T	RERE_ENST00000400908.2_Missense_Mutation_p.P1458T|RERE_ENST00000377464.1_Missense_Mutation_p.P1190T|RERE_ENST00000400907.2_Intron|RERE_ENST00000476556.1_Missense_Mutation_p.P904T	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1458	Pro-rich.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GCAGTCAGGGGGTCGACCAGC	0.637																																																	0													38.0	44.0	42.0					1																	8416274		2203	4300	6503	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.4372C>A	1.37:g.8416274G>T	ENSP00000338629:p.Pro1458Thr		O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.P1458T	ENST00000337907.3	37	c.4372	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591320	0.86851	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908;ENST00000505225	T;T;T	0.57273	0.41;0.43;0.41	5.97	5.97	0.96955	.	.	.	.	.	T	0.74520	0.3727	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75560	-0.3275	9	0.87932	D	0	-23.2468	19.4161	0.94700	0.0:0.0:1.0:0.0	.	1458	Q9P2R6	RERE_HUMAN	T	1458;1190;904;1458;114	ENSP00000338629:P1458T;ENSP00000366684:P1190T;ENSP00000383700:P1458T	ENSP00000338629:P1458T	P	-	1	0	RERE	8338861	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	9.798000	0.99111	2.837000	0.97791	0.655000	0.94253	CCC	RERE	-	pfam_Atrophin-like	ENSG00000142599		0.637	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	-	0.00	95	0	G			8416274	-1	tier1	-	no_errors	ENST00000337907	ensembl	human	known	74_37	missense	29.09	39	16	SNP	1.000	T
RPGRIP1	57096	genome.wustl.edu	37	14	21790078	21790078	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:21790078G>T	ENST00000400017.2	+	13	1677	c.1677G>T	c.(1675-1677)gaG>gaT	p.E559D	RPGRIP1_ENST00000556336.1_Missense_Mutation_p.E532D|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.E532D|RPGRIP1_ENST00000307974.4_5'Flank|RPGRIP1_ENST00000382933.4_Missense_Mutation_p.E201D|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.E559D|RPGRIP1_ENST00000553500.1_3'UTR	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	559					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AAAAGCTGGAGAGGTTGACTC	0.403																																																	0													93.0	90.0	91.0					14																	21790078		1898	4111	6009	SO:0001583	missense	0			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.1677G>T	14.37:g.21790078G>T	ENSP00000382895:p.Glu559Asp		Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	pfam_DUF3250,superfamily_C2_dom	p.E559D	ENST00000400017.2	37	c.1677	CCDS45080.1	14	.	.	.	.	.	.	.	.	.	.	G	8.358	0.832440	0.16820	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000554303	T;T;T;T;T;T;T	0.80909	-0.34;-1.03;-1.13;-1.13;-0.76;-1.37;-1.43	4.58	2.73	0.32206	.	0.674259	0.14952	N	0.288840	D	0.83695	0.5310	M	0.66939	2.045	0.80722	D	1	D;B;D;D	0.64830	0.99;0.033;0.99;0.994	P;B;P;P	0.58928	0.848;0.027;0.848;0.709	T	0.80202	-0.1480	10	0.49607	T	0.09	-6.3836	5.9258	0.19112	0.1738:0.1594:0.6668:0.0	.	34;201;175;559	G3V3I7;Q96KN7-4;Q96KN7-5;Q96KN7	.;.;.;RPGR1_HUMAN	D	532;532;559;559;201;34;32	ENSP00000450445:E532D;ENSP00000451219:E532D;ENSP00000382895:E559D;ENSP00000206660:E559D;ENSP00000372391:E201D;ENSP00000451262:E34D;ENSP00000450426:E32D	ENSP00000206660:E559D	E	+	3	2	RPGRIP1	20859918	0.965000	0.33210	0.944000	0.38274	0.375000	0.29983	1.492000	0.35594	0.649000	0.30751	0.305000	0.20034	GAG	RPGRIP1	-	NULL	ENSG00000092200		0.403	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPGRIP1	HGNC	protein_coding	OTTHUMT00000410258.1		0.00	71	0	G	NM_020366		21790078	+1			no_errors	ENST00000206660	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.972	T
RSBN1	54665	genome.wustl.edu	37	1	114340623	114340623	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:114340623C>T	ENST00000261441.5	-	2	802	c.739G>A	c.(739-741)Gat>Aat	p.D247N		NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	247						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAAAATCATCGGCTCTCTGG	0.363																																																	0													91.0	96.0	94.0					1																	114340623		2194	4287	6481	SO:0001583	missense	0			AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.739G>A	1.37:g.114340623C>T	ENSP00000261441:p.Asp247Asn		A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Missense_Mutation	SNP	NULL	p.D247N	ENST00000261441.5	37	c.739	CCDS862.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280147	0.80692	.	.	ENSG00000081019	ENST00000261441	.	.	.	6.17	6.17	0.99709	.	0.050938	0.85682	D	0.000000	T	0.59742	0.2216	L	0.44542	1.39	0.51233	D	0.999912	D	0.65815	0.995	P	0.54312	0.748	T	0.60058	-0.7337	9	0.66056	D	0.02	-14.4881	20.8794	0.99867	0.0:1.0:0.0:0.0	.	247	Q5VWQ0	RSBN1_HUMAN	N	247	.	ENSP00000261441:D247N	D	-	1	0	RSBN1	114142146	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.463000	0.80869	2.941000	0.99782	0.655000	0.94253	GAT	RSBN1	-	NULL	ENSG00000081019		0.363	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSBN1	HGNC	protein_coding	OTTHUMT00000033022.2		0.00	32	0	C	NM_018364		114340623	-1			no_errors	ENST00000261441	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
RTL1	388015	genome.wustl.edu	37	14	101348367	101348367	+	Missense_Mutation	SNP	G	G	T	rs187380673		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr14:101348367G>T	ENST00000534062.1	-	1	2817	c.2759C>A	c.(2758-2760)gCg>gAg	p.A920E	MIR127_ENST00000384876.1_RNA|MIR136_ENST00000385207.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	920					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CTTCATCTCCGCTTGAGAGTA	0.547																																																	0													29.0	28.0	28.0					14																	101348367		692	1591	2283	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2759C>A	14.37:g.101348367G>T	ENSP00000435342:p.Ala920Glu		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.A920E	ENST00000534062.1	37	c.2759	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	g	0.460	-0.889425	0.02511	.	.	ENSG00000254656	ENST00000534062	T	0.42513	0.97	3.39	-0.485	0.12067	.	1.813340	0.03746	N	0.255713	T	0.24624	0.0597	N	0.19112	0.55	0.09310	N	1	B	0.21520	0.057	B	0.15484	0.013	T	0.15009	-1.0452	10	0.42905	T	0.14	.	0.3657	0.00371	0.3871:0.1903:0.2372:0.1854	.	920	E9PKS8	.	E	920	ENSP00000435342:A920E	ENSP00000435342:A920E	A	-	2	0	RTL1	100418120	0.056000	0.20664	0.041000	0.18516	0.055000	0.15305	0.691000	0.25467	-0.090000	0.12462	-0.417000	0.06048	GCG	RTL1	-	NULL	ENSG00000254656		0.547	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1		0.00	58	0	G	NM_001134888		101348367	-1			no_errors	ENST00000534062	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.042	T
RYR1	6261	genome.wustl.edu	37	19	38954120	38954120	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:38954120G>T	ENST00000359596.3	+	21	2635	c.2635G>T	c.(2635-2637)Gag>Tag	p.E879*	RYR1_ENST00000355481.4_Nonsense_Mutation_p.E879*|RYR1_ENST00000360985.3_Nonsense_Mutation_p.E879*			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	879	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAACATCCACGAGCTCTGGGC	0.657																																																	0													35.0	35.0	35.0					19																	38954120		2203	4300	6503	SO:0001587	stop_gained	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2635G>T	19.37:g.38954120G>T	ENSP00000352608:p.Glu879*		Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E879*	ENST00000359596.3	37	c.2635	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	g	42	9.164480	0.99087	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	4.0	4.0	0.46444	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.9968	0.80256	0.0:0.0:1.0:0.0	.	.	.	.	X	879	.	ENSP00000347667:E879X	E	+	1	0	RYR1	43645960	1.000000	0.71417	0.996000	0.52242	0.587000	0.36485	9.615000	0.98356	2.093000	0.63338	0.444000	0.29173	GAG	RYR1	-	pfam_Ryanodine_rcpt,prints_Ryan_recept	ENSG00000196218		0.657	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	-	0.00	67	0	G			38954120	+1	tier1	-	no_errors	ENST00000359596	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
SASS6	163786	genome.wustl.edu	37	1	100575976	100575976	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:100575976G>T	ENST00000287482.5	-	8	873	c.733C>A	c.(733-735)Caa>Aaa	p.Q245K	SASS6_ENST00000535161.1_Missense_Mutation_p.Q78K|SASS6_ENST00000462159.1_5'UTR	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	245					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		TGGATGTTTTGTTGATGGAGG	0.348																																																	0													158.0	150.0	153.0					1																	100575976		2203	4299	6502	SO:0001583	missense	0			AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.733C>A	1.37:g.100575976G>T	ENSP00000287482:p.Gln245Lys		D3DT55|Q8N3K0	Missense_Mutation	SNP	NULL	p.Q245K	ENST00000287482.5	37	c.733	CCDS764.1	1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416612	0.25552	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.79454	-1.27;-1.27	5.31	3.22	0.36961	.	0.151861	0.56097	D	0.000028	T	0.36826	0.0981	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.25813	-1.0121	10	0.27082	T	0.32	-2.5554	12.6359	0.56683	0.0:0.0:0.5781:0.4219	.	245	Q6UVJ0	SAS6_HUMAN	K	245;218;78	ENSP00000287482:Q245K;ENSP00000440169:Q78K	ENSP00000287482:Q245K	Q	-	1	0	SASS6	100348564	0.115000	0.22152	0.095000	0.20976	0.818000	0.46254	2.292000	0.43549	1.193000	0.43086	0.655000	0.94253	CAA	SASS6	-	NULL	ENSG00000156876		0.348	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASS6	HGNC	protein_coding	OTTHUMT00000029656.2	-	0.00	41	0	G	NM_194292		100575976	-1	tier1	-	no_errors	ENST00000287482	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.239	T
SCARF2	91179	genome.wustl.edu	37	22	20781731	20781731	+	Silent	SNP	C	C	T	rs542257135		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr22:20781731C>T	ENST00000266214.5	-	10	1766	c.1662G>A	c.(1660-1662)tcG>tcA	p.S554S	SCARF2_ENST00000405555.3_Silent_p.S549S	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	554					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TGGTGTCAAACGAGGAGAAGG	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21477	0.0		0.0	False		,,,				2504	0.0																0													106.0	93.0	97.0					22																	20781731		2203	4300	6503	SO:0001819	synonymous_variant	0			AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.1662G>A	22.37:g.20781731C>T			E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt_N_dom,smart_EGF_laminin,smart_EG-like_dom,pfscan_EG-like_dom	p.S549	ENST00000266214.5	37	c.1647	CCDS13779.1	22																																																																																			SCARF2	-	NULL	ENSG00000244486		0.577	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SCARF2	HGNC	protein_coding	OTTHUMT00000320047.1	-	0.00	48	0	C			20781731	-1	tier1	-	no_errors	ENST00000405555	ensembl	human	known	74_37	silent	17.65	28	6	SNP	1.000	T
SCN7A	6332	genome.wustl.edu	37	2	167322481	167322481	+	Silent	SNP	T	T	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:167322481T>G	ENST00000409855.1	-	7	807	c.681A>C	c.(679-681)gtA>gtC	p.V227V		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	227					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TCAGGACCCCTACAAGGGATT	0.403																																																	0													36.0	33.0	34.0					2																	167322481		1814	4078	5892	SO:0001819	synonymous_variant	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.681A>C	2.37:g.167322481T>G				Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.V227	ENST00000409855.1	37	c.681	CCDS46442.1	2																																																																																			SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.403	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	-	0.00	25	0	T			167322481	-1	tier1	-	no_errors	ENST00000409855	ensembl	human	known	74_37	silent	23.33	23	7	SNP	0.492	G
SESN2	83667	genome.wustl.edu	37	1	28601526	28601526	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:28601526G>T	ENST00000253063.3	+	8	1532	c.1211G>T	c.(1210-1212)aGa>aTa	p.R404I		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	404					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		TTTGGCATCAGGTGAGCTCAT	0.468																																																	0													96.0	69.0	78.0					1																	28601526		2203	4300	6503	SO:0001630	splice_region_variant	0			AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.1211+1G>T	1.37:g.28601526G>T			Q5T7D0|Q96SI5	Missense_Mutation	SNP	pfam_PA26	p.R404I	ENST00000253063.3	37	c.1211	CCDS321.1	1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796848	0.90453	.	.	ENSG00000130766	ENST00000253063	T	0.30182	1.54	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.54515	0.1863	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	T	0.53129	-0.8482	10	0.46703	T	0.11	-11.9933	17.1465	0.86767	0.0:0.0:1.0:0.0	.	404	P58004	SESN2_HUMAN	I	404	ENSP00000253063:R404I	ENSP00000253063:R404I	R	+	2	0	SESN2	28474113	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	9.171000	0.94802	2.575000	0.86900	0.655000	0.94253	AGA	SESN2	-	pfam_PA26	ENSG00000130766		0.468	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESN2	HGNC	protein_coding	OTTHUMT00000009840.1	-	0.00	33	0	G		Missense_Mutation	28601526	+1	tier1	-	no_errors	ENST00000253063	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
