#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCB5	340273	genome.wustl.edu	37	7	20685713	20685713	+	Silent	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:20685713C>A	ENST00000404938.2	+	9	1585	c.933C>A	c.(931-933)tcC>tcA	p.S311S	ABCB5_ENST00000258738.6_5'Flank|ABCB5_ENST00000443026.2_5'Flank|ABCB5_ENST00000406935.1_5'Flank	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	311	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATGGAACCTCCTTGATTCTTA	0.403																																																	0													131.0	115.0	119.0					7																	20685713		1568	3582	5150	SO:0001819	synonymous_variant	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.933C>A	7.37:g.20685713C>A			A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.S311	ENST00000404938.2	37	c.933	CCDS55090.1	7																																																																																			ABCB5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000004846		0.403	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	-	0.00	43	0	C	NM_178559		20685713	+1	tier1	-	no_errors	ENST00000404938	ensembl	human	putative	74_37	silent	26.32	14	5	SNP	0.986	A
ACE	1636	genome.wustl.edu	37	17	61564014	61564014	+	Silent	SNP	C	C	A	rs200649158	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:61564014C>A	ENST00000290866.4	+	14	2179	c.2155C>A	c.(2155-2157)Cgg>Agg	p.R719R	ACE_ENST00000290863.6_Silent_p.R145R|ACE_ENST00000490216.2_Silent_p.R145R|ACE_ENST00000421982.2_Silent_p.R29R|ACE_ENST00000428043.1_Silent_p.R719R|ACE_ENST00000577647.1_Silent_p.R145R|ACE_ENST00000413513.3_Silent_p.R145R	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	719	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CACTATCAAGCGGATCATAAA	0.547																																																	0													103.0	87.0	92.0					17																	61564014		2203	4300	6503	SO:0001819	synonymous_variant	0			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.2155C>A	17.37:g.61564014C>A			B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Silent	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.R719	ENST00000290866.4	37	c.2155	CCDS11637.1	17																																																																																			ACE	-	pfam_Peptidase_M2	ENSG00000159640		0.547	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE	HGNC	protein_coding	OTTHUMT00000337675.2		0.00	75	0	C			61564014	+1			no_errors	ENST00000290866	ensembl	human	known	74_37	silent	5.13	74	4	SNP	1.000	A
ACTN2	88	genome.wustl.edu	37	1	236918342	236918342	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:236918342G>T	ENST00000366578.4	+	17	2164	c.1998G>T	c.(1996-1998)caG>caT	p.Q666H	ACTN2_ENST00000546208.1_Missense_Mutation_p.Q160H|ACTN2_ENST00000542672.1_Missense_Mutation_p.Q666H	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	666					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GCTCCATCCAGATCACAGGAG	0.557																																																	0													117.0	115.0	116.0					1																	236918342		2203	4300	6503	SO:0001583	missense	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1998G>T	1.37:g.236918342G>T	ENSP00000355537:p.Gln666His		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q666H	ENST00000366578.4	37	c.1998	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828328	0.32329	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.49432	0.78;0.78;0.78	4.62	3.71	0.42584	.	0.731928	0.13715	N	0.367826	T	0.33030	0.0849	N	0.08118	0	0.34028	D	0.653523	B;B;B;B	0.33528	0.416;0.0;0.391;0.245	B;B;B;B	0.43701	0.215;0.006;0.428;0.112	T	0.45862	-0.9232	10	0.52906	T	0.07	.	5.1172	0.14840	0.1915:0.3174:0.491:0.0	.	451;666;436;666	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	H	666;666;160;435	ENSP00000443495:Q666H;ENSP00000355537:Q666H;ENSP00000438384:Q160H	ENSP00000355537:Q666H	Q	+	3	2	ACTN2	234984965	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.993000	0.29680	0.928000	0.37168	0.557000	0.71058	CAG	ACTN2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000077522		0.557	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	-	0.00	51	0	G	NM_001103		236918342	+1	tier1	-	no_errors	ENST00000366578	ensembl	human	known	74_37	missense	26.32	14	5	SNP	1.000	T
ACVR1	90	genome.wustl.edu	37	2	158637047	158637047	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:158637047C>A	ENST00000263640.3	-	4	562	c.133G>T	c.(133-135)Gag>Tag	p.E45*	ACVR1_ENST00000409283.2_Nonsense_Mutation_p.E45*|ACVR1_ENST00000434821.1_Nonsense_Mutation_p.E45*|ACVR1_ENST00000410057.2_Nonsense_Mutation_p.E45*|ACVR1_ENST00000487456.1_5'UTR	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	45					activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	CAGTGGTCCTCATTACCGCAG	0.488																																																	0													94.0	94.0	94.0					2																	158637047		2203	4300	6503	SO:0001587	stop_gained	0				CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.133G>T	2.37:g.158637047C>A	ENSP00000263640:p.Glu45*			Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.E45*	ENST00000263640.3	37	c.133	CCDS2206.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.757730	0.96898	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057;ENST00000412025;ENST00000440523;ENST00000539637;ENST00000424669	.	.	.	5.09	4.19	0.49359	.	0.356811	0.32002	N	0.006738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	16.3354	0.83059	0.0:0.8334:0.1666:0.0	.	.	.	.	X	45	.	ENSP00000263640:E45X	E	-	1	0	ACVR1	158345293	0.942000	0.31987	0.959000	0.39883	0.981000	0.71138	3.191000	0.50981	2.364000	0.80123	0.655000	0.94253	GAG	ACVR1	-	pfam_Activin_rcpt	ENSG00000115170		0.488	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1	HGNC	protein_coding	OTTHUMT00000254927.1	-	0.00	33	0	C	NM_001105		158637047	-1	tier1	-	no_errors	ENST00000263640	ensembl	human	known	74_37	nonsense	18.75	13	3	SNP	0.987	A
ADAMTS20	80070	genome.wustl.edu	37	12	43777766	43777766	+	Nonsense_Mutation	SNP	A	A	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:43777766A>T	ENST00000389420.3	-	30	4466	c.4467T>A	c.(4465-4467)tgT>tgA	p.C1489*		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1489	TSP type-1 12. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C1489C(2)|p.S1489S(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTCCAGAGCCACAGGTCACAG	0.413																																																	3	Substitution - coding silent(3)	prostate(3)											69.0	59.0	62.0					12																	43777766		2203	4300	6503	SO:0001587	stop_gained	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4467T>A	12.37:g.43777766A>T	ENSP00000374071:p.Cys1489*		A6NNC9|J3QT00	Nonsense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.C1489*	ENST00000389420.3	37	c.4467	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	A	42	9.257192	0.99117	.	.	ENSG00000173157	ENST00000389420	.	.	.	4.25	-0.865	0.10662	.	0.115603	0.38663	N	0.001605	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3226	0.49430	0.7348:0.0:0.2652:0.0	.	.	.	.	X	1489	.	ENSP00000374071:C1489X	C	-	3	2	ADAMTS20	42064033	1.000000	0.71417	0.986000	0.45419	0.947000	0.59692	0.895000	0.28363	-0.433000	0.07286	-1.139000	0.01908	TGT	ADAMTS20	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000173157		0.413	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1		0.00	38	0	A	NM_025003		43777766	-1			no_errors	ENST00000389420	ensembl	human	known	74_37	nonsense	12.50	14	2	SNP	0.999	T
ADAMTS4	9507	genome.wustl.edu	37	1	161166327	161166327	+	Intron	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:161166327G>A	ENST00000367996.5	-	2	1386				ADAMTS4_ENST00000367995.3_Missense_Mutation_p.P326L|ADAMTS4_ENST00000478394.1_5'Flank|NDUFS2_ENST00000367993.3_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4						defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	catggcctgcGGTGCTGACTG	0.567																																																	0													90.0	95.0	93.0					1																	161166327		2203	4300	6503	SO:0001627	intron_variant	0			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.957+19C>T	1.37:g.161166327G>A			Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	pfam_Peptidase_M12B_N	p.P326L	ENST00000367996.5	37	c.977	CCDS1223.1	1	.	.	.	.	.	.	.	.	.	.	G	8.765	0.924544	0.18056	.	.	ENSG00000158859	ENST00000367995	T	0.63913	-0.07	5.21	2.01	0.26516	.	.	.	.	.	T	0.25121	0.0610	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.26643	-1.0097	8	0.72032	D	0.01	.	2.9755	0.05936	0.0945:0.1593:0.5155:0.2307	.	326	Q5VTW1	.	L	326	ENSP00000356974:P326L	ENSP00000356974:P326L	P	-	2	0	ADAMTS4	159432951	0.445000	0.25657	0.001000	0.08648	0.035000	0.12851	0.476000	0.22180	0.213000	0.20722	-0.258000	0.10820	CCG	ADAMTS4	-	NULL	ENSG00000158859		0.567	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS4	HGNC	protein_coding	OTTHUMT00000083066.2	-	0.00	46	0	G	NM_005099		161166327	-1	tier1	-	no_errors	ENST00000367995	ensembl	human	known	74_37	missense	36.21	37	21	SNP	0.000	A
ADAMTS8	11095	genome.wustl.edu	37	11	130275784	130275784	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:130275784C>T	ENST00000257359.6	-	9	3045	c.2339G>A	c.(2338-2340)cGg>cAg	p.R780Q		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	780	Spacer.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		TGGCAAGGGCCGGAAGCTCTG	0.577																																																	0													100.0	106.0	104.0					11																	130275784		1998	4157	6155	SO:0001583	missense	0			AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.2339G>A	11.37:g.130275784C>T	ENSP00000257359:p.Arg780Gln		Q9NZS0	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS8,prints_Peptidase_M12B_ADAM-TS	p.R780Q	ENST00000257359.6	37	c.2339	CCDS41732.1	11	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111416	0.37242	.	.	ENSG00000134917	ENST00000531752;ENST00000257359;ENST00000414575	T	0.49432	0.78	5.34	2.44	0.29823	ADAM-TS Spacer 1 (1);	0.359497	0.30547	N	0.009396	T	0.31513	0.0799	L	0.31526	0.94	0.22017	N	0.999413	B;B	0.27316	0.175;0.034	B;B	0.19391	0.015;0.025	T	0.18272	-1.0342	10	0.54805	T	0.06	.	7.9623	0.30079	0.0:0.601:0.0:0.399	.	780;261	Q9UP79;B3KVX9	ATS8_HUMAN;.	Q	178;780;809	ENSP00000257359:R780Q	ENSP00000257359:R780Q	R	-	2	0	ADAMTS8	129780994	0.000000	0.05858	0.999000	0.59377	0.984000	0.73092	-0.153000	0.10144	0.235000	0.21160	0.460000	0.39030	CGG	ADAMTS8	-	pfam_ADAM_spacer1	ENSG00000134917		0.577	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS8	HGNC	protein_coding	OTTHUMT00000385636.1	-	0.00	32	0	C	NM_007037		130275784	-1	tier1	-	no_errors	ENST00000257359	ensembl	human	known	74_37	missense	25.00	21	7	SNP	0.530	T
ADCY8	114	genome.wustl.edu	37	8	131861901	131861901	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:131861901C>T	ENST00000286355.5	-	10	4451	c.2359G>A	c.(2359-2361)Gtc>Atc	p.V787I	ADCY8_ENST00000377928.3_Intron	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	787					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AAGATGATGACGTTCCGGGCC	0.463										HNSCC(32;0.087)																																							0													132.0	123.0	126.0					8																	131861901		2203	4300	6503	SO:0001583	missense	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2359G>A	8.37:g.131861901C>T	ENSP00000286355:p.Val787Ile			Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.V787I	ENST00000286355.5	37	c.2359	CCDS6363.1	8	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892554	0.33442	.	.	ENSG00000155897	ENST00000286355	T	0.45668	0.89	5.25	3.44	0.39384	.	0.412422	0.25714	N	0.028786	T	0.24122	0.0584	N	0.25647	0.755	0.80722	D	1	B	0.31077	0.307	B	0.20384	0.029	T	0.04078	-1.0979	10	0.13470	T	0.59	.	10.3251	0.43787	0.0:0.8408:0.0:0.1592	.	787	P40145	ADCY8_HUMAN	I	787	ENSP00000286355:V787I	ENSP00000286355:V787I	V	-	1	0	ADCY8	131931083	1.000000	0.71417	0.949000	0.38748	0.999000	0.98932	4.588000	0.60999	0.585000	0.29608	0.655000	0.94253	GTC	ADCY8	-	NULL	ENSG00000155897		0.463	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	-	0.00	34	0	C			131861901	-1	tier1	-	no_errors	ENST00000286355	ensembl	human	known	74_37	missense	42.86	8	6	SNP	0.999	T
ADGB	79747	genome.wustl.edu	37	6	147013986	147013986	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:147013986G>T	ENST00000397944.3	+	12	1588	c.1512G>T	c.(1510-1512)cgG>cgT	p.R504R	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	504					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AGCCTGAACGGTTCCTTGAGA	0.294																																																	0													105.0	96.0	99.0					6																	147013986		692	1586	2278	SO:0001819	synonymous_variant	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.1512G>T	6.37:g.147013986G>T			Q5T402|Q5T904|Q5T905	Silent	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.R504	ENST00000397944.3	37	c.1512		6																																																																																			ADGB	-	smart_Peptidase_C2_calpain_cat	ENSG00000118492		0.294	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	-	0.00	40	0	G	NM_024694		147013986	+1	tier1	-	no_errors	ENST00000397944	ensembl	human	known	74_37	silent	14.81	23	4	SNP	0.948	T
AFAP1L1	134265	genome.wustl.edu	37	5	148687091	148687091	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:148687091G>T	ENST00000296721.4	+	7	760	c.662G>T	c.(661-663)tGc>tTc	p.C221F	AFAP1L1_ENST00000515000.1_Missense_Mutation_p.C221F|AFAP1L1_ENST00000522492.1_3'UTR	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	221	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGAGGGAATGCAGGATATGT	0.607																																																	0													78.0	65.0	70.0					5																	148687091		2203	4300	6503	SO:0001583	missense	0			AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.662G>T	5.37:g.148687091G>T	ENSP00000296721:p.Cys221Phe		Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.C221F	ENST00000296721.4	37	c.662	CCDS34274.1	5	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218671	0.79464	.	.	ENSG00000157510	ENST00000296721;ENST00000515000	T;T	0.11063	2.81;2.81	4.89	4.89	0.63831	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.043965	0.85682	D	0.000000	T	0.33411	0.0862	M	0.65975	2.015	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.83275	0.989;0.948;0.996	T	0.04840	-1.0923	10	0.87932	D	0	-28.3548	18.243	0.89974	0.0:0.0:1.0:0.0	.	221;221;221	Q8TED9-2;Q8TED9;Q8TED9-3	.;AF1L1_HUMAN;.	F	221	ENSP00000296721:C221F;ENSP00000424427:C221F	ENSP00000296721:C221F	C	+	2	0	AFAP1L1	148667284	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.447000	0.73465	2.543000	0.85770	0.561000	0.74099	TGC	AFAP1L1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000157510		0.607	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFAP1L1	HGNC	protein_coding	OTTHUMT00000373443.1		0.00	73	0	G	NM_152406		148687091	+1			no_errors	ENST00000296721	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
AGBL3	340351	genome.wustl.edu	37	7	134743943	134743943	+	Frame_Shift_Del	DEL	A	A	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:134743943delA	ENST00000436302.2	+	12	2118	c.1865delA	c.(1864-1866)gaafs	p.E622fs	AGBL3_ENST00000435976.2_Frame_Shift_Del_p.E622fs|AGBL3_ENST00000458078.1_Frame_Shift_Del_p.E596fs	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	622						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						GACAGTTCAGAATCCATTGAC	0.338																																																	0													262.0	210.0	225.0					7																	134743943		692	1591	2283	SO:0001589	frameshift_variant	0			BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.1865delA	7.37:g.134743943delA	ENSP00000388275:p.Glu622fs		B7Z827|Q9H965	Frame_Shift_Del	DEL	pfam_Peptidase_M14	p.E596fs	ENST00000436302.2	37	c.1787	CCDS47718.1	7																																																																																			AGBL3	-	NULL	ENSG00000146856		0.338	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL3	HGNC	protein_coding	OTTHUMT00000376655.1		0.00	22	0	A	NM_178563		134743943	+1	tier1		no_errors	ENST00000458078	ensembl	human	known	74_37	frame_shift_del	40.00	3	2	DEL	1.000	-
AHNAK2	113146	genome.wustl.edu	37	14	105416271	105416272	+	Missense_Mutation	DNP	GC	GC	AG	rs527306736|rs386781101|rs2582509	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:105416271_105416272GC>AG	ENST00000333244.5	-	7	5635_5636	c.5516_5517GC>CT	c.(5515-5517)gGC>gCT	p.G1839A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1839						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGATGGACTTGCCTGGGGCAGA	0.609																																																	0																																										SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5516_5517delinsAG	14.37:g.105416271_105416272delinsAG	ENSP00000353114:p.Gly1839Ala		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent|Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G1839|p.G1839A	ENST00000333244.5	37	c.5517|c.5516	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.609	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	242|244	0	G|C	NM_138420		105416271|105416272	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	silent|missense	37.84|37.67	92|91	56|55	SNP	0.679|0.417	A|G
ALLC	55821	genome.wustl.edu	37	2	3744990	3744990	+	Missense_Mutation	SNP	G	G	C	rs35124934	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:3744990G>C	ENST00000252505.3	+	10	956	c.794G>C	c.(793-795)cGa>cCa	p.R265P	ALLC_ENST00000471711.1_3'UTR	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	284					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		GCAGTTTTCCGATTGGCACAT	0.373										HNSCC(21;0.051)																																							0													156.0	152.0	153.0					2																	3744990		1858	4097	5955	SO:0001583	missense	0			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.794G>C	2.37:g.3744990G>C	ENSP00000252505:p.Arg265Pro		Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	pfam_Allantoicase_dom,superfamily_Galactose-bd-like,tigrfam_Allantoicase	p.R265P	ENST00000252505.3	37	c.794	CCDS46223.1	2	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947365	0.53186	.	.	ENSG00000151360	ENST00000252505	.	.	.	5.47	4.58	0.56647	Allantoicase domain (1);Galactose-binding domain-like (1);	0.124148	0.49916	D	0.000127	T	0.81997	0.4941	H	0.95539	3.685	0.40270	D	0.97827	D	0.69078	0.997	D	0.67725	0.953	D	0.85594	0.1248	9	0.72032	D	0.01	-12.8632	8.8278	0.35065	0.1715:0.0:0.8285:0.0	.	284	Q8N6M5	ALLC_HUMAN	P	265	.	ENSP00000252505:R265P	R	+	2	0	ALLC	3722865	1.000000	0.71417	0.951000	0.38953	0.612000	0.37316	4.488000	0.60300	2.561000	0.86390	0.563000	0.77884	CGA	ALLC	-	pfam_Allantoicase_dom,superfamily_Galactose-bd-like,tigrfam_Allantoicase	ENSG00000151360		0.373	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALLC	HGNC	protein_coding	OTTHUMT00000322855.1	-	0.00	61	0	G			3744990	+1	tier1	-	no_errors	ENST00000252505	ensembl	human	known	74_37	missense	56.14	25	32	SNP	0.920	C
AMPH	273	genome.wustl.edu	37	7	38431352	38431352	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:38431352G>T	ENST00000356264.2	-	19	2090	c.1875C>A	c.(1873-1875)taC>taA	p.Y625*	AMPH_ENST00000428293.2_Nonsense_Mutation_p.Y583*|AMPH_ENST00000325590.5_Nonsense_Mutation_p.Y583*|AMPH_ENST00000471913.1_5'Flank	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	625	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						AGAATACCTTGTAGAGAAAGC	0.458																																																	0													39.0	43.0	42.0					7																	38431352		2203	4299	6502	SO:0001587	stop_gained	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1875C>A	7.37:g.38431352G>T	ENSP00000348602:p.Tyr625*		A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Nonsense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_Amphiphysin,prints_Amphiphysin_1,prints_SH3_domain	p.Y625*	ENST00000356264.2	37	c.1875	CCDS5456.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.689594|7.689594	0.98434|0.98434	.|.	.|.	ENSG00000078053|ENSG00000078053	ENST00000441628|ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242	.|.	.|.	.|.	5.63|5.63	2.37|2.37	0.29283|0.29283	.|.	.|0.166757	.|0.44483	.|D	.|0.000456	T|.	0.15696|.	0.0378|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32955|.	-0.9887|.	3|.	.|0.02654	.|T	.|1	-14.7173|-14.7173	6.3413|6.3413	0.21324|0.21324	0.5237:0.0:0.4763:0.0|0.5237:0.0:0.4763:0.0	.|.	.|.	.|.	.|.	K|X	508|583;625;583;527	.|.	.|ENSP00000317441:Y583X	Q|Y	-|-	1|3	0|2	AMPH|AMPH	38397877|38397877	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	1.929000|1.929000	0.40114|0.40114	0.640000|0.640000	0.30582|0.30582	0.655000|0.655000	0.94253|0.94253	CAA|TAC	AMPH	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_Amphiphysin,prints_SH3_domain	ENSG00000078053		0.458	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2		0.00	95	0	G	NM_001635		38431352	-1			no_errors	ENST00000356264	ensembl	human	known	74_37	nonsense	5.36	53	3	SNP	1.000	T
ANK1	286	genome.wustl.edu	37	8	41574498	41574498	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:41574498G>T	ENST00000347528.4	-	13	1460	c.1377C>A	c.(1375-1377)aaC>aaA	p.N459K	ANK1_ENST00000396945.1_Missense_Mutation_p.N459K|ANK1_ENST00000396942.1_Missense_Mutation_p.N459K|ANK1_ENST00000265709.8_Missense_Mutation_p.N492K|ANK1_ENST00000289734.7_Missense_Mutation_p.N459K|ANK1_ENST00000352337.4_Missense_Mutation_p.N459K|ANK1_ENST00000379758.2_Missense_Mutation_p.N459K	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	459	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTTTGGCTTTGTTCTGGAGTA	0.483																																																	0													279.0	247.0	258.0					8																	41574498		2203	4300	6503	SO:0001583	missense	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1377C>A	8.37:g.41574498G>T	ENSP00000339620:p.Asn459Lys		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.N459K	ENST00000347528.4	37	c.1377	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739463	0.69304	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05	5.31	3.52	0.40303	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.63873	0.2548	N	0.21583	0.68	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.997;0.99;0.971;0.998	T	0.63453	-0.6634	10	0.54805	T	0.06	.	8.8449	0.35164	0.2309:0.0:0.7691:0.0	.	492;459;459;459;459	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	K	459;459;459;459;459;459;492;459	ENSP00000339620:N459K;ENSP00000289734:N459K;ENSP00000369082:N459K;ENSP00000380149:N459K;ENSP00000380147:N459K;ENSP00000309131:N459K;ENSP00000265709:N492K	ENSP00000265709:N492K	N	-	3	2	ANK1	41693655	0.992000	0.36948	1.000000	0.80357	0.984000	0.73092	0.329000	0.19698	0.739000	0.32628	-0.350000	0.07774	AAC	ANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.483	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1		0.00	80	0	G	NM_020475		41574498	-1			no_errors	ENST00000396942	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
ANKRD13D	338692	genome.wustl.edu	37	11	67067035	67067035	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:67067035G>A	ENST00000447274.2	+	8	1747	c.572G>A	c.(571-573)cGc>cAc	p.R191H	ANKRD13D_ENST00000515828.1_5'Flank|ANKRD13D_ENST00000511455.2_Missense_Mutation_p.R278H|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.R191H|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.R191H			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	191						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CTGGTGACACGCACACGCACG	0.647																																																	0													56.0	43.0	47.0					11																	67067035		2029	3854	5883	SO:0001583	missense	0			AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.572G>A	11.37:g.67067035G>A	ENSP00000402616:p.Arg191His		D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.R278H	ENST00000447274.2	37	c.833		11	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382305	0.82792	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.04	4.1	0.47936	.	0.072834	0.53938	D	0.000047	T	0.68265	0.2982	M	0.89414	3.03	0.51767	D	0.999931	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.953	T	0.71189	-0.4666	10	0.66056	D	0.02	-16.8134	7.21	0.25929	0.1194:0.1684:0.7122:0.0	.	278;191	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	H	191;278;191;191	ENSP00000402616:R191H;ENSP00000427130:R278H;ENSP00000310874:R191H;ENSP00000444404:R191H	ENSP00000310874:R191H	R	+	2	0	ANKRD13D	66823611	0.987000	0.35691	1.000000	0.80357	0.989000	0.77384	3.691000	0.54720	1.304000	0.44892	0.491000	0.48974	CGC	ANKRD13D	-	pfam_ANKRD13	ENSG00000172932		0.647	ANKRD13D-001	KNOWN	basic	protein_coding	ANKRD13D	HGNC	protein_coding	OTTHUMT00000371067.2		0.00	39	0	G	NM_207354		67067035	+1			no_errors	ENST00000511455	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	A
ANKRD30BL	554226	genome.wustl.edu	37	2	132912337	132912337	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:132912337C>T	ENST00000409867.1	-	4	761	c.512G>A	c.(511-513)gGc>gAc	p.G171D	ANKRD30BL_ENST00000470729.1_5'UTR|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	171										endometrium(1)|kidney(3)	4						TGGTGTGTGGCCAGCCTGTAA	0.308																																																	0																																										SO:0001583	missense	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.512G>A	2.37:g.132912337C>T	ENSP00000386398:p.Gly171Asp		B8ZZL7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G171D	ENST00000409867.1	37	c.512		2	.	.	.	.	.	.	.	.	.	.	.	6.263	0.416726	0.11870	.	.	ENSG00000163046	ENST00000409867	T	0.73575	-0.76	0.569	-1.02	0.10135	.	.	.	.	.	T	0.64238	0.2580	.	.	.	0.28526	N	0.912823	.	.	.	.	.	.	T	0.56577	-0.7956	5	0.37606	T	0.19	.	.	.	.	.	.	.	.	D	171	ENSP00000386398:G171D	ENSP00000295181:G171D	G	-	2	0	ANKRD30BL	132628807	0.016000	0.18221	0.320000	0.25306	0.531000	0.34715	-0.061000	0.11693	-0.398000	0.07679	0.184000	0.17185	GGC	ANKRD30BL	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000163046		0.308	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331353.2	-	0.00	102	0	C	NR_027019		132912337	-1	tier1	-	no_errors	ENST00000295181	ensembl	human	known	74_37	missense	51.72	27	30	SNP	0.542	T
ANKS1B	56899	genome.wustl.edu	37	12	99837501	99837501	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:99837501G>T	ENST00000547776.2	-	11	1524	c.1525C>A	c.(1525-1527)Cca>Aca	p.P509T	ANKS1B_ENST00000329257.7_Missense_Mutation_p.P509T|ANKS1B_ENST00000547010.1_Missense_Mutation_p.P89T	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	509						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TCAGGGGATGGAGGTGAACAA	0.418																																																	0													188.0	184.0	185.0					12																	99837501		1906	4120	6026	SO:0001583	missense	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1525C>A	12.37:g.99837501G>T	ENSP00000449629:p.Pro509Thr		A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.P509T	ENST00000547776.2	37	c.1525	CCDS55872.1	12	.	.	.	.	.	.	.	.	.	.	G	26.2	4.714961	0.89112	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000549866	T;T;T;T	0.61040	0.96;0.14;0.96;0.69	6.04	6.04	0.98038	.	0.064498	0.64402	D	0.000008	T	0.69726	0.3143	L	0.40543	1.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.994	T	0.64655	-0.6356	9	.	.	.	-9.4069	18.7754	0.91910	0.0:0.0:1.0:0.0	.	475;89;509	F8VVQ4;Q7Z6G8-6;Q7Z6G8	.;.;ANS1B_HUMAN	T	509;89;509;88;475	ENSP00000449629:P509T;ENSP00000448512:P89T;ENSP00000331381:P509T;ENSP00000449894:P475T	.	P	-	1	0	ANKS1B	98361632	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.328000	0.90014	2.873000	0.98535	0.563000	0.77884	CCA	ANKS1B	-	NULL	ENSG00000185046		0.418	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	-	0.00	28	0	G	NM_020140		99837501	-1	tier1	-	no_errors	ENST00000329257	ensembl	human	known	74_37	missense	28.57	10	4	SNP	1.000	T
ANXA5	308	genome.wustl.edu	37	4	122593777	122593777	+	Frame_Shift_Del	DEL	A	A	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:122593777delA	ENST00000296511.5	-	9	821	c.536delT	c.(535-537)ttafs	p.L179fs	ANXA5_ENST00000515017.1_Frame_Shift_Del_p.L79fs|ANXA5_ENST00000501272.2_Frame_Shift_Del_p.L119fs	NM_001154.3	NP_001145.1	P08758	ANXA5_HUMAN	annexin A5	179					blood coagulation (GO:0007596)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of coagulation (GO:0050819)|response to organic substance (GO:0010033)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipase inhibitor activity (GO:0004859)|phospholipid binding (GO:0005543)			NS(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)	15						AGCCTGAAATAAAGCCTGCAA	0.358																																					Pancreas(191;1279 2147 16046 17806 52646)|GBM(88;628 1285 16585 32846 50188)												0													63.0	62.0	62.0					4																	122593777		2203	4300	6503	SO:0001589	frameshift_variant	0			U05770	CCDS3720.1	4q27	2008-02-05			ENSG00000164111	ENSG00000164111		"""Annexins"""	543	protein-coding gene	gene with protein product		131230		ENX2, ANX5		2960376	Standard	NM_001154		Approved		uc003idv.4	P08758	OTTHUMG00000133034	ENST00000296511.5:c.536delT	4.37:g.122593777delA	ENSP00000296511:p.Leu179fs		D3DNW7|Q6FHB3|Q6FI16|Q8WV69|Q9UDH9	Frame_Shift_Del	DEL	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinV,prints_AnnexinIV	p.L179fs	ENST00000296511.5	37	c.536	CCDS3720.1	4																																																																																			ANXA5	-	pfam_Annexin_repeat,prints_Annexin	ENSG00000164111		0.358	ANXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA5	HGNC	protein_coding	OTTHUMT00000256636.2		0.00	36	0	A	NM_001154		122593777	-1	tier1		no_errors	ENST00000296511	ensembl	human	known	74_37	frame_shift_del	14.29	12	2	DEL	0.995	-
AP4M1	9179	genome.wustl.edu	37	7	99702906	99702906	+	Missense_Mutation	SNP	C	C	A	rs545459309		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:99702906C>A	ENST00000359593.4	+	10	929	c.771C>A	c.(769-771)agC>agA	p.S257R	AP4M1_ENST00000429084.1_Missense_Mutation_p.S264R|AP4M1_ENST00000421755.1_Missense_Mutation_p.S257R|AP4M1_ENST00000422582.1_Missense_Mutation_p.S129R	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	257	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGTTTCACAGCTCTGTGAATC	0.532																																					Pancreas(174;1182 2812 29595 49511)												0													110.0	117.0	115.0					7																	99702906		2203	4300	6503	SO:0001583	missense	0			Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.771C>A	7.37:g.99702906C>A	ENSP00000352603:p.Ser257Arg		D6W5U1|Q8WV65|Q9UHK9	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,prints_Clathrin_mu,pfscan_Clathrin_mu_C	p.S257R	ENST00000359593.4	37	c.771	CCDS5685.1	7	.	.	.	.	.	.	.	.	.	.	C	5.106	0.205148	0.09704	.	.	ENSG00000221838	ENST00000438383;ENST00000429084;ENST00000359593;ENST00000439416;ENST00000421755;ENST00000422582;ENST00000450807	T;T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13;2.13	5.1	-0.162	0.13367	Clathrin adaptor, mu subunit, C-terminal (3);	0.245603	0.44902	D	0.000416	T	0.08980	0.0222	N	0.14661	0.345	0.31832	N	0.624613	B;P;P;P	0.42375	0.349;0.778;0.577;0.577	B;B;B;B	0.36845	0.081;0.176;0.234;0.156	T	0.18745	-1.0327	10	0.62326	D	0.03	-28.0504	5.0127	0.14321	0.0:0.4012:0.1501:0.4487	.	213;209;264;257	C9JMG3;B4DKN7;C9JC87;O00189	.;.;.;AP4M1_HUMAN	R	189;264;257;213;257;129;9	ENSP00000401613:S189R;ENSP00000403663:S264R;ENSP00000352603:S257R;ENSP00000414286:S213R;ENSP00000412185:S257R;ENSP00000406676:S129R;ENSP00000391585:S9R	ENSP00000352603:S257R	S	+	3	2	AP4M1	99540842	1.000000	0.71417	0.980000	0.43619	0.150000	0.21749	0.814000	0.27239	0.057000	0.16193	-0.150000	0.13652	AGC	AP4M1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Clathrin_mu,prints_Clathrin_mu,pfscan_Clathrin_mu_C	ENSG00000221838		0.532	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP4M1	HGNC	protein_coding	OTTHUMT00000336772.4	-	0.00	53	0	C	NM_004722		99702906	+1	tier1	-	no_errors	ENST00000359593	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.970	A
ARHGAP11A	9824	genome.wustl.edu	37	15	32920994	32920994	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:32920994G>T	ENST00000361627.3	+	7	1650	c.928G>T	c.(928-930)Gaa>Taa	p.E310*	ARHGAP11A_ENST00000543522.1_Nonsense_Mutation_p.E121*|ARHGAP11A_ENST00000565905.1_Nonsense_Mutation_p.E121*|ARHGAP11A_ENST00000567348.1_Nonsense_Mutation_p.E310*|ARHGAP11A_ENST00000563864.1_Nonsense_Mutation_p.E310*	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	310					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		ACCTCAAGAAGAAAGAATTGG	0.249																																					Colon(45;757 1134 30003 36652)												0													40.0	43.0	42.0					15																	32920994		2198	4281	6479	SO:0001587	stop_gained	0			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.928G>T	15.37:g.32920994G>T	ENSP00000355090:p.Glu310*		B4DZN9|Q6PI96|Q9Y3S6	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E310*	ENST00000361627.3	37	c.928	CCDS10028.1	15	.	.	.	.	.	.	.	.	.	.	.	43	10.314707	0.99381	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	.	.	.	4.99	4.99	0.66335	.	0.331370	0.26103	N	0.026335	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	18.8299	0.92133	0.0:0.0:1.0:0.0	.	.	.	.	X	310;121	.	ENSP00000355090:E310X	E	+	1	0	ARHGAP11A	30708286	1.000000	0.71417	0.503000	0.27626	0.427000	0.31564	8.421000	0.90259	2.753000	0.94483	0.467000	0.42956	GAA	ARHGAP11A	-	NULL	ENSG00000198826		0.249	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP11A	HGNC	protein_coding	OTTHUMT00000251417.1	-	0.00	78	0	G	NM_014783		32920994	+1	tier1	-	no_errors	ENST00000361627	ensembl	human	known	74_37	nonsense	6.56	56	4	SNP	0.995	T
ARHGAP25	9938	genome.wustl.edu	37	2	68962277	68962277	+	5'UTR	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:68962277G>A	ENST00000295381.3	+	0	365				ARHGAP25_ENST00000456116.2_3'UTR|ARHGAP25_ENST00000467265.1_5'UTR|ARHGAP25_ENST00000544262.1_Intron|ARHGAP25_ENST00000409202.3_5'UTR	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						CAAGAAGGGCGCAAACTGTGA	0.428																																																	0													194.0	172.0	179.0					2																	68962277		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.-55G>A	2.37:g.68962277G>A			A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	RNA	SNP	-	NULL	ENST00000295381.3	37	NULL		2																																																																																			ARHGAP25	-	-	ENSG00000163219		0.428	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP25	HGNC	protein_coding		-	0.00	61	0	G	NM_014882		68962277	+1	tier1	-	no_errors	ENST00000456116	ensembl	human	known	74_37	rna	42.86	20	15	SNP	0.000	A
ARID4B	51742	genome.wustl.edu	37	1	235383152	235383152	+	Silent	SNP	G	G	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:235383152G>C	ENST00000264183.3	-	16	2036	c.1539C>G	c.(1537-1539)tcC>tcG	p.S513S	ARID4B_ENST00000366603.2_Silent_p.S513S|ARID4B_ENST00000349213.3_Silent_p.S513S	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	513	Glu-rich.				histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S513S(1)		NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTATGTTGAGGGATTCATCTA	0.343																																																	1	Substitution - coding silent(1)	lung(1)											218.0	202.0	207.0					1																	235383152		2203	4300	6503	SO:0001819	synonymous_variant	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.1539C>G	1.37:g.235383152G>C			A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Silent	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S513	ENST00000264183.3	37	c.1539	CCDS31061.1	1																																																																																			ARID4B	-	NULL	ENSG00000054267		0.343	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3		0.00	26	0	G	NM_016374		235383152	-1			no_errors	ENST00000264183	ensembl	human	known	74_37	silent	10.00	18	2	SNP	0.952	C
ATAD5	79915	genome.wustl.edu	37	17	29214209	29214209	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:29214209G>T	ENST00000321990.4	+	19	4455		c.e19-1			NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5						cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				CTGTTTTGAAGCTAAATGTTG	0.308																																																	0													84.0	79.0	80.0					17																	29214209		2203	4299	6502	SO:0001630	splice_region_variant	0				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4078-1G>T	17.37:g.29214209G>T			Q05DH0|Q69YR6|Q9H9I1	Splice_Site	SNP	-	e19-1	ENST00000321990.4	37	c.4078-1	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238335	0.79800	.	.	ENSG00000176208	ENST00000321990	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7972	0.96491	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATAD5	26238335	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	7.597000	0.82733	2.685000	0.91497	0.454000	0.30748	.	ATAD5	-	-	ENSG00000176208		0.308	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	HGNC	protein_coding	OTTHUMT00000256206.2		0.00	62	0	G	NM_024857	Intron	29214209	+1			no_errors	ENST00000321990	ensembl	human	known	74_37	splice_site	8.33	33	3	SNP	1.000	T
ARSG	22901	genome.wustl.edu	37	17	66303711	66303711	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:66303711G>T	ENST00000448504.2	+	2	873	c.77G>T	c.(76-78)tGc>tTc	p.C26F	ARSG_ENST00000452479.2_Intron	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	26					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTGGATTTTTGCATCAGTGGG	0.468																																																	0													104.0	110.0	108.0					17																	66303711		2203	4300	6503	SO:0001583	missense	0			AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.77G>T	17.37:g.66303711G>T	ENSP00000407193:p.Cys26Phe		Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.C26F	ENST00000448504.2	37	c.77	CCDS11676.1	17	.	.	.	.	.	.	.	.	.	.	G	6.767	0.510327	0.12883	.	.	ENSG00000141337	ENST00000452479	.	.	.	5.33	-3.47	0.04753	.	1.117560	0.06506	N	0.737093	T	0.21267	0.0512	N	0.19112	0.55	0.09310	N	1	B	0.20671	0.047	B	0.11329	0.006	T	0.24764	-1.0151	9	0.09590	T	0.72	.	6.1566	0.20340	0.3884:0.228:0.3836:0.0	.	26	Q96EG1	ARSG_HUMAN	F	26	.	ENSP00000413953:C26F	C	+	2	0	ARSG	63815306	0.000000	0.05858	0.001000	0.08648	0.789000	0.44602	-0.738000	0.04871	-0.384000	0.07845	0.563000	0.77884	TGC	ARSG	-	NULL	ENSG00000141337		0.468	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSG	HGNC	protein_coding	OTTHUMT00000448369.1		0.00	82	0	G	NM_014960		66303711	+1			no_errors	ENST00000448504	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.000	T