SFTPB	6439	genome.wustl.edu	37	2	85895264	85895266	+	In_Frame_Del	DEL	GCA	GCA	-	rs147057701		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:85895264_85895266delGCA	ENST00000519937.2	-	1	60_62	c.41_43delTGC	c.(40-45)ctgccc>ccc	p.L14del	SFTPB_ENST00000393822.3_In_Frame_Del_p.L26del|SFTPB_ENST00000409383.1_In_Frame_Del_p.L26del|SFTPB_ENST00000342375.3_In_Frame_Del_p.L14del			P07988	PSPB_HUMAN	surfactant protein B	14					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						CAGAGCGTGGGCAGCAGCAGCAG	0.64																																																	0									,	56,3532		3,50,1741					,	3.5	0.8		dbSNP_134	24	135,6753		12,111,3321	no	coding,coding	SFTPB	NM_198843.2,NM_000542.3	,	15,161,5062	A1A1,A1R,RR		1.9599,1.5608,1.8232	,	,		191,10285				SO:0001651	inframe_deletion	0			J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.41_43delTGC	2.37:g.85895273_85895275delGCA	ENSP00000428719:p.Leu14del		Q96R04	In_Frame_Del	DEL	pfam_SapB_2,pfam_SapA,pfam_SapB_1,superfamily_Saposin-like,smart_SapA,smart_SaposinB,pfscan_SapA,pfscan_SaposinB,prints_Saposin	p.L26in_frame_del	ENST00000519937.2	37	c.79_77		2																																																																																			SFTPB	-	NULL	ENSG00000168878		0.640	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	SFTPB	HGNC	protein_coding	OTTHUMT00000252499.3		0.00	32	0	GCA	NM_198843		85895266	-1	tier1		no_errors	ENST00000393822	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	0.966:0.981:0.990	-
SKAP2	8935	genome.wustl.edu	37	7	26779515	26779515	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:26779515G>A	ENST00000345317.2	-	5	689	c.376C>T	c.(376-378)Cgc>Tgc	p.R126C	SKAP2_ENST00000489977.1_5'UTR|SKAP2_ENST00000539623.1_De_novo_Start_OutOfFrame	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	126	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.R126C(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						CCTTTTCTGCGTTTTTCAAGG	0.373																																																	1	Substitution - Missense(1)	skin(1)											74.0	70.0	71.0					7																	26779515		2203	4300	6503	SO:0001583	missense	0				CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.376C>T	7.37:g.26779515G>A	ENSP00000005587:p.Arg126Cys		A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,prints_SH3_domain	p.R126C	ENST00000345317.2	37	c.376	CCDS5400.1	7	.	.	.	.	.	.	.	.	.	.	G	20.8	4.058233	0.76074	.	.	ENSG00000005020	ENST00000345317;ENST00000535331;ENST00000432747	T;T	0.14391	2.51;2.51	5.81	5.81	0.92471	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.38878	0.1057	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.06391	-1.0829	10	0.87932	D	0	-25.7679	17.008	0.86398	0.0:0.0:1.0:0.0	.	111;126	B7Z5N4;O75563	.;SKAP2_HUMAN	C	126;111;111	ENSP00000005587:R126C;ENSP00000408163:R111C	ENSP00000005587:R126C	R	-	1	0	SKAP2	26746040	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.504000	0.66968	2.746000	0.94184	0.591000	0.81541	CGC	SKAP2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000005020		0.373	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKAP2	HGNC	protein_coding	OTTHUMT00000214128.1	-	0.00	72	0	G			26779515	-1	tier1	-	no_errors	ENST00000345317	ensembl	human	known	74_37	missense	9.52	95	10	SNP	1.000	A
SLC16A3	9123	genome.wustl.edu	37	17	80196594	80196594	+	Silent	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:80196594G>T	ENST00000581287.1	+	4	3462	c.1140G>T	c.(1138-1140)gcG>gcT	p.A380A	SLC16A3_ENST00000582743.1_Silent_p.A380A|SLC16A3_ENST00000392339.1_Silent_p.A380A|SLC16A3_ENST00000392341.1_Silent_p.A380A	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	380					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	TCCTGGATGCGACCCACGTCT	0.627																																					Pancreas(52;652 1135 19190 37282 52456)												0													38.0	29.0	32.0					17																	80196594		2196	4297	6493	SO:0001819	synonymous_variant	0			U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.1140G>T	17.37:g.80196594G>T			B3KXG8|Q2M1P8	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.A380	ENST00000581287.1	37	c.1140	CCDS11804.1	17																																																																																			SLC16A3	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000141526		0.627	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A3	HGNC	protein_coding	OTTHUMT00000443498.1		0.00	27	0	G	NM_004207		80196594	+1			no_errors	ENST00000392339	ensembl	human	known	74_37	silent	14.29	18	3	SNP	0.866	T
SLC9B1	150159	genome.wustl.edu	37	4	103832695	103832695	+	Splice_Site	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr4:103832695C>T	ENST00000296422.7	-	8	971		c.e8-1		SLC9B1_ENST00000394789.3_Splice_Site|SLC9B1_ENST00000512651.2_Intron	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										AGTATACCACCTGTAGGGGCA	0.358																																																	0													33.0	33.0	33.0					4																	103832695		2030	3868	5898	SO:0001630	splice_region_variant	0			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.830-1G>A	4.37:g.103832695C>T			A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Splice_Site	SNP	-	e7-1	ENST00000296422.7	37	c.830-1	CCDS34041.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.46|12.46	1.944972|1.944972	0.34283|0.34283	.|.	.|.	ENSG00000164037|ENSG00000164037	ENST00000394789;ENST00000296422;ENST00000514340|ENST00000511253	.|T	.|0.57907	.|0.37	4.36|4.36	4.36|4.36	0.52297|0.52297	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64046	.|0.2563	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63431	.|-0.6639	.|5	.|.	.|.	.|.	.|.	16.1779|16.1779	0.81874|0.81874	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|S	-1|2	.|ENSP00000425544:G2S	.|.	.|G	-|-	.|1	.|0	SLC9B1|SLC9B1	104052144|104052144	1.000000|1.000000	0.71417|0.71417	0.730000|0.730000	0.30809|0.30809	0.133000|0.133000	0.20885|0.20885	3.602000|3.602000	0.54066|0.54066	2.403000|2.403000	0.81681|0.81681	0.585000|0.585000	0.79938|0.79938	.|GGT	SLC9B1	-	-	ENSG00000164037		0.358	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9B1	HGNC	protein_coding	OTTHUMT00000363841.1	-	0.00	54	0	C	NM_139173	Intron	103832695	-1	tier1	-	no_errors	ENST00000296422	ensembl	human	known	74_37	splice_site	11.76	75	10	SNP	0.993	T
SMC3	9126	genome.wustl.edu	37	10	112341689	112341689	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr10:112341689C>T	ENST00000361804.4	+	9	682	c.556C>T	c.(556-558)Cgg>Tgg	p.R186W	SMC3_ENST00000462899.1_3'UTR	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	186					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AGAGGGCAAACGGGAAAAAAT	0.299																																																	0													58.0	65.0	63.0					10																	112341689		2203	4300	6503	SO:0001583	missense	0			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.556C>T	10.37:g.112341689C>T	ENSP00000354720:p.Arg186Trp		A8K156|O60464|Q5T482	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.R186W	ENST00000361804.4	37	c.556	CCDS31285.1	10	.	.	.	.	.	.	.	.	.	.	C	20.8	4.058394	0.76074	.	.	ENSG00000108055	ENST00000361804	T	0.76448	-1.02	5.51	4.6	0.57074	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.87442	0.6178	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.88227	0.2901	10	0.52906	T	0.07	.	14.8326	0.70159	0.2605:0.7395:0.0:0.0	.	186	Q9UQE7	SMC3_HUMAN	W	186	ENSP00000354720:R186W	ENSP00000354720:R186W	R	+	1	2	SMC3	112331679	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.682000	0.37628	1.298000	0.44778	0.591000	0.81541	CGG	SMC3	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000108055		0.299	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SMC3	HGNC	protein_coding	OTTHUMT00000050337.1	-	0.00	39	0	C	NM_005445		112341689	+1	tier1	-	no_errors	ENST00000361804	ensembl	human	known	74_37	missense	13.48	77	12	SNP	1.000	T
SNHG14	104472715	genome.wustl.edu	37	15	25304759	25304759	+	RNA	SNP	G	G	A	rs373230703		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr15:25304759G>A	ENST00000549804.2	+	0	152				SNHG14_ENST00000384733.1_RNA|SNORD116-3_ENST00000384287.1_RNA|SNORD116-5_ENST00000384462.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		TCATACCGTCGTTCTCAGCGG	0.502																																																	0								G		0,1752		0,0,876	183.0	167.0	172.0			-6.1	0.0	15		172	1,3981		0,1,1990	no	intergenic				0,1,2866	AA,AG,GG		0.0251,0.0,0.0174			25304759	1,5733	876	1991	2867			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25304759G>A				RNA	SNP	-	NULL	ENST00000549804.2	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.502	SNHG14-012	KNOWN	non_canonical_other|basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000408278.2	-	0.00	166	0	G			25304759	+1	tier1	-	no_errors	ENST00000384733	ensembl	human	known	74_37	rna	5.69	116	7	SNP	0.000	A
SNX27	81609	genome.wustl.edu	37	1	151611494	151611494	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:151611494G>T	ENST00000458013.2	+	2	562	c.442G>T	c.(442-444)Gac>Tac	p.D148Y	SNX27_ENST00000368838.1_Missense_Mutation_p.D55Y|SNX27_ENST00000368843.3_Missense_Mutation_p.D148Y			Q96L92	SNX27_HUMAN	sorting nexin family member 27	148					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCCCAGTGACGACTCGTTGGG	0.468																																					Colon(46;291 966 40145 41237 41888)												0													132.0	117.0	122.0					1																	151611494		2203	4300	6503	SO:0001583	missense	0			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.442G>T	1.37:g.151611494G>T	ENSP00000400333:p.Asp148Tyr		Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	pfam_Phox,pfam_PDZ,pfam_Ras-assoc,superfamily_Phox,superfamily_PDZ,smart_PDZ,smart_Phox,pfscan_PDZ,pfscan_Phox,pfscan_Ras-assoc	p.D148Y	ENST00000458013.2	37	c.442		1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401066	0.83120	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.54675	0.56;0.57;0.62	4.49	4.49	0.54785	Phox homologous domain (1);PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.62514	0.2434	M	0.67397	2.05	0.80722	D	1	D;D	0.65815	0.966;0.995	P;D	0.63793	0.906;0.918	T	0.67841	-0.5566	10	0.87932	D	0	.	15.8961	0.79336	0.0:0.0:1.0:0.0	.	148;148	Q96L92;Q96L92-3	SNX27_HUMAN;.	Y	148;148;55	ENSP00000400333:D148Y;ENSP00000357836:D148Y;ENSP00000357831:D55Y	ENSP00000357831:D55Y	D	+	1	0	SNX27	149878118	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.235000	0.95353	2.331000	0.79229	0.591000	0.81541	GAC	SNX27	-	superfamily_Phox,superfamily_PDZ	ENSG00000143376		0.468	SNX27-003	NOVEL	basic	protein_coding	SNX27	HGNC	protein_coding	OTTHUMT00000036624.3		0.00	45	0	G	NM_030918		151611494	+1			no_errors	ENST00000368843	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
SOX10	6663	genome.wustl.edu	37	22	38379656	38379656	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr22:38379656G>C	ENST00000396884.2	-	2	418	c.136C>G	c.(136-138)Ccg>Gcg	p.P46A	POLR2F_ENST00000407936.1_Intron|SOX10_ENST00000470555.1_Intron|POLR2F_ENST00000405557.1_Intron|SOX10_ENST00000360880.2_Missense_Mutation_p.P46A	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	46					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					CCTGGCCCCGGGCTGGCTCGC	0.751																																					Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)												0													29.0	19.0	23.0					22																	38379656		2192	4295	6487	SO:0001583	missense	0				CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.136C>G	22.37:g.38379656G>C	ENSP00000380093:p.Pro46Ala		B4DV62|Q6FHW7	Missense_Mutation	SNP	pfam_Sox_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.P46A	ENST00000396884.2	37	c.136	CCDS13964.1	22	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564613	0.27915	.	.	ENSG00000100146	ENST00000396884;ENST00000360880;ENST00000416937;ENST00000427770	T;T;T	0.77098	-1.07;-1.07;-1.07	4.35	4.35	0.52113	.	0.417751	0.21308	N	0.076689	T	0.67859	0.2938	L	0.46157	1.445	0.40033	D	0.975556	B	0.23650	0.089	B	0.22753	0.041	T	0.63409	-0.6644	9	.	.	.	.	8.4313	0.32759	0.1454:0.0:0.8546:0.0	.	46	P56693	SOX10_HUMAN	A	46	ENSP00000380093:P46A;ENSP00000354130:P46A;ENSP00000414853:P46A	.	P	-	1	0	SOX10	36709602	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.964000	0.49192	2.260000	0.74910	0.456000	0.33151	CCG	SOX10	-	pfam_Sox_N	ENSG00000100146		0.751	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SOX10	HGNC	protein_coding	OTTHUMT00000313875.1	-	0.00	24	0	G	NM_006941		38379656	-1	tier1	-	no_errors	ENST00000360880	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	C
RP11-383M4.6	0	genome.wustl.edu	37	9	84564123	84564123	+	lincRNA	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr9:84564123G>T	ENST00000585776.1	-	0	942				SPATA31D3_ENST00000334208.4_RNA																							AGACCTAATGGAGGAGAGCTT	0.512																																																	0																																												0																															9.37:g.84564123G>T				RNA	SNP	-	NULL	ENST00000585776.1	37	NULL		9																																																																																			SPATA31D3	-	-	ENSG00000186788		0.512	RP11-383M4.6-001	KNOWN	basic	lincRNA	SPATA31D3	HGNC	lincRNA	OTTHUMT00000453562.1	-	0.00	77	0	G			84564123	+1	tier1	-	no_errors	ENST00000334208	ensembl	human	known	74_37	rna	7.41	50	4	SNP	0.004	T
SRSF3	6428	genome.wustl.edu	37	6	36569506	36569506	+	Silent	SNP	A	A	G	rs139583002	byFrequency	TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:36569506A>G	ENST00000373715.6	+	5	518	c.402A>G	c.(400-402)agA>agG	p.R134R		NM_003017.4	NP_003008.1	P84103	SRSF3_HUMAN	serine/arginine-rich splicing factor 3	134	2 X approximate repeats, basic.|Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(2)	7						GAGATAGGAGAAGAGAGAGAT	0.388																																																	0								A		1,4405	2.1+/-5.4	0,1,2202	154.0	166.0	162.0		402	1.8	1.0	6	dbSNP_134	162	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	SRSF3	NM_003017.4		0,4,6499	GG,GA,AA		0.0349,0.0227,0.0308		134/165	36569506	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	0			L10838	CCDS4823.1	6p21	2013-02-12	2010-06-22	2010-06-22	ENSG00000112081	ENSG00000112081		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10785	protein-coding gene	gene with protein product		603364	"""splicing factor, arginine/serine-rich 3"""	SFRS3		1577277, 20516191	Standard	NM_003017		Approved	SRp20	uc003omj.3	P84103	OTTHUMG00000014599	ENST00000373715.6:c.402A>G	6.37:g.36569506A>G			B4E241|O08831|P23152|Q5R3K0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R134	ENST00000373715.6	37	c.402	CCDS4823.1	6																																																																																			SRSF3	-	NULL	ENSG00000112081		0.388	SRSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF3	HGNC	protein_coding	OTTHUMT00000040347.2		0.00	21	0	A	NM_003017		36569506	+1			no_errors	ENST00000373715	ensembl	human	known	74_37	silent	10.34	26	3	SNP	0.998	G
STARD13	90627	genome.wustl.edu	37	13	33685025	33685025	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr13:33685025G>C	ENST00000336934.5	-	11	2743	c.2627C>G	c.(2626-2628)gCc>gGc	p.A876G	STARD13_ENST00000399365.3_Missense_Mutation_p.A758G|STARD13_ENST00000255486.4_Missense_Mutation_p.A868G	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	876					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		ACGAGACTGGGCCACCAACTC	0.532																																																	0													109.0	76.0	87.0					13																	33685025		2203	4300	6503	SO:0001583	missense	0			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2627C>G	13.37:g.33685025G>C	ENSP00000338785:p.Ala876Gly		A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.A876G	ENST00000336934.5	37	c.2627	CCDS9348.1	13	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566260	0.45694	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934	T;T;T	0.06142	3.35;3.34;3.35	5.93	5.93	0.95920	.	0.250756	0.47093	D	0.000245	T	0.10208	0.0250	L	0.46741	1.465	0.80722	D	1	B;B;B	0.25206	0.12;0.002;0.001	B;B;B	0.28916	0.096;0.004;0.009	T	0.20571	-1.0271	10	0.28530	T	0.3	.	20.3311	0.98718	0.0:0.0:1.0:0.0	.	841;876;868	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	G	758;868;876	ENSP00000382300:A758G;ENSP00000255486:A868G;ENSP00000338785:A876G	ENSP00000255486:A868G	A	-	2	0	STARD13	32583025	0.930000	0.31532	1.000000	0.80357	0.779000	0.44077	4.381000	0.59587	2.797000	0.96272	0.655000	0.94253	GCC	STARD13	-	NULL	ENSG00000133121		0.532	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	HGNC	protein_coding	OTTHUMT00000276118.2	-	0.00	70	0	G	NM_001243466		33685025	-1	tier1	-	no_errors	ENST00000336934	ensembl	human	known	74_37	missense	11.86	51	7	SNP	0.999	C
STAT5A	6776	genome.wustl.edu	37	17	40458274	40458274	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr17:40458274G>T	ENST00000345506.4	+	14	2131	c.1489G>T	c.(1489-1491)Gcc>Tcc	p.A497S	STAT5A_ENST00000590949.1_Missense_Mutation_p.A497S|STAT5A_ENST00000588868.1_Missense_Mutation_p.A466S|STAT5A_ENST00000452307.2_Missense_Mutation_p.A497S|STAT5A_ENST00000546010.2_Missense_Mutation_p.A467S|STAT5A_ENST00000587646.1_5'UTR	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	497					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		GGTGCCATTTGCCGTGCCTGA	0.537																																																	0													93.0	82.0	86.0					17																	40458274		2203	4300	6503	SO:0001583	missense	0			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1489G>T	17.37:g.40458274G>T	ENSP00000341208:p.Ala497Ser		Q1KLZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.A497S	ENST00000345506.4	37	c.1489	CCDS11424.1	17	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944232	0.34283	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	D;D;D	0.87809	-2.3;-2.3;-2.3	4.65	4.65	0.58169	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);EF-hand-like domain (1);	0.271822	0.37761	N	0.001960	T	0.79167	0.4400	N	0.16266	0.395	0.35940	D	0.833138	B;B;B	0.14438	0.0;0.01;0.0	B;B;B	0.23150	0.012;0.044;0.008	T	0.76443	-0.2957	10	0.21014	T	0.42	-29.7269	17.8824	0.88844	0.0:0.0:1.0:0.0	.	467;468;497	Q1KLZ6;Q59GY7;P42229	.;.;STA5A_HUMAN	S	497;467;468;497	ENSP00000341208:A497S;ENSP00000443107:A467S;ENSP00000400320:A497S	ENSP00000341208:A497S	A	+	1	0	STAT5A	37711800	0.925000	0.31364	0.998000	0.56505	0.991000	0.79684	2.027000	0.41078	2.293000	0.77203	0.561000	0.74099	GCC	STAT5A	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000126561		0.537	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5A	HGNC	protein_coding	OTTHUMT00000319804.1	-	0.00	49	0	G	NM_003152		40458274	+1	tier1	-	no_errors	ENST00000345506	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.997	T
STRADB	55437	genome.wustl.edu	37	2	202344861	202344861	+	Missense_Mutation	SNP	A	A	G	rs139900078		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:202344861A>G	ENST00000194530.3	+	12	1585	c.1220A>G	c.(1219-1221)gAt>gGt	p.D407G	STRADB_ENST00000392249.2_3'UTR	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	407					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.D407G(1)		breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						CCAGAATGTGATTTTCCTGAT	0.403																																																	1	Substitution - Missense(1)	skin(1)											140.0	138.0	139.0					2																	202344861		2203	4300	6503	SO:0001583	missense	0			AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.1220A>G	2.37:g.202344861A>G	ENSP00000194530:p.Asp407Gly		Q5BKY7|Q9P1L0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D407G	ENST00000194530.3	37	c.1220	CCDS2348.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.737|4.737	0.137134|0.137134	0.09032|0.09032	.|.	.|.	ENSG00000082146|ENSG00000082146	ENST00000194530;ENST00000539670;ENST00000392866|ENST00000415688	T|.	0.61510|.	0.1|.	5.55|5.55	-1.4|-1.4	0.08968|0.08968	.|.	1.281530|.	0.04747|.	N|.	0.423931|.	T|.	0.17959|.	0.0431|.	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.24512|.	-1.0158|.	10|.	0.21014|.	T|.	0.42|.	.|.	1.8647|1.8647	0.03195|0.03195	0.3817:0.2818:0.075:0.2616|0.3817:0.2818:0.075:0.2616	.|.	407|.	Q9C0K7|.	STRAB_HUMAN|.	G|W	407;407;269|77	ENSP00000194530:D407G|.	ENSP00000194530:D407G|.	D|X	+|+	2|3	0|0	STRADB|STRADB	202053106|202053106	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.245000|0.245000	0.25701|0.25701	-0.132000|-0.132000	0.10467|0.10467	0.023000|0.023000	0.15187|0.15187	0.533000|0.533000	0.62120|0.62120	GAT|TGA	STRADB	-	NULL	ENSG00000082146		0.403	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRADB	HGNC	protein_coding	OTTHUMT00000256297.1	-	0.00	59	0	A	NM_018571		202344861	+1	tier1	rs139900078	no_errors	ENST00000194530	ensembl	human	known	74_37	missense	7.59	73	6	SNP	0.000	G
STRADB	55437	genome.wustl.edu	37	2	202344886	202344886	+	Silent	SNP	C	C	T	rs146098224		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:202344886C>T	ENST00000194530.3	+	12	1610	c.1245C>T	c.(1243-1245)taC>taT	p.Y415Y	STRADB_ENST00000392249.2_3'UTR	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	415					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						AAGACTCATACTGGGAATTCT	0.393																																																	0													134.0	136.0	135.0					2																	202344886		2203	4300	6503	SO:0001819	synonymous_variant	0			AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.1245C>T	2.37:g.202344886C>T			Q5BKY7|Q9P1L0	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Y415	ENST00000194530.3	37	c.1245	CCDS2348.1	2																																																																																			STRADB	-	NULL	ENSG00000082146		0.393	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRADB	HGNC	protein_coding	OTTHUMT00000256297.1	-	0.00	60	0	C	NM_018571		202344886	+1	tier1	rs146098224	no_errors	ENST00000194530	ensembl	human	known	74_37	silent	12.05	73	10	SNP	0.437	T
STT3B	201595	genome.wustl.edu	37	3	31667586	31667586	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:31667586G>T	ENST00000295770.2	+	13	2249	c.2040G>T	c.(2038-2040)agG>agT	p.R680S		NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	680					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						GGATGGTTAGGATAGCTGAAG	0.378																																																	0													146.0	138.0	141.0					3																	31667586		2203	4300	6503	SO:0001583	missense	0			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.2040G>T	3.37:g.31667586G>T	ENSP00000295770:p.Arg680Ser		Q96JZ4|Q96KY7	Missense_Mutation	SNP	pfam_Oligo_trans_STT3	p.R680S	ENST00000295770.2	37	c.2040	CCDS2650.1	3	.	.	.	.	.	.	.	.	.	.	G	17.89	3.498969	0.64298	.	.	ENSG00000163527	ENST00000295770	D	0.93247	-3.19	5.36	1.64	0.23874	.	0.000000	0.85682	D	0.000000	D	0.97142	0.9066	H	0.96398	3.815	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.95849	0.8873	10	0.59425	D	0.04	-15.0218	8.9451	0.35753	0.4116:0.0:0.5884:0.0	.	680	Q8TCJ2	STT3B_HUMAN	S	680	ENSP00000295770:R680S	ENSP00000295770:R680S	R	+	3	2	STT3B	31642590	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	0.800000	0.27042	0.566000	0.29273	0.313000	0.20887	AGG	STT3B	-	pfam_Oligo_trans_STT3	ENSG00000163527		0.378	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	HGNC	protein_coding	OTTHUMT00000253166.2	-	0.00	34	0	G	NM_178862		31667586	+1	tier1	-	no_errors	ENST00000295770	ensembl	human	known	74_37	missense	13.85	56	9	SNP	0.999	T
SYNE1	23345	genome.wustl.edu	37	6	152655226	152655226	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:152655226C>T	ENST00000367255.5	-	77	13312	c.12711G>A	c.(12709-12711)caG>caA	p.Q4237Q	SYNE1_ENST00000341594.5_Silent_p.Q4102Q|SYNE1_ENST00000423061.1_Silent_p.Q4166Q|SYNE1_ENST00000265368.4_Silent_p.Q4237Q|SYNE1_ENST00000448038.1_Silent_p.Q4166Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4237					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCTTGTTCTCTGAAGATCCT	0.398										HNSCC(10;0.0054)																																							0													214.0	197.0	203.0					6																	152655226		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12711G>A	6.37:g.152655226C>T			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q4237	ENST00000367255.5	37	c.12711	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.398	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	52	0	C	NM_182961		152655226	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	silent	8.62	53	5	SNP	1.000	T
SYT4	6860	genome.wustl.edu	37	18	40854171	40854171	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr18:40854171C>T	ENST00000255224.3	-	2	591	c.223G>A	c.(223-225)Gca>Aca	p.A75T	SYT4_ENST00000590752.1_Missense_Mutation_p.A57T|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	75					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						TTATCATCTGCTCCAAACTTC	0.368																																					NSCLC(85;81 1419 2855 22820 35912)												0													109.0	105.0	106.0					18																	40854171		2203	4300	6503	SO:0001583	missense	0			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.223G>A	18.37:g.40854171C>T	ENSP00000255224:p.Ala75Thr		B4DEU3|Q9P2K4	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	p.A75T	ENST00000255224.3	37	c.223	CCDS11922.1	18	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605401	0.46423	.	.	ENSG00000132872	ENST00000255224	T	0.37584	1.19	5.86	5.86	0.93980	.	0.259107	0.43579	D	0.000541	T	0.35970	0.0950	L	0.51422	1.61	0.36081	D	0.842768	B;B	0.24963	0.115;0.115	B;B	0.23275	0.045;0.045	T	0.31668	-0.9935	10	0.15066	T	0.55	.	20.5632	0.99335	0.0:1.0:0.0:0.0	.	57;75	B4DEU3;Q9H2B2	.;SYT4_HUMAN	T	75	ENSP00000255224:A75T	ENSP00000255224:A75T	A	-	1	0	SYT4	39108169	1.000000	0.71417	0.990000	0.47175	0.805000	0.45488	5.510000	0.67018	2.937000	0.99478	0.650000	0.86243	GCA	SYT4	-	NULL	ENSG00000132872		0.368	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	HGNC	protein_coding	OTTHUMT00000255851.2	-	0.00	42	0	C	NM_020783		40854171	-1	tier1	-	no_errors	ENST00000255224	ensembl	human	known	74_37	missense	22.45	38	11	SNP	1.000	T
TAF3	83860	genome.wustl.edu	37	10	8005922	8005922	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr10:8005922C>T	ENST00000344293.5	+	3	655	c.449C>T	c.(448-450)tCa>tTa	p.S150L		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	150					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						GGAGGCACATCAGCAGAAGCC	0.398																																																	0													48.0	46.0	47.0					10																	8005922		1847	4100	5947	SO:0001583	missense	0			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.449C>T	10.37:g.8005922C>T	ENSP00000340271:p.Ser150Leu		Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	pfam_BTP,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Histone-fold,smart_BTP,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S150L	ENST00000344293.5	37	c.449	CCDS41487.1	10	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219257	0.79464	.	.	ENSG00000165632	ENST00000344293;ENST00000542889	T	0.21191	2.02	5.57	5.57	0.84162	.	0.000000	0.56097	D	0.000025	T	0.49508	0.1561	M	0.77616	2.38	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.36261	-0.9755	10	0.33141	T	0.24	-14.7954	19.5521	0.95324	0.0:1.0:0.0:0.0	.	150	Q5VWG9	TAF3_HUMAN	L	150	ENSP00000340271:S150L	ENSP00000340271:S150L	S	+	2	0	TAF3	8045928	1.000000	0.71417	0.941000	0.38009	0.958000	0.62258	7.487000	0.81328	2.639000	0.89480	0.655000	0.94253	TCA	TAF3	-	NULL	ENSG00000165632		0.398	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF3	HGNC	protein_coding	OTTHUMT00000046725.1	-	0.00	28	0	C	NM_031923		8005922	+1	tier1	-	no_errors	ENST00000344293	ensembl	human	known	74_37	missense	26.92	19	7	SNP	1.000	T