ATP10D	57205	genome.wustl.edu	37	4	47538513	47538513	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:47538513G>T	ENST00000273859.3	+	8	1344	c.1075G>T	c.(1075-1077)Gat>Tat	p.D359Y	ATP10D_ENST00000504445.1_Missense_Mutation_p.D359Y	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	359					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.D359N(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TCCCGAGCCTGATGGACATAT	0.343																																																	1	Substitution - Missense(1)	lung(1)											267.0	263.0	265.0					4																	47538513		2203	4300	6503	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1075G>T	4.37:g.47538513G>T	ENSP00000273859:p.Asp359Tyr		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.D359Y	ENST00000273859.3	37	c.1075	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857567	0.51376	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.44881	0.91;3.92	5.46	5.46	0.80206	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.64402	D	0.000001	T	0.62466	0.2430	L	0.61387	1.9	0.45477	D	0.998443	P;P	0.50156	0.932;0.932	D;P	0.64321	0.924;0.889	T	0.63778	-0.6560	10	0.72032	D	0.01	-22.3925	18.3032	0.90171	0.0:0.0:1.0:0.0	.	359;359	Q9P241;Q6PEW3	AT10D_HUMAN;.	Y	359	ENSP00000273859:D359Y;ENSP00000420909:D359Y	ENSP00000273859:D359Y	D	+	1	0	ATP10D	47233270	0.589000	0.26807	0.926000	0.36857	0.003000	0.03518	1.640000	0.37186	2.577000	0.86979	0.655000	0.94253	GAT	ATP10D	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000145246		0.343	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1		0.00	20	0	G	NM_020453		47538513	+1			no_errors	ENST00000273859	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	T
BABAM1	29086	genome.wustl.edu	37	19	17389663	17389663	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:17389663G>T	ENST00000359435.4	+	9	989	c.796G>T	c.(796-798)Gcc>Tcc	p.A266S	BABAM1_ENST00000595632.1_Missense_Mutation_p.A191S|BABAM1_ENST00000601043.1_Missense_Mutation_p.A266S|BABAM1_ENST00000447614.2_Missense_Mutation_p.A266S|CTD-2278I10.6_ENST00000596542.1_Intron|ANKLE1_ENST00000433424.2_5'Flank|BABAM1_ENST00000598188.1_Missense_Mutation_p.A266S|ANKLE1_ENST00000394458.3_5'Flank|ANKLE1_ENST00000404085.1_5'Flank	NM_001033549.1	NP_001028721.1	Q9NWV8	BABA1_HUMAN	BRISC and BRCA1 A complex member 1	266	VWFA-like.				chromatin modification (GO:0016568)|double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5						GGATATGTTTGCCTTCATGGG	0.582																																																	0													32.0	33.0	33.0					19																	17389663		1968	4125	6093	SO:0001583	missense	0			AK000578	CCDS46012.1, CCDS74310.1	19p13.11	2011-02-21	2011-02-21	2011-01-31	ENSG00000105393	ENSG00000105393			25008	protein-coding gene	gene with protein product	"""Mediator of Rap80 Interactions and Targeting 40 kD"", ""new component of the BRCA1 A complex"""	612766	"""chromosome 19 open reading frame 62"""	C19orf62		11042152	Standard	NM_001288756		Approved	FLJ20571, HSPC142, NBA1, MERIT40	uc002nfv.3	Q9NWV8		ENST00000359435.4:c.796G>T	19.37:g.17389663G>T	ENSP00000352408:p.Ala266Ser		A8MQT0|B4DRY9|B4DVR1|Q6FIA0|Q9P018	Missense_Mutation	SNP	NULL	p.A266S	ENST00000359435.4	37	c.796	CCDS46012.1	19	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289419	0.23478	.	.	ENSG00000105393	ENST00000359435;ENST00000447614	.	.	.	5.06	4.03	0.46877	.	.	.	.	.	T	0.37999	0.1024	L	0.28115	0.83	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.12630	-1.0540	8	0.11794	T	0.64	-7.0268	7.6435	0.28307	0.1868:0.0:0.8132:0.0	.	266	Q9NWV8	BABA1_HUMAN	S	266	.	ENSP00000352408:A266S	A	+	1	0	BABAM1	17250663	0.363000	0.24989	1.000000	0.80357	0.957000	0.61999	0.211000	0.17474	1.364000	0.46038	0.655000	0.94253	GCC	BABAM1	-	NULL	ENSG00000105393		0.582	BABAM1-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	BABAM1	HGNC	protein_coding	OTTHUMT00000463471.1	-	0.00	67	0	G	NM_014173		17389663	+1	tier1	-	no_errors	ENST00000359435	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.997	T
BRINP1	1620	genome.wustl.edu	37	9	121930059	121930059	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:121930059C>T	ENST00000265922.3	-	8	2050	c.1589G>A	c.(1588-1590)aGc>aAc	p.S530N	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	530					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GTTCTTGTTGCTCTTGAGAGT	0.557																																																	0													132.0	102.0	112.0					9																	121930059		2203	4300	6503	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1589G>A	9.37:g.121930059C>T	ENSP00000265922:p.Ser530Asn		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.S530N	ENST00000265922.3	37	c.1589	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076690	0.76415	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.21543	2.0	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.42877	0.1222	M	0.61703	1.905	0.80722	D	1	D	0.54601	0.967	P	0.57776	0.827	T	0.20438	-1.0275	10	0.87932	D	0	-30.9933	19.91	0.97023	0.0:1.0:0.0:0.0	.	530	O60477	DBC1_HUMAN	N	530	ENSP00000265922:S530N	ENSP00000265922:S530N	S	-	2	0	DBC1	120969880	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.743000	0.85020	2.702000	0.92279	0.655000	0.94253	AGC	BRINP1	-	NULL	ENSG00000078725		0.557	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2	-	0.00	45	0	C	NM_014618		121930059	-1	tier1	-	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	36.84	12	7	SNP	1.000	T
C15orf43	145645	genome.wustl.edu	37	15	45270773	45270773	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:45270773G>T	ENST00000340827.3	+	7	627	c.610G>T	c.(610-612)Gtt>Ttt	p.V204F		NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	204										NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		GGCATATCATGTTCAAAATGA	0.274																																																	0													44.0	46.0	46.0					15																	45270773		2193	4286	6479	SO:0001583	missense	0			BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.610G>T	15.37:g.45270773G>T	ENSP00000340644:p.Val204Phe			Missense_Mutation	SNP	NULL	p.V204F	ENST00000340827.3	37	c.610	CCDS10115.1	15	.	.	.	.	.	.	.	.	.	.	G	13.96	2.394296	0.42410	.	.	ENSG00000167014	ENST00000340827	T	0.44881	0.91	4.05	2.05	0.26809	.	0.539898	0.16191	N	0.225368	T	0.28797	0.0714	N	0.24115	0.695	0.23827	N	0.996737	P	0.39250	0.665	B	0.41088	0.347	T	0.13045	-1.0524	10	0.87932	D	0	.	6.273	0.20965	0.2414:0.0:0.7586:0.0	.	204	Q8NHR7	CO043_HUMAN	F	204	ENSP00000340644:V204F	ENSP00000340644:V204F	V	+	1	0	C15orf43	43058065	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	1.263000	0.33004	0.793000	0.33875	0.298000	0.19748	GTT	C15orf43	-	NULL	ENSG00000167014		0.274	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf43	HGNC	protein_coding	OTTHUMT00000254032.1	-	0.00	68	0	G	NM_152448		45270773	+1	tier1	-	no_errors	ENST00000340827	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
C16orf89	146556	genome.wustl.edu	37	16	5094401	5094401	+	3'UTR	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:5094401G>T	ENST00000315997.5	-	0	1593				C16orf89_ENST00000472572.3_Missense_Mutation_p.P345Q|C16orf89_ENST00000474471.3_3'UTR|C16orf89_ENST00000350219.4_3'UTR|ALG1_ENST00000588623.1_Intron|RP11-165E7.1_ENST00000588778.1_RNA|C16orf89_ENST00000422873.1_Missense_Mutation_p.P383Q	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89							cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						TCTGTTTGCTGGGGGGTATTC	0.612																																																	0													63.0	73.0	70.0					16																	5094401		2036	4188	6224	SO:0001624	3_prime_UTR_variant	0				CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.*183C>A	16.37:g.5094401G>T			B4DUM5|Q8N2I3|Q8N4T1	Missense_Mutation	SNP	NULL	p.P383Q	ENST00000315997.5	37	c.1148	CCDS42116.2	16	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738436	0.49045	.	.	ENSG00000153446	ENST00000472572;ENST00000422873	T;T	0.28895	1.59;1.59	4.29	1.05	0.20165	.	.	.	.	.	T	0.42381	0.1200	M	0.64997	1.995	0.09310	N	1	D	0.59767	0.986	P	0.58454	0.839	T	0.20207	-1.0282	9	0.51188	T	0.08	.	7.0442	0.25037	0.0953:0.3297:0.5749:0.0	.	383	G3V0F0	.	Q	345;383	ENSP00000420566:P345Q;ENSP00000390402:P383Q	ENSP00000390402:P383Q	P	-	2	0	C16orf89	5034402	0.001000	0.12720	0.000000	0.03702	0.022000	0.10575	0.616000	0.24344	0.064000	0.16427	0.448000	0.29417	CCA	C16orf89	-	NULL	ENSG00000153446		0.612	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	C16orf89	HGNC	protein_coding	OTTHUMT00000354524.1		0.00	64	0	G	NM_152459		5094401	-1			no_errors	ENST00000422873	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
C16orf89	146556	genome.wustl.edu	37	16	5105289	5105289	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:5105289G>T	ENST00000315997.5	-	6	1027	c.826C>A	c.(826-828)Ctc>Atc	p.L276I	C16orf89_ENST00000472572.3_Missense_Mutation_p.L276I|C16orf89_ENST00000474471.3_Missense_Mutation_p.L308I|C16orf89_ENST00000350219.4_Missense_Mutation_p.L314I|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000422873.1_Missense_Mutation_p.L314I	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	276						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						TGCCAGCTGAGAATGGCCTCC	0.637																																																	0													27.0	29.0	29.0					16																	5105289		1955	4162	6117	SO:0001583	missense	0				CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.826C>A	16.37:g.5105289G>T	ENSP00000324672:p.Leu276Ile		B4DUM5|Q8N2I3|Q8N4T1	Missense_Mutation	SNP	NULL	p.L314I	ENST00000315997.5	37	c.940	CCDS42116.2	16	.	.	.	.	.	.	.	.	.	.	G	18.95	3.730897	0.69074	.	.	ENSG00000153446	ENST00000474471;ENST00000472572;ENST00000477550;ENST00000422873;ENST00000350219;ENST00000315997	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.49	4.52	0.55395	.	0.177601	0.38663	N	0.001608	T	0.61248	0.2332	M	0.69358	2.11	0.34082	D	0.659716	D;D	0.67145	0.996;0.99	P;P	0.59424	0.817;0.857	T	0.74166	-0.3753	10	0.56958	D	0.05	-12.3261	12.457	0.55710	0.0:0.1679:0.8321:0.0	.	276;314	Q6UX73;G3V0F0	CP089_HUMAN;.	I	308;276;276;314;314;308	ENSP00000417158:L308I;ENSP00000420566:L276I;ENSP00000390402:L314I;ENSP00000283478:L314I	ENSP00000324672:L308I	L	-	1	0	C16orf89	5045290	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	2.266000	0.43320	1.273000	0.44346	0.557000	0.71058	CTC	C16orf89	-	NULL	ENSG00000153446		0.637	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	C16orf89	HGNC	protein_coding	OTTHUMT00000354524.1	-	0.00	97	0	G	NM_152459		5105289	-1	tier1	-	no_errors	ENST00000350219	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
C16orf54	283897	genome.wustl.edu	37	16	29756002	29756002	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:29756002G>A	ENST00000329410.3	-	2	366	c.271C>T	c.(271-273)Cgc>Tgc	p.R91C	AC009133.17_ENST00000565600.1_RNA	NM_175900.3	NP_787096.2	Q6UWD8	CP054_HUMAN	chromosome 16 open reading frame 54	91						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|lung(2)|prostate(1)|urinary_tract(1)	6						TCCTCAGAGCGCTCTCGGGCG	0.701																																																	0													13.0	14.0	14.0					16																	29756002		2173	4279	6452	SO:0001583	missense	0			AK093000	CCDS10652.1	16p11.2	2012-10-10		2005-08-09	ENSG00000185905	ENSG00000185905			26649	protein-coding gene	gene with protein product						12975309	Standard	NM_175900		Approved	FLJ35681	uc002dtp.2	Q6UWD8	OTTHUMG00000132116	ENST00000329410.3:c.271C>T	16.37:g.29756002G>A	ENSP00000327506:p.Arg91Cys		A6NJR6|Q8NAB0	Missense_Mutation	SNP	NULL	p.R91C	ENST00000329410.3	37	c.271	CCDS10652.1	16	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202173	0.79127	.	.	ENSG00000185905	ENST00000329410	T	0.53640	0.61	5.09	5.09	0.68999	.	0.000000	0.41938	U	0.000796	T	0.57844	0.2081	L	0.32530	0.975	0.53688	D	0.99997	D	0.89917	1.0	D	0.97110	1.0	T	0.61287	-0.7093	10	0.87932	D	0	-14.362	13.998	0.64414	0.0:0.0:1.0:0.0	.	91	Q6UWD8	CP054_HUMAN	C	91	ENSP00000327506:R91C	ENSP00000327506:R91C	R	-	1	0	C16orf54	29663503	1.000000	0.71417	0.999000	0.59377	0.907000	0.53573	4.456000	0.60081	2.376000	0.81061	0.313000	0.20887	CGC	C16orf54	-	NULL	ENSG00000185905		0.701	C16orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf54	HGNC	protein_coding	OTTHUMT00000255158.1	-	0.00	65	0	G	NM_175900		29756002	-1	tier1	-	no_errors	ENST00000329410	ensembl	human	known	74_37	missense	14.29	23	4	SNP	1.000	A
C17orf75	64149	genome.wustl.edu	37	17	30661542	30661542	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:30661542G>T	ENST00000577809.1	-	8	866	c.817C>A	c.(817-819)Cat>Aat	p.H273N	C17orf75_ENST00000225805.4_Missense_Mutation_p.H273N|RP11-227G15.3_ENST00000581915.1_RNA	NM_022344.3	NP_071739.2	Q9HAS0	NJMU_HUMAN	chromosome 17 open reading frame 75	273										ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			ACAGACTTATGCTGCTCCTCT	0.512																																																	0													70.0	70.0	70.0					17																	30661542		2119	4251	6370	SO:0001583	missense	0			AB062437	CCDS58537.1	17q11.2	2013-01-21			ENSG00000108666	ENSG00000108666			30173	protein-coding gene	gene with protein product							Standard	NM_022344		Approved	NJMU-R1	uc002hhg.3	Q9HAS0		ENST00000577809.1:c.817C>A	17.37:g.30661542G>T	ENSP00000464275:p.His273Asn		Q7Z2H4	Missense_Mutation	SNP	NULL	p.H273N	ENST00000577809.1	37	c.817	CCDS58537.1	17	.	.	.	.	.	.	.	.	.	.	G	6.488	0.458244	0.12342	.	.	ENSG00000108666	ENST00000225805	.	.	.	5.95	4.98	0.66077	.	0.341267	0.38605	N	0.001629	T	0.49795	0.1578	L	0.56769	1.78	0.29113	N	0.88072	B	0.22211	0.066	B	0.21151	0.033	T	0.43972	-0.9358	9	0.22109	T	0.4	-8.4565	16.3048	0.82843	0.0:0.1323:0.8677:0.0	.	273	Q9HAS0	NJMU_HUMAN	N	273	.	ENSP00000225805:H273N	H	-	1	0	C17orf75	27685655	1.000000	0.71417	0.019000	0.16419	0.000000	0.00434	7.843000	0.86859	1.507000	0.48752	-0.176000	0.13171	CAT	C17orf75	-	NULL	ENSG00000108666		0.512	C17orf75-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	C17orf75	HGNC	protein_coding	OTTHUMT00000447204.1	-	0.00	42	0	G	NM_022344		30661542	-1	tier1	-	no_errors	ENST00000225805	ensembl	human	known	74_37	missense	20.00	12	3	SNP	0.448	T
C18orf63	644041	genome.wustl.edu	37	18	72020612	72020612	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr18:72020612G>T	ENST00000579455.1	+	12	1439	c.1110G>T	c.(1108-1110)gtG>gtT	p.V370V		NM_001174123.1	NP_001167594.1	Q68DL7	CR063_HUMAN	chromosome 18 open reading frame 63	370										breast(1)	1						ACCACAAGGTGGAGCTTTCAG	0.488																																																	0																																										SO:0001819	synonymous_variant	0				CCDS54189.1	18q22.3	2012-10-24			ENSG00000206043	ENSG00000206043			40037	protein-coding gene	gene with protein product							Standard	NM_001174123		Approved	DKFZP781G0119	uc002llj.3	Q68DL7	OTTHUMG00000178987	ENST00000579455.1:c.1110G>T	18.37:g.72020612G>T			A6NME8	Silent	SNP	NULL	p.V370	ENST00000579455.1	37	c.1110	CCDS54189.1	18																																																																																			C18orf63	-	NULL	ENSG00000206043		0.488	C18orf63-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	C18orf63	HGNC	protein_coding	OTTHUMT00000444246.2	-	0.00	32	0	G	NM_001174123		72020612	+1	tier1	-	no_errors	ENST00000579455	ensembl	human	known	74_37	silent	100.00	0	2	SNP	1.000	T
C19orf68	374920	genome.wustl.edu	37	19	48685861	48685861	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:48685861C>A	ENST00000328759.7	+	3	457	c.425C>A	c.(424-426)gCc>gAc	p.A142D	ZNF114_ENST00000597695.1_Intron|CARD8_ENST00000600800.1_5'UTR			Q86XI8	CS068_HUMAN	chromosome 19 open reading frame 68	142					hematopoietic progenitor cell differentiation (GO:0002244)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)											CACCTGCTGGCCAACGCCTGC	0.697																																																	0																																										SO:0001583	missense	0			BC043386	CCDS74411.1	19q13.32	2008-08-06			ENSG00000185453	ENSG00000185453			34495	protein-coding gene	gene with protein product						12477932	Standard	NM_199341		Approved	LOC374920	uc002pic.3	Q86XI8		ENST00000328759.7:c.425C>A	19.37:g.48685861C>A	ENSP00000331363:p.Ala142Asp			Missense_Mutation	SNP	NULL	p.A142D	ENST00000328759.7	37	c.425		19	.	.	.	.	.	.	.	.	.	.	c	18.31	3.595591	0.66219	.	.	ENSG00000185453	ENST00000328759	T	0.55234	0.53	4.47	4.47	0.54385	.	0.000000	0.47093	D	0.000260	T	0.59335	0.2186	L	0.27053	0.805	0.40740	D	0.982828	D	0.89917	1.0	D	0.87578	0.998	T	0.59974	-0.7353	10	0.36615	T	0.2	-4.0079	15.0173	0.71597	0.0:1.0:0.0:0.0	.	142	Q86XI8	CS068_HUMAN	D	142	ENSP00000331363:A142D	ENSP00000331363:A142D	A	+	2	0	C19orf68	53377673	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.478000	0.60230	2.228000	0.72767	0.556000	0.70494	GCC	C19orf68	-	NULL	ENSG00000185453		0.697	C19orf68-001	KNOWN	non_canonical_other|basic|appris_principal	protein_coding	C19orf68	HGNC	protein_coding	OTTHUMT00000465598.1	-	0.00	66	0	C	XM_001713770		48685861	+1	tier1	-	no_errors	ENST00000328759	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	A
C1orf123	54987	genome.wustl.edu	37	1	53682462	53682462	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:53682462G>T	ENST00000294360.4	-	6	372	c.331C>A	c.(331-333)Cag>Aag	p.Q111K	C1orf123_ENST00000470385.1_5'UTR	NM_017887.1	NP_060357.1	Q9NWV4	CA123_HUMAN	chromosome 1 open reading frame 123	111						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|pancreas(2)|skin(1)	6						ACCTGCGGCTGGAAATCAACT	0.498																																																	0													118.0	115.0	116.0					1																	53682462		2203	4300	6503	SO:0001583	missense	0			BC010908	CCDS576.1	1p32.3	2011-02-18			ENSG00000162384	ENSG00000162384			26059	protein-coding gene	gene with protein product						12477932	Standard	NM_017887		Approved	FLJ20580	uc001cvd.3	Q9NWV4	OTTHUMG00000008940	ENST00000294360.4:c.331C>A	1.37:g.53682462G>T	ENSP00000294360:p.Gln111Lys			Missense_Mutation	SNP	pfam_DUF866_euk	p.Q111K	ENST00000294360.4	37	c.331	CCDS576.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363756	0.82353	.	.	ENSG00000162384	ENST00000294360;ENST00000371480	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	L	0.31294	0.92	0.80722	D	1	P;P	0.45283	0.729;0.855	P;P	0.46825	0.528;0.456	T	0.59857	-0.7375	9	0.62326	D	0.03	-21.6846	19.843	0.96697	0.0:0.0:1.0:0.0	.	81;111	D3DQ38;Q9NWV4	.;CA123_HUMAN	K	111;92	.	ENSP00000294360:Q111K	Q	-	1	0	C1orf123	53455050	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	8.977000	0.93446	2.679000	0.91253	0.655000	0.94253	CAG	C1orf123	-	pfam_DUF866_euk	ENSG00000162384		0.498	C1orf123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf123	HGNC	protein_coding	OTTHUMT00000024751.1	-	0.00	115	0	G	NM_017887		53682462	-1	tier1	-	no_errors	ENST00000294360	ensembl	human	known	74_37	missense	5.15	92	5	SNP	1.000	T
B3GALT5	10317	genome.wustl.edu	37	21	40971352	40971352	+	Intron	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr21:40971352C>A	ENST00000380620.4	+	2	69				C21orf88_ENST00000380612.4_Intron|C21orf88_ENST00000489821.1_5'UTR			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5						protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				GTCCCCATCTCCACGGTGCAA	0.532																																																	0																																										SO:0001627	intron_variant	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.-523-5669C>A	21.37:g.40971352C>A			A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	RNA	SNP	-	NULL	ENST00000380620.4	37	NULL	CCDS13667.1	21																																																																																			C21orf88	-	-	ENSG00000184809		0.532	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf88	HGNC	protein_coding	OTTHUMT00000195008.2	-	0.00	73	0	C	NM_033170		40971352	-1	tier1	-	no_errors	ENST00000489821	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.003	A
C2CD2L	9854	genome.wustl.edu	37	11	118983046	118983046	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:118983046G>T	ENST00000528586.1	+	4	342	c.272G>T	c.(271-273)gGc>gTc	p.G91V	C2CD2L_ENST00000336702.3_Missense_Mutation_p.G343V			O14523	C2C2L_HUMAN	C2CD2-like	343						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						AGGGATCTGGGCCCCCAGAGC	0.602																																																	0													37.0	39.0	38.0					11																	118983046		2199	4295	6494	SO:0001583	missense	0			AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.272G>T	11.37:g.118983046G>T	ENSP00000433600:p.Gly91Val		Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	superfamily_C2_dom	p.G343V	ENST00000528586.1	37	c.1028		11	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953468	0.73902	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.50813	0.73;0.73	5.23	5.23	0.72850	C2 calcium/lipid-binding domain, CaLB (1);	0.268654	0.42548	D	0.000694	T	0.53562	0.1804	L	0.29908	0.895	0.80722	D	1	D;D	0.59357	0.985;0.985	P;P	0.57244	0.816;0.816	T	0.53781	-0.8390	10	0.52906	T	0.07	-9.0565	17.9555	0.89067	0.0:0.0:1.0:0.0	.	343;343	O14523;O14523-2	C2C2L_HUMAN;.	V	343;91	ENSP00000338885:G343V;ENSP00000433600:G91V	ENSP00000338885:G343V	G	+	2	0	C2CD2L	118488256	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.254000	0.65457	2.731000	0.93534	0.591000	0.81541	GGC	C2CD2L	-	superfamily_C2_dom	ENSG00000172375		0.602	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	C2CD2L	HGNC	protein_coding	OTTHUMT00000388199.2		0.00	120	0	G	NM_014807		118983046	+1			no_errors	ENST00000336702	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.999	T
C8A	731	genome.wustl.edu	37	1	57378299	57378299	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:57378299G>T	ENST00000361249.3	+	10	1699		c.e10+1			NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						CAGACAGAAGGTAAGGTCCGT	0.602																																																	0													54.0	56.0	55.0					1																	57378299		2203	4300	6503	SO:0001630	splice_region_variant	0			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1603+1G>T	1.37:g.57378299G>T			A2RUI4|A2RUI5|Q13668|Q9H130	Splice_Site	SNP	-	e10+1	ENST00000361249.3	37	c.1603+1	CCDS606.1	1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.200231	0.38905	.	.	ENSG00000157131	ENST00000361249	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0789	0.89436	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C8A	57150887	1.000000	0.71417	0.791000	0.31998	0.161000	0.22273	7.055000	0.76656	2.713000	0.92767	0.655000	0.94253	.	C8A	-	-	ENSG00000157131		0.602	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8A	HGNC	protein_coding	OTTHUMT00000022890.1	-	0.00	47	0	G	NM_000562	Intron	57378299	+1	tier1	-	no_errors	ENST00000361249	ensembl	human	known	74_37	splice_site	12.20	36	5	SNP	1.000	T
C8orf34	116328	genome.wustl.edu	37	8	69728126	69728126	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:69728126G>T	ENST00000539993.1	+	13	1846	c.1297G>T	c.(1297-1299)Gct>Tct	p.A433S	C8orf34_ENST00000337103.4_Missense_Mutation_p.A408S|C8orf34_ENST00000518698.1_Missense_Mutation_p.A519S			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	433										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			TGCAGGTTCCGCTGATCTTCT	0.448																																																	0													371.0	319.0	337.0					8																	69728126		2203	4300	6503	SO:0001583	missense	0			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.1297G>T	8.37:g.69728126G>T	ENSP00000438159:p.Ala433Ser		A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.A519S	ENST00000539993.1	37	c.1555		8	.	.	.	.	.	.	.	.	.	.	G	8.668	0.902114	0.17760	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000337103	T;T;T	0.52526	0.66;0.78;0.77	4.2	2.41	0.29592	.	0.525534	0.18828	N	0.130077	T	0.25901	0.0631	N	0.14661	0.345	0.22968	N	0.998495	B	0.33883	0.43	B	0.33799	0.17	T	0.11108	-1.0601	9	.	.	.	-0.6464	6.6945	0.23191	0.2121:0.0:0.7879:0.0	.	433	Q49A92	CH034_HUMAN	S	519;433;408	ENSP00000427820:A519S;ENSP00000438159:A433S;ENSP00000337174:A408S	.	A	+	1	0	C8orf34	69890680	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	0.979000	0.29500	0.735000	0.32537	-0.145000	0.13849	GCT	C8orf34	-	NULL	ENSG00000165084		0.448	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	HGNC	protein_coding			0.00	32	0	G	NM_052958		69728126	+1			no_errors	ENST00000518698	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
CACNA1C	775	genome.wustl.edu	37	12	2800177	2800177	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:2800177G>T	ENST00000347598.4	+	49	6373	c.6373G>T	c.(6373-6375)Gcg>Tcg	p.A2125S	CACNA1C_ENST00000399638.1_Missense_Mutation_p.A2105S|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A2083S|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A2096S|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A2094S|CACNA1C_ENST00000399655.1_Missense_Mutation_p.A2077S|CACNA1C_ENST00000399641.1_Missense_Mutation_p.A2077S|CACNA1C_ENST00000399637.1_Missense_Mutation_p.A2096S|CACNA1C_ENST00000399634.1_Missense_Mutation_p.A2148S|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A2085S|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A2077S|CACNA1C_ENST00000399603.1_Missense_Mutation_p.A2077S|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A2077S|CACNA1C_ENST00000399617.1_Missense_Mutation_p.A2112S|CACNA1C_ENST00000335762.5_Missense_Mutation_p.A2102S|CACNA1C_ENST00000406454.3_Missense_Mutation_p.A2148S|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A2112S|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A2077S|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A2097S|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A2096S|CACNA1C-AS1_ENST00000541673.1_RNA|CACNA1C_ENST00000399591.1_Missense_Mutation_p.A2085S|CACNA1C_ENST00000344100.3_Missense_Mutation_p.A2118S	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2160					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A1612T(1)|p.A2190T(1)|p.A2118T(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GATGGAGAGCGCGGCCGACAA	0.647																																																	3	Substitution - Missense(3)	large_intestine(3)											12.0	15.0	14.0					12																	2800177		1983	4141	6124	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.6373G>T	12.37:g.2800177G>T	ENSP00000266376:p.Ala2125Ser		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.A2148S	ENST00000347598.4	37	c.6442	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	27.5	4.832728	0.91036	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33	4.58	4.58	0.56647	.	0.059993	0.64402	D	0.000005	T	0.78489	0.4291	M	0.83774	2.66	0.49798	D	0.999822	D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999;1.0;1.0;1.0;0.622;1.0;0.999;0.999;0.999;1.0;0.997;0.999;0.999;0.977;0.999;1.0;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D	0.97110	1.0;0.997;0.993;0.999;0.997;0.998;0.997;0.998;0.457;0.999;0.997;0.997;0.997;0.998;0.984;0.996;0.997;0.888;0.997;0.999;0.994;0.996;0.997;0.997;0.993	T	0.82422	-0.0465	10	0.87932	D	0	.	17.926	0.88983	0.0:0.0:1.0:0.0	.	768;2118;2074;2160;2112;2096;2077;2094;2105;2077;2097;2077;2108;2125;2077;2112;2148;2085;2083;2085;2066;2096;2096;2077;2077	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	2102;2077;2077;2105;2077;2096;2096;2085;2077;2125;2097;2077;2118;2094;2112;2083;2096;2077;2148;2112;2148;2085;1978	ENSP00000336982:A2102S;ENSP00000382563:A2077S;ENSP00000382552:A2077S;ENSP00000382547:A2105S;ENSP00000382506:A2077S;ENSP00000382530:A2096S;ENSP00000382546:A2096S;ENSP00000382500:A2085S;ENSP00000382549:A2077S;ENSP00000266376:A2125S;ENSP00000382515:A2097S;ENSP00000382510:A2077S;ENSP00000341092:A2118S;ENSP00000382537:A2094S;ENSP00000329877:A2112S;ENSP00000382557:A2083S;ENSP00000385724:A2096S;ENSP00000382512:A2077S;ENSP00000382542:A2148S;ENSP00000382526:A2112S;ENSP00000385896:A2148S;ENSP00000382504:A2085S	ENSP00000323129:A1978S	A	+	1	0	CACNA1C	2670438	1.000000	0.71417	0.971000	0.41717	0.982000	0.71751	9.482000	0.97935	2.545000	0.85829	0.655000	0.94253	GCG	CACNA1C	-	NULL	ENSG00000151067		0.647	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1		0.00	25	0	G	NM_000719		2800177	+1			no_errors	ENST00000399634	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
CACNA1H	8912	genome.wustl.edu	37	16	1254250	1254250	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:1254250C>T	ENST00000348261.5	+	10	2491	c.2243C>T	c.(2242-2244)gCg>gTg	p.A748V	CACNA1H_ENST00000358590.4_Missense_Mutation_p.A748V|CACNA1H_ENST00000565831.1_Missense_Mutation_p.A748V|RP11-616M22.3_ENST00000564700.1_RNA	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	748			A -> V (in ECA6). {ECO:0000269|PubMed:12891677}.		aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CCACCCCGTGCGACGGACACA	0.711																																																	0			GRCh37	CM032208	CACNA1H	M							13.0	17.0	15.0					16																	1254250		2075	4190	6265	SO:0001583	missense	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.2243C>T	16.37:g.1254250C>T	ENSP00000334198:p.Ala748Val		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.A748V	ENST00000348261.5	37	c.2243	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	C	3.376	-0.127342	0.06753	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96427	-4.01;-3.96	2.81	-4.33	0.03677	.	0.591999	0.17963	N	0.156111	D	0.83959	0.5367	N	0.03608	-0.345	0.09310	N	1	B;B	0.13594	0.008;0.004	B;B	0.09377	0.004;0.001	T	0.76375	-0.2982	10	0.27785	T	0.31	.	2.7589	0.05300	0.3588:0.2748:0.0:0.3664	.	748;748	O95180-2;O95180	.;CAC1H_HUMAN	V	748	ENSP00000334198:A748V;ENSP00000351401:A748V	ENSP00000334198:A748V	A	+	2	0	CACNA1H	1194251	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-0.805000	0.04530	-1.167000	0.02779	-0.314000	0.08810	GCG	CACNA1H	-	NULL	ENSG00000196557		0.711	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	-	0.00	80	0	C	NM_001005407		1254250	+1	tier1	-	no_errors	ENST00000348261	ensembl	human	known	74_37	missense	34.78	45	24	SNP	0.000	T
CACNA1I	8911	genome.wustl.edu	37	22	40074028	40074028	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr22:40074028G>A	ENST00000402142.3	+	31	4970	c.4970G>A	c.(4969-4971)cGg>cAg	p.R1657Q	CACNA1I_ENST00000401624.1_Missense_Mutation_p.R1657Q|CACNA1I_ENST00000407673.1_Missense_Mutation_p.R1622Q|CACNA1I_ENST00000400164.3_Missense_Mutation_p.R1622Q|CACNA1I_ENST00000404898.1_Missense_Mutation_p.R1622Q|CACNA1I_ENST00000336649.4_Missense_Mutation_p.R1663Q	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1657					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GGCATGAGCCGGCATGCCACC	0.642																																																	0													35.0	37.0	36.0					22																	40074028		2074	4206	6280	SO:0001583	missense	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4970G>A	22.37:g.40074028G>A	ENSP00000385019:p.Arg1657Gln		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.R1663Q	ENST00000402142.3	37	c.4988	CCDS46710.1	22	.	.	.	.	.	.	.	.	.	.	G	34	5.361743	0.95877	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34;-4.34;-4.34	4.25	4.25	0.50352	Ion transport (1);	0.127523	0.53938	D	0.000045	D	0.97804	0.9279	L	0.55213	1.73	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.83275	0.995;0.996;0.996;0.994	D	0.98748	1.0719	10	0.66056	D	0.02	.	17.526	0.87800	0.0:0.0:1.0:0.0	.	1622;1657;1622;1657	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	Q	1657;1622;1657;1622;1663;1622	ENSP00000385019:R1657Q;ENSP00000384093:R1622Q;ENSP00000383887:R1657Q;ENSP00000385680:R1622Q;ENSP00000337829:R1663Q;ENSP00000383028:R1622Q	ENSP00000337829:R1663Q	R	+	2	0	CACNA1I	38403974	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.739000	0.98837	2.291000	0.77112	0.448000	0.29417	CGG	CACNA1I	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000100346		0.642	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	-	0.00	121	0	G	NM_001003406		40074028	+1	tier1	-	no_errors	ENST00000336649	ensembl	human	known	74_37	missense	16.09	72	14	SNP	1.000	A
CASK	8573	genome.wustl.edu	37	X	41446170	41446170	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chrX:41446170G>T	ENST00000378163.1	-	14	1778	c.1304C>A	c.(1303-1305)cCt>cAt	p.P435H	CASK_ENST00000378166.4_Missense_Mutation_p.P435H|CASK_ENST00000318588.9_Missense_Mutation_p.P435H|CASK_ENST00000442742.2_Missense_Mutation_p.P435H|CASK_ENST00000421587.2_Missense_Mutation_p.P429H|CASK_ENST00000378158.1_Missense_Mutation_p.P435H|CASK_ENST00000378154.1_Missense_Mutation_p.P435H|CASK_ENST00000361962.4_Missense_Mutation_p.P435H			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	435	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						CATGAAATGAGGTTGTGTTAA	0.308																																					NSCLC(42;104 1086 3090 27189 35040)												0													103.0	90.0	95.0					X																	41446170		2202	4299	6501	SO:0001583	missense	0			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.1304C>A	X.37:g.41446170G>T	ENSP00000367405:p.Pro435His		A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Guanylate_kin-like	p.P435H	ENST00000378163.1	37	c.1304		X	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414989	0.83449	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378179;ENST00000378158;ENST00000378166;ENST00000442742;ENST00000378154	T;T;T;T;T;T;T;T;T	0.72167	-0.53;-0.52;-0.53;-0.51;3.19;-0.53;-0.52;-0.53;-0.63	5.22	5.22	0.72569	L27, C-terminal (1);L27 (2);	0.000000	0.50627	D	0.000120	D	0.87382	0.6163	M	0.90145	3.09	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;D;D;D	0.91635	0.999;0.99;0.987;0.997	D	0.90280	0.4314	10	0.87932	D	0	.	17.9031	0.88910	0.0:0.0:1.0:0.0	.	429;435;435;435	O14936-3;O14936-4;O14936-2;O14936	.;.;.;CSKP_HUMAN	H	429;435;435;435;50;435;435;435;435	ENSP00000400526:P429H;ENSP00000322727:P435H;ENSP00000354641:P435H;ENSP00000367405:P435H;ENSP00000367421:P50H;ENSP00000367400:P435H;ENSP00000367408:P435H;ENSP00000398007:P435H;ENSP00000367396:P435H	ENSP00000322727:P435H	P	-	2	0	CASK	41331114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.372000	0.97165	2.161000	0.67846	0.506000	0.49869	CCT	CASK	-	pfam_L27_C,smart_L27,pfscan_L27	ENSG00000147044		0.308	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	HGNC	protein_coding	OTTHUMT00000056285.1	-	0.00	64	0	G	NM_003688		41446170	-1	tier1	-	no_errors	ENST00000378163	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
CASP8AP2	9994	genome.wustl.edu	37	6	90578514	90578514	+	RNA	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:90578514G>T	ENST00000551025.1	+	0	6942									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CTCACAAAAAGAGAAGAAACA	0.343																																					Colon(187;1656 2025 17045 31481 39901)												0													48.0	44.0	46.0					6																	90578514		1822	4081	5903			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90578514G>T				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.343	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript			0.00	42	0	G	NM_001137667		90578514	+1			no_errors	ENST00000237177	ensembl	human	known	74_37	rna	10.34	26	3	SNP	0.998	T
CASZ1	54897	genome.wustl.edu	37	1	10709147	10709147	+	Silent	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:10709147G>A	ENST00000377022.3	-	15	3455	c.3138C>T	c.(3136-3138)gaC>gaT	p.D1046D	RP4-734G22.3_ENST00000606802.1_RNA|CASZ1_ENST00000344008.5_Silent_p.D1046D	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1046					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D1046_I1049>V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TGATGGCCCCGTCCAAGGTGC	0.627																																																	1	Complex - deletion inframe(1)	prostate(1)											43.0	41.0	42.0					1																	10709147		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3138C>T	1.37:g.10709147G>A			Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D1046	ENST00000377022.3	37	c.3138	CCDS41246.1	1																																																																																			CASZ1	-	smart_Znf_C2H2-like	ENSG00000130940		0.627	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	-	0.00	111	0	G	NM_017766		10709147	-1	tier1	-	no_errors	ENST00000377022	ensembl	human	known	74_37	silent	15.91	74	14	SNP	1.000	A
CBWD6	644019	genome.wustl.edu	37	9	69218755	69218755	+	Intron	SNP	A	A	T	rs550565529	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:69218755A>T	ENST00000377457.5	-	11	870				CBWD6_ENST00000468061.1_Intron|CBWD6_ENST00000377449.1_Intron|CBWD6_ENST00000382399.4_Intron	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding (GO:0005524)			lung(4)	4						AAAATTTCTTAAAAAAAAACA	0.254													.|||	2	0.000399361	0.0	0.0014	5008	,	,		13521	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0				CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.765-194T>A	9.37:g.69218755A>T				RNA	SNP	-	NULL	ENST00000377457.5	37	NULL	CCDS43827.1	9																																																																																			CBWD6	-	-	ENSG00000204790		0.254	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	CBWD6	HGNC	protein_coding	OTTHUMT00000143172.2	-	0.00	46	0	A	XM_928822		69218755	-1	tier1	-	no_errors	ENST00000477430	ensembl	human	known	74_37	rna	21.05	15	4	SNP	0.000	T
CCDC130	81576	genome.wustl.edu	37	19	13869785	13869785	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:13869785C>T	ENST00000586600.1	+	8	864	c.361C>T	c.(361-363)Cgc>Tgc	p.R121C	CCDC130_ENST00000221554.8_Missense_Mutation_p.R121C			P13994	CC130_HUMAN	coiled-coil domain containing 130	121					response to virus (GO:0009615)					endometrium(2)|kidney(1)|large_intestine(3)|ovary(1)|skin(2)|urinary_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			CAAGGAGGAGCGCTGGGACAT	0.647																																																	0													42.0	38.0	39.0					19																	13869785		2203	4300	6503	SO:0001583	missense	0			AF250306	CCDS12296.1	19p13.13	2008-02-05				ENSG00000104957			28118	protein-coding gene	gene with protein product						3203696	Standard	NM_030818		Approved	MGC10471	uc002mxc.1	P13994		ENST00000586600.1:c.361C>T	19.37:g.13869785C>T	ENSP00000465776:p.Arg121Cys		Q9BQ72	Missense_Mutation	SNP	pfam_CWC16	p.R121C	ENST00000586600.1	37	c.361	CCDS12296.1	19	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415228	0.83449	.	.	ENSG00000104957	ENST00000540216;ENST00000221554	T	0.32988	1.43	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.61185	0.2327	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.959;0.996	T	0.66408	-0.5931	10	0.56958	D	0.05	-29.2001	15.9545	0.79876	0.0:1.0:0.0:0.0	.	121;121	B7Z1U2;P13994	.;CC130_HUMAN	C	121	ENSP00000221554:R121C	ENSP00000221554:R121C	R	+	1	0	CCDC130	13730785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.921000	0.63397	2.645000	0.89757	0.561000	0.74099	CGC	CCDC130	-	pfam_CWC16	ENSG00000104957		0.647	CCDC130-001	KNOWN	alternative_5_UTR|upstream_uORF|basic|appris_principal|CCDS	protein_coding	CCDC130	HGNC	protein_coding	OTTHUMT00000453216.2	-	0.00	66	0	C	NM_030818		13869785	+1	tier1	-	no_errors	ENST00000221554	ensembl	human	known	74_37	missense	86.11	5	31	SNP	1.000	T