TBC1D22B	55633	genome.wustl.edu	37	6	37250673	37250673	+	Missense_Mutation	SNP	G	G	T	rs367947387		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:37250673G>T	ENST00000373491.3	+	5	763	c.617G>T	c.(616-618)tGt>tTt	p.C206F		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	206							Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			CTGAGGAAGTGTAGCTGGCCA	0.498																																																	0													109.0	104.0	105.0					6																	37250673		2203	4300	6503	SO:0001583	missense	0			AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.617G>T	6.37:g.37250673G>T	ENSP00000362590:p.Cys206Phe		A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.C206F	ENST00000373491.3	37	c.617	CCDS4832.1	6	.	.	.	.	.	.	.	.	.	.	G	9.398	1.077298	0.20227	.	.	ENSG00000065491	ENST00000373491	T	0.03951	3.75	5.99	5.13	0.70059	Rab-GAP/TBC domain (1);	0.300496	0.42821	D	0.000649	T	0.01353	0.0044	N	0.04880	-0.145	0.46678	D	0.999156	B	0.12013	0.005	B	0.10450	0.005	T	0.49597	-0.8923	10	0.62326	D	0.03	.	14.4616	0.67453	0.0713:0.0:0.9287:0.0	.	206	Q9NU19	TB22B_HUMAN	F	206	ENSP00000362590:C206F	ENSP00000362590:C206F	C	+	2	0	TBC1D22B	37358651	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.103000	0.41806	1.553000	0.49476	-0.126000	0.14955	TGT	TBC1D22B	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000065491		0.498	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22B	HGNC	protein_coding	OTTHUMT00000040402.1	-	0.00	78	0	G	NM_017772		37250673	+1	tier1	-	no_errors	ENST00000373491	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
TCP10L2	401285	genome.wustl.edu	37	6	167608917	167608917	+	3'UTR	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:167608917G>A	ENST00000473271.2	+	0	205							B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2											endometrium(1)|kidney(2)|lung(3)	6						ATGGGACAGTGAAACATTTCA	0.398																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000473271.2:c.*202G>A	6.37:g.167608917G>A				Silent	SNP	NULL	p.*308	ENST00000473271.2	37	c.923		6																																																																																			TCP10L2	-	NULL	ENSG00000166984		0.398	TCP10L2-003	KNOWN	basic|exp_conf	processed_transcript	TCP10L2	HGNC	protein_coding	OTTHUMT00000331450.2	-	0.00	100	0	G	XR_040749		167608917	+1	tier1	-	no_errors	ENST00000283507	ensembl	human	known	74_37	silent	7.53	135	11	SNP	0.995	A
TENM4	26011	genome.wustl.edu	37	11	78387247	78387247	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:78387247G>A	ENST00000278550.7	-	30	5908	c.5446C>T	c.(5446-5448)Cgc>Tgc	p.R1816C		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1816					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TGCTCTTTGCGCTGGCGCCAC	0.667																																																	0													14.0	18.0	16.0					11																	78387247		2061	4177	6238	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5446C>T	11.37:g.78387247G>A	ENSP00000278550:p.Arg1816Cys		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.R1816C	ENST00000278550.7	37	c.5446	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082509	0.76528	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.91068	-2.78;0.58	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.94870	0.8342	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.94669	0.7855	9	.	.	.	.	14.1435	0.65334	0.0:0.0:0.8406:0.1594	.	1816	Q6N022	TEN4_HUMAN	C	1816;280	ENSP00000278550:R1816C;ENSP00000431711:R280C	.	R	-	1	0	ODZ4	78064895	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.262000	0.58847	2.584000	0.87258	0.650000	0.86243	CGC	TENM4	-	NULL	ENSG00000149256		0.667	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	84	0	G			78387247	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	17.14	58	12	SNP	1.000	A
TFDP1	7027	genome.wustl.edu	37	13	114292205	114292205	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr13:114292205C>T	ENST00000375370.5	+	11	1291	c.1079C>T	c.(1078-1080)tCt>tTt	p.S360F	TFDP1_ENST00000538138.1_Intron|TFDP1_ENST00000544902.1_Missense_Mutation_p.S331F	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	360					anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			ACAAGGTTCTCTGCCAGGTGA	0.587										TSP Lung(29;0.18)																																							0													109.0	95.0	99.0					13																	114292205		2203	4300	6503	SO:0001583	missense	0			BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.1079C>T	13.37:g.114292205C>T	ENSP00000364519:p.Ser360Phe		B4DLQ9|Q5JSB4|Q8IZL5	Missense_Mutation	SNP	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcrpt_fac_DP	p.S360F	ENST00000375370.5	37	c.1079	CCDS9538.1	13	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961573	0.34659	.	.	ENSG00000198176	ENST00000375370;ENST00000544902	T;T	0.53640	1.84;0.61	4.56	4.56	0.56223	.	0.218681	0.49305	D	0.000147	T	0.60818	0.2298	M	0.76574	2.34	0.80722	D	1	D;P	0.53462	0.96;0.818	P;B	0.51918	0.684;0.165	T	0.68473	-0.5399	10	0.72032	D	0.01	.	16.6755	0.85278	0.0:1.0:0.0:0.0	.	331;360	F5H452;Q14186	.;TFDP1_HUMAN	F	360;331	ENSP00000364519:S360F;ENSP00000438450:S331F	ENSP00000364519:S360F	S	+	2	0	TFDP1	113340206	1.000000	0.71417	0.974000	0.42286	0.062000	0.15995	4.314000	0.59166	2.231000	0.72958	0.561000	0.74099	TCT	TFDP1	-	pirsf_Transcrpt_fac_DP	ENSG00000198176		0.587	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFDP1	HGNC	protein_coding	OTTHUMT00000045918.3	-	0.00	41	0	C	NM_007111		114292205	+1	tier1	-	no_errors	ENST00000375370	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
TG	7038	genome.wustl.edu	37	8	133895118	133895118	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:133895118C>A	ENST00000220616.4	+	8	989	c.949C>A	c.(949-951)Cca>Aca	p.P317T	TG_ENST00000377869.1_Missense_Mutation_p.P317T	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	317	Thyroglobulin type-1 4. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCCCTATGTTCCAAGCTGCCG	0.552																																																	0													59.0	58.0	58.0					8																	133895118		2203	4300	6503	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.949C>A	8.37:g.133895118C>A	ENSP00000220616:p.Pro317Thr		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.P317T	ENST00000220616.4	37	c.949	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329942	0.81690	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	D;D	0.89343	-2.5;-2.5	5.49	5.49	0.81192	Thyroglobulin type-1 (6);	0.000000	0.64402	D	0.000009	D	0.96904	0.8989	H	0.98089	4.145	0.52501	D	0.999952	D	0.89917	1.0	D	0.97110	1.0	D	0.98308	1.0522	10	0.87932	D	0	.	18.3504	0.90336	0.0:1.0:0.0:0.0	.	317	P01266	THYG_HUMAN	T	317	ENSP00000367100:P317T;ENSP00000220616:P317T	ENSP00000220616:P317T	P	+	1	0	TG	133964300	1.000000	0.71417	0.147000	0.22382	0.612000	0.37316	5.284000	0.65627	2.570000	0.86706	0.563000	0.77884	CCA	TG	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	ENSG00000042832		0.552	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	74	0	C	NM_003235		133895118	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.997	A
THNSL2	55258	genome.wustl.edu	37	2	88484950	88484950	+	Missense_Mutation	SNP	C	C	T	rs530167692		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:88484950C>T	ENST00000324166.5	+	7	2872	c.1181C>T	c.(1180-1182)gCg>gTg	p.A394V	THNSL2_ENST00000377254.3_Intron|THNSL2_ENST00000496844.1_Intron|THNSL2_ENST00000402102.1_Intron|THNSL2_ENST00000358591.2_Missense_Mutation_p.A394V|THNSL2_ENST00000343544.4_Intron|THNSL2_ENST00000449349.1_Intron	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	394					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						CCCCACTCAGCGGTGGCCGTG	0.592																																																	0													31.0	36.0	34.0					2																	88484950		2203	4300	6503	SO:0001583	missense	0				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.1181C>T	2.37:g.88484950C>T	ENSP00000327323:p.Ala394Val		B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	p.A394V	ENST00000324166.5	37	c.1181	CCDS2002.2	2	.	.	.	.	.	.	.	.	.	.	C	33	5.270727	0.95429	.	.	ENSG00000144115	ENST00000358591;ENST00000324166	T;T	0.35236	1.32;1.32	5.8	5.8	0.92144	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	T	0.70833	0.3269	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77408	-0.2599	10	0.72032	D	0.01	.	19.0512	0.93046	0.0:1.0:0.0:0.0	.	394	Q86YJ6	THNS2_HUMAN	V	394	ENSP00000351402:A394V;ENSP00000327323:A394V	ENSP00000327323:A394V	A	+	2	0	THNSL2	88266065	1.000000	0.71417	0.338000	0.25549	0.825000	0.46686	6.683000	0.74533	2.741000	0.93983	0.650000	0.86243	GCG	THNSL2	-	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	ENSG00000144115		0.592	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	HGNC	protein_coding	OTTHUMT00000252662.1	-	0.00	55	0	C	NM_018271		88484950	+1	tier1	-	no_errors	ENST00000324166	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.990	T
TMEM63A	9725	genome.wustl.edu	37	1	226041407	226041407	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:226041407G>A	ENST00000366835.3	-	19	1990	c.1720C>T	c.(1720-1722)Cgg>Tgg	p.R574W		NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	574					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					CCTGGCAGCCGCAGCAGCTCC	0.607																																																	0													52.0	38.0	43.0					1																	226041407		2203	4300	6503	SO:0001583	missense	0				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1720C>T	1.37:g.226041407G>A	ENSP00000355800:p.Arg574Trp		Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	pfam_DUF221	p.R574W	ENST00000366835.3	37	c.1720	CCDS31042.1	1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598095	0.87055	.	.	ENSG00000196187	ENST00000366835	T	0.35973	1.28	5.45	4.5	0.54988	Domain of unknown function DUF221 (1);	0.000000	0.85682	D	0.000000	T	0.64951	0.2645	M	0.90082	3.085	0.80722	D	1	D	0.71674	0.998	D	0.64776	0.929	T	0.73836	-0.3857	10	0.87932	D	0	-34.7788	15.6278	0.76874	0.0:0.0:0.8622:0.1378	.	574	O94886	TM63A_HUMAN	W	574	ENSP00000355800:R574W	ENSP00000355800:R574W	R	-	1	2	TMEM63A	224108030	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.285000	0.65633	2.562000	0.86427	0.563000	0.77884	CGG	TMEM63A	-	pfam_DUF221	ENSG00000196187		0.607	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	HGNC	protein_coding	OTTHUMT00000091154.2	-	0.00	74	0	G	NM_014698		226041407	-1	tier1	-	no_errors	ENST00000366835	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	A
TMEM75	641384	genome.wustl.edu	37	8	128960221	128960221	+	Missense_Mutation	SNP	G	G	T	rs552277176		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:128960221G>T	ENST00000539634.1	-	1	370	c.60C>A	c.(58-60)gaC>gaA	p.D20E				Q8N9X5	TMM75_HUMAN	transmembrane protein 75	20						integral component of membrane (GO:0016021)											GTGCACAGGGGTCAAAGTTTG	0.388													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20111	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0			AK093424		8q24.21	2013-04-03			ENSG00000256655				32295	other	unknown							Standard	NR_103558		Approved	FLJ36105	uc003ysm.2	Q8N9X5		ENST00000539634.1:c.60C>A	8.37:g.128960221G>T	ENSP00000446264:p.Asp20Glu		B2RPD6|B9EH93	Missense_Mutation	SNP	NULL	p.D20E	ENST00000539634.1	37	c.60		8	.	.	.	.	.	.	.	.	.	.	G	9.124	1.009831	0.19277	.	.	ENSG00000256655	ENST00000539634	.	.	.	1.14	1.14	0.20703	.	.	.	.	.	T	0.39384	0.1076	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37220	-0.9715	5	0.87932	D	0	.	5.6408	0.17562	0.0:0.0:1.0:0.0	.	.	.	.	E	20	.	ENSP00000446264:D20E	D	-	3	2	TMEM75	129029403	0.000000	0.05858	0.077000	0.20336	0.068000	0.16541	0.048000	0.14078	0.908000	0.36671	0.508000	0.49915	GAC	TMEM75	-	NULL	ENSG00000256655		0.388	TMEM75-201	KNOWN	basic|appris_principal	protein_coding	TMEM75	HGNC	protein_coding		-	0.00	28	0	G			128960221	-1	tier1	-	no_errors	ENST00000539634	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.100	T
TNFRSF1A	7132	genome.wustl.edu	37	12	6442549	6442549	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr12:6442549C>T	ENST00000162749.2	-	4	755	c.456G>A	c.(454-456)ggG>ggA	p.G152G	TNFRSF1A_ENST00000540022.1_Silent_p.G109G|TNFRSF1A_ENST00000437813.3_5'UTR|TNFRSF1A_ENST00000366159.4_Silent_p.G152G	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A	152					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						GGTGCACGGTCCCATTGAGGC	0.597																																																	0													49.0	47.0	47.0					12																	6442549		2203	4300	6503	SO:0001819	synonymous_variant	0			M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.456G>A	12.37:g.6442549C>T			A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	Missense_Mutation	SNP	NULL	p.G101E	ENST00000162749.2	37	c.302	CCDS8542.1	12																																																																																			TNFRSF1A	-	NULL	ENSG00000067182		0.597	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF1A	HGNC	protein_coding	OTTHUMT00000399038.1	-	0.00	26	0	C	NM_001065		6442549	-1	tier1	-	no_errors	ENST00000534885	ensembl	human	known	74_37	missense	30.77	9	4	SNP	0.994	T
TNFSF4	7292	genome.wustl.edu	37	1	173155952	173155952	+	Silent	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:173155952G>T	ENST00000281834.3	-	3	391	c.255C>A	c.(253-255)atC>atA	p.I85I	TNFSF4_ENST00000488053.1_5'Flank|TNFSF4_ENST00000367718.1_Silent_p.I35I	NM_003326.3	NP_003317.1	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily, member 4	85					acute inflammatory response (GO:0002526)|CD4-positive, alpha-beta T cell costimulation (GO:0035783)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nitrogen dioxide (GO:0035714)|cellular response to prostaglandin E stimulus (GO:0071380)|chemokine (C-C motif) ligand 11 production (GO:0071954)|cholesterol metabolic process (GO:0008203)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|memory T cell activation (GO:0035709)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell activation (GO:0050871)|positive regulation of CD4-positive, alpha-beta T cell costimulation (GO:1900281)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-4-dependent isotype switching to IgE isotypes (GO:2000572)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of memory T cell activation (GO:2000568)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T-helper 2 cell activation (GO:2000570)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of type 2 immune response (GO:0002830)|regulation of adaptive immune response (GO:0002819)|regulation of inflammatory response (GO:0050727)|response to nitrogen dioxide (GO:0035713)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|T-helper 2 cell activation (GO:0035712)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.I85I(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	12						GCACCTTCATGATTTCATCCT	0.398																																																	1	Substitution - coding silent(1)	endometrium(1)											105.0	107.0	106.0					1																	173155952		2203	4300	6503	SO:0001819	synonymous_variant	0			D90224	CCDS1306.1, CCDS72985.1	1q25	2008-07-31	2008-07-31		ENSG00000117586	ENSG00000117586		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11934	protein-coding gene	gene with protein product		603594	"""tax-transcriptionally activated glycoprotein 1, 34kD"""	TXGP1		1996093, 8076595	Standard	XM_005245475		Approved	OX-40L, gp34, CD252	uc001giw.3	P23510	OTTHUMG00000034838	ENST00000281834.3:c.255C>A	1.37:g.173155952G>T			Q5JZA5|Q8IV74|Q9HCN9	Silent	SNP	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom	p.I85	ENST00000281834.3	37	c.255	CCDS1306.1	1																																																																																			TNFSF4	-	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom	ENSG00000117586		0.398	TNFSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF4	HGNC	protein_coding	OTTHUMT00000084271.1		0.00	24	0	G			173155952	-1			no_errors	ENST00000281834	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.023	T
TOP2B	7155	genome.wustl.edu	37	3	25651146	25651146	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:25651146G>T	ENST00000264331.4	-	29	3843	c.3844C>A	c.(3844-3846)Cca>Aca	p.P1282T	TOP2B_ENST00000435706.2_Missense_Mutation_p.P1277T|TOP2B_ENST00000540199.1_Missense_Mutation_p.P134T|TOP2B_ENST00000475717.1_5'Flank|TOP2B_ENST00000542520.1_Missense_Mutation_p.P134T	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	1282					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	CCTTCTACTGGTGCTCCACTG	0.393																																																	0													65.0	56.0	58.0					3																	25651146		1858	4092	5950	SO:0001583	missense	0			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.3844C>A	3.37:g.25651146G>T	ENSP00000264331:p.Pro1282Thr		Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.P1282T	ENST00000264331.4	37	c.3844		3	.	.	.	.	.	.	.	.	.	.	G	11.37	1.617899	0.28801	.	.	ENSG00000077097	ENST00000542520;ENST00000435706;ENST00000264331;ENST00000540199	T;T;T;T	0.43688	0.94;1.02;1.02;0.94	5.72	4.84	0.62591	.	0.489185	0.23398	N	0.048614	T	0.43853	0.1266	L	0.57536	1.79	0.37131	D	0.901253	B;B	0.29037	0.031;0.231	B;B	0.32980	0.034;0.156	T	0.46005	-0.9222	10	0.27785	T	0.31	-3.3822	16.391	0.83537	0.0:0.1321:0.8679:0.0	.	1282;1277	Q02880;Q02880-2	TOP2B_HUMAN;.	T	134;1277;1282;134	ENSP00000446023:P134T;ENSP00000396704:P1277T;ENSP00000264331:P1282T;ENSP00000437352:P134T	ENSP00000264331:P1282T	P	-	1	0	TOP2B	25626150	1.000000	0.71417	0.924000	0.36721	0.444000	0.32077	3.890000	0.56220	1.406000	0.46857	0.585000	0.79938	CCA	TOP2B	-	NULL	ENSG00000077097		0.393	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	HGNC	protein_coding			0.00	34	0	G			25651146	-1			no_errors	ENST00000264331	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.984	T
TPP2	7174	genome.wustl.edu	37	13	103301427	103301427	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr13:103301427G>T	ENST00000376065.4	+	22	2835	c.2799G>T	c.(2797-2799)aaG>aaT	p.K933N	TPP2_ENST00000376052.3_Missense_Mutation_p.K933N	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	933					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCTAGGGAAGAAGAAATCAA	0.333																																																	0													144.0	139.0	140.0					13																	103301427		2203	4300	6503	SO:0001583	missense	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2799G>T	13.37:g.103301427G>T	ENSP00000365233:p.Lys933Asn		Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53_dom,prints_Peptidase_S8_subtilisin-rel	p.K933N	ENST00000376065.4	37	c.2799	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959430	0.74016	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.76	4.92	0.64577	Peptidase S8A, tripeptidyl peptidase II (1);	0.000000	0.85682	D	0.000000	T	0.66499	0.2795	L	0.38175	1.15	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.68961	-0.5271	9	0.59425	D	0.04	.	14.3491	0.66688	0.0706:0.0:0.9294:0.0	.	933	P29144	TPP2_HUMAN	N	933	.	ENSP00000365220:K933N	K	+	3	2	TPP2	102099428	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.422000	0.66453	1.438000	0.47492	0.591000	0.81541	AAG	TPP2	-	pfam_Peptidase_S8A_TPPII	ENSG00000134900		0.333	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2		0.00	26	0	G			103301427	+1			no_errors	ENST00000376065	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
TRIM15	89870	genome.wustl.edu	37	6	30131704	30131705	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:30131704_30131705delTT	ENST00000376694.4	+	1	712_713	c.243_244delTT	c.(241-246)acttacfs	p.Y82fs	TRIM15_ENST00000376688.1_Frame_Shift_Del_p.Y82fs|TRIM10_ENST00000449742.2_5'Flank|TRIM10_ENST00000376704.3_5'Flank	NM_033229.2	NP_150232.2	Q9C019	TRI15_HUMAN	tripartite motif containing 15	82					innate immune response (GO:0045087)|mesodermal cell fate determination (GO:0007500)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	14						TGGGAGAAACTTACTGCGAGGA	0.629																																																	0																																										SO:0001589	frameshift_variant	0			AF220132, U34249	CCDS4677.1	6p21.33	2013-01-09	2011-01-25		ENSG00000204610	ENSG00000204610		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16284	protein-coding gene	gene with protein product			"""zinc finger protein 178"", ""tripartite motif-containing 15"""	ZNF178		11331580, 8304341, 8812418	Standard	NM_033229		Approved	ZNFB7, RNF93	uc010jrx.3	Q9C019	OTTHUMG00000031031	ENST00000376694.4:c.243_244delTT	6.37:g.30131704_30131705delTT	ENSP00000365884:p.Tyr82fs		A2BEC9|O95604|Q8IUX9|Q9C018	Frame_Shift_Del	DEL	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Y82fs	ENST00000376694.4	37	c.243_244	CCDS4677.1	6																																																																																			TRIM15	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000204610		0.629	TRIM15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM15	HGNC	protein_coding	OTTHUMT00000076026.2		0.00	40	0	TT	NM_033229		30131705	+1	tier1		no_errors	ENST00000376694	ensembl	human	known	74_37	frame_shift_del	9.30	39	4	DEL	0.000:0.000	-
TRAF3IP2	10758	genome.wustl.edu	37	6	111884188	111884188	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:111884188G>A	ENST00000340026.6	-	9	2152	c.1558C>T	c.(1558-1560)Ctc>Ttc	p.L520F	TRAF3IP2-AS1_ENST00000449449.2_RNA|TRAF3IP2_ENST00000368735.1_Missense_Mutation_p.L55F|TRAF3IP2_ENST00000368761.5_Missense_Mutation_p.L511F|TRAF3IP2-AS1_ENST00000606892.1_RNA|TRAF3IP2_ENST00000392556.4_Missense_Mutation_p.L99F|TRAF3IP2-AS1_ENST00000442928.2_RNA|TRAF3IP2-AS1_ENST00000438298.2_RNA|TRAF3IP2_ENST00000368731.2_5'UTR|TRAF3IP2-AS1_ENST00000456352.2_RNA|TRAF3IP2-AS1_ENST00000440395.1_RNA|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2_ENST00000359831.4_Missense_Mutation_p.L510F			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	520	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		TTTGGGAAGAGCACAGGGATG	0.348																																																	0													90.0	76.0	81.0					6																	111884188		2203	4300	6503	SO:0001583	missense	0			AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.1558C>T	6.37:g.111884188G>A	ENSP00000345984:p.Leu520Phe		B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Missense_Mutation	SNP	pfam_SEFIR	p.L520F	ENST00000340026.6	37	c.1558		6	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858501	0.91433	.	.	ENSG00000056972	ENST00000392555;ENST00000368761;ENST00000392556;ENST00000340026;ENST00000359831;ENST00000368735	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.50051	0.1593	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.36040	-0.9764	10	0.46703	T	0.11	-27.8804	20.3437	0.98782	0.0:0.0:1.0:0.0	.	510	Q7Z6Q1	.	F	520;511;99;520;510;55	ENSP00000357750:L511F;ENSP00000376339:L99F;ENSP00000345984:L520F;ENSP00000352889:L510F;ENSP00000357724:L55F	ENSP00000345984:L520F	L	-	1	0	TRAF3IP2	111990881	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.735000	0.74806	2.815000	0.96918	0.561000	0.74099	CTC	TRAF3IP2	-	pfam_SEFIR	ENSG00000056972		0.348	TRAF3IP2-001	KNOWN	basic	protein_coding	TRAF3IP2	HGNC	protein_coding	OTTHUMT00000041841.2		0.00	25	0	G			111884188	-1			no_errors	ENST00000340026	ensembl	human	known	74_37	missense	6.06	30	2	SNP	1.000	A
TRAF3IP2	10758	genome.wustl.edu	37	6	111887731	111887731	+	Silent	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr6:111887731G>T	ENST00000340026.6	-	8	2013	c.1419C>A	c.(1417-1419)ccC>ccA	p.P473P	TRAF3IP2-AS1_ENST00000449449.2_RNA|TRAF3IP2_ENST00000368735.1_Silent_p.P8P|TRAF3IP2_ENST00000368761.5_Silent_p.P464P|TRAF3IP2-AS1_ENST00000606892.1_RNA|TRAF3IP2_ENST00000392556.4_Silent_p.P52P|TRAF3IP2-AS1_ENST00000442928.2_RNA|TRAF3IP2-AS1_ENST00000438298.2_RNA|TRAF3IP2_ENST00000368731.2_5'UTR|TRAF3IP2-AS1_ENST00000456352.2_RNA|TRAF3IP2-AS1_ENST00000440395.1_RNA|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2_ENST00000359831.4_Silent_p.P463P			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	473	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		GTTTGTATTTGGGGCTGATTG	0.493																																																	0													262.0	196.0	218.0					6																	111887731		2203	4300	6503	SO:0001819	synonymous_variant	0			AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.1419C>A	6.37:g.111887731G>T			B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Silent	SNP	pfam_SEFIR	p.P473	ENST00000340026.6	37	c.1419		6																																																																																			TRAF3IP2	-	pfam_SEFIR	ENSG00000056972		0.493	TRAF3IP2-001	KNOWN	basic	protein_coding	TRAF3IP2	HGNC	protein_coding	OTTHUMT00000041841.2	-	0.00	91	0	G			111887731	-1	tier1	-	no_errors	ENST00000340026	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
TRIM2	23321	genome.wustl.edu	37	4	154236987	154236987	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr4:154236987delT	ENST00000437508.2	+	8	1738	c.1537delT	c.(1537-1539)tttfs	p.F513fs	TRIM2_ENST00000338700.5_Frame_Shift_Del_p.F540fs	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	513					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		CTTACAGATATTTTCCAATGA	0.483																																																	0													81.0	91.0	88.0					4																	154236987		2203	4300	6503	SO:0001589	frameshift_variant	0			AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.1537delT	4.37:g.154236987delT	ENSP00000415812:p.Phe513fs		D3DP09|O60272|Q9BSI9|Q9UFZ1	Frame_Shift_Del	DEL	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.S541fs	ENST00000437508.2	37	c.1618	CCDS47147.1	4																																																																																			TRIM2	-	pfscan_NHL_repeat_subgr	ENSG00000109654		0.483	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM2	HGNC	protein_coding	OTTHUMT00000342652.1		0.00	26	0	T			154236987	+1	tier1		no_errors	ENST00000338700	ensembl	human	known	74_37	frame_shift_del	11.11	16	2	DEL	1.000	-
TRIM49B	283116	genome.wustl.edu	37	11	49053162	49053162	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:49053162G>T	ENST00000332682.7	+	2	39	c.11G>T	c.(10-12)gGa>gTa	p.G4V		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	4						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						ATGAATTCTGGAATCTTACAG	0.433																																																	0																																										SO:0001583	missense	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.11G>T	11.37:g.49053162G>T	ENSP00000330216:p.Gly4Val			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.G4V	ENST00000332682.7	37	c.11	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	G	1.502	-0.551828	0.03996	.	.	ENSG00000182053	ENST00000332682	T	0.65549	-0.16	0.49	-0.708	0.11241	.	.	.	.	.	T	0.31918	0.0812	N	0.03608	-0.345	0.21290	N	0.999737	.	.	.	.	.	.	T	0.16660	-1.0395	7	0.40728	T	0.16	.	3.7635	0.08613	0.6499:0.0:0.3501:0.0	.	.	.	.	V	4	ENSP00000330216:G4V	ENSP00000330216:G4V	G	+	2	0	AC084851.1	49009738	0.000000	0.05858	0.002000	0.10522	0.040000	0.13550	-0.335000	0.07873	-0.345000	0.08325	0.184000	0.17185	GGA	TRIM49B	-	NULL	ENSG00000182053		0.433	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		-	0.00	188	0	G			49053162	+1	tier1	-	no_errors	ENST00000332682	ensembl	human	known	74_37	missense	18.66	170	39	SNP	0.145	T
TRIM64B	642446	genome.wustl.edu	37	11	89603859	89603859	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:89603859A>C	ENST00000329862.6	-	6	1279	c.1280T>G	c.(1279-1281)cTt>cGt	p.L427R		NM_001136486.1|NM_001164397.1	NP_001129958.1|NP_001157869.1	A6NI03	TR64B_HUMAN	tripartite motif containing 64B	427	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)	2						ACCATAGATAAGAGAACCTTT	0.403																																																	0													8.0	15.0	13.0					11																	89603859		525	1269	1794	SO:0001583	missense	0				CCDS53693.1	11q14.3	2014-04-02	2011-01-25		ENSG00000189253	ENSG00000189253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37147	protein-coding gene	gene with protein product			"""tripartite motif-containing 64B"""				Standard	NM_001164397		Approved		uc021qoo.1	A6NI03	OTTHUMG00000167638	ENST00000329862.6:c.1280T>G	11.37:g.89603859A>C	ENSP00000332969:p.Leu427Arg			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L427R	ENST00000329862.6	37	c.1280	CCDS53693.1	11	.	.	.	.	.	.	.	.	.	.	.	12.01	1.811023	0.32053	.	.	ENSG00000189253	ENST00000329862	T	0.66099	-0.19	2.2	0.894	0.19242	.	.	.	.	.	T	0.68760	0.3036	M	0.85373	2.75	0.09310	N	1	.	.	.	.	.	.	T	0.60454	-0.7260	6	.	.	.	.	4.9278	0.13901	0.6807:0.3193:0.0:0.0	.	.	.	.	R	427	ENSP00000332969:L427R	.	L	-	2	0	TRIM64B	89243507	0.001000	0.12720	0.009000	0.14445	0.144000	0.21451	-0.453000	0.06778	0.077000	0.16863	0.321000	0.21382	CTT	TRIM64B	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000189253		0.403	TRIM64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM64B	HGNC	protein_coding	OTTHUMT00000395440.1	-	0.00	97	0	A			89603859	-1	tier1	-	no_errors	ENST00000329862	ensembl	human	known	74_37	missense	13.16	132	20	SNP	0.224	C