CCDC88B	283234	genome.wustl.edu	37	11	64111516	64111516	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:64111516G>T	ENST00000356786.5	+	14	1547	c.1503G>T	c.(1501-1503)ctG>ctT	p.L501L	CCDC88B_ENST00000301897.4_5'Flank|CCDC88B_ENST00000463837.1_3'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	501						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTCCAGTGCTGGAGGAGGCTC	0.657																																																	0													36.0	37.0	37.0					11																	64111516		2200	4297	6497	SO:0001819	synonymous_variant	0			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1503G>T	11.37:g.64111516G>T			A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Silent	SNP	pfam_Hook-related_fam	p.L501	ENST00000356786.5	37	c.1503	CCDS8072.2	11																																																																																			CCDC88B	-	NULL	ENSG00000168071		0.657	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	HGNC	protein_coding	OTTHUMT00000104845.1	-	0.00	66	0	G	NM_032251		64111516	+1	tier1	-	no_errors	ENST00000356786	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.000	T
CCNE1	898	genome.wustl.edu	37	19	30312651	30312651	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:30312651A>G	ENST00000262643.3	+	8	911	c.632A>G	c.(631-633)cAc>cGc	p.H211R	CCNE1_ENST00000444983.2_Missense_Mutation_p.H196R|CCNE1_ENST00000357943.5_Missense_Mutation_p.H168R	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	211					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			CCAAAGTTGCACCAGTTTGCG	0.398			A		serous ovarian																																			Dom	yes		19	19q12	898	cyclin E1		E	0													94.0	91.0	92.0					19																	30312651		2203	4300	6503	SO:0001583	missense	0			M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.632A>G	19.37:g.30312651A>G	ENSP00000262643:p.His211Arg		A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.H211R	ENST00000262643.3	37	c.632	CCDS12419.1	19	.	.	.	.	.	.	.	.	.	.	A	14.72	2.619948	0.46736	.	.	ENSG00000105173	ENST00000262643;ENST00000357943;ENST00000444983	T;T;T	0.10668	2.85;2.85;2.85	6.08	6.08	0.98989	Cyclin, N-terminal (1);Cyclin-like (3);	0.086328	0.85682	D	0.000000	T	0.08670	0.0215	N	0.25094	0.71	0.58432	D	0.999998	B	0.27732	0.187	B	0.21360	0.034	T	0.32719	-0.9896	10	0.25751	T	0.34	.	15.8323	0.78764	1.0:0.0:0.0:0.0	.	211	P24864	CCNE1_HUMAN	R	211;168;196	ENSP00000262643:H211R;ENSP00000350625:H168R;ENSP00000410179:H196R	ENSP00000262643:H211R	H	+	2	0	CCNE1	35004491	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.102000	0.71486	2.333000	0.79357	0.482000	0.46254	CAC	CCNE1	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	ENSG00000105173		0.398	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNE1	HGNC	protein_coding	OTTHUMT00000438138.1	-	0.00	83	0	A	NM_001238		30312651	+1	tier1	-	no_errors	ENST00000262643	ensembl	human	known	74_37	missense	20.00	48	12	SNP	1.000	G
CCR2	729230	genome.wustl.edu	37	3	46401261	46401261	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:46401261G>T	ENST00000400888.2	+	2	1074	c.1035G>T	c.(1033-1035)gtG>gtT	p.V345V	CCR2_ENST00000292301.4_Silent_p.V345V			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	345					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		ATGTGAAAGTGACTACACAAG	0.498																																																	0													122.0	110.0	114.0					3																	46401261		1568	3582	5150	SO:0001819	synonymous_variant	0				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.1035G>T	3.37:g.46401261G>T			A0AVQ3|B2RMT0|Q4VBL2	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR2	p.V345	ENST00000400888.2	37	c.1035	CCDS43078.1	3																																																																																			CCR2	-	NULL	ENSG00000121807		0.498	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCR2	HGNC	protein_coding	OTTHUMT00000344292.1	-	0.00	35	0	G	NM_000647		46401261	+1	tier1	-	no_errors	ENST00000292301	ensembl	human	known	74_37	silent	51.52	16	17	SNP	0.001	T
CDYL2	124359	genome.wustl.edu	37	16	80646529	80646529	+	Silent	SNP	G	G	T	rs148183173		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:80646529G>T	ENST00000570137.2	-	5	1367	c.1212C>A	c.(1210-1212)gtC>gtA	p.V404V	CDYL2_ENST00000562812.1_Silent_p.V405V|CDYL2_ENST00000563890.1_Silent_p.V405V|CDYL2_ENST00000566173.1_Silent_p.V405V	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	404						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						TTACCAGCGCGACGCCCAGGA	0.622																																																	0													69.0	72.0	71.0					16																	80646529		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.1212C>A	16.37:g.80646529G>T			Q7Z5I8	Silent	SNP	pfam_Crotonase_core_superfam,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.V404	ENST00000570137.2	37	c.1212	CCDS32493.1	16																																																																																			CDYL2	-	pfam_Crotonase_core_superfam	ENSG00000166446		0.622	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDYL2	HGNC	protein_coding	OTTHUMT00000434727.2		0.00	86	0	G	NM_152342		80646529	-1			no_errors	ENST00000570137	ensembl	human	known	74_37	silent	5.00	57	3	SNP	0.958	T
CEP250	11190	genome.wustl.edu	37	20	34092220	34092220	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:34092220G>T	ENST00000397527.1	+	30	6743	c.6023G>T	c.(6022-6024)tGc>tTc	p.C2008F	CEP250_ENST00000342580.4_Missense_Mutation_p.C1952F	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2008	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CTGGATGCCTGCCAGGCACAC	0.612																																																	0													19.0	21.0	20.0					20																	34092220		2203	4300	6503	SO:0001583	missense	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.6023G>T	20.37:g.34092220G>T	ENSP00000380661:p.Cys2008Phe		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	superfamily_Prefoldin	p.C2008F	ENST00000397527.1	37	c.6023	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	G	9.004	0.980844	0.18812	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.57907	2.43;2.37;0.37	4.91	3.96	0.45880	.	0.187668	0.38326	N	0.001740	T	0.65801	0.2726	L	0.49126	1.545	0.30525	N	0.768041	D	0.89917	1.0	D	0.85130	0.997	T	0.68040	-0.5514	10	0.87932	D	0	.	13.1502	0.59484	0.0782:0.0:0.9218:0.0	.	2008	Q9BV73	CP250_HUMAN	F	2008;1952;496	ENSP00000380661:C2008F;ENSP00000341541:C1952F;ENSP00000395992:C496F	ENSP00000341541:C1952F	C	+	2	0	CEP250	33555634	0.998000	0.40836	0.995000	0.50966	0.082000	0.17680	3.305000	0.51873	1.294000	0.44707	-0.150000	0.13652	TGC	CEP250	-	NULL	ENSG00000126001		0.612	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	-	0.00	28	0	G	NM_007186		34092220	+1	tier1	-	no_errors	ENST00000397527	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.968	T
CEP85	64793	genome.wustl.edu	37	1	26603961	26603961	+	3'UTR	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:26603961G>T	ENST00000252992.4	+	0	2597				SH3BGRL3_ENST00000270792.5_5'Flank|SH3BGRL3_ENST00000319041.6_5'Flank|CEP85_ENST00000469609.1_3'UTR|CEP85_ENST00000451429.2_3'UTR	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa							centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						ACACTGGCATGTTGGATTACG	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.*177G>T	1.37:g.26603961G>T			B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	RNA	SNP	-	NULL	ENST00000252992.4	37	NULL	CCDS277.1	1																																																																																			CEP85	-	-	ENSG00000130695		0.498	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CEP85	HGNC	protein_coding	OTTHUMT00000009492.2	-	0.00	98	0	G	NM_022778		26603961	+1	tier1	-	no_errors	ENST00000469609	ensembl	human	known	74_37	rna	5.41	70	4	SNP	0.091	T
CFH	3075	genome.wustl.edu	37	1	196682864	196682864	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:196682864G>T	ENST00000367429.4	+	10	1576		c.e10-1			NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TTCCCTTTTAGAAACATGTTC	0.249																																																	0													37.0	37.0	37.0					1																	196682864		2202	4299	6501	SO:0001630	splice_region_variant	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1337-1G>T	1.37:g.196682864G>T			A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Splice_Site	SNP	-	e10-1	ENST00000367429.4	37	c.1337-1	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287636	0.23478	.	.	ENSG00000000971	ENST00000367429	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2971	0.66321	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CFH	194949487	1.000000	0.71417	0.997000	0.53966	0.095000	0.18619	4.372000	0.59530	2.443000	0.82685	0.591000	0.81541	.	CFH	-	-	ENSG00000000971		0.249	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2		0.00	11	0	G	NM_000186	Intron	196682864	+1			no_errors	ENST00000367429	ensembl	human	known	74_37	splice_site	18.18	9	2	SNP	1.000	T
CHAF1B	8208	genome.wustl.edu	37	21	37771856	37771856	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr21:37771856G>T	ENST00000314103.5	+	7	767	c.616G>T	c.(616-618)Gct>Tct	p.A206S		NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	206					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						GAAGCGTGTGGCTTTCAATGT	0.398																																																	0													150.0	142.0	145.0					21																	37771856		2203	4300	6503	SO:0001583	missense	0			U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.616G>T	21.37:g.37771856G>T	ENSP00000315700:p.Ala206Ser		Q99548	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B	p.A206S	ENST00000314103.5	37	c.616	CCDS13644.1	21	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959052	0.74016	.	.	ENSG00000159259	ENST00000314103	T	0.64991	-0.13	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70876	0.3274	M	0.68317	2.08	0.80722	D	1	P	0.51933	0.949	P	0.54759	0.76	T	0.65833	-0.6072	10	0.09338	T	0.73	-24.8358	18.9576	0.92665	0.0:0.0:1.0:0.0	.	206	Q13112	CAF1B_HUMAN	S	206	ENSP00000315700:A206S	ENSP00000315700:A206S	A	+	1	0	CHAF1B	36693726	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.503000	0.81632	2.560000	0.86352	0.563000	0.77884	GCT	CHAF1B	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000159259		0.398	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1B	HGNC	protein_coding	OTTHUMT00000194616.2	-	0.00	50	0	G	NM_005441		37771856	+1	tier1	-	no_errors	ENST00000314103	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
CHFR	55743	genome.wustl.edu	37	12	133434058	133434058	+	Silent	SNP	G	G	T	rs115029653	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:133434058G>T	ENST00000432561.2	-	9	1108	c.1035C>A	c.(1033-1035)ccC>ccA	p.P345P	CHFR_ENST00000315585.7_Silent_p.P304P|CHFR_ENST00000537522.1_5'Flank|CHFR_ENST00000443047.2_Silent_p.P253P|CHFR_ENST00000450056.2_Silent_p.P333P|CHFR_ENST00000266880.7_Silent_p.P345P|CHFR_ENST00000541837.2_5'UTR			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	345					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TCCGCTCCACGGGACAGCGGC	0.592																																																	0													181.0	141.0	155.0					12																	133434058		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.1035C>A	12.37:g.133434058G>T			A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Silent	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Znf_RING,pfscan_FHA_dom,pfscan_Znf_RING	p.P345	ENST00000432561.2	37	c.1035	CCDS53849.1	12																																																																																			CHFR	-	NULL	ENSG00000072609		0.592	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CHFR	HGNC	protein_coding	OTTHUMT00000397130.2	-	0.00	67	0	G			133434058	-1	tier1	-	no_errors	ENST00000266880	ensembl	human	known	74_37	silent	6.02	78	5	SNP	0.002	T
CHP1	11261	genome.wustl.edu	37	15	41571030	41571030	+	Silent	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:41571030C>A	ENST00000334660.5	+	6	717	c.477C>A	c.(475-477)acC>acA	p.T159T	CHP1_ENST00000560397.1_Intron|CHP1_ENST00000558351.1_3'UTR	NM_007236.4	NP_009167.1	Q99653	CHP1_HUMAN	calcineurin-like EF-hand protein 1	159	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Necessary for nuclear export signal.				calcium ion-dependent exocytosis (GO:0017156)|cellular response to acidic pH (GO:0071468)|cytoplasmic microtubule organization (GO:0031122)|membrane docking (GO:0022406)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|microtubule bundle formation (GO:0001578)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein glycosylation (GO:0060050)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of protein transport (GO:0051222)|positive regulation of sodium:proton antiporter activity (GO:0032417)|potassium ion transport (GO:0006813)|protein export from nucleus (GO:0006611)|protein oligomerization (GO:0051259)|protein stabilization (GO:0050821)|regulation of intracellular pH (GO:0051453)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|kinase binding (GO:0019900)|microtubule binding (GO:0008017)|potassium channel regulator activity (GO:0015459)|protein kinase inhibitor activity (GO:0004860)|transporter activity (GO:0005215)										CAGACAGGACCATTCAGGAGG	0.468																																																	0													154.0	126.0	135.0					15																	41571030		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS10073.1	15q13.3	2013-01-11	2013-01-11		ENSG00000187446	ENSG00000187446		"""EF-hand domain containing"""	17433	protein-coding gene	gene with protein product	"""calcineurin homologous protein"""	606988				15987692, 20720019	Standard	NM_007236		Approved	Sid470p, CHP, SLC9A1BP, p22, p24	uc001znl.3	Q99653	OTTHUMG00000130233	ENST00000334660.5:c.477C>A	15.37:g.41571030C>A			B2R6H9|Q6FHZ9	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.T159	ENST00000334660.5	37	c.477	CCDS10073.1	15																																																																																			CHP1	-	smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000187446		0.468	CHP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHP1	HGNC	protein_coding	OTTHUMT00000252554.2	-	0.00	72	0	C	NM_007236		41571030	+1	tier1	-	no_errors	ENST00000334660	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.998	A
CHRNB4	1143	genome.wustl.edu	37	15	78921536	78921536	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:78921536C>T	ENST00000261751.3	-	5	1222	c.1111G>A	c.(1111-1113)Gag>Aag	p.E371K	RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000560511.1_5'Flank|CHRNB4_ENST00000412074.2_Intron	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	371					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	GCGGTGGCCTCGGGCTTGGTC	0.632																																																	0													48.0	51.0	50.0					15																	78921536		2196	4293	6489	SO:0001583	missense	0			U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.1111G>A	15.37:g.78921536C>T	ENSP00000261751:p.Glu371Lys		A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.E371K	ENST00000261751.3	37	c.1111	CCDS10306.1	15	.	.	.	.	.	.	.	.	.	.	C	1.132	-0.652220	0.03480	.	.	ENSG00000117971	ENST00000261751	T	0.70516	-0.49	4.76	-0.993	0.10228	Neurotransmitter-gated ion-channel transmembrane domain (2);	7.471660	0.00166	N	0.000000	T	0.57036	0.2026	N	0.24115	0.695	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.37776	-0.9691	10	0.17369	T	0.5	.	10.1407	0.42734	0.0:0.4569:0.4106:0.1325	.	371	P30926	ACHB4_HUMAN	K	371	ENSP00000261751:E371K	ENSP00000261751:E371K	E	-	1	0	CHRNB4	76708591	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.647000	0.24812	-0.879000	0.04002	-1.094000	0.02160	GAG	CHRNB4	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000117971		0.632	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB4	HGNC	protein_coding	OTTHUMT00000290108.1	-	0.00	103	0	C			78921536	-1	tier1	-	no_errors	ENST00000261751	ensembl	human	known	74_37	missense	21.21	76	21	SNP	0.000	T
CIAO1	9391	genome.wustl.edu	37	2	96937046	96937046	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:96937046G>T	ENST00000488633.1	+	7	1196	c.977G>T	c.(976-978)gGg>gTg	p.G326V		NM_004804.2	NP_004795.1			cytosolic iron-sulfur assembly component 1											endometrium(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	5						AGTGATGATGGGGAGGTGGCC	0.552																																																	0													72.0	68.0	69.0					2																	96937046		2203	4300	6503	SO:0001583	missense	0			U63810	CCDS2019.1	2q11.1-q11.2	2014-01-13	2014-01-13	2006-11-23	ENSG00000144021	ENSG00000144021		"""WD repeat domain containing"""	14280	protein-coding gene	gene with protein product		604333	"""WD repeat domain 39"", ""cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)"", ""cytosolic iron-sulfur protein assembly 1"""	WDR39		9556563, 10493829	Standard	NM_004804		Approved	CIA1	uc002svs.3	O76071	OTTHUMG00000130452	ENST00000488633.1:c.977G>T	2.37:g.96937046G>T	ENSP00000418287:p.Gly326Val			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G326V	ENST00000488633.1	37	c.977	CCDS2019.1	2	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821476	0.90873	.	.	ENSG00000144021	ENST00000488633	T	0.76060	-0.99	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90442	0.7007	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91657	0.5339	10	0.48119	T	0.1	-36.8863	17.6318	0.88111	0.0:0.0:1.0:0.0	.	326	O76071	CIAO1_HUMAN	V	326	ENSP00000418287:G326V	ENSP00000418287:G326V	G	+	2	0	CIAO1	96300773	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.256000	0.95535	2.779000	0.95612	0.655000	0.94253	GGG	CIAO1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000144021		0.552	CIAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIAO1	HGNC	protein_coding	OTTHUMT00000252843.1	-	0.00	63	0	G	NM_004804		96937046	+1	tier1	-	no_errors	ENST00000488633	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
CLINT1	9685	genome.wustl.edu	37	5	157236744	157236744	+	Frame_Shift_Del	DEL	G	G	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:157236744delG	ENST00000411809.2	-	6	791	c.587delC	c.(586-588)ccafs	p.P196fs	CLINT1_ENST00000296951.5_Frame_Shift_Del_p.P178fs|CLINT1_ENST00000523908.1_Frame_Shift_Del_p.P196fs|CLINT1_ENST00000523094.1_Frame_Shift_Del_p.P178fs|RNU6-260P_ENST00000384092.1_RNA|CLINT1_ENST00000530742.1_Frame_Shift_Del_p.P178fs	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	196					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATCACTGAATGGAAAAGCACT	0.388																																					Colon(22;427 587 2170 6147 14291)												0													152.0	140.0	144.0					5																	157236744		1865	4100	5965	SO:0001589	frameshift_variant	0			AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.587delC	5.37:g.157236744delG	ENSP00000388340:p.Pro196fs		B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Frame_Shift_Del	DEL	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.P178fs	ENST00000411809.2	37	c.533	CCDS47330.1	5																																																																																			CLINT1	-	NULL	ENSG00000113282		0.388	CLINT1-001	KNOWN	basic|CCDS	protein_coding	CLINT1	HGNC	protein_coding	OTTHUMT00000374001.1		0.00	33	0	G	NM_014666		157236744	-1	tier1		no_errors	ENST00000296951	ensembl	human	known	74_37	frame_shift_del	20.00	8	2	DEL	1.000	-
CMPK2	129607	genome.wustl.edu	37	2	6989964	6989964	+	3'UTR	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:6989964G>T	ENST00000256722.5	-	0	1366				CMPK2_ENST00000478738.1_5'UTR|CMPK2_ENST00000458098.1_Intron	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial						cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTTAGACGTGGCACCTGGCCA	0.438																																																	0													114.0	115.0	114.0					2																	6989964		1929	4132	6061	SO:0001624	3_prime_UTR_variant	0				CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.*17C>A	2.37:g.6989964G>T			A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	RNA	SNP	-	NULL	ENST00000256722.5	37	NULL	CCDS42648.1	2																																																																																			CMPK2	-	-	ENSG00000134326		0.438	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CMPK2	HGNC	protein_coding	OTTHUMT00000323339.2	-	0.00	51	0	G	NM_207315		6989964	-1	tier1	-	no_errors	ENST00000478738	ensembl	human	known	74_37	rna	15.00	17	3	SNP	0.000	T
CNRIP1	25927	genome.wustl.edu	37	2	68546496	68546496	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:68546496C>T	ENST00000263655.3	-	1	642	c.37G>A	c.(37-39)Gcg>Acg	p.A13T	CNRIP1_ENST00000481714.1_Intron|CNRIP1_ENST00000409862.1_Missense_Mutation_p.A13T|CNRIP1_ENST00000409559.3_Missense_Mutation_p.A13T	NM_015463.2	NP_056278.1	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	13								p.A13T(2)		kidney(1)|large_intestine(5)|liver(1)|lung(1)|skin(1)	9						ATGCGCAGCGCGATGGAGAGG	0.706																																																	2	Substitution - Missense(2)	large_intestine(2)											30.0	24.0	26.0					2																	68546496		2183	4273	6456	SO:0001583	missense	0			AL110235	CCDS1886.1, CCDS46311.1	2p13	2008-02-05	2007-11-29	2007-11-29	ENSG00000119865	ENSG00000119865			24546	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 32"""	C2orf32		12477932	Standard	NM_015463		Approved	DKFZP566K1924, CRIP1, CRIP1a, CRIP1b	uc002sek.4	Q96F85	OTTHUMG00000129565	ENST00000263655.3:c.37G>A	2.37:g.68546496C>T	ENSP00000263655:p.Ala13Thr		B2R4D0|Q49AN4|Q9UFZ0	Missense_Mutation	SNP	NULL	p.A13T	ENST00000263655.3	37	c.37	CCDS1886.1	2	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300231	0.81136	.	.	ENSG00000119865	ENST00000409559;ENST00000263655;ENST00000409862	.	.	.	4.73	0.667	0.17907	.	0.131033	0.53938	D	0.000059	T	0.33411	0.0862	L	0.43152	1.355	0.37672	D	0.923172	P;P;P	0.50066	0.516;0.931;0.516	B;B;B	0.38880	0.086;0.284;0.058	T	0.25082	-1.0142	9	0.66056	D	0.02	-4.0644	8.1043	0.30877	0.5317:0.3936:0.0:0.0746	.	13;13;13	B8ZZB8;Q96F85;Q96F85-2	.;CNRP1_HUMAN;.	T	13	.	ENSP00000263655:A13T	A	-	1	0	CNRIP1	68400000	1.000000	0.71417	0.846000	0.33378	0.974000	0.67602	1.452000	0.35156	-0.064000	0.13043	-0.500000	0.04577	GCG	CNRIP1	-	NULL	ENSG00000119865		0.706	CNRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNRIP1	HGNC	protein_coding	OTTHUMT00000251758.1	-	0.00	88	0	C	NM_015463		68546496	-1	tier1	-	no_errors	ENST00000263655	ensembl	human	known	74_37	missense	64.79	25	46	SNP	0.884	T
CNTN3	5067	genome.wustl.edu	37	3	74350588	74350588	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:74350588G>T	ENST00000263665.6	-	15	2083	c.2056C>A	c.(2056-2058)Cca>Aca	p.P686T		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	686	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		GGTAAACTTGGTTCTCCACCT	0.408																																																	0													135.0	133.0	134.0					3																	74350588		2203	4300	6503	SO:0001583	missense	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2056C>A	3.37:g.74350588G>T	ENSP00000263665:p.Pro686Thr		B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P686T	ENST00000263665.6	37	c.2056	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764304	0.89932	.	.	ENSG00000113805	ENST00000263665	T	0.57273	0.41	6.08	6.08	0.98989	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84906	0.5576	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89707	0.3909	10	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	686	Q9P232	CNTN3_HUMAN	T	686	ENSP00000263665:P686T	ENSP00000263665:P686T	P	-	1	0	CNTN3	74433278	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.107000	0.94261	2.894000	0.99253	0.591000	0.81541	CCA	CNTN3	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113805		0.408	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1		0.00	69	0	G	NM_020872		74350588	-1			no_errors	ENST00000263665	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
COL17A1	1308	genome.wustl.edu	37	10	105801271	105801271	+	Silent	SNP	T	T	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr10:105801271T>A	ENST00000353479.5	-	37	2867	c.2577A>T	c.(2575-2577)ccA>ccT	p.P859P	COL17A1_ENST00000369733.3_Silent_p.P859P	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	859	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CGGGTGGGCCTGGGGGACCTT	0.517																																																	0													24.0	27.0	26.0					10																	105801271		2202	4300	6502	SO:0001819	synonymous_variant	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2577A>T	10.37:g.105801271T>A			Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	pfam_Collagen	p.P859	ENST00000353479.5	37	c.2577	CCDS7554.1	10																																																																																			COL17A1	-	NULL	ENSG00000065618		0.517	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	-	0.00	120	0	T	NM_130778, NM_000494		105801271	-1	tier1	-	no_errors	ENST00000353479	ensembl	human	known	74_37	silent	50.00	35	35	SNP	0.998	A
COL1A2	1278	genome.wustl.edu	37	7	94043006	94043006	+	Missense_Mutation	SNP	C	C	A	rs140434765		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:94043006C>A	ENST00000297268.6	+	27	2033	c.1562C>A	c.(1561-1563)gCt>gAt	p.A521D		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	521					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TTTTAGGGTGCTCCAGGTCCT	0.438										HNSCC(75;0.22)																																							0													98.0	93.0	95.0					7																	94043006		2203	4300	6503	SO:0001583	missense	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1562C>A	7.37:g.94043006C>A	ENSP00000297268:p.Ala521Asp		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fib_collagen_C	p.A521D	ENST00000297268.6	37	c.1562	CCDS34682.1	7	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837665	0.50951	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93659	-3.26	5.4	5.4	0.78164	.	0.268946	0.36703	N	0.002444	D	0.90810	0.7114	N	0.12746	0.255	0.50467	D	0.999873	P	0.48834	0.916	P	0.54924	0.764	D	0.87596	0.2494	10	0.10636	T	0.68	.	19.5643	0.95386	0.0:1.0:0.0:0.0	.	521	P08123	CO1A2_HUMAN	D	521;522	ENSP00000297268:A521D	ENSP00000297268:A521D	A	+	2	0	COL1A2	93880942	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.900000	0.63252	2.700000	0.92200	0.655000	0.94253	GCT	COL1A2	-	pfam_Collagen	ENSG00000164692		0.438	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2		0.00	41	0	C	NM_000089		94043006	+1			no_errors	ENST00000297268	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	A
COL22A1	169044	genome.wustl.edu	37	8	139715569	139715569	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:139715569G>A	ENST00000303045.6	-	31	2985	c.2539C>T	c.(2539-2541)Cct>Tct	p.P847S	COL22A1_ENST00000435777.1_Missense_Mutation_p.P847S|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	847	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AACCCGGGAGGGCCTGCAGGA	0.478										HNSCC(7;0.00092)																																							0													84.0	83.0	83.0					8																	139715569		2203	4300	6503	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2539C>T	8.37:g.139715569G>A	ENSP00000303153:p.Pro847Ser		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.P847S	ENST00000303045.6	37	c.2539	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	G	7.426	0.637752	0.14386	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.97665	-4.48;-4.48	3.95	3.95	0.45737	.	0.000000	0.47093	U	0.000257	D	0.97114	0.9057	M	0.64567	1.98	0.39990	D	0.975026	D;D	0.89917	1.0;0.993	D;D	0.83275	0.996;0.968	D	0.95110	0.8237	10	0.06891	T	0.86	.	11.7937	0.52084	0.0:0.0:1.0:0.0	.	847;847	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	S	847;847;560	ENSP00000303153:P847S;ENSP00000387655:P847S	ENSP00000303153:P847S	P	-	1	0	COL22A1	139784751	0.995000	0.38212	0.792000	0.32020	0.516000	0.34256	3.698000	0.54771	2.482000	0.83794	0.563000	0.77884	CCT	COL22A1	-	pfam_Collagen	ENSG00000169436		0.478	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	-	0.00	69	0	G	XM_291257		139715569	-1	tier1	-	no_errors	ENST00000303045	ensembl	human	known	74_37	missense	38.30	28	18	SNP	0.809	A
COMMD9	29099	genome.wustl.edu	37	11	36297787	36297787	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:36297787G>T	ENST00000263401.5	-	5	372	c.356C>A	c.(355-357)tCt>tAt	p.S119Y	LINC00610_ENST00000355500.1_lincRNA|COMMD9_ENST00000533308.1_5'Flank|COMMD9_ENST00000452374.2_Missense_Mutation_p.S77Y|COMMD9_ENST00000532705.1_Silent_p.L107L	NM_014186.3	NP_054905.2	Q9P000	COMD9_HUMAN	COMM domain containing 9	119										kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	5	all_lung(20;0.211)	all_hematologic(20;0.107)				GCGTGGCAGAGAGACTGTGGA	0.557																																																	0													90.0	73.0	79.0					11																	36297787		2202	4298	6500	SO:0001583	missense	0			AY542164	CCDS7900.1, CCDS44571.1	11p13	2008-02-05			ENSG00000110442	ENSG00000110442			25014	protein-coding gene	gene with protein product		612299				15799966	Standard	NM_014186		Approved	HSPC166, FLJ31106	uc001mwn.4	Q9P000	OTTHUMG00000166333	ENST00000263401.5:c.356C>A	11.37:g.36297787G>T	ENSP00000263401:p.Ser119Tyr		E9PAN2|Q96FI2|Q9H0R0	Missense_Mutation	SNP	pfam_HCaRG	p.S119Y	ENST00000263401.5	37	c.356	CCDS7900.1	11	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459439	0.84317	.	.	ENSG00000110442	ENST00000263401;ENST00000537683;ENST00000452374	T;T	0.10960	2.82;2.82	5.73	4.82	0.62117	.	0.048985	0.85682	D	0.000000	T	0.37019	0.0988	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.35425	-0.9789	10	0.72032	D	0.01	-19.0372	13.7846	0.63102	0.0753:0.0:0.9247:0.0	.	77;119	Q9P000-2;Q9P000	.;COMD9_HUMAN	Y	119;119;77	ENSP00000263401:S119Y;ENSP00000392510:S77Y	ENSP00000263401:S119Y	S	-	2	0	COMMD9	36254363	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.331000	0.90022	1.417000	0.47077	0.563000	0.77884	TCT	COMMD9	-	pfam_HCaRG	ENSG00000110442		0.557	COMMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMMD9	HGNC	protein_coding	OTTHUMT00000389196.1	-	0.00	26	0	G	NM_014186		36297787	-1	tier1	-	no_errors	ENST00000263401	ensembl	human	known	74_37	missense	17.39	19	4	SNP	1.000	T
CORIN	10699	genome.wustl.edu	37	4	47605414	47605414	+	Splice_Site	SNP	T	T	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:47605414T>G	ENST00000273857.4	-	20	2811	c.2812A>C	c.(2812-2814)Atg>Ctg	p.M938L	CORIN_ENST00000505909.1_Splice_Site_p.M901L|CORIN_ENST00000502252.1_Splice_Site_p.M871L|CORIN_ENST00000508498.1_Splice_Site_p.M799L	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	938	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						aCTGGCTTACTTTTATTGCCC	0.478																																																	0													60.0	59.0	59.0					4																	47605414		2203	4300	6503	SO:0001630	splice_region_variant	0			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.2812+1A>C	4.37:g.47605414T>G			B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_Frizzled_dom,superfamily_Trypsin-like_Pept_dom,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_Frizzled_dom,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,prints_LDrepeatLR_classA_rpt,prints_Peptidase_S1A,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.M938L	ENST00000273857.4	37	c.2812	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	T	9.341	1.062907	0.19987	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909	D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37	5.8	4.63	0.57726	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.124306	0.64402	D	0.000001	T	0.74496	0.3724	N	0.03983	-0.305	0.80722	D	1	B;B	0.20261	0.036;0.043	B;B	0.23852	0.025;0.049	T	0.66232	-0.5975	9	.	.	.	.	11.6076	0.51041	0.0:0.0694:0.0:0.9306	.	871;938	B4E1Y7;Q9Y5Q5	.;CORIN_HUMAN	L	938;799;871;901	ENSP00000273857:M938L;ENSP00000425597:M799L;ENSP00000424212:M871L;ENSP00000425401:M901L	.	M	-	1	0	CORIN	47300171	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.865000	0.62998	1.034000	0.39945	0.459000	0.35465	ATG	CORIN	-	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000145244		0.478	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	HGNC	protein_coding	OTTHUMT00000216906.2	-	0.00	21	0	T		Missense_Mutation	47605414	-1	tier1	-	no_errors	ENST00000273857	ensembl	human	known	74_37	missense	100.00	0	7	SNP	1.000	G
CPXM2	119587	genome.wustl.edu	37	10	125639812	125639812	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr10:125639812G>T	ENST00000241305.3	-	2	472	c.318C>A	c.(316-318)aaC>aaA	p.N106K	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	106					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		TAACTTTTTTGTTGCTGTGTT	0.473																																																	0													191.0	180.0	184.0					10																	125639812		2203	4300	6503	SO:0001583	missense	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.318C>A	10.37:g.125639812G>T	ENSP00000241305:p.Asn106Lys		B4E3Q2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.N106K	ENST00000241305.3	37	c.318	CCDS7637.1	10	.	.	.	.	.	.	.	.	.	.	G	1.107	-0.659369	0.03454	.	.	ENSG00000121898	ENST00000241305;ENST00000418782	D	0.95821	-3.82	3.59	2.66	0.31614	.	0.770737	0.11881	N	0.520502	D	0.85805	0.5782	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.76446	-0.2956	10	0.02654	T	1	-11.5554	8.2981	0.31997	0.0:0.0:0.7647:0.2353	.	106	Q8N436	CPXM2_HUMAN	K	106	ENSP00000241305:N106K	ENSP00000241305:N106K	N	-	3	2	CPXM2	125629802	0.998000	0.40836	1.000000	0.80357	0.283000	0.27025	1.361000	0.34136	1.040000	0.40099	0.655000	0.94253	AAC	CPXM2	-	NULL	ENSG00000121898		0.473	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1	-	0.00	58	0	G	NM_198148		125639812	-1	tier1	-	no_errors	ENST00000241305	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
CRAMP1L	57585	genome.wustl.edu	37	16	1676115	1676115	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:1676115G>A	ENST00000397412.3	+	3	587	c.488G>A	c.(487-489)tGg>tAg	p.W163*	CRAMP1L_ENST00000436138.3_Nonsense_Mutation_p.W160*|CRAMP1L_ENST00000293925.5_Nonsense_Mutation_p.W163*|LA16c-395F10.1_ENST00000415176.1_RNA			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	163	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						CGGCGGCAGTGGGAGTCGTGG	0.647																																																	0													75.0	79.0	78.0					16																	1676115		692	1591	2283	SO:0001587	stop_gained	0			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.488G>A	16.37:g.1676115G>A	ENSP00000380559:p.Trp163*		A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.W163*	ENST00000397412.3	37	c.488	CCDS10440.2	16	.	.	.	.	.	.	.	.	.	.	G	37	6.623517	0.97714	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-20.2845	20.074	0.97736	0.0:0.0:1.0:0.0	.	.	.	.	X	163;163;160	.	ENSP00000293925:W163X	W	+	2	0	CRAMP1L	1616116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.553000	0.98118	2.746000	0.94184	0.655000	0.94253	TGG	CRAMP1L	-	superfamily_Homeodomain-like,smart_SANT/Myb	ENSG00000007545		0.647	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAMP1L	HGNC	protein_coding	OTTHUMT00000157297.4	-	0.00	87	0	G			1676115	+1	tier1	-	no_errors	ENST00000293925	ensembl	human	known	74_37	nonsense	6.78	54	4	SNP	1.000	A
CRYGD	1421	genome.wustl.edu	37	2	208986573	208986573	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:208986573G>C	ENST00000264376.4	-	3	376	c.349C>G	c.(349-351)Cgc>Ggc	p.R117G		NM_006891.3	NP_008822.2	P07320	CRGD_HUMAN	crystallin, gamma D	117	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				cellular response to reactive oxygen species (GO:0034614)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		TCATTGAAGCGGAAGCGGTCC	0.562																																																	0													122.0	116.0	118.0					2																	208986573		2203	4300	6503	SO:0001583	missense	0				CCDS2378.1	2q33.3	2013-02-14			ENSG00000118231	ENSG00000118231			2411	protein-coding gene	gene with protein product		123690		CRYG4			Standard	NM_006891		Approved		uc002vcn.4	P07320	OTTHUMG00000132944	ENST00000264376.4:c.349C>G	2.37:g.208986573G>C	ENSP00000264376:p.Arg117Gly		Q17RF7|Q53R51|Q99681	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.R117G	ENST00000264376.4	37	c.349	CCDS2378.1	2	.	.	.	.	.	.	.	.	.	.	G	13.09	2.132528	0.37630	.	.	ENSG00000118231	ENST00000264376	T	0.75589	-0.95	4.25	3.38	0.38709	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.439725	0.25535	N	0.030015	T	0.63815	0.2543	N	0.26162	0.8	0.24754	N	0.992964	B	0.22983	0.078	B	0.37888	0.26	T	0.57136	-0.7863	10	0.49607	T	0.09	.	5.1593	0.15053	0.1054:0.0:0.6913:0.2032	.	117	P07320	CRGD_HUMAN	G	117	ENSP00000264376:R117G	ENSP00000264376:R117G	R	-	1	0	CRYGD	208694818	0.959000	0.32827	0.936000	0.37596	0.977000	0.68977	2.522000	0.45572	1.013000	0.39391	0.555000	0.69702	CGC	CRYGD	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000118231		0.562	CRYGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGD	HGNC	protein_coding	OTTHUMT00000256476.2	-	0.00	54	0	G	NM_006891		208986573	-1	tier1	-	no_errors	ENST00000264376	ensembl	human	known	74_37	missense	38.46	23	15	SNP	0.722	C
CTNNB1	1499	genome.wustl.edu	37	3	41266100	41266100	+	Missense_Mutation	SNP	T	T	G	rs121913416		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:41266100T>G	ENST00000349496.5	+	3	377	c.97T>G	c.(97-99)Tct>Gct	p.S33A	CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.S33P(47)|p.S33A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_D32del(4)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.D32_S33insS(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33T(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTACCTGGACTCTGGAATCCA	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)			Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	212	Deletion - In frame(115)|Substitution - Missense(70)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(1)	liver(130)|large_intestine(20)|endometrium(14)|stomach(10)|pituitary(9)|pancreas(9)|central_nervous_system(8)|adrenal_gland(2)|small_intestine(2)|biliary_tract(2)|skin(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|breast(1)											93.0	77.0	82.0					3																	41266100		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.97T>G	3.37:g.41266100T>G	ENSP00000344456:p.Ser33Ala		A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.S33A	ENST00000349496.5	37	c.97	CCDS2694.1	3	.	.	.	.	.	.	.	.	.	.	T	22.6	4.317386	0.81469	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74509	-0.3642	10	0.87932	D	0	-10.7796	16.0677	0.80897	0.0:0.0:0.0:1.0	.	33	P35222	CTNB1_HUMAN	A	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26A;ENSP00000385604:S33A;ENSP00000412219:S33A;ENSP00000379486:S33A;ENSP00000344456:S33A;ENSP00000411226:S26A;ENSP00000379488:S33A;ENSP00000409302:S33A;ENSP00000401599:S33A	ENSP00000344456:S33A	S	+	1	0	CTNNB1	41241104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	CTNNB1	-	NULL	ENSG00000168036		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2	-	0.00	30	0	T	NM_001098210		41266100	+1	tier1	-	no_errors	ENST00000349496	ensembl	human	known	74_37	missense	50.00	8	8	SNP	1.000	G