TRPA1	8989	genome.wustl.edu	37	8	72981315	72981315	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:72981315G>C	ENST00000262209.4	-	3	594	c.387C>G	c.(385-387)ttC>ttG	p.F129L		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	129					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CCATCATGTTGAAGTTTCGGA	0.478																																																	0													229.0	243.0	238.0					8																	72981315		2203	4300	6503	SO:0001583	missense	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.387C>G	8.37:g.72981315G>C	ENSP00000262209:p.Phe129Leu		A6NIN6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.F129L	ENST00000262209.4	37	c.387	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	G	3.877	-0.026769	0.07589	.	.	ENSG00000104321	ENST00000262209	T	0.15017	2.46	5.74	3.86	0.44501	Ankyrin repeat-containing domain (4);	2.273830	0.01005	N	0.003745	T	0.11067	0.0270	N	0.05414	-0.055	0.24063	N	0.996005	B	0.09022	0.002	B	0.06405	0.002	T	0.24333	-1.0163	10	0.30854	T	0.27	2.6832	6.7882	0.23685	0.0697:0.1252:0.6676:0.1375	.	129	O75762	TRPA1_HUMAN	L	129	ENSP00000262209:F129L	ENSP00000262209:F129L	F	-	3	2	TRPA1	73143869	0.852000	0.29690	0.131000	0.22000	0.204000	0.24138	1.768000	0.38511	0.691000	0.31592	0.655000	0.94253	TTC	TRPA1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104321		0.478	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	-	0.00	69	0	G	NM_007332		72981315	-1	tier1	-	no_errors	ENST00000262209	ensembl	human	known	74_37	missense	13.51	64	10	SNP	0.757	C
TRPM4	54795	genome.wustl.edu	37	19	49703625	49703625	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:49703625G>T	ENST00000252826.5	+	18	2840	c.2714G>T	c.(2713-2715)cGg>cTg	p.R905L	TRPM4_ENST00000427978.2_Missense_Mutation_p.R760L|TRPM4_ENST00000355712.5_Missense_Mutation_p.R551L	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	905					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TTCACGGTGCGGCTGCTTCAC	0.607																																																	0													60.0	54.0	56.0					19																	49703625		2203	4300	6503	SO:0001583	missense	0			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.2714G>T	19.37:g.49703625G>T	ENSP00000252826:p.Arg905Leu		A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.R905L	ENST00000252826.5	37	c.2714	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	G	33	5.213495	0.95069	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	D;T;D	0.99619	-6.28;-0.72;-6.28	4.21	4.21	0.49690	Ion transport (1);	0.063176	0.64402	D	0.000015	D	0.99635	0.9866	M	0.89095	3.005	0.58432	D	0.999992	D;D;D;D	0.89917	0.997;0.997;0.997;1.0	D;P;P;D	0.97110	0.95;0.873;0.873;1.0	D	0.97562	1.0099	10	0.87932	D	0	-27.4517	15.7186	0.77688	0.0:0.0:1.0:0.0	.	551;731;760;905	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	L	905;760;551	ENSP00000252826:R905L;ENSP00000407492:R760L;ENSP00000347944:R551L	ENSP00000252826:R905L	R	+	2	0	TRPM4	54395437	1.000000	0.71417	0.972000	0.41901	0.932000	0.56968	9.056000	0.93881	2.084000	0.62774	0.491000	0.48974	CGG	TRPM4	-	pfam_Ion_trans_dom	ENSG00000130529		0.607	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	HGNC	protein_coding	OTTHUMT00000465543.2	-	0.00	45	0	G	NM_017636		49703625	+1	tier1	-	no_errors	ENST00000252826	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	T
TRPS1	7227	genome.wustl.edu	37	8	116632015	116632015	+	Missense_Mutation	SNP	G	G	T	rs200964070	byFrequency	TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr8:116632015G>T	ENST00000220888.5	-	2	430	c.271C>A	c.(271-273)Ccc>Acc	p.P91T	TRPS1_ENST00000519076.1_Intron|TRPS1_ENST00000520276.1_Missense_Mutation_p.P95T|TRPS1_ENST00000519674.1_Missense_Mutation_p.P91T|TRPS1_ENST00000395715.3_Missense_Mutation_p.P104T			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	91					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CCCTTACTGGGGCTTTCATAA	0.483									Langer-Giedion syndrome																																								0													91.0	85.0	87.0					8																	116632015		1916	4142	6058	SO:0001583	missense	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.271C>A	8.37:g.116632015G>T	ENSP00000220888:p.Pro91Thr		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.P104T	ENST00000220888.5	37	c.310		8	.	.	.	.	.	.	.	.	.	.	G	12.16	1.855732	0.32791	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674;ENST00000395713;ENST00000519815	D;D;D;T	0.98419	-4.92;-4.9;-4.9;0.91	5.82	3.1	0.35709	.	0.252817	0.33346	N	0.005013	D	0.92967	0.7762	N	0.08118	0	0.35798	D	0.82292	B;B;B	0.29085	0.232;0.149;0.232	B;B;B	0.29353	0.101;0.047;0.063	D	0.89745	0.3936	10	0.20046	T	0.44	-1.5836	11.2559	0.49054	0.1971:0.0:0.8029:0.0	.	95;91;104	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	T	104;91;95;91;104;104	ENSP00000379065:P104T;ENSP00000220888:P91T;ENSP00000428680:P95T;ENSP00000429174:P91T	ENSP00000220888:P91T	P	-	1	0	TRPS1	116701190	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.348000	0.59379	0.399000	0.25367	0.650000	0.86243	CCC	TRPS1	-	NULL	ENSG00000104447		0.483	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3		0.00	39	0	G	NM_014112		116632015	-1			no_errors	ENST00000395715	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
TTC14	151613	genome.wustl.edu	37	3	180320998	180320998	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr3:180320998C>T	ENST00000296015.4	+	3	505	c.373C>T	c.(373-375)Cgt>Tgt	p.R125C	RP11-496B10.3_ENST00000472596.1_lincRNA|TTC14_ENST00000382584.4_Missense_Mutation_p.R125C|TTC14_ENST00000412756.2_Missense_Mutation_p.R125C	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	125							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AGATATTGAGCGTGGTGATAT	0.373																																																	0													250.0	236.0	241.0					3																	180320998		2203	4300	6503	SO:0001583	missense	0			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.373C>T	3.37:g.180320998C>T	ENSP00000296015:p.Arg125Cys		G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	pfam_TPR_1,superfamily_NA-bd_OB-fold,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.R125C	ENST00000296015.4	37	c.373	CCDS3237.1	3	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620844	0.87460	.	.	ENSG00000163728	ENST00000296015;ENST00000491380;ENST00000412756;ENST00000382584;ENST00000492617;ENST00000495660	T;T	0.50813	0.73;0.76	5.71	5.71	0.89125	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);	0.058333	0.64402	D	0.000001	T	0.69278	0.3093	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.976;0.949;0.988	T	0.70457	-0.4866	10	0.72032	D	0.01	-9.776	19.8449	0.96704	0.0:1.0:0.0:0.0	.	125;125;125	Q96N46-2;G5E9X0;Q96N46	.;.;TTC14_HUMAN	C	125;125;125;125;25;25	ENSP00000296015:R125C;ENSP00000372027:R125C	ENSP00000296015:R125C	R	+	1	0	TTC14	181803692	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.435000	0.59941	2.680000	0.91292	0.655000	0.94253	CGT	TTC14	-	superfamily_NA-bd_OB-fold	ENSG00000163728		0.373	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC14	HGNC	protein_coding	OTTHUMT00000349786.1	-	0.00	46	0	C	NM_133462		180320998	+1	tier1	-	no_errors	ENST00000296015	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
UGT1A4	54657	genome.wustl.edu	37	2	234628062	234628062	+	Missense_Mutation	SNP	C	C	T	rs538242607		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:234628062C>T	ENST00000373409.3	+	1	639	c.596C>T	c.(595-597)aCg>aTg	p.T199M	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000373424.1_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	199					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	AAGTTACTAACGACCAATTCA	0.443													C|||	1	0.000199681	0.0008	0.0	5008	,	,		23183	0.0		0.0	False		,,,				2504	0.0				Melanoma(99;1011 1962 13201 26492)												0													165.0	158.0	160.0					2																	234628062		2203	4297	6500	SO:0001583	missense	0			M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.596C>T	2.37:g.234628062C>T	ENSP00000362508:p.Thr199Met		B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.T199M	ENST00000373409.3	37	c.596	CCDS33405.1	2	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601251	0.46423	.	.	ENSG00000244474	ENST00000373409	T	0.60672	0.17	4.35	4.35	0.52113	.	.	.	.	.	T	0.80502	0.4635	M	0.88570	2.965	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.74057	-0.3787	9	0.87932	D	0	.	16.8588	0.86012	0.0:1.0:0.0:0.0	.	199;199	B8K288;P22310	.;UD14_HUMAN	M	199	ENSP00000362508:T199M	ENSP00000362508:T199M	T	+	2	0	UGT1A4	234292801	0.147000	0.22687	0.003000	0.11579	0.014000	0.08584	3.964000	0.56780	1.942000	0.56320	0.491000	0.48974	ACG	UGT1A4	-	pfam_UDP_glucos_trans	ENSG00000244474		0.443	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A4	HGNC	protein_coding	OTTHUMT00000130984.1	-	0.00	118	0	C	NM_007120		234628062	+1	tier1	-	no_errors	ENST00000373409	ensembl	human	known	74_37	missense	20.35	90	23	SNP	0.022	T
UNC13A	23025	genome.wustl.edu	37	19	17778978	17778978	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:17778978C>T	ENST00000519716.2	-	6	415	c.416G>A	c.(415-417)cGc>cAc	p.R139H	UNC13A_ENST00000551649.1_Missense_Mutation_p.R139H|UNC13A_ENST00000552293.1_Missense_Mutation_p.R139H|UNC13A_ENST00000550896.1_Missense_Mutation_p.R139H|UNC13A_ENST00000252773.7_Missense_Mutation_p.R139H|UNC13A_ENST00000428389.2_Missense_Mutation_p.R227H	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	139					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GGCCCAGTAGCGAGCCTCCTC	0.582																																																	0													77.0	79.0	78.0					19																	17778978		2011	4186	6197	SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.416G>A	19.37:g.17778978C>T	ENSP00000429562:p.Arg139His		E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_dom,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.R227H	ENST00000519716.2	37	c.680	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885449	0.72410	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51;-0.51	4.38	4.38	0.52667	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000001	T	0.65249	0.2673	M	0.63843	1.955	0.35461	D	0.796509	D	0.58268	0.982	B	0.37731	0.257	T	0.79035	-0.1968	10	0.62326	D	0.03	-14.5696	14.4334	0.67266	0.0:1.0:0.0:0.0	.	139	Q9UPW8	UN13A_HUMAN	H	139;227;139;139;139;139	ENSP00000429562:R139H;ENSP00000400409:R227H;ENSP00000252773:R139H;ENSP00000447236:R139H;ENSP00000447572:R139H;ENSP00000446831:R139H	ENSP00000252773:R139H	R	-	2	0	UNC13A	17639978	0.985000	0.35326	0.980000	0.43619	0.789000	0.44602	4.748000	0.62148	1.995000	0.58328	0.561000	0.74099	CGC	UNC13A	-	superfamily_C2_dom	ENSG00000130477		0.582	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	-	0.00	52	0	C	XM_038604		17778978	-1	tier1	-	no_errors	ENST00000428389	ensembl	human	known	74_37	missense	12.73	47	7	SNP	0.994	T
USP14	9097	genome.wustl.edu	37	18	197625	197625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr18:197625G>T	ENST00000261601.7	+	8	695	c.604G>T	c.(604-606)Gaa>Taa	p.E202*	USP14_ENST00000400266.3_Nonsense_Mutation_p.E191*|USP14_ENST00000383589.2_Nonsense_Mutation_p.E156*|USP14_ENST00000582707.1_Nonsense_Mutation_p.E167*	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	202	USP.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				GGATGCTAATGAATGTTGGAT	0.328																																																	0													120.0	127.0	125.0					18																	197625		2203	4299	6502	SO:0001587	stop_gained	0			U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.604G>T	18.37:g.197625G>T	ENSP00000261601:p.Glu202*		J3QRZ5|Q53XY5	Nonsense_Mutation	SNP	pfam_Peptidase_C19/C67,smart_Ubiquitin_dom,pfscan_Peptidase_C19/C67,pfscan_Ubiquitin_supergroup	p.E202*	ENST00000261601.7	37	c.604	CCDS32780.1	18	.	.	.	.	.	.	.	.	.	.	G	37	6.608290	0.97701	.	.	ENSG00000101557	ENST00000261601;ENST00000383589;ENST00000400266	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.6463	19.8765	0.96875	0.0:0.0:1.0:0.0	.	.	.	.	X	202;167;191	.	ENSP00000261601:E202X	E	+	1	0	USP14	187625	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.262000	0.95591	2.695000	0.91970	0.650000	0.86243	GAA	USP14	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000101557		0.328	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP14	HGNC	protein_coding	OTTHUMT00000440305.3		0.00	32	0	G	NM_005151		197625	+1			no_errors	ENST00000261601	ensembl	human	known	74_37	nonsense	9.38	29	3	SNP	1.000	T
USP28	57646	genome.wustl.edu	37	11	113683093	113683093	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr11:113683093C>G	ENST00000003302.4	-	16	1945	c.1877G>C	c.(1876-1878)tGg>tCg	p.W626S	USP28_ENST00000545540.1_Missense_Mutation_p.W501S|USP28_ENST00000544967.1_Missense_Mutation_p.W334S|USP28_ENST00000260188.5_Missense_Mutation_p.W626S	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	626	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		AACTTCTTCCCAGGAAGATTC	0.418																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												0													130.0	132.0	131.0					11																	113683093		2201	4296	6497	SO:0001583	missense	0			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.1877G>C	11.37:g.113683093C>G	ENSP00000003302:p.Trp626Ser		B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,pfscan_Peptidase_C19/C67	p.W626S	ENST00000003302.4	37	c.1877	CCDS31680.1	11	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206580	0.79127	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000538475	T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65	5.52	4.61	0.57282	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.48677	0.1513	L	0.58669	1.825	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	T	0.24977	-1.0145	10	0.23891	T	0.37	-7.9862	13.7601	0.62961	0.0:0.9267:0.0:0.0733	.	501;626;334	B4E3L3;Q96RU2;G3V1N5	.;UBP28_HUMAN;.	S	626;626;334;501;330	ENSP00000003302:W626S;ENSP00000260188:W626S;ENSP00000442431:W334S;ENSP00000444991:W501S;ENSP00000442257:W330S	ENSP00000003302:W626S	W	-	2	0	USP28	113188303	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.772000	0.68889	2.585000	0.87301	0.655000	0.94253	TGG	USP28	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000048028		0.418	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	HGNC	protein_coding	OTTHUMT00000398789.1	-	0.00	34	0	C			113683093	-1	tier1	-	no_errors	ENST00000003302	ensembl	human	known	74_37	missense	20.00	40	10	SNP	1.000	G
USP9Y	8287	genome.wustl.edu	37	Y	14821396	14821396	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrY:14821396C>G	ENST00000338981.3	+	3	961	c.16C>G	c.(16-18)Cat>Gat	p.H6D	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	6					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AGCCATCACTCATGGCTCTCC	0.448																																																	0													63.0	67.0	66.0					Y																	14821396		596	1919	2515	SO:0001583	missense	0			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.16C>G	Y.37:g.14821396C>G	ENSP00000342812:p.His6Asp		O14601	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,superfamily_Glycoside_hydrolase_SF,pfscan_Peptidase_C19/C67	p.H6D	ENST00000338981.3	37	c.16	CCDS14781.1	Y																																																																																			USP9Y	-	NULL	ENSG00000114374		0.448	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP9Y	HGNC	protein_coding	OTTHUMT00000088703.2	-	0.00	17	0	C	NM_004654		14821396	+1	tier1	-	no_errors	ENST00000338981	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	G
VEGFC	7424	genome.wustl.edu	37	4	177632662	177632662	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr4:177632662G>T	ENST00000280193.2	-	4	1110	c.695C>A	c.(694-696)aCa>aAa	p.T232K	VEGFC_ENST00000507638.1_5'UTR	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	232					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		CTGTGGTAGTGTTGCTGGCAG	0.343																																																	0													131.0	124.0	127.0					4																	177632662		1893	4104	5997	SO:0001583	missense	0			BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.695C>A	4.37:g.177632662G>T	ENSP00000280193:p.Thr232Lys		B2R9Q8	Missense_Mutation	SNP	pfam_PDGF/VEGF_dom,pfam_CXCXC_repeat,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	p.T232K	ENST00000280193.2	37	c.695	CCDS43285.1	4	.	.	.	.	.	.	.	.	.	.	G	14.22	2.470920	0.43942	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.89	5.05	0.67936	.	0.296217	0.31051	N	0.008357	T	0.50240	0.1604	M	0.63428	1.95	0.41698	D	0.989389	B	0.32245	0.361	B	0.26864	0.074	T	0.50013	-0.8877	9	0.07990	T	0.79	-1.3281	15.2367	0.73436	0.0674:0.0:0.9326:0.0	.	232	P49767	VEGFC_HUMAN	K	232	.	ENSP00000280193:T232K	T	-	2	0	VEGFC	177869656	0.990000	0.36364	0.216000	0.23742	0.990000	0.78478	5.053000	0.64269	1.495000	0.48549	0.585000	0.79938	ACA	VEGFC	-	NULL	ENSG00000150630		0.343	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEGFC	HGNC	protein_coding	OTTHUMT00000361991.1	-	0.00	49	0	G	NM_005429		177632662	-1	tier1	-	no_errors	ENST00000280193	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.874	T
WBP4	11193	genome.wustl.edu	37	13	41642797	41642797	+	Silent	SNP	A	A	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr13:41642797A>G	ENST00000379487.3	+	5	763	c.363A>G	c.(361-363)aaA>aaG	p.K121K	WBP4_ENST00000542082.1_Silent_p.K100K	NM_007187.3	NP_009118.1	O75554	WBP4_HUMAN	WW domain binding protein 4	121	Lys-rich.				mRNA cis splicing, via spliceosome (GO:0045292)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	nucleic acid binding (GO:0003676)|proline-rich region binding (GO:0070064)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|prostate(1)|skin(1)	12		Lung NSC(96;3.55e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;3.11e-09)|Epithelial(112;3.37e-06)|OV - Ovarian serous cystadenocarcinoma(117;8.3e-05)|GBM - Glioblastoma multiforme(144;0.00102)|BRCA - Breast invasive adenocarcinoma(63;0.07)		aaagaaaaaaagaTCCTTCAA	0.383																																																	0													93.0	92.0	92.0					13																	41642797		2203	4300	6503	SO:0001819	synonymous_variant	0			AF071185	CCDS9375.1	13q13.3	2012-10-17	2012-10-17		ENSG00000120688	ENSG00000120688			12739	protein-coding gene	gene with protein product	"""formin binding protein 21"""	604981				9724750	Standard	NM_007187		Approved	FBP21, MGC117310	uc001uxt.3	O75554	OTTHUMG00000016784	ENST00000379487.3:c.363A>G	13.37:g.41642797A>G			B7Z4M2|Q32P29	Silent	SNP	pfam_WW_dom,pfam_Znf_U1-C,superfamily_WW_dom,smart_Znf_U1,smart_WW_dom,pfscan_WW_dom,pfscan_Znf_C2H2_matrin	p.K121	ENST00000379487.3	37	c.363	CCDS9375.1	13																																																																																			WBP4	-	NULL	ENSG00000120688		0.383	WBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP4	HGNC	protein_coding	OTTHUMT00000044655.2	-	0.00	33	0	A	NM_007187		41642797	+1	tier1	-	no_errors	ENST00000379487	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.981	G
WBSCR17	64409	genome.wustl.edu	37	7	70886046	70886046	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:70886046C>A	ENST00000333538.5	+	5	1551	c.917C>A	c.(916-918)cCc>cAc	p.P306H	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	306					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TACATCAGCCCCCCAAAAGAC	0.582																																																	0													79.0	77.0	78.0					7																	70886046		2203	4300	6503	SO:0001583	missense	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.917C>A	7.37:g.70886046C>A	ENSP00000329654:p.Pro306His		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.P306H	ENST00000333538.5	37	c.917	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802580	0.90623	.	.	ENSG00000185274	ENST00000333538	T	0.61158	0.13	5.32	5.32	0.75619	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.81211	0.4775	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85292	0.1068	10	0.87932	D	0	.	18.0015	0.89199	0.0:1.0:0.0:0.0	.	306	Q6IS24	GLTL3_HUMAN	H	306	ENSP00000329654:P306H	ENSP00000329654:P306H	P	+	2	0	WBSCR17	70523982	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.490000	0.84030	0.557000	0.71058	CCC	WBSCR17	-	pfam_Glyco_trans_2	ENSG00000185274		0.582	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1		0.00	51	0	C	NM_022479		70886046	+1			no_errors	ENST00000333538	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	A
XBP1	7494	genome.wustl.edu	37	22	29191375	29191375	+	3'UTR	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr22:29191375C>G	ENST00000216037.6	-	0	1017				XBP1_ENST00000405219.3_3'UTR|XBP1_ENST00000403532.3_3'UTR|XBP1_ENST00000344347.5_Missense_Mutation_p.E307Q	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						AGGTCATCTTCTACAGGTTCT	0.498																																																	0													75.0	81.0	79.0					22																	29191375		1196	2234	3430	SO:0001624	3_prime_UTR_variant	0			M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.*159G>C	22.37:g.29191375C>G			Q8WYK6|Q969P1|Q96BD7	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.E307Q	ENST00000216037.6	37	c.919	CCDS13847.1	22	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430661	0.62844	.	.	ENSG00000100219	ENST00000344347	.	.	.	5.73	5.73	0.89815	.	0.245809	0.38778	N	0.001567	T	0.76751	0.4031	.	.	.	0.47441	D	0.999424	D	0.59767	0.986	P	0.58873	0.847	T	0.78964	-0.1996	8	0.72032	D	0.01	.	17.3898	0.87427	0.0:1.0:0.0:0.0	.	307	P17861-2	.	Q	307	.	ENSP00000343155:E307Q	E	-	1	0	XBP1	27521375	1.000000	0.71417	0.983000	0.44433	0.971000	0.66376	6.188000	0.72045	2.704000	0.92352	0.655000	0.94253	GAA	XBP1	-	NULL	ENSG00000100219		0.498	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	XBP1	HGNC	protein_coding	OTTHUMT00000321274.1	-	0.00	60	0	C	NM_005080		29191375	-1	tier1	-	no_errors	ENST00000344347	ensembl	human	known	74_37	missense	9.23	59	6	SNP	1.000	G
XIRP2	129446	genome.wustl.edu	37	2	168067378	168067378	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr2:168067378G>T	ENST00000409728.1	+	5	884	c.795G>T	c.(793-795)agG>agT	p.R265S	XIRP2_ENST00000409756.2_Missense_Mutation_p.R232S|XIRP2_ENST00000409195.1_Missense_Mutation_p.R232S|XIRP2_ENST00000420519.1_Missense_Mutation_p.R265S|XIRP2_ENST00000409043.1_Missense_Mutation_p.R232S|XIRP2_ENST00000295237.9_Missense_Mutation_p.R232S|XIRP2_ENST00000409273.1_Missense_Mutation_p.R10S|XIRP2_ENST00000409605.1_Missense_Mutation_p.R10S	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	57					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CTGTTTCCAGGGGTGACTGCC	0.532																																																	0													79.0	84.0	82.0					2																	168067378		2042	4196	6238	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.795G>T	2.37:g.168067378G>T	ENSP00000386619:p.Arg265Ser		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.R232S	ENST00000409728.1	37	c.696	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976146	0.74360	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237;ENST00000409273;ENST00000409605	T;T;T;T;T;T;T;T	0.79247	-1.25;-1.23;4.05;-1.25;-1.23;4.05;4.12;-1.18	5.93	2.75	0.32379	.	0.335587	0.34067	N	0.004288	T	0.81903	0.4921	L	0.61218	1.895	0.28861	N	0.895506	B;D;D;B;B	0.67145	0.165;0.996;0.996;0.211;0.25	B;D;D;B;B	0.66497	0.067;0.944;0.944;0.106;0.092	T	0.74031	-0.3795	10	0.66056	D	0.02	-8.2396	5.8722	0.18809	0.2582:0.145:0.5968:0.0	.	57;232;265;57;10	A4UGR9;A4UGR9-4;A4UGR9-6;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.;.;.	S	232;265;232;232;265;232;10;10	ENSP00000386454:R232S;ENSP00000386619:R265S;ENSP00000386840:R232S;ENSP00000386724:R232S;ENSP00000415541:R265S;ENSP00000295237:R232S;ENSP00000387255:R10S;ENSP00000386981:R10S	ENSP00000295237:R232S	R	+	3	2	XIRP2	167775624	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.740000	0.26188	0.847000	0.35167	0.655000	0.94253	AGG	XIRP2	-	NULL	ENSG00000163092		0.532	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	-	0.00	51	0	G	NM_152381		168067378	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.993	T
YTHDC2	64848	genome.wustl.edu	37	5	112889642	112889642	+	Missense_Mutation	SNP	C	C	G	rs544302245		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr5:112889642C>G	ENST00000161863.4	+	16	2269	c.2056C>G	c.(2056-2058)Ctt>Gtt	p.L686V	YTHDC2_ENST00000515883.1_Missense_Mutation_p.L686V	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	686	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GTTGCAGATTCTTTCCACCAA	0.294													C|||	1	0.000199681	0.0	0.0	5008	,	,		15191	0.0		0.0	False		,,,				2504	0.001																0													125.0	118.0	121.0					5																	112889642		2202	4298	6500	SO:0001583	missense	0			AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.2056C>G	5.37:g.112889642C>G	ENSP00000161863:p.Leu686Val		B2RP66	Missense_Mutation	SNP	pfam_YTH_domain,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,pfam_R3H_ss-bd,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_R3H_ss-bd,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_R3H_ss-bd,pfscan_YTH_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L686V	ENST00000161863.4	37	c.2056	CCDS4113.1	5	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128030	0.77549	.	.	ENSG00000047188	ENST00000161863;ENST00000515883;ENST00000511372	T;T	0.66280	1.69;-0.2	5.51	5.51	0.81932	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.77082	0.4078	L	0.53249	1.67	0.54753	D	0.999987	P	0.50528	0.936	D	0.72625	0.978	T	0.77189	-0.2679	10	0.59425	D	0.04	.	19.3947	0.94603	0.0:1.0:0.0:0.0	.	686	Q9H6S0	YTDC2_HUMAN	V	686;686;596	ENSP00000161863:L686V;ENSP00000423101:L686V	ENSP00000161863:L686V	L	+	1	0	YTHDC2	112917541	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.641000	0.83368	2.572000	0.86782	0.650000	0.86243	CTT	YTHDC2	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000047188		0.294	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDC2	HGNC	protein_coding	OTTHUMT00000250776.2	-	0.00	19	0	C	NM_022828		112889642	+1	tier1	-	no_errors	ENST00000161863	ensembl	human	known	74_37	missense	27.78	26	10	SNP	1.000	G
YWHAG	7532	genome.wustl.edu	37	7	75959220	75959220	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr7:75959220C>A	ENST00000307630.3	-	2	640	c.418G>T	c.(418-420)Gga>Tga	p.G140*		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	140					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						CTTTTCTCTCCGGTGGCCACT	0.562																																																	0													137.0	137.0	137.0					7																	75959220		2203	4300	6503	SO:0001587	stop_gained	0			AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.418G>T	7.37:g.75959220C>A	ENSP00000306330:p.Gly140*		O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Nonsense_Mutation	SNP	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.G140*	ENST00000307630.3	37	c.418	CCDS5584.1	7	.	.	.	.	.	.	.	.	.	.	C	37	6.109776	0.97291	.	.	ENSG00000170027	ENST00000307630;ENST00000536755;ENST00000453207	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.2853	0.90112	0.0:1.0:0.0:0.0	.	.	.	.	X	140;118;100	.	ENSP00000306330:G140X	G	-	1	0	YWHAG	75797156	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	7.616000	0.83018	2.793000	0.96121	0.650000	0.86243	GGA	YWHAG	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	ENSG00000170027		0.562	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAG	HGNC	protein_coding	OTTHUMT00000253002.1		0.00	35	0	C	NM_012479		75959220	-1			no_errors	ENST00000307630	ensembl	human	known	74_37	nonsense	6.78	54	4	SNP	1.000	A