CTTNBP2	83992	genome.wustl.edu	37	7	117432023	117432023	+	Silent	SNP	G	G	T	rs367880685		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:117432023G>T	ENST00000160373.3	-	4	1318	c.1227C>A	c.(1225-1227)acC>acA	p.T409T	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	409	Pro-rich.				brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GTGTTTGAGCGGTGGGAGGGG	0.517																																																	0													194.0	173.0	180.0					7																	117432023		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1227C>A	7.37:g.117432023G>T			O43389|Q7LG11|Q9C0A5	Silent	SNP	pfam_Cortactin-binding_p2_N,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T409	ENST00000160373.3	37	c.1227	CCDS5774.1	7																																																																																			CTTNBP2	-	NULL	ENSG00000077063		0.517	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4	-	0.00	111	0	G	NM_033427		117432023	-1	tier1	-	no_errors	ENST00000160373	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.000	T
CUL9	23113	genome.wustl.edu	37	6	43181534	43181534	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:43181534G>T	ENST00000252050.4	+	29	5656	c.5572G>T	c.(5572-5574)Gag>Tag	p.E1858*	CUL9_ENST00000502937.1_3'UTR|CUL9_ENST00000354495.3_Nonsense_Mutation_p.E1748*|CUL9_ENST00000372647.2_Splice_Site|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1858					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCTGAACGTAGAGAAGGATGA	0.582																																																	0													81.0	82.0	81.0					6																	43181534		2203	4300	6503	SO:0001587	stop_gained	0			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5572G>T	6.37:g.43181534G>T	ENSP00000252050:p.Glu1858*		O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Nonsense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_Znf_C6HC,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,superfamily_UBA-like,smart_Cullin_neddylation_domain,smart_Znf_C6HC,pfscan_Znf_RING,pfscan_Cullin_homology	p.E1858*	ENST00000252050.4	37	c.5572	CCDS4890.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.68|12.68	2.009876|2.009876	0.35415|0.35415	.|.	.|.	ENSG00000112659|ENSG00000112659	ENST00000372647|ENST00000252050;ENST00000354495	.|.	.|.	.|.	5.22|5.22	4.34|4.34	0.51931|0.51931	.|.	.|0.101939	.|0.64402	.|D	.|0.000004	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.87932	.|D	.|0	.|-17.0194	15.7187|15.7187	0.77691|0.77691	0.0:0.1372:0.8628:0.0|0.0:0.1372:0.8628:0.0	.|.	.|.	.|.	.|.	.|X	-1|1858;1748	.|.	.|ENSP00000252050:E1858X	.|E	+|+	.|1	.|0	CUL9|CUL9	43289512|43289512	1.000000|1.000000	0.71417|0.71417	0.731000|0.731000	0.30826|0.30826	0.500000|0.500000	0.33767|0.33767	4.556000|4.556000	0.60775|0.60775	1.176000|1.176000	0.42840|0.42840	0.655000|0.655000	0.94253|0.94253	.|GAG	CUL9	-	NULL	ENSG00000112659		0.582	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL9	HGNC	protein_coding	OTTHUMT00000040582.2	-	0.00	118	0	G	NM_015089		43181534	+1	tier1	-	no_errors	ENST00000252050	ensembl	human	known	74_37	nonsense	5.48	68	4	SNP	0.999	T
CUX2	23316	genome.wustl.edu	37	12	111736347	111736347	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:111736347C>A	ENST00000261726.6	+	9	861	c.707C>A	c.(706-708)gCa>gAa	p.A236E		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	236					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						TGTCTCAGGGCAGATGAAGTC	0.662																																																	0													22.0	23.0	23.0					12																	111736347		1916	4124	6040	SO:0001583	missense	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.707C>A	12.37:g.111736347C>A	ENSP00000261726:p.Ala236Glu		A7E2Y4	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.A236E	ENST00000261726.6	37	c.707	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	C	23.6	4.431276	0.83776	.	.	ENSG00000111249	ENST00000261726	T	0.49720	0.77	4.32	4.32	0.51571	.	0.227062	0.45361	D	0.000364	T	0.51924	0.1703	M	0.62723	1.935	0.37643	D	0.922136	P	0.50943	0.94	P	0.47915	0.561	T	0.58075	-0.7700	10	0.28530	T	0.3	-12.2396	15.7529	0.78001	0.0:1.0:0.0:0.0	.	236	O14529	CUX2_HUMAN	E	236	ENSP00000261726:A236E	ENSP00000261726:A236E	A	+	2	0	CUX2	110220730	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.280000	0.58959	2.131000	0.65755	0.561000	0.74099	GCA	CUX2	-	NULL	ENSG00000111249		0.662	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1		0.00	133	0	C	NM_015267		111736347	+1			no_errors	ENST00000261726	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
CYFIP1	23191	genome.wustl.edu	37	15	22999533	22999533	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:22999533G>T	ENST00000313077.7	+	29	3530	c.3405G>T	c.(3403-3405)caG>caT	p.Q1135H	CYFIP1_ENST00000560848.1_Missense_Mutation_p.Q1135H|CYFIP1_ENST00000435939.2_Missense_Mutation_p.Q704H	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GTGCCATGCAGTTTGTCTACT	0.587																																																	0													79.0	71.0	74.0					15																	22999533		2203	4300	6503	SO:0001583	missense	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.3405G>T	15.37:g.22999533G>T	ENSP00000324549:p.Gln1135His			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.Q1135H	ENST00000313077.7	37	c.3405	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016888	0.93404	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.29397	1.57;1.57	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000006	T	0.64800	0.2631	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.73380	0.98;0.958	T	0.72821	-0.4177	10	0.87932	D	0	-36.6457	19.1954	0.93686	0.0:0.0:1.0:0.0	.	704;1135	Q7L576-2;Q7L576	.;CYFP1_HUMAN	H	1135;1137;704	ENSP00000324549:Q1135H;ENSP00000405956:Q704H	ENSP00000324549:Q1135H	Q	+	3	2	CYFIP1	20550974	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.681000	0.74523	2.624000	0.88883	0.561000	0.74099	CAG	CYFIP1	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	ENSG00000068793		0.587	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2		0.00	38	0	G	NM_014608		22999533	+1			no_errors	ENST00000313077	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
CYP24A1	1591	genome.wustl.edu	37	20	52779343	52779343	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:52779343G>T	ENST00000216862.3	-	7	1296	c.903C>A	c.(901-903)ttC>ttA	p.F301L	CYP24A1_ENST00000395955.3_Missense_Mutation_p.F301L|CYP24A1_ENST00000395954.3_Missense_Mutation_p.F159L	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	301					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	TGTCACAAAGGAAATCTGCAC	0.453																																																	0													89.0	82.0	84.0					20																	52779343		2203	4300	6503	SO:0001583	missense	0			U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.903C>A	20.37:g.52779343G>T	ENSP00000216862:p.Phe301Leu		Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_CYP24A_mit,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.F301L	ENST00000216862.3	37	c.903	CCDS33491.1	20	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953426	0.34471	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	T;T;T	0.70516	-0.49;-0.49;-0.49	5.6	2.6	0.31112	.	0.052897	0.85682	D	0.000000	T	0.58395	0.2119	L	0.35487	1.065	0.45567	D	0.998518	B;B;B	0.24317	0.004;0.101;0.059	B;B;B	0.32980	0.043;0.156;0.042	T	0.52859	-0.8519	10	0.29301	T	0.29	-26.2327	8.5483	0.33435	0.3461:0.0:0.6539:0.0	.	301;301;159	Q32ML3;Q07973;Q5I2W7	.;CP24A_HUMAN;.	L	301;301;159	ENSP00000216862:F301L;ENSP00000379285:F301L;ENSP00000379284:F159L	ENSP00000216862:F301L	F	-	3	2	CYP24A1	52212750	0.985000	0.35326	0.980000	0.43619	0.715000	0.41141	0.189000	0.17037	1.370000	0.46153	0.655000	0.94253	TTC	CYP24A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP24A_mit	ENSG00000019186		0.453	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP24A1	HGNC	protein_coding	OTTHUMT00000079769.2	-	0.00	77	0	G			52779343	-1	tier1	-	no_errors	ENST00000216862	ensembl	human	known	74_37	missense	22.03	46	13	SNP	0.998	T
DAB2IP	153090	genome.wustl.edu	37	9	124530738	124530738	+	Silent	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:124530738C>A	ENST00000408936.3	+	10	1907	c.1725C>A	c.(1723-1725)tcC>tcA	p.S575S	DAB2IP_ENST00000259371.2_Silent_p.S547S|DAB2IP_ENST00000309989.1_Silent_p.S451S			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	575					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						AATACATGTCCTTCATGAACC	0.587																																																	0													139.0	121.0	127.0					9																	124530738		2203	4300	6503	SO:0001819	synonymous_variant	0			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.1725C>A	9.37:g.124530738C>A			A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Silent	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.S575	ENST00000408936.3	37	c.1725		9																																																																																			DAB2IP	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP	ENSG00000136848		0.587	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	HGNC	protein_coding	OTTHUMT00000317857.1	-	0.00	78	0	C	NM_032552		124530738	+1	tier1	-	no_errors	ENST00000408936	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.905	A
DCC	1630	genome.wustl.edu	37	18	50866153	50866153	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr18:50866153G>A	ENST00000442544.2	+	15	2851	c.2235G>A	c.(2233-2235)tgG>tgA	p.W745*	DCC_ENST00000581580.1_Nonsense_Mutation_p.W400*|DCC_ENST00000412726.1_Nonsense_Mutation_p.W593*	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	745	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCATGAGTTGGACTCCTCCCT	0.493																																																	0													241.0	199.0	213.0					18																	50866153		2203	4300	6503	SO:0001587	stop_gained	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.2235G>A	18.37:g.50866153G>A	ENSP00000389140:p.Trp745*			Nonsense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W745*	ENST00000442544.2	37	c.2235	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	40	8.392058	0.98791	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	.	.	.	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.7948	0.88566	0.0:0.0:1.0:0.0	.	.	.	.	X	745;678;593	.	ENSP00000304146:W678X	W	+	3	0	DCC	49120151	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.504000	0.97986	2.565000	0.86533	0.655000	0.94253	TGG	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187323		0.493	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	44	0	G	NM_005215		50866153	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	nonsense	45.45	6	5	SNP	1.000	A
DHRS7B	25979	genome.wustl.edu	37	17	21081549	21081549	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:21081549G>T	ENST00000395511.3	+	3	523	c.203G>T	c.(202-204)tGt>tTt	p.C68F	DHRS7B_ENST00000579303.1_Missense_Mutation_p.C53F	NM_015510.4	NP_056325.2	Q6IAN0	DRS7B_HUMAN	dehydrogenase/reductase (SDR family) member 7B	68						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|pancreas(2)	7						CCCTTAGAATGTGCAAAAGTC	0.512																																																	0													119.0	110.0	113.0					17																	21081549		2203	4300	6503	SO:0001583	missense	0			BC004126	CCDS11215.1	17p12	2011-09-20				ENSG00000109016		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	24547	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 1"""					10810093, 11230166, 19027726	Standard	NM_015510		Approved	DKFZp566O084, MGC8916, CGI-93, SDR32C1	uc002gyo.3	Q6IAN0		ENST00000395511.3:c.203G>T	17.37:g.21081549G>T	ENSP00000378887:p.Cys68Phe		B5MEF4|Q6UX59|Q9BTF9|Q9UFM6|Q9Y3A1	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_DUF1776_fun,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.C68F	ENST00000395511.3	37	c.203	CCDS11215.1	17	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217685	0.79352	.	.	ENSG00000109016	ENST00000395511;ENST00000346603	D	0.87103	-2.21	5.38	5.38	0.77491	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87541	0.6203	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90047	0.4146	10	0.56958	D	0.05	.	19.489	0.95042	0.0:0.0:1.0:0.0	.	68	Q6IAN0	DRS7B_HUMAN	F	68	ENSP00000378887:C68F	ENSP00000320352:C68F	C	+	2	0	DHRS7B	21022141	1.000000	0.71417	0.999000	0.59377	0.927000	0.56198	7.864000	0.87037	2.684000	0.91462	0.555000	0.69702	TGT	DHRS7B	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	ENSG00000109016		0.512	DHRS7B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DHRS7B	HGNC	protein_coding	OTTHUMT00000444066.3	-	0.00	75	0	G	NM_015510		21081549	+1	tier1	-	no_errors	ENST00000395511	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
DLGAP5	9787	genome.wustl.edu	37	14	55615075	55615075	+	Silent	SNP	T	T	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:55615075T>C	ENST00000247191.2	-	19	2751	c.2535A>G	c.(2533-2535)gaA>gaG	p.E845E	DLGAP5_ENST00000395425.2_3'UTR	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	845					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						AAATTCAAAATTCTCCTGGTT	0.318																																																	0													76.0	84.0	81.0					14																	55615075		2203	4300	6503	SO:0001819	synonymous_variant	0			D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.2535A>G	14.37:g.55615075T>C			A8MTM6|B4DRM8|Q86T11|Q8NG58	Silent	SNP	pfam_GKAP	p.E845	ENST00000247191.2	37	c.2535	CCDS9723.1	14																																																																																			DLGAP5	-	NULL	ENSG00000126787		0.318	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP5	HGNC	protein_coding	OTTHUMT00000276908.2	-	0.00	94	0	T	NM_014750		55615075	-1	tier1	-	no_errors	ENST00000247191	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.249	C
DNAH12	201625	genome.wustl.edu	37	3	57327776	57327776	+	3'UTR	SNP	T	T	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:57327776T>A	ENST00000351747.2	-	0	9492				ASB14_ENST00000389601.3_5'Flank|DNAH12_ENST00000344804.4_Intron|DNAH12_ENST00000462713.1_5'UTR|ASB14_ENST00000487349.1_5'Flank	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TTTTTTTTTTTAAACTTTTGG	0.328																																																	0													17.0	18.0	18.0					3																	57327776		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.*33A>T	3.37:g.57327776T>A			A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	RNA	SNP	-	NULL	ENST00000351747.2	37	NULL		3																																																																																			DNAH12	-	-	ENSG00000174844		0.328	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		-	0.00	19	0	T	NM_178504		57327776	-1	tier1	-	no_errors	ENST00000462713	ensembl	human	known	74_37	rna	50.00	5	5	SNP	0.000	A
DNAH14	127602	genome.wustl.edu	37	1	225268353	225268353	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:225268353delT	ENST00000445597.2	+	15	2841	c.2841delT	c.(2839-2841)tctfs	p.S947fs	DNAH14_ENST00000439375.2_Frame_Shift_Del_p.S1013fs|DNAH14_ENST00000430092.1_Frame_Shift_Del_p.S1013fs			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	947					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AGCGAGCCTCTTGGGAATGGA	0.388																																																	0													54.0	43.0	46.0					1																	225268353		692	1591	2283	SO:0001589	frameshift_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.2841delT	1.37:g.225268353delT	ENSP00000409472:p.Ser947fs		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Frame_Shift_Del	DEL	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.W1014fs	ENST00000445597.2	37	c.3039		1																																																																																			DNAH14	-	pfam_Dynein_heavy_dom-2	ENSG00000185842		0.388	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3		0.00	53	0	T	XM_059166		225268353	+1	tier1		no_errors	ENST00000430092	ensembl	human	known	74_37	frame_shift_del	14.29	12	2	DEL	0.000	-
DNAJC17	55192	genome.wustl.edu	37	15	41067283	41067283	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:41067283C>A	ENST00000220496.4	-	8	576	c.546G>T	c.(544-546)gaG>gaT	p.E182D		NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	182	RRM.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		TTGACTCATCCTCCTTCTTGC	0.498																																																	0													166.0	127.0	140.0					15																	41067283		2203	4300	6503	SO:0001583	missense	0			AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.546G>T	15.37:g.41067283C>A	ENSP00000220496:p.Glu182Asp			Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_RRM_dom,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.E182D	ENST00000220496.4	37	c.546	CCDS10065.1	15	.	.	.	.	.	.	.	.	.	.	C	10.80	1.452869	0.26161	.	.	ENSG00000104129	ENST00000220496	T	0.17691	2.26	5.02	-2.31	0.06765	.	0.099482	0.64402	D	0.000002	T	0.05181	0.0138	N	0.10782	0.045	0.42148	D	0.991547	B	0.06786	0.001	B	0.06405	0.002	T	0.35822	-0.9773	10	0.15499	T	0.54	.	1.1206	0.01724	0.2139:0.3065:0.1083:0.3714	.	182	Q9NVM6	DJC17_HUMAN	D	182	ENSP00000220496:E182D	ENSP00000220496:E182D	E	-	3	2	DNAJC17	38854575	0.999000	0.42202	0.603000	0.28903	0.959000	0.62525	0.468000	0.22051	-0.103000	0.12175	0.561000	0.74099	GAG	DNAJC17	-	NULL	ENSG00000104129		0.498	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC17	HGNC	protein_coding	OTTHUMT00000252356.2	-	0.00	51	0	C	NM_018163		41067283	-1	tier1	-	no_errors	ENST00000220496	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.922	A
EHMT2	10919	genome.wustl.edu	37	6	31851610	31851610	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:31851610G>T	ENST00000375537.4	-	22	2895	c.2889C>A	c.(2887-2889)aaC>aaA	p.N963K	EHMT2_ENST00000375528.4_Missense_Mutation_p.N986K|EHMT2_ENST00000395728.3_Missense_Mutation_p.N1020K|EHMT2_ENST00000375530.4_Missense_Mutation_p.N929K|EHMT2_ENST00000480912.1_5'UTR|EHMT2-AS1_ENST00000434689.1_RNA	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	963					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						TGCGATCGATGTTCATGGTGG	0.567																																																	0													166.0	157.0	160.0					6																	31851610		2203	4300	6503	SO:0001583	missense	0			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.2889C>A	6.37:g.31851610G>T	ENSP00000364687:p.Asn963Lys		B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.N1020K	ENST00000375537.4	37	c.3060	CCDS4725.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.73|17.73	3.460772|3.460772	0.63513|0.63513	.|.	.|.	ENSG00000204371|ENSG00000204371	ENST00000436026|ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	.|D;D;D;D	.|0.89123	.|-2.47;-2.47;-2.47;-2.47	5.45|5.45	1.15|1.15	0.20763|0.20763	.|Pre-SET zinc-binding sub-group (1);Pre-SET domain (1);	.|0.048642	.|0.85682	.|D	.|0.000000	T|T	0.80696|0.80696	0.4672|0.4672	L|L	0.41573|0.41573	1.285|1.285	0.47737|0.47737	D|D	0.999503|0.999503	.|P;B;P;P	.|0.43750	.|0.807;0.28;0.816;0.717	.|B;B;P;P	.|0.48189	.|0.441;0.252;0.57;0.465	T|T	0.78976|0.78976	-0.1991|-0.1991	5|10	.|0.56958	.|D	.|0.05	.|.	9.5722|9.5722	0.39436|0.39436	0.4106:0.0:0.5894:0.0|0.4106:0.0:0.5894:0.0	.|.	.|986;929;963;784	.|A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.|.;.;EHMT2_HUMAN;.	N|K	294|1020;986;929;963;784	.|ENSP00000379078:N1020K;ENSP00000364678:N986K;ENSP00000364680:N929K;ENSP00000364687:N963K	.|ENSP00000364678:N986K	H|N	-|-	1|3	0|2	EHMT2|EHMT2	31959589|31959589	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.838000|0.838000	0.47535|0.47535	2.342000|2.342000	0.43992|0.43992	0.293000|0.293000	0.22520|0.22520	-0.145000|-0.145000	0.13849|0.13849	CAT|AAC	EHMT2	-	pfam_Pre-SET_dom,smart_Pre-SET_Zn-bd_sub	ENSG00000204371		0.567	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	HGNC	protein_coding	OTTHUMT00000076355.5	-	0.00	52	0	G	NM_006709		31851610	-1	tier1	-	no_errors	ENST00000395728	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.998	T
ELFN2	114794	genome.wustl.edu	37	22	37771876	37771877	+	5'UTR	INS	-	-	CCT	rs553606382|rs142158248|rs370069619	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr22:37771876_37771877insCCT	ENST00000402918.2	-	0	483_484				ELFN2_ENST00000435824.1_5'UTR|RP1-63G5.8_ENST00000609322.1_RNA|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2						negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					GACTtcctctccctcctcctcc	0.634														1306	0.260783	0.2088	0.2161	5008	,	,		16480	0.3343		0.2763	False		,,,				2504	0.271																0																																										SO:0001623	5_prime_UTR_variant	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.-303->AGG	22.37:g.37771883_37771885dupCCT			Q96PY3	RNA	INS	-	NULL	ENST00000402918.2	37	NULL	CCDS33642.1	22																																																																																			ELFN2	-	-	ENSG00000166897		0.634	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2		0.00	36	0	-	NM_052906		37771877	-1	tier1		no_errors	ENST00000414347	ensembl	human	known	74_37	rna	10.42	43	5	INS	0.001:0.043	CCT
ENPEP	2028	genome.wustl.edu	37	4	111430838	111430838	+	Frame_Shift_Del	DEL	G	G	-	rs142050074		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:111430838delG	ENST00000265162.5	+	5	1411	c.1069delG	c.(1069-1071)ggtfs	p.G357fs	RP11-380D23.1_ENST00000503998.1_RNA	NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	357	Substrate binding. {ECO:0000250}.				angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		TTTTGGCACTGGTGCCATGGA	0.418																																																	0													134.0	131.0	132.0					4																	111430838		2203	4300	6503	SO:0001589	frameshift_variant	0			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1069delG	4.37:g.111430838delG	ENSP00000265162:p.Gly357fs		Q504U2	Frame_Shift_Del	DEL	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.G357fs	ENST00000265162.5	37	c.1069	CCDS3691.1	4																																																																																			ENPEP	-	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	ENSG00000138792		0.418	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	HGNC	protein_coding	OTTHUMT00000255747.2		0.00	96	0	G			111430838	+1	tier1		no_errors	ENST00000265162	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	1.000	-
ENPP5	59084	genome.wustl.edu	37	6	46133249	46133249	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:46133249G>C	ENST00000371383.2	-	4	1141	c.881C>G	c.(880-882)aCt>aGt	p.T294S	ENPP5_ENST00000230565.3_Missense_Mutation_p.T294S|ENPP5_ENST00000492313.1_5'UTR					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						TTTGTAAACAGTAAGATTAGG	0.398																																																	0													204.0	179.0	187.0					6																	46133249		2203	4300	6503	SO:0001583	missense	0			AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.881C>G	6.37:g.46133249G>C	ENSP00000360436:p.Thr294Ser			Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.T294S	ENST00000371383.2	37	c.881	CCDS4915.1	6	.	.	.	.	.	.	.	.	.	.	G	15.31	2.794629	0.50102	.	.	ENSG00000112796	ENST00000371383;ENST00000230565	T;T	0.71341	-0.56;-0.56	5.77	5.77	0.91146	Alkaline-phosphatase-like, core domain (1);	0.179817	0.50627	D	0.000120	T	0.49218	0.1544	L	0.52206	1.635	0.25440	N	0.988104	P;P	0.37548	0.599;0.599	B;B	0.38296	0.27;0.27	T	0.43893	-0.9363	10	0.25751	T	0.34	-20.4505	11.1035	0.48188	0.0:0.1185:0.6485:0.233	.	294;294	A8K9X7;Q9UJA9	.;ENPP5_HUMAN	S	294	ENSP00000360436:T294S;ENSP00000230565:T294S	ENSP00000230565:T294S	T	-	2	0	ENPP5	46241208	0.993000	0.37304	0.954000	0.39281	0.305000	0.27757	1.230000	0.32612	2.884000	0.98904	0.655000	0.94253	ACT	ENPP5	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000112796		0.398	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP5	HGNC	protein_coding	OTTHUMT00000040779.2	-	0.00	79	0	G			46133249	-1	tier1	-	no_errors	ENST00000230565	ensembl	human	known	74_37	missense	19.44	29	7	SNP	0.934	C
CCAR2	57805	genome.wustl.edu	37	8	22473839	22473839	+	Intron	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:22473839C>A	ENST00000308511.4	+	14	2094				CCAR2_ENST00000520861.1_Intron|RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000389279.3_Intron			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GTTCCGAGCGCTTCCTGTGCC	0.612																																																	0																																										SO:0001627	intron_variant	0			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1845+78C>A	8.37:g.22473839C>A			A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	RNA	SNP	-	NULL	ENST00000308511.4	37	NULL	CCDS34863.1	8																																																																																			RP11-582J16.5	-	-	ENSG00000253200		0.612	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253200	Clone_based_vega_gene	protein_coding	OTTHUMT00000375865.1	-	0.00	19	0	C	NM_021174		22473839	-1	tier1	-	no_errors	ENST00000521025	ensembl	human	known	74_37	rna	25.00	9	3	SNP	0.000	A
KLK6	5653	genome.wustl.edu	37	19	51471489	51471489	+	Intron	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:51471489C>T	ENST00000376851.3	-	2	432				KLK6_ENST00000310157.2_Intron|KLK6_ENST00000594641.1_5'Flank|CTB-147C22.9_ENST00000594512.1_RNA|KLK6_ENST00000391808.1_Intron|KLK6_ENST00000424910.2_5'Flank|KLK6_ENST00000376853.4_5'Flank	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6						amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		GCCTTGACCTCTGTCCTTCCC	0.537																																																	0																																										SO:0001627	intron_variant	0			U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.8-121G>A	19.37:g.51471489C>T			A6NJA1|A8MW09|Q6H301	RNA	SNP	-	NULL	ENST00000376851.3	37	NULL	CCDS12811.1	19																																																																																			CTB-147C22.9	-	-	ENSG00000267879		0.537	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000267879	Clone_based_vega_gene	protein_coding	OTTHUMT00000465060.1	-	0.00	30	0	C	NM_002774		51471489	+1	tier1	-	no_errors	ENST00000594512	ensembl	human	known	74_37	rna	37.50	25	15	SNP	0.000	T
EPHB2	2048	genome.wustl.edu	37	1	23110900	23110900	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:23110900G>T	ENST00000400191.3	+	3	160	c.142G>T	c.(142-144)Ggc>Tgc	p.G48C	EPHB2_ENST00000544305.1_Missense_Mutation_p.G48C|EPHB2_ENST00000374632.3_Missense_Mutation_p.G48C|EPHB2_ENST00000374630.3_Missense_Mutation_p.G48C|EPHB2_ENST00000374627.1_Missense_Mutation_p.G42C	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	48	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		AGAGGTGAGTGGCTACGATGA	0.552																																																	0													95.0	80.0	85.0					1																	23110900		2203	4300	6503	SO:0001583	missense	0			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.142G>T	1.37:g.23110900G>T	ENSP00000383053:p.Gly48Cys		O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G48C	ENST00000400191.3	37	c.142		1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169485	0.78452	.	.	ENSG00000133216	ENST00000374625;ENST00000544305;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T;T	0.10288	2.89;2.89;2.89;2.89;2.89	5.19	5.19	0.71726	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.41259	0.1151	M	0.88570	2.965	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.996	T	0.45293	-0.9271	10	0.72032	D	0.01	.	17.4346	0.87548	0.0:0.0:1.0:0.0	.	48;48;66;48	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	C	48;48;48;48;48;42	ENSP00000444174:G48C;ENSP00000363761:G48C;ENSP00000383053:G48C;ENSP00000363763:G48C;ENSP00000363758:G42C	ENSP00000363755:G48C	G	+	1	0	EPHB2	22983487	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.578000	0.98200	2.704000	0.92352	0.484000	0.47621	GGC	EPHB2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000133216		0.552	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	HGNC	protein_coding	OTTHUMT00000008060.2		0.00	42	0	G	NM_017449		23110900	+1			no_errors	ENST00000400191	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
ERC2	26059	genome.wustl.edu	37	3	55543261	55543262	+	3'UTR	INS	-	-	T	rs148198090		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:55543261_55543262insT	ENST00000288221.6	-	0	5211_5212				ERC2_ENST00000486496.1_5'UTR	NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		ACATGGGTTGGTTTTTTTTTTC	0.386																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.*2083->A	3.37:g.55543271_55543271dupT			Q2T9F6|Q86TK4	RNA	INS	-	NULL	ENST00000288221.6	37	NULL	CCDS46851.1	3																																																																																			ERC2	-	-	ENSG00000187672		0.386	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2		0.00	28	0	-	NM_015576		55543262	-1	tier1		no_errors	ENST00000484530	ensembl	human	known	74_37	rna	15.79	16	3	INS	0.078:0.002	T
FAM105A	54491	genome.wustl.edu	37	5	14607502	14607502	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:14607502G>T	ENST00000274217.3	+	6	682	c.562G>T	c.(562-564)Gag>Tag	p.E188*		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	188	OTU.									large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					TTTTGGTCCTGAGAAGTATAC	0.378																																																	0													145.0	146.0	146.0					5																	14607502		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.562G>T	5.37:g.14607502G>T	ENSP00000274217:p.Glu188*		Q53H50|Q9H037	Nonsense_Mutation	SNP	prints_FAM105,prints_FAM105A	p.E188*	ENST00000274217.3	37	c.562	CCDS3884.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.573827	0.96553	.	.	ENSG00000145569	ENST00000274217	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-30.3016	19.7398	0.96223	0.0:0.0:1.0:0.0	.	.	.	.	X	188	.	ENSP00000274217:E188X	E	+	1	0	FAM105A	14660502	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.744000	0.74854	2.660000	0.90430	0.655000	0.94253	GAG	FAM105A	-	prints_FAM105A	ENSG00000145569		0.378	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM105A	HGNC	protein_coding	OTTHUMT00000253710.1	-	0.00	88	0	G	NM_019018		14607502	+1	tier1	-	no_errors	ENST00000274217	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	1.000	T
FAM117A	81558	genome.wustl.edu	37	17	47794910	47794910	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:47794910G>A	ENST00000240364.2	-	6	954	c.875C>T	c.(874-876)gCc>gTc	p.A292V	FAM117A_ENST00000513602.1_Missense_Mutation_p.A20V|RP11-613C6.2_ENST00000512720.1_RNA|FAM117A_ENST00000514018.1_5'Flank	NM_030802.3	NP_110429.1	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	292										haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	17						CTCCTCGGCGGCACCCCGATG	0.627																																																	0													38.0	35.0	36.0					17																	47794910		2190	4285	6475	SO:0001583	missense	0			BC037572	CCDS11553.1	17q21.33	2006-04-26				ENSG00000121104			24179	protein-coding gene	gene with protein product	"""C/EBP induced protein"""					12477932	Standard	NM_030802		Approved		uc002ipk.3	Q9C073		ENST00000240364.2:c.875C>T	17.37:g.47794910G>A	ENSP00000240364:p.Ala292Val		B7Z7Q3	Missense_Mutation	SNP	NULL	p.A292V	ENST00000240364.2	37	c.875	CCDS11553.1	17	.	.	.	.	.	.	.	.	.	.	G	10.80	1.453685	0.26161	.	.	ENSG00000121104	ENST00000240364;ENST00000511743	.	.	.	5.2	3.14	0.36123	.	0.469078	0.20231	N	0.096480	T	0.14700	0.0355	N	0.03608	-0.345	0.09310	N	1	B	0.19583	0.037	B	0.19148	0.024	T	0.11036	-1.0604	9	0.38643	T	0.18	-27.5635	5.7251	0.18008	0.1572:0.1733:0.6695:0.0	.	292	Q9C073	F117A_HUMAN	V	292;182	.	ENSP00000240364:A292V	A	-	2	0	FAM117A	45149909	0.131000	0.22433	0.031000	0.17742	0.638000	0.38207	1.832000	0.39151	1.385000	0.46445	0.655000	0.94253	GCC	FAM117A	-	NULL	ENSG00000121104		0.627	FAM117A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM117A	HGNC	protein_coding	OTTHUMT00000365736.1	-	0.00	47	0	G	NM_030802		47794910	-1	tier1	-	no_errors	ENST00000240364	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.091	A
FAM162A	26355	genome.wustl.edu	37	3	122121729	122121729	+	Splice_Site	SNP	C	C	A	rs199578714		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:122121729C>A	ENST00000477892.1	+	2	241	c.157C>A	c.(157-159)Cgc>Agc	p.R53S	FAM162A_ENST00000469967.1_Splice_Site_p.R53S|FAM162A_ENST00000232125.5_Splice_Site_p.R43S	NM_014367.3	NP_055182.3	Q96A26	F162A_HUMAN	family with sequence similarity 162, member A	53					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to hypoxia (GO:0071456)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6						AGCTCCATCCCGTAAGTTTTT	0.383																																																	0													67.0	64.0	65.0					3																	122121729		1812	4069	5881	SO:0001630	splice_region_variant	0			AF191020	CCDS43139.1	3q21.1	2008-06-05	2008-06-05	2008-06-05	ENSG00000114023	ENSG00000114023			17865	protein-coding gene	gene with protein product		608017	"""chromosome 3 open reading frame 28"""	C3orf28		11085516	Standard	NM_014367		Approved	E2IG5	uc003eez.3	Q96A26	OTTHUMG00000159494	ENST00000477892.1:c.157+1C>A	3.37:g.122121729C>A			Q9NRN6|Q9UJX8	Missense_Mutation	SNP	pfam_DUF1075	p.R53S	ENST00000477892.1	37	c.157	CCDS43139.1	3	.	.	.	.	.	.	.	.	.	.	C	9.824	1.186505	0.21870	.	.	ENSG00000114023	ENST00000232125;ENST00000477892;ENST00000469967	T;T;T	0.28255	1.62;1.62;1.62	4.98	-1.9	0.07665	.	1.849220	0.02440	N	0.084450	T	0.24661	0.0598	L	0.53249	1.67	0.26758	N	0.97007	B;B	0.15930	0.015;0.002	B;B	0.17098	0.017;0.003	T	0.06607	-1.0817	10	0.16896	T	0.51	.	1.1584	0.01800	0.2822:0.3922:0.1341:0.1914	.	53;53	E9PH05;Q96A26	.;F162A_HUMAN	S	43;53;53	ENSP00000232125:R43S;ENSP00000419088:R53S;ENSP00000419491:R53S	ENSP00000232125:R43S	R	+	1	0	FAM162A	123604419	0.086000	0.21541	0.912000	0.35992	0.982000	0.71751	-1.451000	0.02387	-0.628000	0.05582	0.650000	0.86243	CGC	FAM162A	-	pfam_DUF1075	ENSG00000114023		0.383	FAM162A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM162A	HGNC	protein_coding	OTTHUMT00000355766.1		0.00	54	0	C	NM_014367	Missense_Mutation	122121729	+1			no_errors	ENST00000477892	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.946	A
FAM26F	441168	genome.wustl.edu	37	6	116784539	116784539	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:116784539C>A	ENST00000368605.1	+	3	714	c.619C>A	c.(619-621)Ctg>Atg	p.L207M	FAM26F_ENST00000368606.3_Missense_Mutation_p.L35M|RP1-93H18.6_ENST00000476099.1_RNA	NM_001010919.1	NP_001010919.1	Q5R3K3	FA26F_HUMAN	family with sequence similarity 26, member F	207					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)	3				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		TTTTCTGCAGCTGAAATTCTG	0.383																																																	0													135.0	133.0	133.0					6																	116784539		2203	4300	6503	SO:0001583	missense	0			AF086130	CCDS34519.1, CCDS64506.1	6q22.1	2007-06-20			ENSG00000188820	ENSG00000188820			33391	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 187"""	C6orf187			Standard	NM_001010919		Approved	RP1-93H18.5, OTTHUMP00000017061, OTTHUMP00000017062, dJ93H18.5	uc003pwv.4	Q5R3K3	OTTHUMG00000015438	ENST00000368605.1:c.619C>A	6.37:g.116784539C>A	ENSP00000357594:p.Leu207Met		B9EJB0|Q5R3K4	Missense_Mutation	SNP	NULL	p.L207M	ENST00000368605.1	37	c.619	CCDS34519.1	6	.	.	.	.	.	.	.	.	.	.	C	17.29	3.353349	0.61293	.	.	ENSG00000188820	ENST00000368606;ENST00000368605;ENST00000368604	T;T;T	0.19806	2.12;2.12;2.12	5.11	0.176	0.15049	.	0.088940	0.46442	D	0.000291	T	0.21962	0.0529	M	0.71296	2.17	0.32513	N	0.537329	D	0.89917	1.0	D	0.76071	0.987	T	0.03184	-1.1063	10	0.39692	T	0.17	-9.6283	5.4947	0.16795	0.1283:0.5849:0.0:0.2868	.	207	Q5R3K3	FA26F_HUMAN	M	35;207;50	ENSP00000357595:L35M;ENSP00000357594:L207M;ENSP00000357593:L50M	ENSP00000357593:L50M	L	+	1	2	FAM26F	116891232	1.000000	0.71417	0.611000	0.29010	0.919000	0.55068	0.819000	0.27308	-0.165000	0.10908	-0.150000	0.13652	CTG	FAM26F	-	NULL	ENSG00000188820		0.383	FAM26F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM26F	HGNC	protein_coding	OTTHUMT00000041946.1	-	0.00	75	0	C	NM_001010919		116784539	+1	tier1	-	no_errors	ENST00000368605	ensembl	human	known	74_37	missense	15.49	60	11	SNP	0.980	A
FAT2	2196	genome.wustl.edu	37	5	150945577	150945577	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:150945577G>T	ENST00000261800.5	-	1	2928	c.2916C>A	c.(2914-2916)ttC>ttA	p.F972L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	972	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGTCCACCCGGAAGGTCCCAT	0.597																																																	0													46.0	49.0	48.0					5																	150945577		2203	4300	6503	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2916C>A	5.37:g.150945577G>T	ENSP00000261800:p.Phe972Leu		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.F972L	ENST00000261800.5	37	c.2916	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208516	0.58343	.	.	ENSG00000086570	ENST00000261800	T	0.70749	-0.51	5.39	4.52	0.55395	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000002	D	0.86112	0.5855	M	0.93241	3.395	0.50171	D	0.999854	D	0.76494	0.999	D	0.87578	0.998	D	0.87830	0.2644	10	0.66056	D	0.02	.	9.4676	0.38822	0.216:0.0:0.784:0.0	.	972	Q9NYQ8	FAT2_HUMAN	L	972	ENSP00000261800:F972L	ENSP00000261800:F972L	F	-	3	2	FAT2	150925770	0.967000	0.33354	0.995000	0.50966	0.981000	0.71138	1.854000	0.39368	2.523000	0.85059	0.561000	0.74099	TTC	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.597	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	24	0	G	NM_001447		150945577	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	57.69	11	15	SNP	0.701	T
FAT3	120114	genome.wustl.edu	37	11	92495313	92495313	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:92495313G>T	ENST00000298047.6	+	4	3978	c.3961G>T	c.(3961-3963)Gca>Tca	p.A1321S	FAT3_ENST00000409404.2_Missense_Mutation_p.A1321S|RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000525166.1_Missense_Mutation_p.A1171S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1321	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCAGTTTACAGCAGGCAGTTA	0.428										TCGA Ovarian(4;0.039)																																							0													69.0	66.0	67.0					11																	92495313		1890	4124	6014	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3961G>T	11.37:g.92495313G>T	ENSP00000298047:p.Ala1321Ser		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.A1321S	ENST00000298047.6	37	c.3961		11	.	.	.	.	.	.	.	.	.	.	G	32	5.151384	0.94645	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.52057	0.68;0.68;0.68	5.58	5.58	0.84498	.	.	.	.	.	T	0.63117	0.2484	L	0.43701	1.375	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57797	-0.7749	9	0.34782	T	0.22	.	19.5733	0.95430	0.0:0.0:1.0:0.0	.	1321	Q8TDW7-3	.	S	1321;1321;1171	ENSP00000298047:A1321S;ENSP00000387040:A1321S;ENSP00000432586:A1171S	ENSP00000298047:A1321S	A	+	1	0	FAT3	92134961	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.787000	0.99055	2.618000	0.88619	0.563000	0.77884	GCA	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.428	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	32	0	G	NM_001008781		92495313	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126411719	126411719	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:126411719C>A	ENST00000394329.3	+	17	13755	c.13742C>A	c.(13741-13743)cCa>cAa	p.P4581Q	FAT4_ENST00000335110.5_Missense_Mutation_p.P2822Q	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4581					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AACCCAAAACCAGATATCATT	0.468																																																	0													95.0	103.0	100.0					4																	126411719		2203	4300	6503	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.13742C>A	4.37:g.126411719C>A	ENSP00000377862:p.Pro4581Gln		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.P4581Q	ENST00000394329.3	37	c.13742	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	14.73	2.622555	0.46840	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	D;D	0.96300	-3.97;-2.55	4.95	4.95	0.65309	.	0.000000	0.34314	U	0.004065	D	0.97321	0.9124	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	D	0.98335	1.0535	10	0.87932	D	0	.	17.186	0.86867	0.0:1.0:0.0:0.0	.	2822;4581;4580	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	Q	4581;2822	ENSP00000377862:P4581Q;ENSP00000335169:P2822Q	ENSP00000335169:P2822Q	P	+	2	0	FAT4	126631169	1.000000	0.71417	0.493000	0.27502	0.965000	0.64279	7.534000	0.82004	2.275000	0.75901	0.561000	0.74099	CCA	FAT4	-	NULL	ENSG00000196159		0.468	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	79	0	C	NM_024582		126411719	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	A
FGD3	89846	genome.wustl.edu	37	9	95797636	95797636	+	Missense_Mutation	SNP	G	G	T	rs200577392	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:95797636G>T	ENST00000375482.3	+	18	2439	c.1943G>T	c.(1942-1944)cGc>cTc	p.R648L	FGD3_ENST00000538555.1_Missense_Mutation_p.R251L|FGD3_ENST00000416701.2_Missense_Mutation_p.R647L|FGD3_ENST00000337352.6_Missense_Mutation_p.R648L	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	648	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.R648L(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						CGGCTGCCCCGCACCATCCCT	0.682																																																	1	Substitution - Missense(1)	lung(1)											24.0	29.0	27.0					9																	95797636		2109	4237	6346	SO:0001583	missense	0			AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.1943G>T	9.37:g.95797636G>T	ENSP00000364631:p.Arg648Leu		F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.R648L	ENST00000375482.3	37	c.1943	CCDS43849.1	9	.	.	.	.	.	.	.	.	.	.	g	7.835	0.720704	0.15372	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352;ENST00000538555	T;T;T;T	0.72505	-0.57;-0.56;-0.57;-0.66	4.37	-6.13	0.02118	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	1.764920	0.03294	N	0.188010	T	0.57460	0.2055	M	0.62723	1.935	0.09310	N	1	B;B	0.13594	0.008;0.001	B;B	0.17098	0.017;0.002	T	0.41251	-0.9519	10	0.11485	T	0.65	.	0.7623	0.01009	0.3834:0.1186:0.259:0.2391	.	647;648	F8W7P2;Q5JSP0	.;FGD3_HUMAN	L	648;647;648;251	ENSP00000364631:R648L;ENSP00000413833:R647L;ENSP00000336914:R648L;ENSP00000442560:R251L	ENSP00000336914:R648L	R	+	2	0	FGD3	94837457	0.000000	0.05858	0.000000	0.03702	0.218000	0.24690	-0.600000	0.05693	-1.516000	0.01782	-1.418000	0.01112	CGC	FGD3	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000127084		0.682	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	HGNC	protein_coding	OTTHUMT00000055493.1		0.00	62	0	G	NM_033086		95797636	+1			no_errors	ENST00000337352	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.000	T
FHDC1	85462	genome.wustl.edu	37	4	153864387	153864387	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:153864387C>A	ENST00000511601.1	+	2	366	c.178C>A	c.(178-180)Cca>Aca	p.P60T	FHDC1_ENST00000260008.3_Missense_Mutation_p.P60T			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	60									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					CTCCCCTCCTCCACCCCCACC	0.617																																																	0													54.0	39.0	44.0					4																	153864387		2203	4299	6502	SO:0001583	missense	0			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.178C>A	4.37:g.153864387C>A	ENSP00000427567:p.Pro60Thr			Missense_Mutation	SNP	pfam_FH2_Formin,smart_FH2_Formin	p.P60T	ENST00000511601.1	37	c.178	CCDS34081.1	4	.	.	.	.	.	.	.	.	.	.	C	4.912	0.169548	0.09339	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.52754	0.65;0.65	4.64	3.8	0.43715	.	1.244620	0.05562	N	0.569539	T	0.45538	0.1347	L	0.59436	1.845	0.09310	N	0.999999	B	0.29988	0.264	B	0.24541	0.054	T	0.41233	-0.9520	10	0.72032	D	0.01	.	7.5901	0.28017	0.1628:0.7495:0.0:0.0877	.	60	Q9C0D6	FHDC1_HUMAN	T	60	ENSP00000427567:P60T;ENSP00000260008:P60T	ENSP00000260008:P60T	P	+	1	0	FHDC1	154083837	0.998000	0.40836	0.013000	0.15412	0.043000	0.13939	1.366000	0.34193	1.288000	0.44600	-0.253000	0.11424	CCA	FHDC1	-	NULL	ENSG00000137460		0.617	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	-	0.00	88	0	C	NM_033393		153864387	+1	tier1	-	no_errors	ENST00000260008	ensembl	human	known	74_37	missense	9.43	48	5	SNP	0.017	A
FLVCR2	55640	genome.wustl.edu	37	14	76100017	76100017	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:76100017G>T	ENST00000238667.4	+	4	1354	c.998G>T	c.(997-999)cGc>cTc	p.R333L	FLVCR2_ENST00000539311.1_Missense_Mutation_p.R128L|FLVCR2_ENST00000556241.1_Intron|FLVCR2_ENST00000553587.1_Missense_Mutation_p.R81L|FLVCR2_ENST00000555027.1_Missense_Mutation_p.R48L|FLVCR2_ENST00000556856.1_Intron	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	333					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		CTTCTGAATCGCATGGTGATC	0.488																																																	0													240.0	202.0	215.0					14																	76100017		2203	4300	6503	SO:0001583	missense	0			AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.998G>T	14.37:g.76100017G>T	ENSP00000238667:p.Arg333Leu		B7Z485|Q53ZT9|Q96JY3|Q9NX90	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,superfamily_Trimer_LpxA-like,pfscan_MFS_dom	p.R333L	ENST00000238667.4	37	c.998	CCDS9844.1	14	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512728	0.85389	.	.	ENSG00000119686	ENST00000238667;ENST00000539311;ENST00000555058;ENST00000553341;ENST00000553587;ENST00000554580;ENST00000555027	T;T;T;T;T;T;T	0.55234	0.69;0.69;0.53;0.53;0.53;0.53;0.53	5.69	4.8	0.61643	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.62282	0.2415	M	0.77820	2.39	0.80722	D	1	P;P	0.48407	0.91;0.806	P;P	0.49953	0.627;0.627	T	0.65821	-0.6075	10	0.51188	T	0.08	-16.3905	11.7446	0.51813	0.083:0.0:0.917:0.0	.	128;333	B7Z485;Q9UPI3	.;FLVC2_HUMAN	L	333;128;81;34;81;33;48	ENSP00000238667:R333L;ENSP00000443439:R128L;ENSP00000451104:R81L;ENSP00000452584:R34L;ENSP00000451603:R81L;ENSP00000451781:R33L;ENSP00000452453:R48L	ENSP00000238667:R333L	R	+	2	0	AC007182.1	75169770	1.000000	0.71417	0.990000	0.47175	0.973000	0.67179	6.052000	0.71080	1.407000	0.46875	0.591000	0.81541	CGC	FLVCR2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000119686		0.488	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR2	HGNC	protein_coding	OTTHUMT00000413672.1		0.00	87	0	G	NM_017791		76100017	+1			no_errors	ENST00000238667	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
FMN1	342184	genome.wustl.edu	37	15	33445353	33445353	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:33445353G>T	ENST00000559047.1	-	1	1762	c.1763C>A	c.(1762-1764)gCc>gAc	p.A588D	FMN1_ENST00000320930.7_Missense_Mutation_p.A588D|FMN1_ENST00000561249.1_Missense_Mutation_p.A588D			Q68DA7	FMN1_HUMAN	formin 1	588	Mediates interaction with alpha-catenin. {ECO:0000250}.|Microtubule-binding. {ECO:0000250}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		TCTGAGGAAGGCCGGGCTGGC	0.597																																																	0																																										SO:0001583	missense	0			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.1763C>A	15.37:g.33445353G>T	ENSP00000454047:p.Ala588Asp		Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	NULL	p.A588D	ENST00000559047.1	37	c.1763		15	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633848	0.67130	.	.	ENSG00000186031	ENST00000320930	.	.	.	5.65	4.72	0.59763	.	0.658046	0.14056	N	0.344389	T	0.56848	0.2013	N	0.19112	0.55	0.27120	N	0.962151	D	0.56746	0.977	P	0.58873	0.847	T	0.67879	-0.5556	8	0.66056	D	0.02	.	16.673	0.85271	0.0:0.1295:0.8705:0.0	.	588	C9JFW6	.	D	588	.	ENSP00000325166:A588D	A	-	2	0	AC090098.1	31232645	1.000000	0.71417	0.696000	0.30242	0.734000	0.41952	3.699000	0.54778	1.586000	0.49944	0.655000	0.94253	GCC	FMN1	-	NULL	ENSG00000248905		0.597	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	HGNC	protein_coding	OTTHUMT00000417414.1	-	0.00	57	0	G	NM_001103184		33445353	-1	tier1	-	no_errors	ENST00000320930	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.967	T
FNIP1	96459	genome.wustl.edu	37	5	131008399	131008399	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:131008399C>A	ENST00000510461.1	-	14	1833	c.1738G>T	c.(1738-1740)Gaa>Taa	p.E580*	CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307954.8_Nonsense_Mutation_p.E535*|FNIP1_ENST00000307968.7_Nonsense_Mutation_p.E552*	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	580					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.E580K(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TACTCTGATTCTTCTATTTCA	0.353																																																	1	Substitution - Missense(1)	large_intestine(1)											164.0	154.0	157.0					5																	131008399		2203	4300	6503	SO:0001587	stop_gained	0			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1738G>T	5.37:g.131008399C>A	ENSP00000421985:p.Glu580*		D6RJH5|Q86T47|Q9BUT0	Nonsense_Mutation	SNP	NULL	p.E580*	ENST00000510461.1	37	c.1738	CCDS34227.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.672632	0.96754	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-11.0845	20.126	0.97982	0.0:1.0:0.0:0.0	.	.	.	.	X	552;535;340;580	.	ENSP00000310453:E535X	E	-	1	0	FNIP1	131036298	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.487000	0.81328	2.749000	0.94314	0.655000	0.94253	GAA	FNIP1	-	NULL	ENSG00000217128		0.353	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FNIP1	HGNC	protein_coding	OTTHUMT00000370077.1		0.00	42	0	C	NM_133372		131008399	-1			no_errors	ENST00000510461	ensembl	human	known	74_37	nonsense	10.00	18	2	SNP	1.000	A
FSCB	84075	genome.wustl.edu	37	14	44974442	44974442	+	Silent	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:44974442C>T	ENST00000340446.4	-	1	2040	c.1749G>A	c.(1747-1749)gaG>gaA	p.E583E	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	583	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CTGCAGTGGTCTCTTCACCTG	0.537																																																	0													28.0	30.0	29.0					14																	44974442		2203	4300	6503	SO:0001819	synonymous_variant	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1749G>A	14.37:g.44974442C>T			Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	NULL	p.E583	ENST00000340446.4	37	c.1749	CCDS9679.1	14																																																																																			FSCB	-	NULL	ENSG00000189139		0.537	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1		0.00	46	0	C	NM_032135		44974442	-1			no_errors	ENST00000340446	ensembl	human	known	74_37	silent	14.29	12	2	SNP	0.004	T
GAK	2580	genome.wustl.edu	37	4	862466	862466	+	Silent	SNP	C	C	T	rs572190550		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:862466C>T	ENST00000314167.4	-	20	2366	c.2256G>A	c.(2254-2256)ccG>ccA	p.P752P	GAK_ENST00000511163.1_Silent_p.P673P|GAK_ENST00000509566.1_5'UTR	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	752					cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		GGGGAAGCTCCGGCTTCCCTG	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		16266	0.001		0.0	False		,,,				2504	0.0																0													18.0	20.0	19.0					4																	862466		2139	4158	6297	SO:0001819	synonymous_variant	0			D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.2256G>A	4.37:g.862466C>T			Q5U4P5|Q9BVY6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_Kinase-like_dom,superfamily_DnaJ_domain,superfamily_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_DnaJ_domain,pfscan_Prot_kinase_dom,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.P752	ENST00000314167.4	37	c.2256	CCDS3340.1	4																																																																																			GAK	-	NULL	ENSG00000178950		0.692	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAK	HGNC	protein_coding	OTTHUMT00000239188.1		0.00	114	0	C	NM_005255		862466	-1			no_errors	ENST00000314167	ensembl	human	known	74_37	silent	5.88	48	3	SNP	0.001	T
GFRA1	2674	genome.wustl.edu	37	10	117884831	117884831	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr10:117884831C>T	ENST00000355422.6	-	6	1221	c.671G>A	c.(670-672)cGg>cAg	p.R224Q	GFRA1_ENST00000439649.3_Missense_Mutation_p.R219Q|GFRA1_ENST00000544592.1_Missense_Mutation_p.R103Q|GFRA1_ENST00000369236.1_Missense_Mutation_p.R219Q	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	224					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		CTGTCGCCTCCGCTCTGTGCA	0.567																																					Ovarian(128;329 1725 45498 46808 50759)												0													80.0	68.0	72.0					10																	117884831		2203	4300	6503	SO:0001583	missense	0			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.671G>A	10.37:g.117884831C>T	ENSP00000347591:p.Arg224Gln		A8KA21|O15507|O43912	Missense_Mutation	SNP	pfam_GDNF/GAS1,smart_GDNF/GAS1,pirsf_Glial_neurotroph_fac_rcpt_a1/2,prints_GDNF_rcpt,prints_GDNF_rcpt_A1	p.R224Q	ENST00000355422.6	37	c.671	CCDS44481.1	10	.	.	.	.	.	.	.	.	.	.	C	37	5.987554	0.97173	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.63744	-0.06;-0.06	5.99	5.99	0.97316	GDNF/GAS1 (2);	0.109281	0.64402	D	0.000014	D	0.83229	0.5209	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.937	D	0.84106	0.0398	10	0.54805	T	0.06	-8.0016	20.4777	0.99188	0.0:1.0:0.0:0.0	.	224;219	P56159;P56159-2	GFRA1_HUMAN;.	Q	224;219;219;103;219	ENSP00000358239:R219Q;ENSP00000442179:R103Q	ENSP00000347591:R219Q	R	-	2	0	GFRA1	117874821	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	7.818000	0.86416	2.840000	0.97914	0.655000	0.94253	CGG	GFRA1	-	pfam_GDNF/GAS1,smart_GDNF/GAS1,pirsf_Glial_neurotroph_fac_rcpt_a1/2,prints_GDNF_rcpt	ENSG00000151892		0.567	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GFRA1	HGNC	protein_coding	OTTHUMT00000050512.2	-	0.00	43	0	C	NM_145793		117884831	-1	tier1	-	no_errors	ENST00000355422	ensembl	human	known	74_37	missense	53.57	13	15	SNP	1.000	T
GOLGA2P5	55592	genome.wustl.edu	37	12	100562920	100562921	+	RNA	INS	-	-	T	rs58822438		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:100562920_100562921insT	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						GGTCTCATTTGTTTTttttttt	0.406																																																	0																																												0																															12.37:g.100562931_100562931dupT			Q9NSV2	RNA	INS	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			GOLGA2B	-	-	ENSG00000238105		0.406	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	Clone_based_vega_gene	pseudogene	OTTHUMT00000396439.2		0.00	25	0	-			100562921	-1	tier1		no_errors	ENST00000421840	ensembl	human	known	74_37	rna	11.11	24	3	INS	0.000:0.000	T
GOLM1	51280	genome.wustl.edu	37	9	88648293	88648293	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:88648293G>T	ENST00000388712.3	-	9	1201	c.1033C>A	c.(1033-1035)Ctg>Atg	p.L345M	GOLM1_ENST00000388711.3_Missense_Mutation_p.L345M|GOLM1_ENST00000257504.6_5'Flank	NM_016548.3	NP_057632.2	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	345					nucleus organization (GO:0006997)|regulation of lipid metabolic process (GO:0019216)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)		p.L345L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17						TCTCCTCTCAGTTTCTGCTGG	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											203.0	169.0	180.0					9																	88648293		2203	4299	6502	SO:0001583	missense	0			AF236056	CCDS35054.1	9q21.33	2012-12-13	2007-07-30	2007-07-30	ENSG00000135052	ENSG00000135052			15451	protein-coding gene	gene with protein product		606804	"""golgi phosphoprotein 2"", ""chromosome 9 open reading frame 155"""	GOLPH2, C9orf155		10831838, 18953438, 22542941	Standard	NM_016548		Approved	GP73, FLJ23608, bA379P1.3	uc004aol.3	Q8NBJ4	OTTHUMG00000020130	ENST00000388712.3:c.1033C>A	9.37:g.88648293G>T	ENSP00000373364:p.Leu345Met		Q6IAF4|Q9NRB9	Missense_Mutation	SNP	NULL	p.L345M	ENST00000388712.3	37	c.1033	CCDS35054.1	9	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542263	0.65198	.	.	ENSG00000135052	ENST00000388712;ENST00000388711	T;T	0.51071	0.72;0.72	4.79	0.404	0.16355	.	0.880500	0.09710	N	0.765858	T	0.41003	0.1140	L	0.47716	1.5	0.09310	N	1	P	0.44195	0.828	P	0.45138	0.471	T	0.27673	-1.0067	10	0.51188	T	0.08	-28.0831	3.4952	0.07653	0.0965:0.3404:0.4102:0.1529	.	345	Q8NBJ4	GOLM1_HUMAN	M	345	ENSP00000373364:L345M;ENSP00000373363:L345M	ENSP00000373363:L345M	L	-	1	2	GOLM1	87838113	0.000000	0.05858	0.000000	0.03702	0.815000	0.46073	-0.028000	0.12350	-0.099000	0.12263	0.655000	0.94253	CTG	GOLM1	-	NULL	ENSG00000135052		0.428	GOLM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLM1	HGNC	protein_coding	OTTHUMT00000052904.2		0.00	44	0	G	NM_177937		88648293	-1			no_errors	ENST00000388711	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.000	T
GREB1	9687	genome.wustl.edu	37	2	11767137	11767137	+	Silent	SNP	G	G	A	rs543467857		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:11767137G>A	ENST00000381486.2	+	25	4656	c.4356G>A	c.(4354-4356)acG>acA	p.T1452T	GREB1_ENST00000396123.1_Silent_p.T450T|GREB1_ENST00000234142.5_Silent_p.T1452T	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1452						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGCGTCAGACGGCACGGATGA	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		20421	0.0		0.0	False		,,,				2504	0.001				Ovarian(39;850 945 2785 23371 33093)												0													84.0	90.0	88.0					2																	11767137		2098	4224	6322	SO:0001819	synonymous_variant	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4356G>A	2.37:g.11767137G>A			A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	superfamily_P-loop_NTPase	p.T1452	ENST00000381486.2	37	c.4356	CCDS42655.1	2																																																																																			GREB1	-	NULL	ENSG00000196208		0.562	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	-	0.00	72	0	G	NM_014668		11767137	+1	tier1	-	no_errors	ENST00000234142	ensembl	human	known	74_37	silent	24.59	46	15	SNP	0.169	A
GRIN2B	2904	genome.wustl.edu	37	12	13768094	13768094	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:13768094G>T	ENST00000609686.1	-	7	1817	c.1608C>A	c.(1606-1608)gtC>gtA	p.V536V		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	536					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTGACACCATGACACTGATGC	0.517																																																	0													194.0	150.0	165.0					12																	13768094		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1608C>A	12.37:g.13768094G>T			Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V536	ENST00000609686.1	37	c.1608	CCDS8662.1	12																																																																																			GRIN2B	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000273079		0.517	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	-	0.00	56	0	G			13768094	-1	tier1	-	no_errors	ENST00000609686	ensembl	human	known	74_37	silent	11.43	31	4	SNP	1.000	T
GSDMC	56169	genome.wustl.edu	37	8	130789632	130789632	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:130789632G>A	ENST00000276708.4	-	2	1083	c.202C>T	c.(202-204)Cca>Tca	p.P68S		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	68						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						GAAGAACTTGGCTCCAGGATG	0.433																																																	0													96.0	85.0	89.0					8																	130789632		2203	4300	6503	SO:0001583	missense	0			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.202C>T	8.37:g.130789632G>A	ENSP00000276708:p.Pro68Ser		Q5XKF3|Q6P494	Missense_Mutation	SNP	pfam_Gasdermin	p.P68S	ENST00000276708.4	37	c.202	CCDS6360.1	8	.	.	.	.	.	.	.	.	.	.	G	9.748	1.166728	0.21621	.	.	ENSG00000147697	ENST00000276708	T	0.33216	1.42	4.15	2.34	0.29019	.	0.640803	0.14159	N	0.337502	T	0.38268	0.1034	L	0.52905	1.665	0.20074	N	0.999934	D	0.69078	0.997	P	0.55871	0.786	T	0.11817	-1.0572	10	0.40728	T	0.16	.	6.5584	0.22474	0.223:0.0:0.777:0.0	.	68	Q9BYG8	GSDMC_HUMAN	S	68	ENSP00000276708:P68S	ENSP00000276708:P68S	P	-	1	0	GSDMC	130858814	0.996000	0.38824	0.071000	0.20095	0.054000	0.15201	1.469000	0.35343	0.524000	0.28502	-0.216000	0.12614	CCA	GSDMC	-	pfam_Gasdermin	ENSG00000147697		0.433	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	-	0.00	48	0	G			130789632	-1	tier1	-	no_errors	ENST00000276708	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.259	A
GSTM3	2947	genome.wustl.edu	37	1	110280279	110280279	+	Splice_Site	SNP	T	T	C	rs59389091		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:110280279T>C	ENST00000540225.1	-	7	777	c.467A>G	c.(466-468)aAg>aGg	p.K156R	RP4-735C1.4_ENST00000431955.1_RNA|GSTM3_ENST00000256594.3_Splice_Site_p.K156R|GSTM3_ENST00000488824.1_5'UTR|GSTM3_ENST00000361066.2_Splice_Site_p.K156R			P21266	GSTM3_HUMAN	glutathione S-transferase mu 3 (brain)	156	GST C-terminal.				cellular detoxification of nitrogen compound (GO:0070458)|establishment of blood-nerve barrier (GO:0008065)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|nitrobenzene metabolic process (GO:0018916)|response to estrogen (GO:0043627)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.K156fs*30(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|skin(1)	9		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Colorectal(144;0.0339)|Lung(183;0.0426)|all cancers(265;0.113)|Epithelial(280;0.125)|COAD - Colon adenocarcinoma(174;0.134)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)|Vitamin E(DB00163)	TCTTCCTACCTTTTCCCCGGC	0.438																																																	1	Deletion - Frameshift(1)	large_intestine(1)											129.0	148.0	141.0					1																	110280279		2203	4300	6503	SO:0001630	splice_region_variant	0			BC000088	CCDS812.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134202	ENSG00000134202	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4635	protein-coding gene	gene with protein product		138390	"""glutathione S-transferase M3 (brain)"""			2345169	Standard	NM_000849		Approved	GST5	uc001dyo.2	P21266	OTTHUMG00000011640	ENST00000540225.1:c.468+1A>G	1.37:g.110280279T>C			O60550|Q96HA3	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_mu	p.K156R	ENST00000540225.1	37	c.467	CCDS812.1	1	.	.	.	.	.	.	.	.	.	.	T	18.49	3.635916	0.67130	.	.	ENSG00000134202	ENST00000540225;ENST00000256594;ENST00000361066	T;T;T	0.03801	3.8;3.8;3.8	5.53	5.53	0.82687	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.07548	0.0190	M	0.83603	2.65	0.58432	D	0.999999	B;B;B	0.31625	0.105;0.332;0.105	B;B;B	0.39217	0.026;0.294;0.026	T	0.00525	-1.1689	10	0.72032	D	0.01	-18.6724	14.7863	0.69806	0.0:0.0:0.0:1.0	.	156;162;156	Q6FGJ9;Q59EJ5;P21266	.;.;GSTM3_HUMAN	R	156	ENSP00000444978:K156R;ENSP00000256594:K156R;ENSP00000354357:K156R	ENSP00000256594:K156R	K	-	2	0	GSTM3	110081802	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.191000	0.65110	2.315000	0.78130	0.533000	0.62120	AAG	GSTM3	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,prints_GST_mu	ENSG00000134202		0.438	GSTM3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTM3	HGNC	protein_coding	OTTHUMT00000032182.1		0.00	14	0	T	NM_000849	Missense_Mutation	110280279	-1			no_errors	ENST00000256594	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	C
GTF2A1L	11036	genome.wustl.edu	37	2	48845183	48845183	+	Intron	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:48845183G>A	ENST00000403751.3	+	1	58				GTF2A1L_ENST00000468326.1_3'UTR|GTF2A1L_ENST00000430487.2_Intron|STON1-GTF2A1L_ENST00000394754.1_Intron|STON1-GTF2A1L_ENST00000309827.2_Intron|STON1-GTF2A1L_ENST00000394751.3_Intron|STON1-GTF2A1L_ENST00000402114.2_Intron|STON1-GTF2A1L_ENST00000405008.1_Intron	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like						cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCTTCTTCACGTCTGTGTTGG	0.527																																																	0																																										SO:0001627	intron_variant	0			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.21+149G>A	2.37:g.48845183G>A			B4DY14|Q53FD9|Q5D050	RNA	SNP	-	NULL	ENST00000403751.3	37	NULL	CCDS46281.1	2																																																																																			GTF2A1L	-	-	ENSG00000242441		0.527	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2A1L	HGNC	protein_coding	OTTHUMT00000323852.4	-	0.00	51	0	G	NM_006872		48845183	+1	tier1	-	no_errors	ENST00000468326	ensembl	human	known	74_37	rna	65.71	12	23	SNP	0.000	A
GTF2F1	2962	genome.wustl.edu	37	19	6381410	6381412	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:6381410_6381412delCTC	ENST00000394456.5	-	9	1440_1442	c.976_978delGAG	c.(976-978)gagdel	p.E326del	GTF2F1_ENST00000429701.2_In_Frame_Del_p.E241del|PSPN_ENST00000597721.1_5'Flank	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	326	Glu-rich.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						GTGccttcttctcctcctcctcc	0.64																																																	0										17,4245		1,15,2115						3.9	1.0			48	27,8225		1,25,4100	no	coding	GTF2F1	NM_002096.2		2,40,6215	A1A1,A1R,RR		0.3272,0.3989,0.3516				44,12470				SO:0001651	inframe_deletion	0				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.976_978delGAG	19.37:g.6381419_6381421delCTC	ENSP00000377969:p.Glu326del		B2RCS0|Q9BWN0	In_Frame_Del	DEL	pfam_TFIIF-alpha,superfamily_TFIIF_interaction	p.E326in_frame_del	ENST00000394456.5	37	c.978_976	CCDS12165.1	19																																																																																			GTF2F1	-	pfam_TFIIF-alpha	ENSG00000125651		0.640	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F1	HGNC	protein_coding	OTTHUMT00000398033.1		0.00	34	0	CTC	NM_002096		6381412	-1	tier1		no_errors	ENST00000394456	ensembl	human	known	74_37	in_frame_del	5.88	32	2	DEL	1.000:1.000:1.000	-
GTF3C3	9330	genome.wustl.edu	37	2	197649613	197649614	+	Frame_Shift_Ins	INS	-	-	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:197649613_197649614insT	ENST00000263956.3	-	8	1170_1171	c.1081_1082insA	c.(1081-1083)actfs	p.T361fs	GTF3C3_ENST00000409364.3_Frame_Shift_Ins_p.T361fs|GTF3C3_ENST00000470386.1_5'Flank	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	361					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TTCTTCTGAAGTTTTTTTTTCC	0.337																																																	0																																										SO:0001589	frameshift_variant	0			AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.1082dupA	2.37:g.197649622_197649622dupT	ENSP00000263956:p.Thr361fs		Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Frame_Shift_Ins	INS	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T361fs	ENST00000263956.3	37	c.1082_1081	CCDS2316.1	2																																																																																			GTF3C3	-	NULL	ENSG00000119041		0.337	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C3	HGNC	protein_coding	OTTHUMT00000256104.1		0.00	38	0	-			197649614	-1	tier1		no_errors	ENST00000263956	ensembl	human	known	74_37	frame_shift_ins	14.29	18	3	INS	0.008:0.044	T
GUCA1C	9626	genome.wustl.edu	37	3	108639294	108639294	+	Frame_Shift_Del	DEL	C	C	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:108639294delC	ENST00000261047.3	-	2	475	c.343delG	c.(343-345)gacfs	p.D115fs	GUCA1C_ENST00000393963.3_Frame_Shift_Del_p.D115fs|GUCA1C_ENST00000471108.1_Frame_Shift_Del_p.D115fs	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	115	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						ATGAACATGTCCAGTAGTTCA	0.353																																					NSCLC(157;1360 1999 30631 40189 44208)												0													112.0	113.0	112.0					3																	108639294		2203	4299	6502	SO:0001589	frameshift_variant	0			AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.343delG	3.37:g.108639294delC	ENSP00000261047:p.Asp115fs		O95844|Q9UNM0	Frame_Shift_Del	DEL	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.D115fs	ENST00000261047.3	37	c.343	CCDS2954.1	3																																																																																			GUCA1C	-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000138472		0.353	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1C	HGNC	protein_coding	OTTHUMT00000353819.1		0.00	63	0	C	NM_005459		108639294	-1	tier1		no_errors	ENST00000261047	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	0.973	-
GZF1	64412	genome.wustl.edu	37	20	23345574	23345577	+	Frame_Shift_Del	DEL	GAGA	GAGA	-	rs374194682		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	GAGA	GAGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:23345574_23345577delGAGA	ENST00000338121.5	+	2	631_634	c.554_557delGAGA	c.(553-558)ggagagfs	p.GE185fs	GZF1_ENST00000544236.1_Intron|GZF1_ENST00000377051.2_Frame_Shift_Del_p.GE185fs|GZF1_ENST00000542987.1_Intron			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	185					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					GACTACCCAGGAGAGAGAGCCAGC	0.539																																																	0																																										SO:0001589	frameshift_variant	0			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.554_557delGAGA	20.37:g.23345578_23345581delGAGA	ENSP00000338290:p.Gly185fs		A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R187fs	ENST00000338121.5	37	c.554_557	CCDS13151.1	20																																																																																			GZF1	-	NULL	ENSG00000125812		0.539	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GZF1	HGNC	protein_coding	OTTHUMT00000078333.1		0.00	64	0	GAGA	NM_022482		23345577	+1	tier1		no_errors	ENST00000338121	ensembl	human	known	74_37	frame_shift_del	16.19	88	17	DEL	0.000:0.000:0.001:0.000	-
HCN4	10021	genome.wustl.edu	37	15	73635991	73635991	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:73635991C>T	ENST00000261917.3	-	2	1937	c.944G>A	c.(943-945)cGc>cAc	p.R315H	RP11-272D12.1_ENST00000557981.1_RNA|RP11-272D12.1_ENST00000558742.1_RNA	NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	315					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GATCCCTGTGCGGAAGTTGAG	0.488																																																	0													93.0	77.0	82.0					15																	73635991		2198	4297	6495	SO:0001583	missense	0			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.944G>A	15.37:g.73635991C>T	ENSP00000261917:p.Arg315His		Q9UMQ7	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.R315H	ENST00000261917.3	37	c.944	CCDS10248.1	15	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418677	0.83559	.	.	ENSG00000138622	ENST00000261917	D	0.98192	-4.78	5.34	5.34	0.76211	Ion transport (1);	.	.	.	.	D	0.98563	0.9520	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99146	1.0857	9	0.46703	T	0.11	.	19.4036	0.94640	0.0:1.0:0.0:0.0	.	315	Q9Y3Q4	HCN4_HUMAN	H	315	ENSP00000261917:R315H	ENSP00000261917:R315H	R	-	2	0	HCN4	71423044	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.671000	0.83941	2.657000	0.90304	0.655000	0.94253	CGC	HCN4	-	pfam_Ion_trans_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000138622		0.488	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	HGNC	protein_coding	OTTHUMT00000268900.2	-	0.00	95	0	C	NM_005477		73635991	-1	tier1	-	no_errors	ENST00000261917	ensembl	human	known	74_37	missense	20.00	64	16	SNP	1.000	T
HCRTR2	3062	genome.wustl.edu	37	6	55142396	55142396	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:55142396G>T	ENST00000370862.3	+	5	1317	c.981G>T	c.(979-981)aaG>aaT	p.K327N		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	327					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ATGTGCTAAAGAGGTAAAACT	0.333																																																	0													76.0	75.0	75.0					6																	55142396		2203	4300	6503	SO:0001583	missense	0			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.981G>T	6.37:g.55142396G>T	ENSP00000359899:p.Lys327Asn		Q5VTM0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Orexin_rcpt_2,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt,prints_GPCR_Rhodpsn,prints_Orexin_rcpt_2,prints_NPY_rcpt	p.K327N	ENST00000370862.3	37	c.981	CCDS4956.1	6	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500513	0.64298	.	.	ENSG00000137252	ENST00000370862	T	0.71461	-0.57	6.16	2.34	0.29019	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.54498	0.1862	L	0.31065	0.9	0.80722	D	1	D	0.58268	0.982	P	0.61722	0.893	T	0.51733	-0.8668	10	0.17832	T	0.49	.	8.2407	0.31658	0.4474:0.0:0.5526:0.0	.	327	O43614	OX2R_HUMAN	N	327	ENSP00000359899:K327N	ENSP00000359899:K327N	K	+	3	2	HCRTR2	55250355	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.095000	0.50235	0.440000	0.26502	0.650000	0.86243	AAG	HCRTR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt	ENSG00000137252		0.333	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR2	HGNC	protein_coding	OTTHUMT00000043392.1	-	0.00	23	0	G			55142396	+1	tier1	-	no_errors	ENST00000370862	ensembl	human	known	74_37	missense	30.00	7	3	SNP	1.000	T
HERC1	8925	genome.wustl.edu	37	15	64048745	64048745	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:64048745G>T	ENST00000443617.2	-	5	1511	c.1424C>A	c.(1423-1425)aCa>aAa	p.T475K		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	475					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTCTCCTTCTGTCGTAAAGGC	0.398																																																	0													110.0	103.0	105.0					15																	64048745		1873	4098	5971	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.1424C>A	15.37:g.64048745G>T	ENSP00000390158:p.Thr475Lys		Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.T475K	ENST00000443617.2	37	c.1424	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	G	12.48	1.949694	0.34377	.	.	ENSG00000103657	ENST00000443617	T	0.79940	-1.32	5.14	5.14	0.70334	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	U	0.000000	T	0.67822	0.2934	N	0.14661	0.345	0.42665	D	0.993495	B;B	0.15473	0.013;0.013	B;B	0.09377	0.004;0.004	T	0.62407	-0.6861	10	0.17369	T	0.5	.	18.9606	0.92676	0.0:0.0:1.0:0.0	.	475;475	C9JUT5;Q15751	.;HERC1_HUMAN	K	475	ENSP00000390158:T475K	ENSP00000390158:T475K	T	-	2	0	HERC1	61835798	1.000000	0.71417	0.962000	0.40283	0.983000	0.72400	4.791000	0.62460	2.554000	0.86153	0.561000	0.74099	ACA	HERC1	-	superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens	ENSG00000103657		0.398	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1		0.00	72	0	G	NM_003922		64048745	-1			no_errors	ENST00000443617	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.750	T
HIF1A	3091	genome.wustl.edu	37	14	62212426	62212426	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:62212426G>T	ENST00000337138.4	+	14	2485	c.2220G>T	c.(2218-2220)caG>caT	p.Q740H	HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000539097.1_Missense_Mutation_p.Q764H|HIF1A_ENST00000394997.1_Missense_Mutation_p.Q741H|RP11-618G20.1_ENST00000555937.1_RNA|HIF1A_ENST00000323441.6_Intron|HIF1A_ENST00000557538.1_Missense_Mutation_p.Q681H	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	740	ID.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TATTACAGCAGCCAGACGATC	0.308																																																	0													130.0	126.0	127.0					14																	62212426		2203	4300	6503	SO:0001583	missense	0			U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.2220G>T	14.37:g.62212426G>T	ENSP00000338018:p.Gln740His		C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_HIF-1_alpha,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.Q764H	ENST00000337138.4	37	c.2292	CCDS9753.1	14	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397414	0.62177	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000557538;ENST00000539097	T;T;T;T	0.52057	0.69;0.69;0.69;0.68	5.87	-3.79	0.04320	.	2.339110	0.01643	N	0.024150	T	0.47600	0.1454	L	0.47716	1.5	0.28279	N	0.924045	P;P	0.46220	0.874;0.874	P;P	0.47206	0.541;0.541	T	0.53322	-0.8455	10	0.56958	D	0.05	.	8.4383	0.32799	0.6067:0.1144:0.2789:0.0	.	741;740	A8MYV6;Q16665	.;HIF1A_HUMAN	H	491;681;740;741;681;764	ENSP00000338018:Q740H;ENSP00000378446:Q741H;ENSP00000451696:Q681H;ENSP00000437955:Q764H	ENSP00000338018:Q740H	Q	+	3	2	HIF1A	61282179	0.991000	0.36638	0.938000	0.37757	0.978000	0.69477	0.308000	0.19314	-0.724000	0.04908	-0.148000	0.13756	CAG	HIF1A	-	NULL	ENSG00000100644		0.308	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HIF1A	HGNC	protein_coding	OTTHUMT00000276977.2	-	0.00	46	0	G	NM_001530		62212426	+1	tier1	-	no_errors	ENST00000539097	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.925	T