ZMYM3	9203	genome.wustl.edu	37	X	70471418	70471418	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chrX:70471418G>T	ENST00000353904.2	-	3	888	c.701C>A	c.(700-702)cCg>cAg	p.P234Q	ZMYM3_ENST00000373998.1_Missense_Mutation_p.P234Q|ZMYM3_ENST00000373982.1_Missense_Mutation_p.P234Q|ZMYM3_ENST00000314425.5_Missense_Mutation_p.P234Q|ZMYM3_ENST00000373978.1_Missense_Mutation_p.P234Q|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Missense_Mutation_p.P234Q|ZMYM3_ENST00000373984.3_Missense_Mutation_p.P234Q|ZMYM3_ENST00000373981.1_Missense_Mutation_p.P234Q	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	234					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CCGTTCAGGCGGCTTCTCACT	0.587																																																	0													55.0	32.0	40.0					X																	70471418		2199	4293	6492	SO:0001583	missense	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.701C>A	X.37:g.70471418G>T	ENSP00000343909:p.Pro234Gln		D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.P234Q	ENST00000353904.2	37	c.701	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	g	9.672	1.147105	0.21288	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981;ENST00000373978	T;T;T;T;T;T;T	0.54866	1.54;0.96;1.54;1.37;1.38;0.55;0.91	4.3	2.49	0.30216	.	0.252019	0.28828	N	0.014019	T	0.27967	0.0689	N	0.14661	0.345	0.26784	N	0.969537	P;B;B	0.44690	0.841;0.084;0.024	B;B;B	0.37047	0.24;0.038;0.004	T	0.10917	-1.0609	10	0.34782	T	0.22	-2.7423	6.2856	0.21031	0.0907:0.0:0.5886:0.3207	.	234;234;234	Q96E26;Q14202-2;Q14202	.;.;ZMYM3_HUMAN	Q	234	ENSP00000322845:P234Q;ENSP00000363110:P234Q;ENSP00000343909:P234Q;ENSP00000363096:P234Q;ENSP00000363100:P234Q;ENSP00000363094:P234Q;ENSP00000363093:P234Q	ENSP00000322845:P234Q	P	-	2	0	ZMYM3	70388143	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	3.116000	0.50399	0.295000	0.22570	0.425000	0.28330	CCG	ZMYM3	-	NULL	ENSG00000147130		0.587	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1		0.00	45	0	G	NM_201599		70471418	-1			no_errors	ENST00000373988	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.992	T
ZNF254	9534	genome.wustl.edu	37	19	24309076	24309076	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:24309076C>G	ENST00000357002.4	+	4	389	c.274C>G	c.(274-276)Caa>Gaa	p.Q92E	ZNF254_ENST00000342944.6_Missense_Mutation_p.Q7E	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	92					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				TCATTTTGCTCAAGACCTTTG	0.308																																																	0													32.0	33.0	33.0					19																	24309076		2168	4279	6447	SO:0001583	missense	0			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.274C>G	19.37:g.24309076C>G	ENSP00000349494:p.Gln92Glu		A4QPC0|Q86XL7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q92E	ENST00000357002.4	37	c.274	CCDS32983.1	19	.	.	.	.	.	.	.	.	.	.	C	4.553	0.102703	0.08731	.	.	ENSG00000213096	ENST00000342944;ENST00000357002;ENST00000392281	T;T	0.08720	3.06;3.39	1.42	-0.124	0.13523	.	.	.	.	.	T	0.07818	0.0196	L	0.48174	1.505	0.09310	N	1	B	0.21147	0.052	B	0.17979	0.02	T	0.32025	-0.9922	9	0.48119	T	0.1	.	6.8441	0.23979	0.0:0.4613:0.5387:0.0	.	92	O75437	ZN254_HUMAN	E	7;92;92	ENSP00000445527:Q7E;ENSP00000349494:Q92E	ENSP00000445527:Q7E	Q	+	1	0	ZNF254	24100916	.	.	0.003000	0.11579	0.631000	0.37964	.	.	0.536000	0.28733	0.313000	0.20887	CAA	ZNF254	-	NULL	ENSG00000213096		0.308	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF254	HGNC	protein_coding	OTTHUMT00000466453.1	-	0.00	43	0	C	NM_004876		24309076	+1	tier1	-	no_errors	ENST00000357002	ensembl	human	known	74_37	missense	21.43	44	12	SNP	0.000	G
ZNF420	147923	genome.wustl.edu	37	19	37621074	37621074	+	3'UTR	SNP	T	T	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:37621074T>A	ENST00000337995.3	+	0	3396				ZNF585A_ENST00000588723.1_Intron|ZNF420_ENST00000586540.1_3'UTR|CTC-454I21.4_ENST00000587645.1_RNA|ZNF420_ENST00000304239.7_Missense_Mutation_p.F516Y	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			catggggactttgagaatggt	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.*1114T>A	19.37:g.37621074T>A			B2RDY6|Q96ML5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F516Y	ENST00000337995.3	37	c.1547	CCDS12498.1	19	.	.	.	.	.	.	.	.	.	.	T	7.513	0.655127	0.14580	.	.	ENSG00000197050	ENST00000304239	T	0.06933	3.24	3.77	1.66	0.24008	.	.	.	.	.	T	0.02688	0.0081	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.45702	-0.9243	6	0.02654	T	1	.	5.3791	0.16181	0.0:0.2358:0.0:0.7642	.	.	.	.	Y	516	ENSP00000306102:F516Y	ENSP00000306102:F516Y	F	+	2	0	ZNF420	42312914	0.000000	0.05858	0.005000	0.12908	0.007000	0.05969	-0.714000	0.05002	0.299000	0.22661	-0.263000	0.10527	TTT	ZNF420	-	NULL	ENSG00000197050		0.443	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF420	HGNC	protein_coding	OTTHUMT00000109587.3	-	0.00	62	0	T	NM_144689		37621074	+1	tier1	-	no_errors	ENST00000304239	ensembl	human	putative	74_37	missense	20.00	48	12	SNP	0.005	A
ZNF160	90338	genome.wustl.edu	37	19	53571671	53571671	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:53571671G>A	ENST00000429604.1	-	7	2531	c.2116C>T	c.(2116-2118)Cga>Tga	p.R706*	ZNF160_ENST00000601421.1_Nonsense_Mutation_p.R670*|ZNF160_ENST00000599056.1_Nonsense_Mutation_p.R706*|ZNF160_ENST00000418871.1_Nonsense_Mutation_p.R706*	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	706					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		TCATTGCATCGGTAAGGTTTC	0.443																																																	0													159.0	135.0	143.0					19																	53571671		2203	4300	6503	SO:0001587	stop_gained	0			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.2116C>T	19.37:g.53571671G>A	ENSP00000406201:p.Arg706*		Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R706*	ENST00000429604.1	37	c.2116	CCDS12859.1	19	.	.	.	.	.	.	.	.	.	.	G	38	6.701804	0.97772	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	.	.	.	2.47	-1.23	0.09465	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	5.3366	0.15961	0.0:0.1179:0.307:0.5751	.	.	.	.	X	706	.	ENSP00000409597:R706X	R	-	1	2	ZNF160	58263483	0.000000	0.05858	0.000000	0.03702	0.289000	0.27227	-4.369000	0.00245	-0.181000	0.10619	-0.310000	0.09108	CGA	ZNF160	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170949		0.443	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	HGNC	protein_coding	OTTHUMT00000463994.2	-	0.00	80	0	G	NM_033288		53571671	-1	tier1	-	no_errors	ENST00000418871	ensembl	human	known	74_37	nonsense	12.50	63	9	SNP	0.052	A
ZNF423	23090	genome.wustl.edu	37	16	49669911	49669911	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr16:49669911G>A	ENST00000561648.1	-	4	3205	c.3152C>T	c.(3151-3153)gCg>gTg	p.A1051V	ZNF423_ENST00000562520.1_Missense_Mutation_p.A991V|ZNF423_ENST00000567169.1_Missense_Mutation_p.A934V|ZNF423_ENST00000262383.2_Missense_Mutation_p.A1051V|ZNF423_ENST00000535559.1_Missense_Mutation_p.A934V|ZNF423_ENST00000563137.2_Missense_Mutation_p.A991V|ZNF423_ENST00000562871.1_Missense_Mutation_p.A991V	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1051					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGAGGACGCCGCTGAGCTGCC	0.612																																																	0													48.0	46.0	46.0					16																	49669911		2199	4300	6499	SO:0001583	missense	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3152C>T	16.37:g.49669911G>A	ENSP00000455426:p.Ala1051Val		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1051V	ENST00000561648.1	37	c.3152	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	G	9.990	1.230471	0.22542	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09163	3.01;3.05	5.1	5.1	0.69264	.	0.158032	0.56097	D	0.000037	T	0.06554	0.0168	N	0.08118	0	0.58432	D	0.999993	B	0.29766	0.256	B	0.25405	0.06	T	0.44528	-0.9322	9	.	.	.	-11.3181	18.5424	0.91033	0.0:0.0:1.0:0.0	.	1051	Q2M1K9	ZN423_HUMAN	V	1051;934	ENSP00000262383:A1051V;ENSP00000442321:A934V	.	A	-	2	0	ZNF423	48227412	1.000000	0.71417	0.806000	0.32338	0.115000	0.19883	7.494000	0.81503	2.390000	0.81377	0.561000	0.74099	GCG	ZNF423	-	NULL	ENSG00000102935		0.612	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	-	0.00	44	0	G	NM_015069		49669911	-1	tier1	-	no_errors	ENST00000262383	ensembl	human	known	74_37	missense	26.83	30	11	SNP	1.000	A
ZNF534	147658	genome.wustl.edu	37	19	52942558	52942558	+	Silent	SNP	C	C	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:52942558C>T	ENST00000332323.6	+	4	1945	c.1884C>T	c.(1882-1884)ttC>ttT	p.F628F	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000433050.1_Silent_p.F615F	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	628					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						GCAAGGTCTTCAGTCGGAATT	0.408																																																	0													52.0	49.0	50.0					19																	52942558		692	1591	2283	SO:0001819	synonymous_variant	0			AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1884C>T	19.37:g.52942558C>T			Q76KX9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F628	ENST00000332323.6	37	c.1884	CCDS46165.1	19																																																																																			ZNF534	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198633		0.408	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000460877.1	-	0.00	57	0	C	NM_182512		52942558	+1	tier1	-	no_errors	ENST00000332323	ensembl	human	known	74_37	silent	36.07	39	22	SNP	0.009	T
ZNF697	90874	genome.wustl.edu	37	1	120165530	120165530	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr1:120165530G>T	ENST00000421812.2	-	3	1555	c.1436C>A	c.(1435-1437)aCg>aAg	p.T479K		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		CTGCGTGAGCGTGGAGAAGTC	0.647																																																	0													25.0	29.0	27.0					1																	120165530		2203	4300	6503	SO:0001583	missense	0			AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1436C>A	1.37:g.120165530G>T	ENSP00000396857:p.Thr479Lys		Q96IT2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T479K	ENST00000421812.2	37	c.1436	CCDS44202.1	1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.454403	0.26161	.	.	ENSG00000143067	ENST00000421812	T	0.15256	2.44	5.21	4.3	0.51218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37577	N	0.002032	T	0.08088	0.0202	N	0.21583	0.68	0.31167	N	0.7037	D	0.58970	0.984	P	0.58210	0.835	T	0.10847	-1.0612	10	0.18276	T	0.48	-13.7465	7.0404	0.25017	0.088:0.0:0.7414:0.1706	.	479	Q5TEC3	ZN697_HUMAN	K	479	ENSP00000396857:T479K	ENSP00000396857:T479K	T	-	2	0	ZNF697	119967053	0.220000	0.23631	1.000000	0.80357	0.113000	0.19764	0.540000	0.23191	1.354000	0.45846	-0.136000	0.14681	ACG	ZNF697	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000143067		0.647	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF697	HGNC	protein_coding	OTTHUMT00000036349.3		0.00	49	0	G	XM_371286		120165530	-1			no_errors	ENST00000421812	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	T
ZNF99	7652	genome.wustl.edu	37	19	22940554	22940554	+	Silent	SNP	A	A	G	rs12980594		TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:22940554A>G	ENST00000596209.1	-	4	2247	c.2157T>C	c.(2155-2157)acT>acC	p.T719T	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Silent_p.T628T	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	719					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T628T(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGAGTTGAGGACT	0.363																																																	2	Substitution - coding silent(2)	prostate(2)											41.0	43.0	43.0					19																	22940554		2080	4217	6297	SO:0001819	synonymous_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2157T>C	19.37:g.22940554A>G			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T628	ENST00000596209.1	37	c.1884	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.363	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1		0.00	24	0	A	XM_065124		22940554	-1			no_errors	ENST00000397104	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.001	G
ZNF730	100129543	genome.wustl.edu	37	19	23329258	23329258	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6L6-01B-11D-A33E-09	TCGA-R6-A6L6-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a11a03e7-daed-4928-91bd-6e39606e95be	d6ddfca3-2910-436f-be68-5307de6276a1	g.chr19:23329258A>C	ENST00000597761.2	+	4	1611	c.1412A>C	c.(1411-1413)aAg>aCg	p.K471T		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	471					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						ACTACACATAAGATAATTCAT	0.373																																																	0																																										SO:0001583	missense	0			AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.1412A>C	19.37:g.23329258A>C	ENSP00000472959:p.Lys471Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K471T	ENST00000597761.2	37	c.1412	CCDS59371.1	19	.	.	.	.	.	.	.	.	.	.	A	11.31	1.600289	0.28534	.	.	ENSG00000183850	ENST00000327867	.	.	.	0.828	0.828	0.18841	.	.	.	.	.	T	0.40015	0.1100	.	.	.	0.20873	N	0.999832	.	.	.	.	.	.	T	0.36648	-0.9739	5	0.72032	D	0.01	.	6.7165	0.23306	1.0:0.0:0.0:0.0	.	.	.	.	T	471	.	ENSP00000329365:K471T	K	+	2	0	ZNF730	23121098	0.000000	0.05858	0.060000	0.19600	0.060000	0.15804	-0.476000	0.06591	0.249000	0.21456	0.246000	0.17985	AAG	ZNF730	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000183850		0.373	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF730	HGNC	protein_coding	OTTHUMT00000465737.2	-	0.00	34	0	A	XM_001719792		23329258	+1	tier1	-	no_errors	ENST00000597761	ensembl	human	known	74_37	missense	14.00	43	7	SNP	0.981	C