HMGCS2	3158	genome.wustl.edu	37	1	120298057	120298057	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:120298057G>T	ENST00000369406.3	-	6	1229	c.1180C>A	c.(1180-1182)Ctg>Atg	p.L394M	HMGCS2_ENST00000544913.2_Missense_Mutation_p.L352M|HMGCS2_ENST00000476640.1_5'Flank	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	394					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)	p.L394V(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		CACTGGGACAGAAGCGAGGCC	0.552																																																	1	Substitution - Missense(1)	lung(1)											275.0	256.0	262.0					1																	120298057		2203	4300	6503	SO:0001583	missense	0			BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.1180C>A	1.37:g.120298057G>T	ENSP00000358414:p.Leu394Met		B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Missense_Mutation	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.L394M	ENST00000369406.3	37	c.1180	CCDS905.1	1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475762	0.44044	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	D;D	0.83673	-1.75;-1.75	5.26	3.38	0.38709	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.000000	0.49305	D	0.000151	D	0.88691	0.6505	M	0.91872	3.25	0.28139	N	0.929866	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.83501	0.0075	10	0.72032	D	0.01	-9.6397	9.9644	0.41715	0.1684:0.0:0.8316:0.0	.	352;394	B7Z8R3;P54868	.;HMCS2_HUMAN	M	394;352	ENSP00000358414:L394M;ENSP00000439495:L352M	ENSP00000358414:L394M	L	-	1	2	HMGCS2	120099580	1.000000	0.71417	0.023000	0.16930	0.655000	0.38815	3.118000	0.50414	0.698000	0.31739	0.563000	0.77884	CTG	HMGCS2	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	ENSG00000134240		0.552	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS2	HGNC	protein_coding	OTTHUMT00000033469.2		0.00	76	0	G	NM_005518		120298057	-1			no_errors	ENST00000369406	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.171	T
HRNR	388697	genome.wustl.edu	37	1	152188847	152188847	+	Missense_Mutation	SNP	A	A	G	rs145667921		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:152188847A>G	ENST00000368801.2	-	3	5333	c.5258T>C	c.(5257-5259)gTc>gCc	p.V1753A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1753					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGACCAAAGACAGAAGAGTG	0.562																																																	0													1.0	1.0	1.0					1																	152188847		388	960	1348	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5258T>C	1.37:g.152188847A>G	ENSP00000357791:p.Val1753Ala		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.V1753A	ENST00000368801.2	37	c.5258	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.191978	0.38707	.	.	ENSG00000197915	ENST00000368801	T	0.01548	4.78	3.15	2.19	0.27852	.	.	.	.	.	T	0.00412	0.0013	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48103	-0.9064	9	0.07482	T	0.82	.	1.9459	0.03356	0.2121:0.4632:0.2061:0.1186	.	1753	Q86YZ3	HORN_HUMAN	A	1753	ENSP00000357791:V1753A	ENSP00000357791:V1753A	V	-	2	0	HRNR	150455471	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.214000	0.09292	0.170000	0.19704	-0.294000	0.09567	GTC	HRNR	-	NULL	ENSG00000197915		0.562	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	49	0	A	XM_373868		152188847	-1	tier1	rs145667921	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.002	G
HTT	3064	genome.wustl.edu	37	4	3189472	3189472	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:3189472G>T	ENST00000355072.5	+	39	5229	c.5084G>T	c.(5083-5085)cGt>cTt	p.R1695L		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1695					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.R1695H(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GTTCTTTCTCGTATTCAGGAG	0.423																																																	1	Substitution - Missense(1)	endometrium(1)											191.0	175.0	180.0					4																	3189472		1840	4102	5942	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.5084G>T	4.37:g.3189472G>T	ENSP00000347184:p.Arg1695Leu		Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.R1695L	ENST00000355072.5	37	c.5084	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008751	0.93346	.	.	ENSG00000197386	ENST00000355072	T	0.07688	3.17	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.31167	0.0788	M	0.72894	2.215	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.00802	-1.1560	10	0.72032	D	0.01	.	19.7324	0.96188	0.0:0.0:1.0:0.0	.	1695	P42858	HD_HUMAN	L	1695	ENSP00000347184:R1695L	ENSP00000347184:R1695L	R	+	2	0	HTT	3159270	1.000000	0.71417	0.550000	0.28217	0.705000	0.40729	9.624000	0.98398	2.663000	0.90544	0.655000	0.94253	CGT	HTT	-	NULL	ENSG00000197386		0.423	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2		0.00	68	0	G	NM_002111		3189472	+1			no_errors	ENST00000355072	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	T
IDE	3416	genome.wustl.edu	37	10	94274768	94274768	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr10:94274768G>T	ENST00000265986.6	-	5	749	c.693C>A	c.(691-693)aaC>aaA	p.N231K		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	231					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TGCCTTCTTGGTTTGGTCTAG	0.358																																																	0													180.0	188.0	185.0					10																	94274768		2203	4300	6503	SO:0001583	missense	0			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.693C>A	10.37:g.94274768G>T	ENSP00000265986:p.Asn231Lys		B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.N231K	ENST00000265986.6	37	c.693	CCDS7421.1	10	.	.	.	.	.	.	.	.	.	.	G	1.658	-0.512309	0.04200	.	.	ENSG00000119912	ENST00000265986;ENST00000436178	T	0.29397	1.57	6.06	3.22	0.36961	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.161158	0.56097	D	0.000025	T	0.05502	0.0145	N	0.00289	-1.7	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28808	-1.0032	10	0.02654	T	1	-19.0163	5.615	0.17426	0.2641:0.0:0.6098:0.1261	.	231	P14735	IDE_HUMAN	K	231;217	ENSP00000265986:N231K	ENSP00000265986:N231K	N	-	3	2	IDE	94264748	0.974000	0.33945	1.000000	0.80357	0.996000	0.88848	0.284000	0.18864	0.913000	0.36797	-0.136000	0.14681	AAC	IDE	-	superfamily_Metalloenz_LuxS/M16	ENSG00000119912		0.358	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDE	HGNC	protein_coding	OTTHUMT00000049393.1	-	0.00	75	0	G	NM_004969		94274768	-1	tier1	-	no_errors	ENST00000265986	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.999	T
IGFN1	91156	genome.wustl.edu	37	1	201181738	201181738	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:201181738G>A	ENST00000335211.4	+	12	7847	c.7717G>A	c.(7717-7719)Gca>Aca	p.A2573T	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGGGGGGTTGGCATCTCAGGG	0.597																																																	0													18.0	21.0	20.0					1																	201181738		692	1591	2283	SO:0001583	missense	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.7717G>A	1.37:g.201181738G>A	ENSP00000334714:p.Ala2573Thr		F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A2573T	ENST00000335211.4	37	c.7717	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	g	7.138	0.581194	0.13686	.	.	ENSG00000163395	ENST00000335211	T	0.50277	0.75	3.66	1.5	0.22942	.	.	.	.	.	T	0.22820	0.0551	N	0.08118	0	0.20764	N	0.999855	.	.	.	.	.	.	T	0.19943	-1.0290	6	.	.	.	.	4.8702	0.13629	0.1205:0.0:0.6713:0.2082	.	.	.	.	T	2573	ENSP00000334714:A2573T	.	A	+	1	0	IGFN1	199448361	0.001000	0.12720	0.004000	0.12327	0.033000	0.12548	0.807000	0.27140	0.482000	0.27582	0.306000	0.20318	GCA	IGFN1	-	NULL	ENSG00000163395		0.597	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding			0.00	66	0	G	NM_178275		201181738	+1			no_errors	ENST00000335211	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.003	A
IGSF1	3547	genome.wustl.edu	37	X	130417199	130417199	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chrX:130417199G>T	ENST00000361420.3	-	6	786	c.707C>A	c.(706-708)cCc>cAc	p.P236H	IGSF1_ENST00000370904.1_Missense_Mutation_p.P227H|IGSF1_ENST00000370910.1_Missense_Mutation_p.P227H|IGSF1_ENST00000370903.3_Missense_Mutation_p.P236H			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	236	Ig-like C2-type 3.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TGCCATGATGGGCCCAGGATG	0.478																																																	0													67.0	64.0	65.0					X																	130417199		2203	4300	6503	SO:0001583	missense	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.707C>A	X.37:g.130417199G>T	ENSP00000355010:p.Pro236His		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P236H	ENST00000361420.3	37	c.707	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	10.91	1.484098	0.26598	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.00792	5.69;5.69;5.69;5.69	4.46	-1.2	0.09554	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.647057	0.13786	N	0.362910	T	0.00936	0.0031	M	0.66506	2.035	0.22142	N	0.999338	B;B	0.06786	0.0;0.001	B;B	0.12837	0.002;0.008	T	0.49360	-0.8948	10	0.72032	D	0.01	.	0.2827	0.00247	0.2288:0.1657:0.2647:0.3408	.	227;236	Q8N6C5-2;Q8N6C5	.;IGSF1_HUMAN	H	227;236;227;236	ENSP00000359947:P227H;ENSP00000355010:P236H;ENSP00000359941:P227H;ENSP00000359940:P236H	ENSP00000355010:P236H	P	-	2	0	IGSF1	130244880	0.744000	0.28250	0.306000	0.25113	0.990000	0.78478	0.770000	0.26618	-0.223000	0.09943	0.594000	0.82650	CCC	IGSF1	-	smart_Ig_sub	ENSG00000147255		0.478	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1		0.00	20	0	G			130417199	-1			no_errors	ENST00000370903	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.040	T
TMEM86A	144110	genome.wustl.edu	37	11	18727656	18727656	+	IGR	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:18727656C>T	ENST00000280734.2	+	0	3595				IGSF22_ENST00000513874.1_Silent_p.K1206K|RP11-1081L13.4_ENST00000527285.1_RNA|IGSF22_ENST00000510673.1_5'UTR	NM_153347.1	NP_699178.1	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A							integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	11						GCCAGTCCTTCTTCTCGTAGG	0.716																																																	0													47.0	51.0	50.0					11																	18727656		692	1591	2283	SO:0001628	intergenic_variant	0			BC035692	CCDS7844.1	11p15.1	2005-10-28				ENSG00000151117			26890	protein-coding gene	gene with protein product							Standard	NM_153347		Approved	FLJ90119	uc001moz.1	Q8N2M4			11.37:g.18727656C>T			Q96AJ0	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K1206	ENST00000280734.2	37	c.3618	CCDS7844.1	11																																																																																			IGSF22	-	NULL	ENSG00000179057		0.716	TMEM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000387812.1	-	0.00	49	0	C	NM_153347		18727656	-1	tier1	-	no_errors	ENST00000513874	ensembl	human	known	74_37	silent	49.09	28	27	SNP	0.003	T
IK	3550	genome.wustl.edu	37	5	140037180	140037180	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:140037180G>T	ENST00000417647.2	+	10	982	c.843G>T	c.(841-843)aaG>aaT	p.K281N		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	281					cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCATTAGCAAGCTGACCCAGA	0.438																																																	0													153.0	137.0	142.0					5																	140037180		1929	4147	6076	SO:0001583	missense	0			BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.843G>T	5.37:g.140037180G>T	ENSP00000396301:p.Lys281Asn		Q6IPD8	Missense_Mutation	SNP	pfam_RED_N,pfam_RED_C	p.K281N	ENST00000417647.2	37	c.843	CCDS47280.1	5	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903970	0.72754	.	.	ENSG00000113141	ENST00000417647	.	.	.	5.48	4.61	0.57282	RED-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81327	0.4799	M	0.90814	3.15	0.58432	D	0.999999	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.981	D	0.84567	0.0653	9	0.87932	D	0	.	11.438	0.50078	0.1473:0.0:0.8527:0.0	.	281;281	Q9UK43;Q13123	.;RED_HUMAN	N	281	.	ENSP00000396301:K281N	K	+	3	2	IK	140017364	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.071000	0.41500	1.451000	0.47736	-0.140000	0.14226	AAG	IK	-	pfam_RED_N	ENSG00000113141		0.438	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	IK	HGNC	protein_coding	OTTHUMT00000372897.1	-	0.00	70	0	G	NM_006083		140037180	+1	tier1	-	no_errors	ENST00000417647	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
INHBA	3624	genome.wustl.edu	37	7	41729394	41729394	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:41729394G>A	ENST00000242208.4	-	3	1381	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	INHBA_ENST00000442711.1_Missense_Mutation_p.R379W|INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	379				RMR -> AC (in Ref. 7; CAA51163). {ECO:0000305}.	activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.R379W(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CTATGGCCCCGCATGCGGTAG	0.537										TSP Lung(11;0.080)																																							1	Substitution - Missense(1)	large_intestine(1)											126.0	112.0	117.0					7																	41729394		2203	4300	6503	SO:0001583	missense	0				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.1135C>T	7.37:g.41729394G>A	ENSP00000242208:p.Arg379Trp		Q14599	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaA,prints_Inhibin_asu	p.R379W	ENST00000242208.4	37	c.1135	CCDS5464.1	7	.	.	.	.	.	.	.	.	.	.	.	14.76	2.631060	0.46944	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	D;D	0.85339	-1.97;-1.97	5.86	2.59	0.31030	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92319	0.7563	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93414	0.6771	10	0.87932	D	0	-21.1176	15.948	0.79809	0.0:0.0:0.5124:0.4876	.	379	P08476	INHBA_HUMAN	W	379	ENSP00000242208:R379W;ENSP00000397197:R379W	ENSP00000242208:R379W	R	-	1	2	INHBA	41695919	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.507000	0.22675	0.732000	0.32470	0.591000	0.81541	CGG	INHBA	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000122641		0.537	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBA	HGNC	protein_coding	OTTHUMT00000250793.1	-	0.00	42	0	G			41729394	-1	tier1	-	no_errors	ENST00000242208	ensembl	human	known	74_37	missense	68.18	7	15	SNP	0.995	A
IP6K3	117283	genome.wustl.edu	37	6	33690743	33690743	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:33690743G>T	ENST00000293756.4	-	6	1313	c.987C>A	c.(985-987)atC>atA	p.I329I	IP6K3_ENST00000451316.1_Silent_p.I329I	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	329					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						GCCCATCATAGATGACAAGGA	0.617																																																	0													63.0	67.0	65.0					6																	33690743		2203	4300	6503	SO:0001819	synonymous_variant	0			AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.987C>A	6.37:g.33690743G>T			Q96MQ9	Silent	SNP	pfam_IPK	p.I329	ENST00000293756.4	37	c.987	CCDS34435.1	6																																																																																			IP6K3	-	pfam_IPK	ENSG00000161896		0.617	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K3	HGNC	protein_coding	OTTHUMT00000040203.1		0.00	50	0	G	NM_054111		33690743	-1			no_errors	ENST00000293756	ensembl	human	known	74_37	silent	7.50	37	3	SNP	1.000	T
IRX1	79192	genome.wustl.edu	37	5	3600242	3600242	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:3600242G>A	ENST00000302006.3	+	2	1232	c.1180G>A	c.(1180-1182)Gtt>Att	p.V394I	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	394					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CTTCCTGGGCGTTGGCGCTCC	0.657																																																	0													48.0	47.0	47.0					5																	3600242		2202	4300	6502	SO:0001583	missense	0			U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1180G>A	5.37:g.3600242G>A	ENSP00000305244:p.Val394Ile		Q7Z2F8|Q8N312	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.V394I	ENST00000302006.3	37	c.1180	CCDS34132.1	5	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149723	0.37923	.	.	ENSG00000170549	ENST00000302006	T	0.59502	0.26	4.17	4.17	0.49024	.	0.145888	0.44285	D	0.000476	T	0.70395	0.3219	L	0.57536	1.79	0.52099	D	0.999947	D	0.76494	0.999	D	0.72982	0.979	T	0.67711	-0.5600	10	0.22706	T	0.39	.	16.4849	0.84182	0.0:0.0:1.0:0.0	.	394	P78414	IRX1_HUMAN	I	394	ENSP00000305244:V394I	ENSP00000305244:V394I	V	+	1	0	IRX1	3653242	1.000000	0.71417	0.818000	0.32626	0.004000	0.04260	7.072000	0.76777	1.834000	0.53371	0.467000	0.42956	GTT	IRX1	-	NULL	ENSG00000170549		0.657	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX1	HGNC	protein_coding	OTTHUMT00000365546.1	-	0.00	32	0	G	NM_024337		3600242	+1	tier1	-	no_errors	ENST00000302006	ensembl	human	known	74_37	missense	65.38	9	17	SNP	1.000	A
ITGAD	3681	genome.wustl.edu	37	16	31426281	31426281	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:31426281C>T	ENST00000389202.2	+	18	2301	c.2252C>T	c.(2251-2253)gCc>gTc	p.A751V		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	751					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CCTGTGCTGGCCGTGGGCTCA	0.537																																																	0													113.0	102.0	106.0					16																	31426281		2197	4300	6497	SO:0001583	missense	0			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.2252C>T	16.37:g.31426281C>T	ENSP00000373854:p.Ala751Val		Q15575|Q15576	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A751V	ENST00000389202.2	37	c.2252	CCDS32438.1	16	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619430	0.46736	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.47177	0.85	5.03	2.91	0.33838	Integrin alpha-2 (1);	.	.	.	.	T	0.67720	0.2923	M	0.83118	2.625	0.28701	N	0.904059	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	T	0.60786	-0.7194	9	0.56958	D	0.05	.	10.2284	0.43241	0.3569:0.6431:0.0:0.0	.	767;751	Q59H14;Q13349	.;ITAD_HUMAN	V	767;751	ENSP00000373854:A751V	ENSP00000373854:A751V	A	+	2	0	ITGAD	31333782	0.027000	0.19231	0.792000	0.32020	0.201000	0.24016	-0.000000	0.12993	1.068000	0.40764	0.195000	0.17529	GCC	ITGAD	-	pfam_Integrin_alpha-2	ENSG00000156886		0.537	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	HGNC	protein_coding	OTTHUMT00000432836.1	-	0.00	42	0	C	NM_005353		31426281	+1	tier1	-	no_errors	ENST00000389202	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.718	T
JPH2	57158	genome.wustl.edu	37	20	42788997	42788997	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:42788997G>A	ENST00000372980.3	-	2	1302	c.430C>T	c.(430-432)Cgc>Tgc	p.R144C		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	144					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACGCTCTGGCGTACTCCGTAG	0.716																																																	0													19.0	11.0	14.0					20																	42788997		2107	4117	6224	SO:0001583	missense	0			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.430C>T	20.37:g.42788997G>A	ENSP00000362071:p.Arg144Cys		E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.R144C	ENST00000372980.3	37	c.430	CCDS13325.1	20	.	.	.	.	.	.	.	.	.	.	g	20.7	4.037693	0.75617	.	.	ENSG00000149596	ENST00000372980	T	0.53857	0.6	3.34	3.34	0.38264	.	0.000000	0.85682	U	0.000000	T	0.64371	0.2592	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68918	-0.5282	10	0.66056	D	0.02	.	14.8586	0.70362	0.0:0.0:1.0:0.0	.	144	Q9BR39	JPH2_HUMAN	C	144	ENSP00000362071:R144C	ENSP00000362071:R144C	R	-	1	0	JPH2	42222411	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	9.122000	0.94380	1.700000	0.51204	0.306000	0.20318	CGC	JPH2	-	pfam_MORN,smart_MORN,pirsf_Junctophilin	ENSG00000149596		0.716	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	HGNC	protein_coding	OTTHUMT00000080307.1	-	0.00	56	0	G			42788997	-1	tier1	-	no_errors	ENST00000372980	ensembl	human	known	74_37	missense	29.91	75	32	SNP	1.000	A
JPH3	57338	genome.wustl.edu	37	16	87678031	87678031	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:87678031G>A	ENST00000284262.2	+	2	792	c.550G>A	c.(550-552)Gcg>Acg	p.A184T		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	184					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		CGCCTCTCCGGCGGTGGCCGG	0.692																																																	0													33.0	38.0	36.0					16																	87678031		2191	4294	6485	SO:0001583	missense	0			AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.550G>A	16.37:g.87678031G>A	ENSP00000284262:p.Ala184Thr		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	pirsf_Junctophilin,pfam_MORN,smart_MORN	p.A184T	ENST00000284262.2	37	c.550	CCDS10962.1	16	.	.	.	.	.	.	.	.	.	.	G	10.50	1.366560	0.24771	.	.	ENSG00000154118	ENST00000537256;ENST00000284262	T	0.45668	0.89	5.03	4.07	0.47477	.	0.337477	0.31123	N	0.008204	T	0.16514	0.0397	N	0.02916	-0.46	0.43982	D	0.99667	B	0.09022	0.002	B	0.11329	0.006	T	0.06789	-1.0807	10	0.09843	T	0.71	.	8.6652	0.34116	0.1721:0.0:0.8279:0.0	.	184	Q8WXH2	JPH3_HUMAN	T	47;184	ENSP00000284262:A184T	ENSP00000284262:A184T	A	+	1	0	JPH3	86235532	1.000000	0.71417	0.101000	0.21167	0.542000	0.35054	6.205000	0.72148	1.115000	0.41800	0.462000	0.41574	GCG	JPH3	-	pirsf_Junctophilin	ENSG00000154118		0.692	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH3	HGNC	protein_coding	OTTHUMT00000269108.2	-	0.00	64	0	G			87678031	+1	tier1	-	no_errors	ENST00000284262	ensembl	human	known	74_37	missense	53.57	25	30	SNP	0.938	A
KAT2B	8850	genome.wustl.edu	37	3	20178458	20178458	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:20178458C>A	ENST00000263754.4	+	12	2229	c.1774C>A	c.(1774-1776)Cat>Aat	p.H592N	MIR3135A_ENST00000578460.1_RNA	NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	592	N-acetyltransferase. {ECO:0000250|UniProtKB:Q92830, ECO:0000255|PROSITE-ProRule:PRU00532}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.H592Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						CCTGATGAATCATTTGAAAGA	0.358																																																	1	Substitution - Missense(1)	skin(1)											127.0	110.0	116.0					3																	20178458		2203	4300	6503	SO:0001583	missense	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1774C>A	3.37:g.20178458C>A	ENSP00000263754:p.His592Asn		Q6NSK1	Missense_Mutation	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom	p.H592N	ENST00000263754.4	37	c.1774	CCDS2634.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.113637	0.94339	.	.	ENSG00000114166	ENST00000263754	T	0.25579	1.79	5.66	5.66	0.87406	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.62636	0.2444	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.69997	-0.4993	10	0.87932	D	0	-21.8842	20.1253	0.97977	0.0:1.0:0.0:0.0	.	592	Q92831	KAT2B_HUMAN	N	592	ENSP00000263754:H592N	ENSP00000263754:H592N	H	+	1	0	KAT2B	20153462	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.832000	0.97577	0.655000	0.94253	CAT	KAT2B	-	pirsf_Hist_acetylase_PCAF,pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000114166		0.358	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1		0.00	33	0	C	NM_003884		20178458	+1			no_errors	ENST00000263754	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	A
KAT7	11143	genome.wustl.edu	37	17	47893244	47893244	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:47893244G>T	ENST00000259021.4	+	8	1212	c.932G>T	c.(931-933)cGa>cTa	p.R311L	KAT7_ENST00000509773.1_Missense_Mutation_p.R201L|KAT7_ENST00000510819.1_Missense_Mutation_p.R142L|KAT7_ENST00000435742.2_Missense_Mutation_p.R125L|KAT7_ENST00000424009.2_Missense_Mutation_p.R281L|KAT7_ENST00000454930.2_Missense_Mutation_p.R172L|KAT7_ENST00000503935.2_Missense_Mutation_p.R155L|KAT7_ENST00000513980.1_3'UTR	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	311					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GATCTTTTCCGAAGAGCACAA	0.458																																																	0													78.0	78.0	78.0					17																	47893244		2203	4300	6503	SO:0001583	missense	0			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.932G>T	17.37:g.47893244G>T	ENSP00000259021:p.Arg311Leu		B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.R311L	ENST00000259021.4	37	c.932	CCDS11554.1	17	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383825	0.82792	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009;ENST00000503935;ENST00000435742	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.72366	0.3451	M	0.65677	2.01	0.80722	D	1	D;B;P;P;D;D	0.64830	0.986;0.229;0.885;0.944;0.994;0.99	P;B;B;P;P;P	0.52856	0.599;0.055;0.445;0.554;0.698;0.711	T	0.74417	-0.3672	9	0.56958	D	0.05	-7.704	18.8697	0.92308	0.0:0.0:1.0:0.0	.	274;142;201;172;311;281	B4DGY4;B4DFE0;B4DFB4;E7ER15;O95251;G5E9K7	.;.;.;.;KAT7_HUMAN;.	L	311;172;201;142;281;155;125	.	ENSP00000259021:R311L	R	+	2	0	KAT7	45248243	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.750000	0.91623	2.788000	0.95919	0.650000	0.86243	CGA	KAT7	-	NULL	ENSG00000136504		0.458	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	HGNC	protein_coding	OTTHUMT00000366032.1		0.00	39	0	G	NM_007067		47893244	+1			no_errors	ENST00000259021	ensembl	human	known	74_37	missense	16.67	10	2	SNP	1.000	T
KCNH2	3757	genome.wustl.edu	37	7	150648627	150648627	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:150648627G>T	ENST00000262186.5	-	7	2255	c.1854C>A	c.(1852-1854)acC>acA	p.T618T	KCNH2_ENST00000392968.2_Silent_p.T522T|KCNH2_ENST00000430723.3_Silent_p.T618T|KCNH2_ENST00000330883.4_Silent_p.T278T	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	618					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GGCTGCTGAAGGTGAAGTAGA	0.577																																					GBM(137;110 1844 13671 20123 45161)												0													104.0	90.0	95.0					7																	150648627		2203	4300	6503	SO:0001819	synonymous_variant	0			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.1854C>A	7.37:g.150648627G>T			A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.T618	ENST00000262186.5	37	c.1854	CCDS5910.1	7																																																																																			KCNH2	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000055118		0.577	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH2	HGNC	protein_coding	OTTHUMT00000350741.2		0.00	77	0	G	NM_000238		150648627	-1			no_errors	ENST00000262186	ensembl	human	known	74_37	silent	5.41	70	4	SNP	1.000	T
KCNJ8	3764	genome.wustl.edu	37	12	21926469	21926469	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:21926469G>A	ENST00000240662.2	-	2	427	c.82C>T	c.(82-84)Cga>Tga	p.R28*		NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	28					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	AGGCGGTCTCGGATGCGCGGC	0.597											OREG0021704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													76.0	78.0	77.0					12																	21926469		2203	4300	6503	SO:0001587	stop_gained	0			BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.82C>T	12.37:g.21926469G>A	ENSP00000240662:p.Arg28*	752	O00657	Nonsense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir6.1	p.R28*	ENST00000240662.2	37	c.82	CCDS8692.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.496026	0.96355	.	.	ENSG00000121361	ENST00000240662;ENST00000539350;ENST00000537950	.	.	.	4.88	2.88	0.33553	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	13.8725	0.63629	0.0:0.0:0.6331:0.3668	.	.	.	.	X	28	.	ENSP00000240662:R28X	R	-	1	2	KCNJ8	21817736	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.178000	0.42519	1.268000	0.44264	0.591000	0.81541	CGA	KCNJ8	-	pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir6.1	ENSG00000121361		0.597	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ8	HGNC	protein_coding	OTTHUMT00000402226.1	-	0.00	38	0	G	NM_004982		21926469	-1	tier1	-	no_errors	ENST00000240662	ensembl	human	known	74_37	nonsense	63.64	20	35	SNP	1.000	A
KIAA1598	57698	genome.wustl.edu	37	10	118644866	118644867	+	3'UTR	INS	-	-	T	rs145381187		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr10:118644866_118644867insT	ENST00000355371.4	-	0	3381_3382				ENO4_ENST00000369207.2_Intron|KIAA1598_ENST00000260777.10_3'UTR|KIAA1598_ENST00000392903.2_Intron|KIAA1598_ENST00000497044.1_5'UTR	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598						axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		AGCTGCATAAGTTTTTTTTTTA	0.262																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.*989->A	10.37:g.118644876_118644876dupT			A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	RNA	INS	-	NULL	ENST00000355371.4	37	NULL	CCDS44482.1	10																																																																																			KIAA1598	-	-	ENSG00000187164		0.262	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1598	HGNC	protein_coding			0.00	58	0	-	NM_018330		118644867	-1	tier1		no_errors	ENST00000497044	ensembl	human	known	74_37	rna	11.36	39	5	INS	1.000:0.999	T
KLHL23	151230	genome.wustl.edu	37	2	170591713	170591713	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:170591713G>T	ENST00000392647.2	+	2	433	c.189G>T	c.(187-189)aaG>aaT	p.K63N	KLHL23_ENST00000272797.4_Missense_Mutation_p.K63N|KLHL23_ENST00000602521.1_Intron	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	63	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						ATTATTTTAAGGCAATGTTCA	0.353																																																	0													61.0	68.0	66.0					2																	170591713		2200	4298	6498	SO:0001583	missense	0			BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.189G>T	2.37:g.170591713G>T	ENSP00000376419:p.Lys63Asn		Q8N9B9|Q96FT8	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.K63N	ENST00000392647.2	37	c.189	CCDS2236.1	2	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830270	0.50845	.	.	ENSG00000213160	ENST00000272797;ENST00000392647	T;T	0.70749	-0.51;-0.51	5.81	3.7	0.42460	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.045522	0.85682	D	0.000000	T	0.68513	0.3009	L	0.55213	1.73	0.33637	D	0.606769	B	0.28258	0.205	B	0.39152	0.292	T	0.75028	-0.3462	9	0.45353	T	0.12	.	9.4527	0.38736	0.2823:0.0:0.7177:0.0	.	63	Q8NBE8	KLH23_HUMAN	N	63	ENSP00000272797:K63N;ENSP00000376419:K63N	ENSP00000272797:K63N	K	+	3	2	KLHL23	170299959	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.499000	0.45372	1.456000	0.47831	0.655000	0.94253	AAG	KLHL23	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000213160		0.353	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL23	HGNC	protein_coding	OTTHUMT00000255271.2	-	0.00	54	0	G	NM_144711		170591713	+1	tier1	-	no_errors	ENST00000272797	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
KMT2C	58508	genome.wustl.edu	37	7	151874148	151874148	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:151874148delT	ENST00000262189.6	-	38	8608	c.8390delA	c.(8389-8391)aagfs	p.K2797fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.K2797fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2797				K -> R (in Ref. 1; AAK00583). {ECO:0000305}.	histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.K2797fs*26(20)									TTCTTGTTCCTTTTTTTTTGG	0.348																																																	20	Deletion - Frameshift(20)	large_intestine(18)|liver(2)											135.0	130.0	132.0					7																	151874148		2203	4300	6503	SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8390delA	7.37:g.151874148delT	ENSP00000262189:p.Lys2797fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.K2797fs	ENST00000262189.6	37	c.8390	CCDS5931.1	7																																																																																			KMT2C	-	NULL	ENSG00000055609		0.348	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3		0.00	23	0	T			151874148	-1	tier1		no_errors	ENST00000355193	ensembl	human	known	74_37	frame_shift_del	19.05	17	4	DEL	0.019	-
KNTC1	9735	genome.wustl.edu	37	12	123099634	123099637	+	Splice_Site	DEL	GTAA	GTAA	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	GTAA	GTAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:123099634_123099637delGTAA	ENST00000333479.7	+	56	6150		c.e56+1		KNTC1_ENST00000436959.3_Splice_Site|KNTC1_ENST00000450485.2_Splice_Site|KNTC1_ENST00000537348.1_Splice_Site	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CTTCAATATGGTAAGTAAGACTCA	0.392																																																	0																																										SO:0001630	splice_region_variant	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.5973+1GTAA>-	12.37:g.123099638_123099641delGTAA			A7E2C4|B3KSG2	Splice_Site	DEL	-	e55+1	ENST00000333479.7	37	c.5973+1_5973+1	CCDS45002.1	12																																																																																			KNTC1	-	-	ENSG00000184445		0.392	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2		0.00	50	0	GTAA		Intron	123099637	+1	tier1		no_errors	ENST00000333479	ensembl	human	known	74_37	splice_site_del	22.50	31	9	DEL	1.000:1.000:0.996:1.000	-
KPNA1	3836	genome.wustl.edu	37	3	122146488	122146488	+	Silent	SNP	A	A	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:122146488A>T	ENST00000344337.6	-	13	1502	c.1326T>A	c.(1324-1326)gtT>gtA	p.V442V	RP11-299J3.8_ENST00000608015.1_RNA|KPNA1_ENST00000466923.1_5'UTR|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	442					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)	p.V442V(1)		NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		CATTTAGGGCAACCTGTACAA	0.433																																					Melanoma(12;340 801 11196 19797)												1	Substitution - coding silent(1)	breast(1)											96.0	89.0	91.0					3																	122146488		2203	4300	6503	SO:0001819	synonymous_variant	0			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.1326T>A	3.37:g.122146488A>T			D3DN93|Q6IBQ9|Q9BQ56	Silent	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.V442	ENST00000344337.6	37	c.1326	CCDS3013.1	3																																																																																			KPNA1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000114030		0.433	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1		0.00	44	0	A	NM_002264		122146488	-1			no_errors	ENST00000344337	ensembl	human	known	74_37	silent	10.00	18	2	SNP	1.000	T
LEPRE1	64175	genome.wustl.edu	37	1	43228043	43228043	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:43228043G>T	ENST00000296388.5	-	2	620	c.569C>A	c.(568-570)tCt>tAt	p.S190Y	LEPRE1_ENST00000397054.3_Missense_Mutation_p.S190Y|LEPRE1_ENST00000236040.4_Missense_Mutation_p.S190Y			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	190					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CTTCACTCCAGACATGGTTTG	0.418																																																	0													170.0	161.0	164.0					1																	43228043		2203	4300	6503	SO:0001583	missense	0			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.569C>A	1.37:g.43228043G>T	ENSP00000296388:p.Ser190Tyr		Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.S190Y	ENST00000296388.5	37	c.569	CCDS472.2	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221675	0.79464	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.27557	1.66;1.66;1.66	5.82	5.82	0.92795	Tetratricopeptide-like helical (1);	0.102943	0.64402	D	0.000003	T	0.47303	0.1438	L	0.58810	1.83	0.33929	D	0.641765	D;D;P;D	0.67145	0.996;0.991;0.925;0.958	P;P;P;P	0.60473	0.875;0.875;0.541;0.635	T	0.61153	-0.7120	10	0.72032	D	0.01	-18.8347	12.5369	0.56145	0.0:0.0:0.8336:0.1664	.	190;190;55;190	Q32P28-2;Q32P28-3;B4DNM8;Q32P28	.;.;.;P3H1_HUMAN	Y	190;190;190;55	ENSP00000380245:S190Y;ENSP00000236040:S190Y;ENSP00000296388:S190Y	ENSP00000236040:S190Y	S	-	2	0	LEPRE1	43000630	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.437000	0.59955	2.756000	0.94617	0.563000	0.77884	TCT	LEPRE1	-	NULL	ENSG00000117385		0.418	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LEPRE1	HGNC	protein_coding	OTTHUMT00000019790.2	-	0.00	60	0	G	NM_022356		43228043	-1	tier1	-	no_errors	ENST00000236040	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.997	T
LBR	3930	genome.wustl.edu	37	1	225611623	225611623	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:225611623T>C	ENST00000338179.2	-	2	280	c.155A>G	c.(154-156)aAt>aGt	p.N52S	LBR_ENST00000272163.4_Missense_Mutation_p.N52S	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	52	Tudor.				cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		CTTAATATCATTCTCTTTCAA	0.378																																																	0													208.0	211.0	210.0					1																	225611623		2203	4300	6503	SO:0001583	missense	0			L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.155A>G	1.37:g.225611623T>C	ENSP00000339883:p.Asn52Ser		B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	pfam_Ergosterol_biosynth_ERG4_ERG24,pfam_Lamin-B_rcpt_of_tudor,pfam_DUF1295,smart_Tudor	p.N52S	ENST00000338179.2	37	c.155	CCDS1545.1	1	.	.	.	.	.	.	.	.	.	.	T	1.941	-0.443653	0.04604	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000425080	D;D;T	0.96745	-4.11;-4.11;0.64	5.3	-5.63	0.02474	Lamin-B receptor of TUDOR domain (1);Tudor domain (1);	0.606682	0.19252	N	0.118918	D	0.83083	0.5177	N	0.01874	-0.695	0.22424	N	0.999119	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.74503	-0.3644	10	0.02654	T	1	-2.8992	12.7272	0.57176	0.0:0.4663:0.0:0.5337	.	52;52	C9JXK0;Q14739	.;LBR_HUMAN	S	52	ENSP00000272163:N52S;ENSP00000339883:N52S;ENSP00000388059:N52S	ENSP00000272163:N52S	N	-	2	0	LBR	223678246	0.923000	0.31300	0.620000	0.29132	0.792000	0.44763	-0.016000	0.12613	-1.641000	0.01523	-0.899000	0.02877	AAT	LBR	-	pfam_Lamin-B_rcpt_of_tudor,smart_Tudor	ENSG00000143815		0.378	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LBR	HGNC	protein_coding	OTTHUMT00000091398.1	-	0.00	53	0	T	NM_002296		225611623	-1	tier1	-	no_errors	ENST00000272163	ensembl	human	known	74_37	missense	16.33	41	8	SNP	0.681	C
LINC00957	255031	genome.wustl.edu	37	7	44080367	44080367	+	lincRNA	SNP	A	A	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:44080367A>G	ENST00000441052.1	+	0	1052				RASA4CP_ENST00000446874.1_RNA					long intergenic non-protein coding RNA 957																		GCAGCCCGGAACACCTGCGTG	0.721																																																	0																																												0			BC014556		7p13	2013-06-04			ENSG00000235314	ENSG00000235314		"""Long non-coding RNAs"""	22332	non-coding RNA	RNA, long non-coding							Standard	NR_015401		Approved				OTTHUMG00000155351		7.37:g.44080367A>G				RNA	SNP	-	NULL	ENST00000441052.1	37	NULL		7																																																																																			LINC00957	-	-	ENSG00000235314		0.721	LINC00957-001	KNOWN	basic	lincRNA	LINC00957	HGNC	lincRNA	OTTHUMT00000339589.1		0.00	32	0	A			44080367	+1			no_errors	ENST00000416824	ensembl	human	known	74_37	rna	16.67	25	5	SNP	0.998	G
LMBR1L	55716	genome.wustl.edu	37	12	49500756	49500756	+	Missense_Mutation	SNP	C	C	T	rs370079049		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:49500756C>T	ENST00000267102.8	-	2	487	c.145G>A	c.(145-147)Gag>Aag	p.E49K	LMBR1L_ENST00000547382.1_Missense_Mutation_p.E49K|LMBR1L_ENST00000553204.1_5'UTR|LMBR1L_ENST00000395141.4_5'Flank	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	49	LCN1-binding.				endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GTGGTGAACTCAGCAGGCTTC	0.517																																																	0								C	LYS/GLU	0,4220		0,0,2110	130.0	148.0	142.0		145	5.2	1.0	12		142	1,8465		0,1,4232	no	missense	LMBR1L	NM_018113.2	56	0,1,6342	TT,TC,CC		0.0118,0.0,0.0079	benign	49/490	49500756	1,12685	2110	4233	6343	SO:0001583	missense	0			AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.145G>A	12.37:g.49500756C>T	ENSP00000267102:p.Glu49Lys		Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot,prints_Lipcalin_1_rcpt	p.E49K	ENST00000267102.8	37	c.145	CCDS8780.2	12	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768340	0.90020	0.0	1.18E-4	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000547675;ENST00000550137;ENST00000551854;ENST00000551782	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	5.25	5.25	0.73442	LMBR1-like membrane protein (1);	0.103535	0.64402	D	0.000004	T	0.32194	0.0821	L	0.46157	1.445	0.80722	D	1	B;B	0.30542	0.241;0.284	B;B	0.30943	0.051;0.122	T	0.12451	-1.0547	10	0.66056	D	0.02	.	17.7869	0.88540	0.0:1.0:0.0:0.0	.	49;49	Q6UX01-3;Q6UX01	.;LMBRL_HUMAN	K	49;49;49;49;54;49	ENSP00000267102:E49K;ENSP00000447329:E49K;ENSP00000447240:E49K;ENSP00000446641:E54K;ENSP00000449633:E49K	ENSP00000267102:E49K	E	-	1	0	LMBR1L	47787023	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.194000	0.77789	2.744000	0.94065	0.563000	0.77884	GAG	LMBR1L	-	pfam_LMBR1-like_membr_prot	ENSG00000139636		0.517	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	HGNC	protein_coding	OTTHUMT00000318696.1	-	0.00	115	0	C	NM_018113		49500756	-1	tier1	-	no_errors	ENST00000267102	ensembl	human	known	74_37	missense	12.62	90	13	SNP	1.000	T
KIAA2012	100652824	genome.wustl.edu	37	2	202964402	202964402	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:202964402C>T	ENST00000541917.1	+	6	1268	c.895C>T	c.(895-897)Caa>Taa	p.Q299*	AC079354.1_ENST00000409515.3_3'UTR|AC079354.1_ENST00000295844.3_Nonsense_Mutation_p.Q355*																							AAAGACACAGCAAACCTCCAG	0.468																																																	0																																										SO:0001587	stop_gained	0																														ENST00000541917.1:c.895C>T	2.37:g.202964402C>T	ENSP00000437957:p.Gln299*			Nonsense_Mutation	SNP	NULL	p.Q299*	ENST00000541917.1	37	c.895		2	.	.	.	.	.	.	.	.	.	.	C	38	7.197374	0.98129	.	.	ENSG00000182329	ENST00000541917;ENST00000295844	.	.	.	6.03	5.14	0.70334	.	0.682462	0.12855	N	0.433634	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-1.7182	12.4264	0.55548	0.1819:0.8181:0.0:0.0	.	.	.	.	X	299;355	.	ENSP00000295844:Q355X	Q	+	1	0	AC079354.1	202672647	0.007000	0.16637	0.148000	0.22405	0.035000	0.12851	1.108000	0.31123	1.509000	0.48786	-0.274000	0.10170	CAA	AC079354.1	-	NULL	ENSG00000182329		0.468	AC079354.1-201	KNOWN	basic|appris_principal	protein_coding	LOC100652824	Clone_based_vega_gene	protein_coding		-	0.00	72	0	C			202964402	+1	tier1	-	no_errors	ENST00000541917	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	0.078	T
CCM2L	140706	genome.wustl.edu	37	20	30616960	30616960	+	Intron	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:30616960G>T	ENST00000300415.8	+	8	1276				RP1-310O13.7_ENST00000449519.1_RNA|CCM2L_ENST00000262659.8_Intron			Q9NUG4	CCM2L_HUMAN	cerebral cavernous malformation 2-like																		aatggcacaagcaaaagcctg	0.547																																																	0													82.0	75.0	77.0					20																	30616960		2203	4300	6503	SO:0001627	intron_variant	0			AL031658	CCDS13195.1	20q11.21	2012-10-30	2012-10-30	2012-10-30	ENSG00000101331	ENSG00000101331			16153	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 160"""	C20orf160			Standard	NM_080625		Approved	dJ310O13.5	uc002wxf.2	Q9NUG4	OTTHUMG00000032197	ENST00000300415.8:c.1263+33G>T	20.37:g.30616960G>T			Q5JYR9|Q8N5F1|Q8N6G8|Q96MD5	RNA	SNP	-	NULL	ENST00000300415.8	37	NULL		20																																																																																			RP1-310O13.7	-	-	ENSG00000226239		0.547	CCM2L-201	KNOWN	basic|appris_candidate_longest	protein_coding	LOC101929636	Clone_based_vega_gene	protein_coding		-	0.00	29	0	G	NM_080625		30616960	-1	tier1	-	no_errors	ENST00000449519	ensembl	human	known	74_37	rna	6.56	57	4	SNP	0.000	T
LOC729218	729218	genome.wustl.edu	37	4	119552246	119552246	+	lincRNA	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:119552246C>T	ENST00000567913.2	+	0	1757																											AGCTCCTGTCCCAGAACGTCA	0.572																																																	0																																												0																															4.37:g.119552246C>T				RNA	SNP	-	NULL	ENST00000567913.2	37	NULL		4																																																																																			RP11-384K6.6	-	-	ENSG00000260404		0.572	RP11-384K6.6-001	KNOWN	basic	lincRNA	LOC101929676	Clone_based_vega_gene	lincRNA	OTTHUMT00000364170.2		0.00	45	0	C			119552246	+1			no_errors	ENST00000567913	ensembl	human	known	74_37	rna	16.67	20	4	SNP	0.987	T
CARD14	79092	genome.wustl.edu	37	17	78178223	78178223	+	Intron	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:78178223G>T	ENST00000573882.1	+	19	2934				RP11-334C17.5_ENST00000576824.1_RNA|RP11-334C17.5_ENST00000570309.1_RNA|RP11-334C17.5_ENST00000572730.1_RNA|CARD14_ENST00000344227.2_Intron|RP11-334C17.5_ENST00000573346.1_RNA|RP11-334C17.5_ENST00000573935.1_RNA			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14						activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TGGTCAGCTGGGGCAGGGGGA	0.617																																																	0																																										SO:0001627	intron_variant	0			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.2398+83G>T	17.37:g.78178223G>T			B8QQJ3|Q9BVB5	RNA	SNP	-	NULL	ENST00000573882.1	37	NULL	CCDS11768.1	17																																																																																			RP11-334C17.5	-	-	ENSG00000262580		0.617	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929888	Clone_based_vega_gene	protein_coding	OTTHUMT00000437507.1	-	0.00	45	0	G			78178223	-1	tier1	-	no_errors	ENST00000570309	ensembl	human	known	74_37	rna	6.35	59	4	SNP	0.000	T
VLDLR	7436	genome.wustl.edu	37	9	2622147	2622149	+	5'UTR	DEL	CGG	CGG	-	rs369552432	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	CGG	CGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:2622147_2622149delCGG	ENST00000382100.3	+	0	314_316				RP11-125B21.2_ENST00000416826.2_RNA|RP11-125B21.2_ENST00000453601.1_RNA|RP11-125B21.2_ENST00000599229.1_RNA|VLDLR_ENST00000382099.2_5'UTR	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor						cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		GCGGAGCGAAcggcggcggcggc	0.724																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.-41CGG>-	9.37:g.2622156_2622158delCGG			B2RMZ7|D3DRH6|Q5VVF6	RNA	DEL	-	NULL	ENST00000382100.3	37	NULL	CCDS6446.1	9																																																																																			RP11-125B21.2	-	-	ENSG00000236404		0.724	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC101930053	Clone_based_vega_gene	protein_coding	OTTHUMT00000051519.2		0.00	33	0	CGG	NM_003383		2622149	-1	tier1		no_errors	ENST00000453601	ensembl	human	known	74_37	rna	18.18	9	2	DEL	0.995:0.997:0.998	-
LPIN1	23175	genome.wustl.edu	37	2	11913846	11913846	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:11913846G>T	ENST00000256720.2	+	5	790	c.697G>T	c.(697-699)Gat>Tat	p.D233Y	LPIN1_ENST00000425416.2_Missense_Mutation_p.D239Y|LPIN1_ENST00000396098.1_Missense_Mutation_p.D239Y|LPIN1_ENST00000396099.1_Missense_Mutation_p.D239Y|LPIN1_ENST00000449576.2_Missense_Mutation_p.D282Y	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	233					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		CCCTAATTCGGATAGAGAGTG	0.473																																																	0													126.0	124.0	125.0					2																	11913846		2203	4300	6503	SO:0001583	missense	0			D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.697G>T	2.37:g.11913846G>T	ENSP00000256720:p.Asp233Tyr		A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,superfamily_WD40_repeat_dom,smart_LNS2	p.D282Y	ENST00000256720.2	37	c.844	CCDS1682.1	2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315663	0.81469	.	.	ENSG00000134324	ENST00000449576;ENST00000396098;ENST00000396099;ENST00000425416;ENST00000256720	D;D;D;D;D	0.90676	-1.73;-2.71;-1.7;-1.92;-1.91	5.33	5.33	0.75918	.	0.250238	0.45867	D	0.000323	D	0.94644	0.8273	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	0.999;0.993;1.0	D;P;D	0.75484	0.957;0.855;0.986	D	0.95072	0.8205	10	0.87932	D	0	-12.2847	17.1909	0.86879	0.0:0.0:1.0:0.0	.	282;233;239	F5GY24;Q14693;A8MU38	.;LPIN1_HUMAN;.	Y	282;239;239;239;233	ENSP00000397908:D282Y;ENSP00000379405:D239Y;ENSP00000379406:D239Y;ENSP00000401522:D239Y;ENSP00000256720:D233Y	ENSP00000256720:D233Y	D	+	1	0	LPIN1	11831297	1.000000	0.71417	0.754000	0.31244	0.918000	0.54935	6.758000	0.74929	2.505000	0.84491	0.467000	0.42956	GAT	LPIN1	-	NULL	ENSG00000134324		0.473	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN1	HGNC	protein_coding	OTTHUMT00000239296.3		0.00	55	0	G	NM_145693		11913846	+1			no_errors	ENST00000449576	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.935	T
LRP1B	53353	genome.wustl.edu	37	2	141598621	141598621	+	Silent	SNP	T	T	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:141598621T>C	ENST00000389484.3	-	30	5951	c.4980A>G	c.(4978-4980)tcA>tcG	p.S1660S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1660					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATAAATTACGTGACACCCAAT	0.373										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													133.0	124.0	127.0					2																	141598621		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4980A>G	2.37:g.141598621T>C			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.S1660	ENST00000389484.3	37	c.4980	CCDS2182.1	2																																																																																			LRP1B	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000168702		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	41	0	T	NM_018557		141598621	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	47.83	12	11	SNP	0.918	C
LRRC32	2615	genome.wustl.edu	37	11	76376953	76376953	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:76376953G>T	ENST00000407242.2	-	2	288	c.46C>A	c.(46-48)Ctg>Atg	p.L16M	LRRC32_ENST00000464145.1_5'UTR|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000404995.1_Missense_Mutation_p.L16M|LRRC32_ENST00000260061.5_Missense_Mutation_p.L16M	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	16					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						TGTGCAGCCAGGCCTAGGGTC	0.597																																																	0													175.0	150.0	159.0					11																	76376953		2200	4292	6492	SO:0001583	missense	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.46C>A	11.37:g.76376953G>T	ENSP00000384126:p.Leu16Met		Q86V06	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.L16M	ENST00000407242.2	37	c.46	CCDS8245.1	11	.	.	.	.	.	.	.	.	.	.	G	14.07	2.424591	0.43020	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995;ENST00000421973	T;T;T;T	0.59906	1.05;1.05;1.05;0.23	3.85	3.85	0.44370	.	0.229124	0.29342	N	0.012434	T	0.67961	0.2949	L	0.47716	1.5	0.31817	N	0.626496	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.994	T	0.68443	-0.5407	10	0.30854	T	0.27	.	15.5702	0.76330	0.0:0.0:1.0:0.0	.	16;16	C9JYU3;Q14392	.;LRC32_HUMAN	M	16	ENSP00000260061:L16M;ENSP00000384126:L16M;ENSP00000385766:L16M;ENSP00000413331:L16M	ENSP00000260061:L16M	L	-	1	2	LRRC32	76054601	1.000000	0.71417	0.997000	0.53966	0.032000	0.12392	2.364000	0.44187	2.445000	0.82738	0.467000	0.42956	CTG	LRRC32	-	NULL	ENSG00000137507		0.597	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	-	0.00	56	0	G	NM_005512		76376953	-1	tier1	-	no_errors	ENST00000260061	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.999	T
LRRTM1	347730	genome.wustl.edu	37	2	80529687	80529687	+	Missense_Mutation	SNP	C	C	G	rs200735251		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:80529687C>G	ENST00000295057.3	-	2	1914	c.1258G>C	c.(1258-1260)Gag>Cag	p.E420Q	CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000541047.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.E420Q|CTNNA2_ENST00000466387.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	420					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.E420K(2)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						ACGGCGTTCTCGGCGTGCTCG	0.662										HNSCC(69;0.2)																																							2	Substitution - Missense(2)	skin(2)											56.0	52.0	53.0					2																	80529687		2203	4300	6503	SO:0001583	missense	0			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1258G>C	2.37:g.80529687C>G	ENSP00000295057:p.Glu420Gln		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E420Q	ENST00000295057.3	37	c.1258	CCDS1966.1	2	.	.	.	.	.	.	.	.	.	.	C	16.40	3.113877	0.56398	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.39787	1.06;1.06	5.04	5.04	0.67666	.	0.070917	0.56097	U	0.000031	T	0.36166	0.0957	N	0.08118	0	0.80722	D	1	D	0.55605	0.972	P	0.52554	0.702	T	0.26155	-1.0111	9	.	.	.	.	18.4061	0.90536	0.0:1.0:0.0:0.0	.	420	Q86UE6	LRRT1_HUMAN	Q	420	ENSP00000295057:E420Q;ENSP00000386646:E420Q	.	E	-	1	0	LRRTM1	80383198	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.814000	0.86154	2.310000	0.77875	0.655000	0.94253	GAG	LRRTM1	-	NULL	ENSG00000162951		0.662	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM1	HGNC	protein_coding	OTTHUMT00000313614.1	-	0.00	29	0	C	NM_178839		80529687	-1	tier1	-	no_errors	ENST00000295057	ensembl	human	known	74_37	missense	25.00	24	8	SNP	1.000	G
LTBP3	4054	genome.wustl.edu	37	11	65307271	65307271	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:65307271G>A	ENST00000301873.5	-	25	3735	c.3467C>T	c.(3466-3468)gCc>gTc	p.A1156V	LTBP3_ENST00000530785.1_Missense_Mutation_p.A159V|LTBP3_ENST00000532932.1_Missense_Mutation_p.A586V|LTBP3_ENST00000536982.1_Missense_Mutation_p.A735V|LTBP3_ENST00000322147.4_Missense_Mutation_p.A1109V|LTBP3_ENST00000529189.1_Missense_Mutation_p.A112V	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	1156	TB 4.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						GAAGGTGAGGGCAGGCCCGGC	0.761																																																	0													2.0	3.0	3.0					11																	65307271		1663	3347	5010	SO:0001583	missense	0			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.3467C>T	11.37:g.65307271G>A	ENSP00000301873:p.Ala1156Val		O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.A1156V	ENST00000301873.5	37	c.3467	CCDS44647.1	11	.	.	.	.	.	.	.	.	.	.	G	5.970	0.363006	0.11296	.	.	ENSG00000168056	ENST00000301874;ENST00000322147;ENST00000301873;ENST00000530785;ENST00000529189;ENST00000532932;ENST00000536982;ENST00000532661;ENST00000529371;ENST00000530866	T;T;D;T;D;T;D;D;T	0.93763	-1.37;-1.46;-2.58;-0.42;-2.58;-1.32;-3.28;-3.28;-1.35	4.93	1.33	0.21861	Matrix fibril-associated (3);TGF-beta binding (1);	0.847721	0.10620	N	0.653461	D	0.83367	0.5239	N	0.12746	0.255	0.09310	N	1	B;B;B;B;B;B;B	0.32302	0.243;0.007;0.024;0.363;0.016;0.005;0.089	B;B;B;B;B;B;B	0.35182	0.197;0.006;0.014;0.183;0.009;0.009;0.098	T	0.72890	-0.4155	10	0.15952	T	0.53	.	3.9868	0.09519	0.2033:0.474:0.3227:0.0	.	1067;735;992;1156;1109;586;735	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2;B4DQL8	.;.;.;LTBP3_HUMAN;.;.;.	V	159;1109;1156;159;112;586;735;112;29;1067	ENSP00000326647:A1109V;ENSP00000301873:A1156V;ENSP00000434315:A159V;ENSP00000434406:A112V;ENSP00000435530:A586V;ENSP00000441912:A735V;ENSP00000436341:A112V;ENSP00000436032:A29V;ENSP00000435276:A1067V	ENSP00000301873:A1156V	A	-	2	0	LTBP3	65063847	0.228000	0.23718	0.011000	0.14972	0.001000	0.01503	0.715000	0.25822	0.432000	0.26286	-0.175000	0.13238	GCC	LTBP3	-	pfam_TB_dom,superfamily_TB_dom	ENSG00000168056		0.761	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	HGNC	protein_coding	OTTHUMT00000390538.1		0.00	9	0	G	NM_021070		65307271	-1			no_errors	ENST00000301873	ensembl	human	known	74_37	missense	50.00	5	5	SNP	0.001	A
LZTR1	8216	genome.wustl.edu	37	22	21343119	21343119	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr22:21343119G>T	ENST00000215739.8	+	6	910	c.551G>T	c.(550-552)aGt>aTt	p.S184I	LZTR1_ENST00000389355.3_Missense_Mutation_p.S165I|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	184					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			ACGGTGTACAGTGACAAGCTG	0.652																																																	0													175.0	134.0	148.0					22																	21343119		2203	4300	6503	SO:0001583	missense	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.551G>T	22.37:g.21343119G>T	ENSP00000215739:p.Ser184Ile		Q14776|Q20WK0	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.S184I	ENST00000215739.8	37	c.551	CCDS33606.1	22	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982567	0.74474	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.67523	-0.27;-0.27	5.87	2.61	0.31194	Kelch-type beta propeller (1);	0.081401	0.85682	D	0.000000	T	0.58963	0.2159	N	0.19112	0.55	0.52099	D	0.999943	P;P;P;D	0.59357	0.873;0.953;0.873;0.985	P;P;P;P	0.54100	0.5;0.637;0.602;0.742	T	0.60321	-0.7286	10	0.72032	D	0.01	-8.4682	7.9722	0.30134	0.2845:0.0:0.7155:0.0	.	165;143;184;143	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	I	143;184;165	ENSP00000215739:S184I;ENSP00000374006:S165I	ENSP00000215739:S184I	S	+	2	0	LZTR1	19673119	0.998000	0.40836	0.998000	0.56505	0.891000	0.51852	1.953000	0.40352	0.753000	0.32945	-0.140000	0.14226	AGT	LZTR1	-	smart_Kelch_1	ENSG00000099949		0.652	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	-	0.00	60	0	G	NM_006767		21343119	+1	tier1	-	no_errors	ENST00000215739	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.999	T
MACF1	23499	genome.wustl.edu	37	1	39715766	39715766	+	Silent	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:39715766C>A	ENST00000372915.3	+	3	450	c.363C>A	c.(361-363)ggC>ggA	p.G121G	MACF1_ENST00000317713.7_Silent_p.G121G|RP11-420K8.1_ENST00000289890.7_RNA|MACF1_ENST00000545844.1_Silent_p.G121G|MACF1_ENST00000564288.1_Silent_p.G84G|MACF1_ENST00000567887.1_Silent_p.G121G|MACF1_ENST00000539005.1_Silent_p.G121G|MACF1_ENST00000536367.1_Silent_p.G84G|MACF1_ENST00000361689.2_Silent_p.G121G			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	121	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCCTCTCAGGCATCAAACTGG	0.478																																																	0													187.0	168.0	174.0					1																	39715766		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.363C>A	1.37:g.39715766C>A			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.G121	ENST00000372915.3	37	c.363		1																																																																																			MACF1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000127603		0.478	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	57	0	C	NM_033044		39715766	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	silent	10.00	27	3	SNP	0.998	A
MBD3L5	284428	genome.wustl.edu	37	19	7032880	7032880	+	Missense_Mutation	SNP	A	A	G	rs79151215	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:7032880A>G	ENST00000329753.5	+	2	636	c.602A>G	c.(601-603)cAg>cGg	p.Q201R		NM_001136507.1	NP_001129979.1	A6NJ08	MB3L5_HUMAN	methyl-CpG binding domain protein 3-like 5	201																	CTGGCCAGGCAGGCAGAAATG	0.547													-|||	109	0.0217652	0.0174	0.0259	5008	,	,		6300	0.0139		0.0119	False		,,,				2504	0.0429																0													7.0	9.0	8.0					19																	7032880		263	853	1116	SO:0001583	missense	0				CCDS45942.1	19p13.2	2014-04-01			ENSG00000237247	ENSG00000237247			37204	protein-coding gene	gene with protein product							Standard	NM_001136507		Approved		uc010xjl.2	A6NJ08	OTTHUMG00000181973	ENST00000329753.5:c.602A>G	19.37:g.7032880A>G	ENSP00000331435:p.Gln201Arg			Missense_Mutation	SNP	NULL	p.Q201R	ENST00000329753.5	37	c.602	CCDS45942.1	19	.	.	.	.	.	.	.	.	.	.	.	6.262	0.416398	0.11870	.	.	ENSG00000237247	ENST00000450263;ENST00000329753	.	.	.	1.65	1.65	0.23941	.	0.500961	0.14905	N	0.291589	T	0.30386	0.0763	L	0.44542	1.39	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17776	-1.0358	9	0.44086	T	0.13	-22.1657	5.4169	0.16378	1.0:0.0:0.0:0.0	.	201	A6NJ08	MB3L5_HUMAN	R	201	.	ENSP00000331435:Q201R	Q	+	2	0	MBD3L5	6983880	0.010000	0.17322	0.011000	0.14972	0.045000	0.14185	0.089000	0.15002	1.036000	0.39998	0.429000	0.28392	CAG	MBD3L5	-	NULL	ENSG00000237247		0.547	MBD3L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L5	HGNC	protein_coding	OTTHUMT00000458497.1		0.00	66	0	A	NM_001136507		7032880	+1			no_errors	ENST00000329753	ensembl	human	known	74_37	missense	27.27	8	3	SNP	0.012	G
MBD3L2	125997	genome.wustl.edu	37	19	7051393	7051393	+	Silent	SNP	A	A	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:7051393A>G	ENST00000381393.3	+	2	440	c.387A>G	c.(385-387)agA>agG	p.R129R		NM_144614.3	NP_653215.2	Q8NHZ7	MB3L2_HUMAN	methyl-CpG binding domain protein 3-like 2	129										endometrium(1)	1	all_hematologic(4;0.166)			Lung(535;0.179)		CTCTGGACAGAGCTGGTGCTG	0.627																																																	0													1.0	1.0	1.0					19																	7051393		659	1622	2281	SO:0001819	synonymous_variant	0			AF503919	CCDS42483.1	19p13.3	2011-01-31			ENSG00000230522	ENSG00000230522			18532	protein-coding gene	gene with protein product		607964					Standard	NM_144614		Approved		uc010dvf.1	Q8NHZ7		ENST00000381393.3:c.387A>G	19.37:g.7051393A>G				Silent	SNP	NULL	p.R129	ENST00000381393.3	37	c.387	CCDS42483.1	19																																																																																			MBD3L2	-	NULL	ENSG00000230522		0.627	MBD3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L2	HGNC	protein_coding	OTTHUMT00000458499.1	-	0.00	18	0	A	NM_144614		7051393	+1	tier1	-	no_errors	ENST00000381393	ensembl	human	known	74_37	silent	83.33	1	5	SNP	0.000	G
MC1R	4157	genome.wustl.edu	37	16	89986519	89986519	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:89986519G>T	ENST00000555147.1	+	1	2233	c.853G>T	c.(853-855)Gcc>Tcc	p.A285S	MC1R_ENST00000555427.1_Missense_Mutation_p.A285S|TUBB3_ENST00000554444.1_5'Flank|TUBB3_ENST00000556922.1_Missense_Mutation_p.A285S|RP11-566K11.4_ENST00000554623.1_RNA|RP11-566K11.7_ENST00000570217.1_RNA	NM_002386.3	NP_002377.4	Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)	285					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		CCTCTTTCTCGCCCTCATCAT	0.597									Melanoma, Familial Clustering of																																								0													112.0	109.0	110.0					16																	89986519		2127	4256	6383	SO:0001583	missense	0	Familial Cancer Database			CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555147.1:c.853G>T	16.37:g.89986519G>T	ENSP00000451605:p.Ala285Ser		Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_MSH_rcpt,prints_Melcrt_ACTH_rcpt,prints_GPCR_Rhodpsn,prints_Melancort_rcpt	p.A285S	ENST00000555147.1	37	c.853	CCDS56011.1	16	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864669	0.51482	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258839	ENST00000555427;ENST00000556922;ENST00000555147	T;T;T	0.72167	-0.63;-0.63;-0.63	5.27	-8.23	0.01033	GPCR, rhodopsin-like superfamily (1);	1.588320	0.04849	U	0.441987	T	0.65291	0.2677	L	0.58810	1.83	0.09310	N	1	B	0.20550	0.046	B	0.33750	0.169	T	0.55373	-0.8151	9	.	.	.	.	9.4686	0.38829	0.6234:0.1586:0.218:0.0	.	285	Q01726	MSHR_HUMAN	S	285	ENSP00000451760:A285S;ENSP00000451560:A285S;ENSP00000451605:A285S	.	A	+	1	0	MC1R;RP11-566K11.2	88514020	0.000000	0.05858	0.001000	0.08648	0.823000	0.46562	-0.190000	0.09615	-1.930000	0.01056	-0.252000	0.11476	GCC	MC1R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Melancort_rcpt	ENSG00000258839		0.597	MC1R-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	MC1R	HGNC	protein_coding	OTTHUMT00000412014.1		0.00	55	0	G	NM_002386		89986519	+1			no_errors	ENST00000555147	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.003	T
MITD1	129531	genome.wustl.edu	37	2	99790475	99790475	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:99790475G>T	ENST00000289359.2	-	2	232	c.156C>A	c.(154-156)acC>acA	p.T52T	MITD1_ENST00000466880.1_5'UTR|MRPL30_ENST00000410042.1_Intron	NM_138798.1	NP_620153.1	Q8WV92	MITD1_HUMAN	MIT, microtubule interacting and transport, domain containing 1	52	MIT.				cytokinetic cell separation (GO:0000920)|mitotic cytokinesis (GO:0000281)|mitotic cytokinetic cell separation (GO:1902409)|negative regulation of protein binding (GO:0032091)|transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)	phosphatidylinositol binding (GO:0035091)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)			large_intestine(3)|lung(2)|ovary(1)	6						TATTATCTTTGGTACCTACaa	0.274																																																	0													71.0	65.0	67.0					2																	99790475		2202	4299	6501	SO:0001819	synonymous_variant	0			BC018453	CCDS2040.1	2q11.2	2006-07-14			ENSG00000158411	ENSG00000158411			25207	protein-coding gene	gene with protein product						16730941	Standard	NM_138798		Approved	LOC129531	uc002szs.1	Q8WV92	OTTHUMG00000130638	ENST00000289359.2:c.156C>A	2.37:g.99790475G>T			Q69YV0	Silent	SNP	pfam_MIT,smart_MIT	p.T52	ENST00000289359.2	37	c.156	CCDS2040.1	2																																																																																			MITD1	-	pfam_MIT,smart_MIT	ENSG00000158411		0.274	MITD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MITD1	HGNC	protein_coding	OTTHUMT00000253126.1	-	0.00	36	0	G	NM_138798		99790475	-1	tier1	-	no_errors	ENST00000289359	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.994	T
NIFK	84365	genome.wustl.edu	37	2	122493190	122493190	+	Splice_Site	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:122493190C>T	ENST00000285814.4	-	2	314	c.242G>A	c.(241-243)aGg>aAg	p.R81K		NM_032390.4	NP_115766.3	Q9BYG3	MK67I_HUMAN		81	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of phosphatase activity (GO:0010923)|protein complex assembly (GO:0006461)|rRNA metabolic process (GO:0016072)|rRNA transcription (GO:0009303)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12						AAATCTTACCCTTTTACTTCT	0.388																																																	0													108.0	109.0	108.0					2																	122493190		2203	4300	6503	SO:0001630	splice_region_variant	0																														ENST00000285814.4:c.243+1G>A	2.37:g.122493190C>T			A8K788|Q8TB66|Q96ED4	Missense_Mutation	SNP	pfam_hNIFK_FHA_Ki67_binding,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R81K	ENST00000285814.4	37	c.242	CCDS2135.1	2	.	.	.	.	.	.	.	.	.	.	C	6.771	0.511122	0.12883	.	.	ENSG00000155438	ENST00000285814;ENST00000409201;ENST00000451734	T;T	0.15487	2.42;2.42	4.39	-0.914	0.10497	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.172475	0.64402	N	0.000011	T	0.04048	0.0113	N	0.01668	-0.77	0.41152	D	0.986031	B;B	0.19073	0.002;0.033	B;B	0.22753	0.023;0.041	T	0.45977	-0.9224	10	0.02654	T	1	-8.7839	7.6371	0.28272	0.0:0.3842:0.0:0.6158	.	81;81	B4DSM4;Q9BYG3	.;MK67I_HUMAN	K	81;81;49	ENSP00000285814:R81K;ENSP00000398116:R49K	ENSP00000285814:R81K	R	-	2	0	MKI67IP	122209660	1.000000	0.71417	0.819000	0.32651	0.971000	0.66376	1.496000	0.35638	-0.334000	0.08463	0.561000	0.74099	AGG	MKI67IP	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000155438		0.388	MKI67IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKI67IP	HGNC	protein_coding	OTTHUMT00000254239.2	-	0.00	104	0	C		Missense_Mutation	122493190	-1	tier1	-	no_errors	ENST00000285814	ensembl	human	known	74_37	missense	33.33	63	32	SNP	1.000	T
MMD2	221938	genome.wustl.edu	37	7	4965104	4965104	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:4965104G>C	ENST00000404774.3	-	2	301	c.107C>G	c.(106-108)gCg>gGg	p.A36G	MMD2_ENST00000401401.3_Missense_Mutation_p.A36G|MMD2_ENST00000406755.1_Missense_Mutation_p.A36G	NM_001100600.1	NP_001094070.1	Q8IY49	PAQRA_HUMAN	monocyte to macrophage differentiation-associated 2	36						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(11)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		ACAGTTGGCCGCATGTTCATA	0.602																																																	0													151.0	150.0	150.0					7																	4965104		1948	4132	6080	SO:0001583	missense	0			BC037881	CCDS47529.1, CCDS47530.1, CCDS59047.1	7p22	2004-06-23			ENSG00000136297	ENSG00000136297			30133	protein-coding gene	gene with protein product		614581				12477932	Standard	NM_198403		Approved	PAQR10	uc003sno.4	Q8IY49	OTTHUMG00000151844	ENST00000404774.3:c.107C>G	7.37:g.4965104G>C	ENSP00000384690:p.Ala36Gly		B5MBW4|Q6NVU5|Q6TCH0	Missense_Mutation	SNP	pfam_HlyIII-related	p.A36G	ENST00000404774.3	37	c.107	CCDS47529.1	7	.	.	.	.	.	.	.	.	.	.	g	22.8	4.334046	0.81801	.	.	ENSG00000136297	ENST00000404774;ENST00000406755;ENST00000401401	T;T;T	0.31247	1.5;1.5;1.5	3.82	3.82	0.43975	.	0.000000	0.64402	D	0.000001	T	0.56819	0.2011	M	0.80982	2.52	0.58432	D	0.999994	D;D;P	0.76494	0.999;0.998;0.922	D;D;P	0.76575	0.988;0.971;0.805	T	0.65154	-0.6237	10	0.72032	D	0.01	-7.5795	14.8881	0.70584	0.0:0.0:1.0:0.0	.	36;36;36	B5MBW4;Q8IY49;Q8IY49-2	.;PAQRA_HUMAN;.	G	36	ENSP00000384690:A36G;ENSP00000385963:A36G;ENSP00000384141:A36G	ENSP00000384141:A36G	A	-	2	0	MMD2	4931630	1.000000	0.71417	0.933000	0.37362	0.983000	0.72400	8.793000	0.91862	1.965000	0.57142	0.561000	0.74099	GCG	MMD2	-	pfam_HlyIII-related	ENSG00000136297		0.602	MMD2-001	KNOWN	basic|CCDS	protein_coding	MMD2	HGNC	protein_coding	OTTHUMT00000324136.1		0.00	41	0	G	NM_198403		4965104	-1			no_errors	ENST00000404774	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	C
MMP16	4325	genome.wustl.edu	37	8	89068395	89068395	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:89068395C>A	ENST00000286614.6	-	8	1615	c.1334G>T	c.(1333-1335)tGg>tTg	p.W445L		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	445					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.W445*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GACGTCCTCCCACCAAATGGC	0.418																																																	1	Substitution - Nonsense(1)	cervix(1)											118.0	111.0	113.0					8																	89068395		2203	4300	6503	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1334G>T	8.37:g.89068395C>A	ENSP00000286614:p.Trp445Leu		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.W445L	ENST00000286614.6	37	c.1334	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.396043	0.96009	.	.	ENSG00000156103	ENST00000286614	T	0.08282	3.11	5.91	5.91	0.95273	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.38612	0.1047	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.21109	-1.0255	10	0.52906	T	0.07	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	445	P51512	MMP16_HUMAN	L	445	ENSP00000286614:W445L	ENSP00000286614:W445L	W	-	2	0	MMP16	89137511	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.794000	0.85869	2.793000	0.96121	0.655000	0.94253	TGG	MMP16	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat	ENSG00000156103		0.418	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2		0.00	62	0	C	NM_005941		89068395	-1			no_errors	ENST00000286614	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	A
MMP17	4326	genome.wustl.edu	37	12	132325284	132325284	+	Missense_Mutation	SNP	G	G	A	rs370404573		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:132325284G>A	ENST00000360564.1	+	4	691	c.589G>A	c.(589-591)Ggc>Agc	p.G197S	MMP17_ENST00000535291.1_Missense_Mutation_p.G113S|MMP17_ENST00000535182.1_3'UTR	NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	197					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	CCATAACGACGGCTACCCCTT	0.677																																																	0								G	SER/GLY	0,4406		0,0,2203	69.0	60.0	63.0		589	0.1	0.6	12		63	1,8599	1.2+/-3.3	0,1,4299	no	missense	MMP17	NM_016155.4	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	197/604	132325284	1,13005	2203	4300	6503	SO:0001583	missense	0			X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.589G>A	12.37:g.132325284G>A	ENSP00000353767:p.Gly197Ser		Q14850	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.G197S	ENST00000360564.1	37	c.589	CCDS31927.1	12	.	.	.	.	.	.	.	.	.	.	G	5.536	0.283894	0.10458	0.0	1.16E-4	ENSG00000198598	ENST00000360564;ENST00000545671;ENST00000545790;ENST00000535291;ENST00000534865	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01	4.39	0.117	0.14652	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.770342	0.11692	N	0.538773	T	0.22589	0.0545	L	0.41824	1.3	0.80722	D	1	D	0.54397	0.966	P	0.50231	0.635	T	0.19451	-1.0305	10	0.02654	T	1	.	16.7367	0.85448	0.0:0.3978:0.6022:0.0	.	197	Q9ULZ9	MMP17_HUMAN	S	197;93;113;113;38	ENSP00000353767:G197S;ENSP00000444603:G93S;ENSP00000441710:G113S;ENSP00000441106:G113S;ENSP00000442104:G38S	ENSP00000353767:G197S	G	+	1	0	MMP17	130891237	0.994000	0.37717	0.562000	0.28370	0.015000	0.08874	2.404000	0.44539	-0.159000	0.11021	0.313000	0.20887	GGC	MMP17	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	ENSG00000198598		0.677	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP17	HGNC	protein_coding	OTTHUMT00000397757.1	-	0.00	117	0	G	NM_016155		132325284	+1	tier1	-	no_errors	ENST00000360564	ensembl	human	known	74_37	missense	65.45	57	108	SNP	1.000	A
MMP25	64386	genome.wustl.edu	37	16	3097523	3097523	+	Silent	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:3097523G>A	ENST00000336577.4	+	2	444	c.207G>A	c.(205-207)gcG>gcA	p.A69A		NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25	70					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	AGAGGTTCGCGGGGCTGCCGG	0.667																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)												0													52.0	60.0	57.0					16																	3097523		2198	4300	6498	SO:0001819	synonymous_variant	0			AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.207G>A	16.37:g.3097523G>A			Q96F04|Q96TE2	Silent	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.A69	ENST00000336577.4	37	c.207	CCDS10492.1	16																																																																																			MMP25	-	pirsf_Pept_M10A_Metazoans,pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like	ENSG00000008516		0.667	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP25	HGNC	protein_coding	OTTHUMT00000437116.1	-	0.00	129	0	G	NM_022468		3097523	+1	tier1	-	no_errors	ENST00000336577	ensembl	human	known	74_37	silent	62.67	28	47	SNP	0.007	A
MST1L	11223	genome.wustl.edu	37	1	17084043	17084043	+	RNA	SNP	C	C	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:17084043C>G	ENST00000455405.2	-	0	669							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CCAACAGTCCCTCAGTGCACA	0.557																																																	0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084043C>G			B7WPB1|Q13209	RNA	SNP	-	NULL	ENST00000455405.2	37	NULL		1	.	.	.	.	.	.	.	.	.	.	.	0.024	-1.388123	0.01185	.	.	ENSG00000186715	ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.825650	0.03114	N	0.162826	T	0.22044	0.0531	.	.	.	.	.	.	B;B	0.15141	0.012;0.0	B;B	0.11329	0.006;0.001	T	0.12116	-1.0560	6	0.33141	T	0.24	.	3.7818	0.08683	0.0:0.3342:0.0:0.6658	.	626;652	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	D	626;652	.	ENSP00000439273:E626D	E	-	3	2	MST1P9	16956630	0.000000	0.05858	0.558000	0.28319	0.000000	0.00434	-0.649000	0.05384	-0.406000	0.07588	0.000000	0.15137	GAG	MST1L	-	-	ENSG00000186715		0.557	MST1L-002	KNOWN	basic	processed_transcript	MST1L	HGNC	pseudogene	OTTHUMT00000400328.1	-	0.00	179	0	C	NM_001271733		17084043	-1	tier1	-	no_errors	ENST00000455405	ensembl	human	known	74_37	rna	5.46	225	13	SNP	0.114	G
MTNR1A	4543	genome.wustl.edu	37	4	187455160	187455160	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:187455160G>C	ENST00000307161.5	-	2	937	c.736C>G	c.(736-738)Ctt>Gtt	p.L246V	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	246					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	ATGGCAAAAAGGACAAAAACC	0.537																																																	0													115.0	123.0	120.0					4																	187455160		2203	4300	6503	SO:0001583	missense	0				CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.736C>G	4.37:g.187455160G>C	ENSP00000302811:p.Leu246Val		A0AVC5|B0M0L2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melatonin_rcpt,prints_GPCR_Rhodpsn,prints_Mel_1A_rcpt,prints_NPY_rcpt,prints_Mel_rcpt_1C	p.L246V	ENST00000307161.5	37	c.736	CCDS3848.1	4	.	.	.	.	.	.	.	.	.	.	G	10.22	1.288936	0.23478	.	.	ENSG00000168412	ENST00000307161	T	0.68903	-0.36	4.96	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	0.062425	0.64402	D	0.000003	T	0.62036	0.2395	L	0.41124	1.26	0.80722	D	1	B	0.20671	0.047	B	0.31390	0.129	T	0.61252	-0.7100	10	0.62326	D	0.03	-12.0301	14.471	0.67517	0.0:0.0:0.8515:0.1485	.	246	P48039	MTR1A_HUMAN	V	246	ENSP00000302811:L246V	ENSP00000302811:L246V	L	-	1	0	MTNR1A	187692154	1.000000	0.71417	0.473000	0.27253	0.063000	0.16089	6.577000	0.74027	1.044000	0.40200	0.655000	0.94253	CTT	MTNR1A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000168412		0.537	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTNR1A	HGNC	protein_coding	OTTHUMT00000360189.1	-	0.00	31	0	G			187455160	-1	tier1	-	no_errors	ENST00000307161	ensembl	human	known	74_37	missense	55.56	4	5	SNP	0.995	C
MUC12	10071	genome.wustl.edu	37	7	100612955	100612956	+	In_Frame_Ins	INS	-	-	CTG	rs150485202|rs374842509		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:100612955_100612956insCTG	ENST00000379442.3	+	1	52_53	c.52_53insCTG	c.(52-54)act>aCTGct	p.18_19insA	MUC12_ENST00000536621.1_In_Frame_Ins_p.18_19insA|RP11-395B7.2_ENST00000420080.1_RNA			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	18					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CGCGTCCGTTACTACAGTGACA	0.634																																																	0										747,2323		50,647,838						-0.8	0.0		dbSNP_130	49	1170,4352		68,1034,1659	no	coding	MUC12	NM_001164462.1		118,1681,2497	A1A1,A1R,RR		21.188,24.3322,22.3115				1917,6675				SO:0001652	inframe_insertion	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	Exception_encountered	7.37:g.100612955_100612956insCTG	ENSP00000368755:p.Thr18_Thr19insAla		A6ND38|F5GWV9|Q9UKN0	In_Frame_Ins	INS	pfam_SEA_dom	p.19in_frame_insA	ENST00000379442.3	37	c.52_53		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.634	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1		0.00	34	0	-	XM_379904		100612956	+1	tier1		no_errors	ENST00000536621	ensembl	human	known	74_37	in_frame_ins	12.20	36	5	INS	0.000:0.000	CTG
MYO18A	399687	genome.wustl.edu	37	17	27423864	27423864	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:27423864G>T	ENST00000527372.1	-	28	4480	c.4300C>A	c.(4300-4302)Cga>Aga	p.R1434R	MYO18A_ENST00000354329.4_Silent_p.R1434R|MYO18A_ENST00000533112.1_Silent_p.R1434R|MYO18A_ENST00000531253.1_Silent_p.R1434R	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1434					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GCCGTCAGTCGCTGGCACTTC	0.617																																					Esophageal Squamous(182;472 2015 7001 15270 22562)												0													27.0	30.0	29.0					17																	27423864		2132	4272	6404	SO:0001819	synonymous_variant	0			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.4300C>A	17.37:g.27423864G>T			Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_P-loop_NTPase,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.R1434	ENST00000527372.1	37	c.4300	CCDS45642.1	17																																																																																			MYO18A	-	pfam_Myosin_tail	ENSG00000196535		0.617	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000389396.1		0.00	37	0	G	NM_078471		27423864	-1			no_errors	ENST00000354329	ensembl	human	known	74_37	silent	7.14	26	2	SNP	1.000	T
MYO9B	4650	genome.wustl.edu	37	19	17278782	17278782	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:17278782G>T	ENST00000594824.1	+	11	1848	c.1701G>T	c.(1699-1701)tgG>tgT	p.W567C	MYO9B_ENST00000397274.2_Missense_Mutation_p.W567C|MYO9B_ENST00000595618.1_Missense_Mutation_p.W567C|CTD-3032J10.2_ENST00000599360.1_RNA|CTD-3032J10.2_ENST00000597216.1_RNA			Q13459	MYO9B_HUMAN	myosin IXB	567	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GGATCACGTGGCACAACATCG	0.517																																																	0													38.0	46.0	43.0					19																	17278782		2080	4203	6283	SO:0001583	missense	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.1701G>T	19.37:g.17278782G>T	ENSP00000471367:p.Trp567Cys		O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.W567C	ENST00000594824.1	37	c.1701		19	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254819	0.80135	.	.	ENSG00000099331	ENST00000397274	D	0.89810	-2.57	4.85	4.85	0.62838	Myosin head, motor domain (2);	0.000000	0.52532	D	0.000061	D	0.96084	0.8724	H	0.94264	3.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97411	1.0002	10	0.87932	D	0	.	16.9722	0.86303	0.0:0.0:1.0:0.0	.	567;567;573	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	C	567	ENSP00000380444:W567C	ENSP00000380444:W567C	W	+	3	0	MYO9B	17139782	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.685000	0.98661	2.243000	0.73865	0.561000	0.74099	TGG	MYO9B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000099331		0.517	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1		0.00	65	0	G			17278782	+1			no_errors	ENST00000594824	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
NBPF9	400818	genome.wustl.edu	37	1	144822162	144822162	+	Intron	SNP	C	C	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:144822162C>G	ENST00000468645.1	+	7	1023				NBPF9_ENST00000281815.8_Intron|NBPF9_ENST00000440491.2_Intron|NBPF9_ENST00000338347.4_Intron			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						GCCTTGTGCCCCTTGTTGGGC	0.498																																																	0																																										SO:0001627	intron_variant	0				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.1023+78C>G	1.37:g.144822162C>G				RNA	SNP	-	NULL	ENST00000468645.1	37	NULL		1																																																																																			NBPF9	-	-	ENSG00000168614		0.498	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NBPF9	HGNC	protein_coding	OTTHUMT00000038846.1	-	0.00	13	0	C	NM_001037675		144822162	+1	tier1	-	no_errors	ENST00000488888	ensembl	human	known	74_37	rna	50.00	2	2	SNP	0.000	G
NCKAP5	344148	genome.wustl.edu	37	2	133618112	133618112	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:133618112T>A	ENST00000409261.1	-	11	1133	c.760A>T	c.(760-762)Atc>Ttc	p.I254F	NCKAP5_ENST00000405974.3_Missense_Mutation_p.I254F|NCKAP5_ENST00000409213.1_Missense_Mutation_p.I254F|NCKAP5_ENST00000317721.6_Missense_Mutation_p.I254F	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	254										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGGAATAGGATGCTTAGTGTT	0.408																																																	0													174.0	167.0	169.0					2																	133618112		1951	4139	6090	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.760A>T	2.37:g.133618112T>A	ENSP00000387128:p.Ile254Phe		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.I254F	ENST00000409261.1	37	c.760	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	T	17.19	3.327005	0.60743	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.44482	2.91;0.92;2.91;0.92	5.76	1.95	0.26073	.	1.138740	0.07401	U	0.890782	T	0.31918	0.0812	N	0.14661	0.345	0.27145	N	0.961558	B;P	0.49559	0.023;0.925	B;P	0.52217	0.01;0.693	T	0.17501	-1.0367	10	0.45353	T	0.12	.	0.2486	0.00202	0.236:0.1533:0.2436:0.3671	.	254;254	O14513-2;O14513	.;NCKP5_HUMAN	F	254	ENSP00000387128:I254F;ENSP00000386952:I254F;ENSP00000380603:I254F;ENSP00000385692:I254F	ENSP00000380603:I254F	I	-	1	0	NCKAP5	133334582	1.000000	0.71417	0.976000	0.42696	0.986000	0.74619	1.251000	0.32862	0.401000	0.25424	0.450000	0.29827	ATC	NCKAP5	-	NULL	ENSG00000176771		0.408	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	-	0.00	38	0	T	NM_207481		133618112	-1	tier1	-	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	43.48	13	10	SNP	0.998	A
NCOR2	9612	genome.wustl.edu	37	12	124820115	124820115	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:124820115C>A	ENST00000405201.1	-	39	6179	c.6179G>T	c.(6178-6180)aGt>aTt	p.S2060I	NCOR2_ENST00000356219.3_Missense_Mutation_p.S2067I|NCOR2_ENST00000397355.1_Missense_Mutation_p.S2051I|NCOR2_ENST00000404121.2_Missense_Mutation_p.S1621I|NCOR2_ENST00000404621.1_Missense_Mutation_p.S2050I|NCOR2_ENST00000429285.2_Missense_Mutation_p.S2050I			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2071					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GTGGGTCAGACTGGGTGAGCT	0.687																																																	0													29.0	38.0	35.0					12																	124820115		1924	4123	6047	SO:0001583	missense	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6179G>T	12.37:g.124820115C>A	ENSP00000384018:p.Ser2060Ile		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S2067I	ENST00000405201.1	37	c.6200	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	C	12.26	1.884761	0.33255	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000447675;ENST00000429285	T;T;T;T;T;T	0.18657	2.2;2.46;2.2;2.46;2.2;2.46	3.56	3.56	0.40772	.	0.416253	0.27778	N	0.017895	T	0.32194	0.0821	L	0.38531	1.155	0.35517	D	0.801155	D;D;D	0.71674	0.996;0.998;0.997	P;P;P	0.59703	0.731;0.862;0.791	T	0.47222	-0.9134	10	0.56958	D	0.05	-17.5848	16.0192	0.80468	0.0:1.0:0.0:0.0	.	2051;2060;2071	C9J239;C9JFD3;Q9Y618	.;.;NCOR2_HUMAN	I	2060;2050;2067;2051;2059;1621;152;2050	ENSP00000384018:S2060I;ENSP00000384202:S2050I;ENSP00000348551:S2067I;ENSP00000380513:S2051I;ENSP00000385618:S1621I;ENSP00000400281:S2050I	ENSP00000348551:S2067I	S	-	2	0	NCOR2	123386068	1.000000	0.71417	0.997000	0.53966	0.130000	0.20726	3.597000	0.54031	1.927000	0.55829	0.505000	0.49811	AGT	NCOR2	-	NULL	ENSG00000196498		0.687	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	-	0.00	102	0	C	NM_006312		124820115	-1	tier1	-	no_errors	ENST00000356219	ensembl	human	known	74_37	missense	59.57	57	84	SNP	1.000	A
NDUFS3	4722	genome.wustl.edu	37	11	47600657	47600657	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:47600657C>T	ENST00000263774.4	+	1	96	c.14C>T	c.(13-15)gCg>gTg	p.A5V	KBTBD4_ENST00000395288.2_5'Flank|NDUFS3_ENST00000534208.1_Missense_Mutation_p.A5V|NDUFS3_ENST00000529276.1_Missense_Mutation_p.A5V|KBTBD4_ENST00000525720.1_5'Flank|NDUFS3_ENST00000528192.1_Missense_Mutation_p.A5V|KBTBD4_ENST00000533290.1_5'Flank|NDUFS3_ENST00000533507.1_Intron|NDUFS3_ENST00000534716.2_Missense_Mutation_p.A5V|KBTBD4_ENST00000430070.2_5'Flank|KBTBD4_ENST00000526005.1_5'Flank|RNU5E-10P_ENST00000363506.1_RNA	NM_004551.2	NP_004542.1	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)	5				MAAAAVA -> MAAGRY (in Ref. 3). {ECO:0000305}.	cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)	9					Doxorubicin(DB00997)	GCGGCGGCGGCGGTAGCCAGG	0.692																																					Pancreas(15;551 601 22438 23457 52512)												0													14.0	15.0	15.0					11																	47600657		2147	4214	6361	SO:0001583	missense	0			AF067139	CCDS7941.1	11p11.11	2011-08-03	2002-08-29		ENSG00000213619	ENSG00000213619	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7710	protein-coding gene	gene with protein product	"""complex I 30kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial"""	603846	"""NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004551		Approved	CI-30	uc001nga.2	O75489	OTTHUMG00000166893	ENST00000263774.4:c.14C>T	11.37:g.47600657C>T	ENSP00000263774:p.Ala5Val		B2R9J1|B4DFM8|Q9UNQ8	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_30kDa_su,tigrfam_NADH_DH_suC	p.A5V	ENST00000263774.4	37	c.14	CCDS7941.1	11	.	.	.	.	.	.	.	.	.	.	C	15.16	2.751818	0.49362	.	.	ENSG00000213619	ENST00000263774;ENST00000529276;ENST00000528192;ENST00000530295;ENST00000534208;ENST00000534716	T;T	0.77489	-1.1;1.42	5.47	4.56	0.56223	.	0.470662	0.23918	N	0.043262	T	0.69949	0.3168	L	0.58101	1.795	0.09310	N	0.999992	B;B	0.20550	0.012;0.046	B;B	0.10450	0.003;0.005	T	0.53704	-0.8401	10	0.09338	T	0.73	-33.586	11.8687	0.52509	0.0:0.9179:0.0:0.0821	.	5;5	B4DFM8;O75489	.;NDUS3_HUMAN	V	5	ENSP00000263774:A5V;ENSP00000432099:A5V	ENSP00000263774:A5V	A	+	2	0	NDUFS3	47557233	0.003000	0.15002	0.016000	0.15963	0.001000	0.01503	0.010000	0.13242	1.455000	0.47813	-0.119000	0.15052	GCG	NDUFS3	-	NULL	ENSG00000213619		0.692	NDUFS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFS3	HGNC	protein_coding	OTTHUMT00000391749.1	-	0.00	39	0	C	NM_004551		47600657	+1	tier1	-	no_errors	ENST00000263774	ensembl	human	known	74_37	missense	9.43	48	5	SNP	0.150	T
NES	10763	genome.wustl.edu	37	1	156642916	156642916	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:156642916G>T	ENST00000368223.3	-	4	1196	c.1064C>A	c.(1063-1065)tCc>tAc	p.S355Y		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	355	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGAGGGGAGGGAAGTTGGGCT	0.602																																																	0													37.0	47.0	43.0					1																	156642916		2202	4299	6501	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1064C>A	1.37:g.156642916G>T	ENSP00000357206:p.Ser355Tyr		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_IF	p.S355Y	ENST00000368223.3	37	c.1064	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271370	0.59649	.	.	ENSG00000132688	ENST00000368223;ENST00000255024	D	0.86694	-2.16	4.87	3.95	0.45737	.	0.542047	0.13979	N	0.349638	D	0.83266	0.5217	L	0.53249	1.67	0.25430	N	0.988194	D	0.61697	0.99	P	0.54664	0.758	T	0.75701	-0.3226	10	0.87932	D	0	.	8.8793	0.35365	0.1049:0.0:0.8951:0.0	.	355	P48681	NEST_HUMAN	Y	355	ENSP00000357206:S355Y	ENSP00000255024:S355Y	S	-	2	0	NES	154909540	0.885000	0.30320	0.567000	0.28434	0.982000	0.71751	2.573000	0.46007	1.046000	0.40249	0.313000	0.20887	TCC	NES	-	NULL	ENSG00000132688		0.602	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	-	0.00	43	0	G	NM_006617		156642916	-1	tier1	-	no_errors	ENST00000368223	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.504	T
NFAT5	10725	genome.wustl.edu	37	16	69703968	69703968	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:69703968G>T	ENST00000354436.2	+	7	1722	c.1404G>T	c.(1402-1404)aaG>aaT	p.K468N	NFAT5_ENST00000566899.1_Missense_Mutation_p.K392N|NFAT5_ENST00000393742.2_Missense_Mutation_p.K392N|NFAT5_ENST00000432919.1_Missense_Mutation_p.K486N|NFAT5_ENST00000567239.1_Missense_Mutation_p.K486N|NFAT5_ENST00000349945.1_Missense_Mutation_p.K392N	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	468					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TAATCGGCAAGAACTTTCTGA	0.363																																																	0													60.0	61.0	61.0					16																	69703968		2198	4300	6498	SO:0001583	missense	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1404G>T	16.37:g.69703968G>T	ENSP00000346420:p.Lys468Asn		A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.K486N	ENST00000354436.2	37	c.1458	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484698	0.63962	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.18	0.331	0.15933	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.50137	0.1598	M	0.76170	2.325	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;1.0	D;D;D;D	0.85130	0.993;0.972;0.989;0.997	T	0.50866	-0.8777	10	0.72032	D	0.01	-3.6313	10.1722	0.42917	0.3842:0.0:0.6158:0.0	.	486;468;486;392	A2RRB4;O94916;E9PHR7;O94916-2	.;NFAT5_HUMAN;.;.	N	486;486;392;468;392	ENSP00000396538:K486N;ENSP00000338806:K392N;ENSP00000346420:K468N;ENSP00000377343:K392N	ENSP00000338806:K392N	K	+	3	2	NFAT5	68261469	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.731000	0.47343	0.186000	0.20125	-0.237000	0.12165	AAG	NFAT5	-	superfamily_Ig_E-set,smart_IPT,prints_NFAT	ENSG00000102908		0.363	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2		0.00	53	0	G	NM_138714		69703968	+1			no_errors	ENST00000432919	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.999	T
NLRP12	91662	genome.wustl.edu	37	19	54313956	54313956	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:54313956G>T	ENST00000324134.6	-	3	1125	c.957C>A	c.(955-957)ccC>ccA	p.P319P	NLRP12_ENST00000351894.4_Silent_p.P319P|NLRP12_ENST00000354278.3_Silent_p.P319P|NLRP12_ENST00000345770.5_Silent_p.P319P|NLRP12_ENST00000391772.1_Silent_p.P319P|NLRP12_ENST00000391773.1_Silent_p.P319P|NLRP12_ENST00000535162.1_Silent_p.P319P|NLRP12_ENST00000391775.3_Silent_p.P319P	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	319	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCAGCTCCGTGGGCCGTTTCT	0.572																																																	0													45.0	48.0	47.0					19																	54313956		2203	4300	6503	SO:0001819	synonymous_variant	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.957C>A	19.37:g.54313956G>T			A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.P319	ENST00000324134.6	37	c.957	CCDS12864.1	19																																																																																			NLRP12	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000142405		0.572	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	-	0.00	42	0	G	NM_144687		54313956	-1	tier1	-	no_errors	ENST00000324134	ensembl	human	known	74_37	silent	8.16	44	4	SNP	0.235	T
NLRX1	79671	genome.wustl.edu	37	11	119045798	119045798	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:119045798G>T	ENST00000409109.1	+	6	2073	c.1486G>T	c.(1486-1488)Gcc>Tcc	p.A496S	NLRX1_ENST00000409991.1_Missense_Mutation_p.A496S|NLRX1_ENST00000409265.4_Missense_Mutation_p.A496S|NLRX1_ENST00000525863.1_Missense_Mutation_p.A496S|NLRX1_ENST00000292199.2_Missense_Mutation_p.A496S	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	496	Required for interaction with MAVS.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CACCGTGCCCGCCATGCAGGA	0.607																																																	0													94.0	82.0	86.0					11																	119045798		2200	4295	6495	SO:0001583	missense	0			AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.1486G>T	11.37:g.119045798G>T	ENSP00000387334:p.Ala496Ser		A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.A496S	ENST00000409109.1	37	c.1486	CCDS8416.1	11	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308761	0.40895	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T	0.67865	-0.19;-0.19;-0.29;-0.19;-0.29	5.76	4.82	0.62117	.	0.068570	0.64402	D	0.000012	T	0.59569	0.2203	L	0.34521	1.04	0.29525	N	0.8532	P;P	0.51537	0.946;0.928	P;B	0.51324	0.666;0.323	T	0.53816	-0.8385	10	0.09084	T	0.74	.	10.2031	0.43097	0.0705:0.0:0.792:0.1375	.	496;496	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	S	496	ENSP00000386851:A496S;ENSP00000292199:A496S;ENSP00000386858:A496S;ENSP00000387334:A496S;ENSP00000433442:A496S	ENSP00000292199:A496S	A	+	1	0	NLRX1	118551008	1.000000	0.71417	0.876000	0.34364	0.935000	0.57460	5.268000	0.65536	1.367000	0.46095	0.655000	0.94253	GCC	NLRX1	-	NULL	ENSG00000160703		0.607	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NLRX1	HGNC	protein_coding	OTTHUMT00000335403.1	-	0.00	77	0	G	NM_170722		119045798	+1	tier1	-	no_errors	ENST00000292199	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.980	T
NOX3	50508	genome.wustl.edu	37	6	155743884	155743884	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:155743884G>T	ENST00000159060.2	-	10	1354	c.1252C>A	c.(1252-1254)Ctg>Atg	p.L418M		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	418					detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		ATAGATTTCAGAAGAGCAGCG	0.502																																																	0													153.0	144.0	147.0					6																	155743884		2203	4300	6503	SO:0001583	missense	0			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.1252C>A	6.37:g.155743884G>T	ENSP00000159060:p.Leu418Met		Q9HBJ9	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.L418M	ENST00000159060.2	37	c.1252	CCDS5250.1	6	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916373	0.52546	.	.	ENSG00000074771	ENST00000159060	D	0.96073	-3.9	5.81	4.76	0.60689	Ferric reductase, NAD binding (1);	0.000000	0.51477	D	0.000100	D	0.97885	0.9305	H	0.95504	3.68	0.40794	D	0.983288	D	0.57899	0.981	P	0.60236	0.871	D	0.98442	1.0587	10	0.87932	D	0	-12.1055	13.4936	0.61411	0.1168:0.0:0.8832:0.0	.	418	Q9HBY0	NOX3_HUMAN	M	418	ENSP00000159060:L418M	ENSP00000159060:L418M	L	-	1	2	NOX3	155785576	1.000000	0.71417	0.984000	0.44739	0.444000	0.32077	3.019000	0.49635	2.747000	0.94245	0.643000	0.83706	CTG	NOX3	-	pfam_Fe_red_NAD-bd_6,prints_Cyt_b245_heavy_chain	ENSG00000074771		0.502	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1	-	0.00	48	0	G			155743884	-1	tier1	-	no_errors	ENST00000159060	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	T
NPDC1	56654	genome.wustl.edu	37	9	139934198	139934198	+	3'UTR	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:139934198C>A	ENST00000371601.4	-	0	1217				RP11-229P13.20_ENST00000457302.2_lincRNA|NPDC1_ENST00000488145.1_5'Flank|NPDC1_ENST00000371600.3_3'UTR	NM_015392.3	NP_056207.3	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and control, 1							integral component of membrane (GO:0016021)				NS(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	5	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		GGTCGGGGAGCAGGTGGGCGT	0.677																																																	0													16.0	19.0	18.0					9																	139934198		2178	4278	6456	SO:0001624	3_prime_UTR_variant	0			AF285836	CCDS7024.1	9q34.3	2008-07-21			ENSG00000107281	ENSG00000107281			7899	protein-coding gene	gene with protein product		605798				11245976	Standard	NM_015392		Approved	DKFZp586J0523, CAB-, CAB1	uc004ckt.2	Q9NQX5	OTTHUMG00000020956	ENST00000371601.4:c.*26G>T	9.37:g.139934198C>A			Q5SPY8|Q9BTD6|Q9BXT3|Q9NQS2|Q9Y434	RNA	SNP	-	NULL	ENST00000371601.4	37	NULL	CCDS7024.1	9																																																																																			NPDC1	-	-	ENSG00000107281		0.677	NPDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPDC1	HGNC	protein_coding	OTTHUMT00000055182.1	-	0.00	69	0	C	NM_015392		139934198	-1	tier1	-	no_errors	ENST00000472668	ensembl	human	known	74_37	rna	9.76	36	4	SNP	0.000	A
NPIPB6	728741	genome.wustl.edu	37	16	28354350	28354350	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:28354350C>T	ENST00000532254.1	-	7	1541	c.856G>A	c.(856-858)Gag>Aag	p.E286K	NPIPB6_ENST00000533640.1_Missense_Mutation_p.E268K	NM_001282524.1	NP_001269453.1	E9PJ23	NPIB6_HUMAN	nuclear pore complex interacting protein family, member B6	286	Pro-rich.							p.E286K(2)									AGCAGACACTCAGTAGGTGTC	0.502																																																	2	Substitution - Missense(2)	endometrium(2)																																								SO:0001583	missense	0				CCDS61892.1	16p11.2	2013-06-11			ENSG00000198156	ENSG00000198156			37454	protein-coding gene	gene with protein product							Standard	XM_005255741		Approved			E9PJ23	OTTHUMG00000166319	ENST00000532254.1:c.856G>A	16.37:g.28354350C>T	ENSP00000431871:p.Glu286Lys			Missense_Mutation	SNP	NULL	p.E286K	ENST00000532254.1	37	c.856		16	.	.	.	.	.	.	.	.	.	.	-	10.97	1.500495	0.26861	.	.	ENSG00000198156	ENST00000533640;ENST00000532254	T;T	0.51817	0.69;0.69	.	.	.	.	.	.	.	.	T	0.58495	0.2126	L	0.59436	1.845	0.09310	N	1	D;P	0.69078	0.997;0.915	D;P	0.80764	0.994;0.871	T	0.46062	-0.9218	7	0.51188	T	0.08	.	.	.	.	.	286;268	E9PJ23;E9PS57	.;.	K	268;286	ENSP00000435924:E268K;ENSP00000431871:E286K	ENSP00000431871:E286K	E	-	1	0	RP11-57A19.3	28261851	0.003000	0.15002	0.002000	0.10522	0.002000	0.02628	0.055000	0.14229	0.088000	0.17205	0.089000	0.15464	GAG	NPIPB6	-	NULL	ENSG00000198156		0.502	NPIPB6-002	NOVEL	basic|appris_principal	protein_coding	NPIPB6	HGNC	protein_coding	OTTHUMT00000389133.1		0.00	100	0	C	XM_001717652		28354350	-1			no_errors	ENST00000532254	ensembl	human	novel	74_37	missense	10.20	44	5	SNP	0.002	T
NR2C1	7181	genome.wustl.edu	37	12	95416047	95416047	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:95416047C>A	ENST00000333003.5	-	14	2100	c.1770G>T	c.(1768-1770)gaG>gaT	p.E590D		NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	590	Required for interaction with NRIP1. {ECO:0000250}.				gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						AATCTGCAGGCTCCATTTTCA	0.368																																																	0													128.0	133.0	131.0					12																	95416047		2203	4300	6503	SO:0001583	missense	0			M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1770G>T	12.37:g.95416047C>A	ENSP00000333275:p.Glu590Asp		A8K5K4|Q15625|Q15626	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.E590D	ENST00000333003.5	37	c.1770	CCDS9051.1	12	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697024	0.48202	.	.	ENSG00000120798	ENST00000333003	T	0.52057	0.68	5.89	0.787	0.18596	Nuclear hormone receptor, ligand-binding (1);	0.096846	0.64402	D	0.000001	T	0.56156	0.1966	L	0.49126	1.545	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	T	0.46470	-0.9189	10	0.29301	T	0.29	.	10.8152	0.46571	0.0:0.5798:0.0:0.4202	.	590	P13056	NR2C1_HUMAN	D	590	ENSP00000333275:E590D	ENSP00000333275:E590D	E	-	3	2	NR2C1	93940178	0.950000	0.32346	0.996000	0.52242	0.738000	0.42128	0.142000	0.16096	-0.122000	0.11766	-0.142000	0.14014	GAG	NR2C1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000120798		0.368	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	HGNC	protein_coding	OTTHUMT00000407565.2		0.00	44	0	C	NM_003297		95416047	-1			no_errors	ENST00000333003	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.996	A
NUP188	23511	genome.wustl.edu	37	9	131745618	131745618	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:131745618G>A	ENST00000372577.2	+	18	1864	c.1843G>A	c.(1843-1845)Gtc>Atc	p.V615I		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	615					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.V615I(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TGCTTCTTGTGTCAACTGCTT	0.443																																																	1	Substitution - Missense(1)	urinary_tract(1)											218.0	203.0	208.0					9																	131745618		2203	4300	6503	SO:0001583	missense	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1843G>A	9.37:g.131745618G>A	ENSP00000361658:p.Val615Ile		Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.V615I	ENST00000372577.2	37	c.1843	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	G	28.2	4.897802	0.91962	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.64085	-0.08	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.69468	0.3114	L	0.27053	0.805	0.80722	D	1	D	0.63046	0.992	D	0.77004	0.989	T	0.67197	-0.5731	10	0.34782	T	0.22	-11.8947	18.5867	0.91192	0.0:0.0:1.0:0.0	.	615	Q5SRE5	NU188_HUMAN	I	504;615	ENSP00000361658:V615I	ENSP00000349125:V504I	V	+	1	0	NUP188	130785439	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.182000	0.94881	2.708000	0.92522	0.563000	0.77884	GTC	NUP188	-	pfam_Nucleoporin_Nup188	ENSG00000095319		0.443	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2		0.00	64	0	G			131745618	+1			no_errors	ENST00000372577	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	A
OBSCN	84033	genome.wustl.edu	37	1	228494222	228494222	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:228494222C>T	ENST00000422127.1	+	44	11853	c.11809C>T	c.(11809-11811)Cca>Tca	p.P3937S	OBSCN_ENST00000284548.11_Missense_Mutation_p.P3937S|OBSCN_ENST00000366707.4_Missense_Mutation_p.P1571S|OBSCN_ENST00000570156.2_Missense_Mutation_p.P4894S|OBSCN_ENST00000366709.4_Missense_Mutation_p.P1056S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3937	Ig-like 40.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCGCCGGGAGCCACGGCTTCA	0.647																																																	0													29.0	33.0	31.0					1																	228494222		1968	4155	6123	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11809C>T	1.37:g.228494222C>T	ENSP00000409493:p.Pro3937Ser		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.P3937S	ENST00000422127.1	37	c.11809	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668306	0.29604	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.28	-3.2	0.05156	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.158870	0.06438	N	0.725348	T	0.59307	0.2184	L	0.41906	1.305	0.09310	N	1	D;B	0.58970	0.984;0.032	P;B	0.57204	0.815;0.022	T	0.53315	-0.8456	10	0.54805	T	0.06	.	1.935	0.03335	0.4895:0.1681:0.1896:0.1528	.	3937;3937	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	3937;3937;1571;1056	ENSP00000284548:P3937S;ENSP00000409493:P3937S;ENSP00000355668:P1571S;ENSP00000355670:P1056S	ENSP00000284548:P3937S	P	+	1	0	OBSCN	226560845	0.000000	0.05858	0.126000	0.21872	0.060000	0.15804	-0.725000	0.04942	-0.255000	0.09486	0.462000	0.41574	CCA	OBSCN	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000154358		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding			0.00	32	0	C	NM_052843		228494222	+1			no_errors	ENST00000422127	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.000	T
OR2L3	391192	genome.wustl.edu	37	1	248224713	248224713	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:248224713C>A	ENST00000359959.3	+	1	730	c.730C>A	c.(730-732)Ctc>Atc	p.L244I	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CAGCACCCACCTCACTGTAGT	0.478																																																	0													155.0	143.0	147.0					1																	248224713		2203	4300	6503	SO:0001583	missense	0			AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.730C>A	1.37:g.248224713C>A	ENSP00000353044:p.Leu244Ile		B9EH44	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L244I	ENST00000359959.3	37	c.730	CCDS31104.1	1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293991	0.23564	.	.	ENSG00000198128	ENST00000359959	T	0.43294	0.95	2.05	1.08	0.20341	GPCR, rhodopsin-like superfamily (1);	0.000000	0.28376	U	0.015580	T	0.47192	0.1432	M	0.64404	1.975	0.26925	N	0.966595	P	0.50156	0.932	P	0.55087	0.768	T	0.32508	-0.9904	10	0.44086	T	0.13	.	5.8494	0.18683	0.0:0.7226:0.0:0.2774	.	244	Q8NG85	OR2L3_HUMAN	I	244	ENSP00000353044:L244I	ENSP00000353044:L244I	L	+	1	0	OR2L3	246291336	0.000000	0.05858	0.892000	0.35008	0.110000	0.19582	-0.453000	0.06778	0.175000	0.19841	0.462000	0.41574	CTC	OR2L3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000198128		0.478	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L3	HGNC	protein_coding	OTTHUMT00000096852.1		0.00	97	0	C	NM_001004687		248224713	+1			no_errors	ENST00000359959	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.911	A
OR4K5	79317	genome.wustl.edu	37	14	20389688	20389688	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:20389688C>A	ENST00000315915.4	+	1	948	c.923C>A	c.(922-924)cCa>cAa	p.P308Q		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P308Q(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TACCTGAGGCCAAGGAGAATT	0.373																																																	1	Substitution - Missense(1)	lung(1)											89.0	101.0	97.0					14																	20389688		2203	4299	6502	SO:0001583	missense	0			BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.923C>A	14.37:g.20389688C>A	ENSP00000319511:p.Pro308Gln		Q6IFA7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P308Q	ENST00000315915.4	37	c.923	CCDS32024.1	14	.	.	.	.	.	.	.	.	.	.	.	0.208	-1.039063	0.02013	.	.	ENSG00000176281	ENST00000315915	T	0.37235	1.21	3.99	3.09	0.35607	.	0.632412	0.13767	N	0.364127	T	0.23688	0.0573	L	0.34521	1.04	0.09310	N	1	B	0.33212	0.402	B	0.33392	0.163	T	0.13710	-1.0499	10	0.29301	T	0.29	.	4.649	0.12585	0.2158:0.6693:0.0:0.1149	.	308	Q8NGD3	OR4K5_HUMAN	Q	308	ENSP00000319511:P308Q	ENSP00000319511:P308Q	P	+	2	0	OR4K5	19459528	0.019000	0.18553	0.002000	0.10522	0.110000	0.19582	3.111000	0.50360	0.873000	0.35799	0.650000	0.86243	CCA	OR4K5	-	NULL	ENSG00000176281		0.373	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K5	HGNC	protein_coding	OTTHUMT00000409867.1		0.00	77	0	C	NM_001005483		20389688	+1			no_errors	ENST00000315915	ensembl	human	known	74_37	missense	10.00	18	2	SNP	0.000	A
OSBPL5	114879	genome.wustl.edu	37	11	3113730	3113730	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:3113730G>A	ENST00000263650.7	-	19	2350	c.2191C>T	c.(2191-2193)Cgg>Tgg	p.R731W	OSBPL5_ENST00000389989.3_Missense_Mutation_p.R663W|OSBPL5_ENST00000348039.5_Missense_Mutation_p.R663W|OSBPL5_ENST00000542243.1_Missense_Mutation_p.R362W|OSBPL5_ENST00000478260.1_Missense_Mutation_p.R185W|OSBPL5_ENST00000525498.1_Missense_Mutation_p.R642W	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	731					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGCAAGGTCCGCAGGATCCCG	0.697											OREG0020694	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													32.0	27.0	29.0					11																	3113730		2194	4285	6479	SO:0001583	missense	0			AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.2191C>T	11.37:g.3113730G>A	ENSP00000263650:p.Arg731Trp	608	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R731W	ENST00000263650.7	37	c.2191	CCDS31344.1	11	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825683	0.50739	.	.	ENSG00000021762	ENST00000478260;ENST00000263650;ENST00000389989;ENST00000534454;ENST00000525498;ENST00000542243;ENST00000348039;ENST00000357352	T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5	4.47	2.58	0.30949	.	1.375470	0.04481	N	0.377845	T	0.19886	0.0478	N	0.08118	0	0.28202	N	0.927318	P;D;P	0.55800	0.933;0.973;0.933	B;B;B	0.41860	0.296;0.368;0.296	T	0.28933	-1.0028	10	0.52906	T	0.07	-0.5401	9.6725	0.40021	0.1735:0.0:0.8265:0.0	.	642;663;731	B4DVB0;Q8N596;Q9H0X9	.;.;OSBL5_HUMAN	W	185;731;663;284;642;362;663;350	ENSP00000437141:R185W;ENSP00000263650:R731W;ENSP00000374639:R663W;ENSP00000431412:R284W;ENSP00000433342:R642W;ENSP00000441551:R362W;ENSP00000302872:R663W	ENSP00000263650:R731W	R	-	1	2	OSBPL5	3070306	1.000000	0.71417	0.046000	0.18839	0.271000	0.26615	5.344000	0.65981	0.354000	0.24105	0.561000	0.74099	CGG	OSBPL5	-	NULL	ENSG00000021762		0.697	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL5	HGNC	protein_coding	OTTHUMT00000032332.2	-	0.00	160	0	G			3113730	-1	tier1	-	no_errors	ENST00000263650	ensembl	human	known	74_37	missense	51.75	68	74	SNP	1.000	A
OR8B4	283162	genome.wustl.edu	37	11	124294459	124294459	+	Missense_Mutation	SNP	G	G	T	rs140207564		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:124294459G>T	ENST00000356130.3	-	1	330	c.309C>A	c.(307-309)ttC>ttA	p.F103L		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CAAAGAAACAGAAGAAAAATA	0.423																																																	0													103.0	102.0	102.0					11																	124294459		2201	4299	6500	SO:0001583	missense	0			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.309C>A	11.37:g.124294459G>T	ENSP00000348449:p.Phe103Leu		B2RNF8|Q6IFQ7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.F103L	ENST00000356130.3	37	c.309	CCDS31710.1	11	.	.	.	.	.	.	.	.	.	.	g	13.52	2.260268	0.39995	.	.	ENSG00000198657	ENST00000356130	T	0.00309	8.16	4.62	2.74	0.32292	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000033	T	0.00210	0.0006	L	0.49571	1.57	0.26359	N	0.977086	B	0.20368	0.044	B	0.21151	0.033	T	0.34700	-0.9818	10	0.66056	D	0.02	.	7.1371	0.25535	0.2906:0.0:0.7094:0.0	.	103	Q96RC9	OR8B4_HUMAN	L	103	ENSP00000348449:F103L	ENSP00000348449:F103L	F	-	3	2	OR8B4	123799669	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-0.122000	0.10627	1.305000	0.44909	0.655000	0.94253	TTC	OR8B4	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198657		0.423	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B4	HGNC	protein_coding	OTTHUMT00000387055.1	-	0.00	21	0	G	NM_001005196		124294459	-1	tier1	-	no_errors	ENST00000356130	ensembl	human	known	74_37	missense	18.75	12	3	SNP	0.623	T
OTOA	146183	genome.wustl.edu	37	16	21712311	21712311	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:21712311T>C	ENST00000286149.4	+	10	944	c.943T>C	c.(943-945)Tcc>Ccc	p.S315P	OTOA_ENST00000388958.3_Missense_Mutation_p.S315P|OTOA_ENST00000388956.4_Missense_Mutation_p.S236P			Q7RTW8	OTOAN_HUMAN	otoancorin	315					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		GATCAGCTCCTCCAACTTTAA	0.522																																																	0													90.0	78.0	82.0					16																	21712311		2199	4300	6499	SO:0001583	missense	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.943T>C	16.37:g.21712311T>C	ENSP00000286149:p.Ser315Pro		A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	NULL	p.S315P	ENST00000286149.4	37	c.943		16	.	.	.	.	.	.	.	.	.	.	T	23.0	4.368439	0.82463	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956	D;D;D	0.83506	-1.73;-1.73;-1.73	5.41	5.41	0.78517	.	0.065465	0.64402	D	0.000006	D	0.89632	0.6771	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.90539	0.4501	10	0.72032	D	0.01	-20.0642	13.7046	0.62631	0.0:0.0:0.0:1.0	.	236;315	B3KWU3;E9PF51	.;.	P	315;315;236	ENSP00000373610:S315P;ENSP00000286149:S315P;ENSP00000373608:S236P	ENSP00000286149:S315P	S	+	1	0	OTOA	21619812	1.000000	0.71417	0.875000	0.34327	0.967000	0.64934	5.740000	0.68629	2.171000	0.68590	0.528000	0.53228	TCC	OTOA	-	NULL	ENSG00000155719		0.522	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	-	0.00	34	0	T			21712311	+1	tier1	-	no_errors	ENST00000286149	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.993	C
OTOF	9381	genome.wustl.edu	37	2	26693554	26693556	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:26693554_26693556delCTT	ENST00000272371.2	-	32	4054_4056	c.3928_3930delAAG	c.(3928-3930)aagdel	p.K1310del	OTOF_ENST00000339598.3_In_Frame_Del_p.K543del|OTOF_ENST00000402415.3_In_Frame_Del_p.K620del|OTOF_ENST00000403946.3_In_Frame_Del_p.K1310del|OTOF_ENST00000338581.6_In_Frame_Del_p.K543del	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1310	Poly-Lys.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGCAGTGCCcttcttcttcttc	0.576																																					GBM(102;732 1451 20652 24062 31372)												0									,,,	10,9,4247		0,0,10,0,9,2114					,,,	4.9	1.0			146	5,24,8225		0,0,5,0,24,4098	no	codingComplex,codingComplex,codingComplex,codingComplex	OTOF	NM_194323.2,NM_194322.2,NM_194248.2,NM_004802.3	,,,	0,0,15,0,33,6212	A1A1,A1A2,A1R,A2A2,A2R,RR		0.3513,0.4454,0.3834	,,,	,,,		15,33,12472				SO:0001651	inframe_deletion	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3928_3930delAAG	2.37:g.26693563_26693565delCTT	ENSP00000272371:p.Lys1310del		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	In_Frame_Del	DEL	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.K1310in_frame_del	ENST00000272371.2	37	c.3930_3928	CCDS1725.1	2																																																																																			OTOF	-	NULL	ENSG00000115155		0.576	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3		0.00	20	0	CTT			26693556	-1	tier1		no_errors	ENST00000272371	ensembl	human	known	74_37	in_frame_del	15.79	16	3	DEL	0.998:1.000:1.000	-
PAXIP1	22976	genome.wustl.edu	37	7	154760267	154760269	+	In_Frame_Del	DEL	CTG	CTG	-	rs141168451		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:154760267_154760269delCTG	ENST00000404141.1	-	7	1796_1798	c.1642_1644delCAG	c.(1642-1644)cagdel	p.Q548del	PAXIP1_ENST00000397192.1_In_Frame_Del_p.Q548del|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	548	Gln-rich.			Missing (in Ref. 4; AAB91434). {ECO:0000305}.	adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GACTTTGCATctgctgctgctgc	0.626																																																	0										135,3467		9,117,1675						-0.6	0.0		dbSNP_134	18	258,6344		17,224,3060	no	coding	PAXIP1	NM_007349.3		26,341,4735	A1A1,A1R,RR		3.9079,3.7479,3.8514				393,9811				SO:0001651	inframe_deletion	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1642_1644delCAG	7.37:g.154760276_154760278delCTG	ENSP00000384048:p.Gln548del		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	In_Frame_Del	DEL	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q548in_frame_del	ENST00000404141.1	37	c.1644_1642	CCDS47753.1	7																																																																																			PAXIP1	-	NULL	ENSG00000157212		0.626	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	32	0	CTG	NM_007349		154760269	-1	tier1		no_errors	ENST00000397192	ensembl	human	known	74_37	in_frame_del	11.54	23	3	DEL	0.709:0.971:0.997	-
PCDHB14	56122	genome.wustl.edu	37	5	140605202	140605202	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:140605202G>A	ENST00000239449.4	+	1	2125	c.2125G>A	c.(2125-2127)Gtg>Atg	p.V709M	PCDHB14_ENST00000515856.2_Missense_Mutation_p.V556M	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	709					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCCTGTTCGTGGCGGTGCG	0.706																																					Ovarian(141;50 1831 27899 33809 37648)												0													72.0	87.0	82.0					5																	140605202		2188	4265	6453	SO:0001583	missense	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2125G>A	5.37:g.140605202G>A	ENSP00000239449:p.Val709Met		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V709M	ENST00000239449.4	37	c.2125	CCDS4256.1	5	.	.	.	.	.	.	.	.	.	.	-	17.07	3.294546	0.60086	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.15256	2.44;2.44	4.36	3.19	0.36642	.	.	.	.	.	T	0.35885	0.0947	H	0.97131	3.945	0.09310	N	1	D	0.54964	0.969	P	0.45232	0.474	T	0.50250	-0.8850	9	0.72032	D	0.01	.	6.8628	0.24076	0.1342:0.0:0.697:0.1688	.	709	Q9Y5E9	PCDBE_HUMAN	M	556;709	ENSP00000444518:V556M;ENSP00000239449:V709M	ENSP00000239449:V709M	V	+	1	0	PCDHB14	140585386	0.000000	0.05858	0.119000	0.21687	0.415000	0.31203	0.262000	0.18460	2.127000	0.65507	0.650000	0.86243	GTG	PCDHB14	-	NULL	ENSG00000120327		0.706	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	-	0.00	115	0	G	NM_018934		140605202	+1	tier1	-	no_errors	ENST00000239449	ensembl	human	known	74_37	missense	24.24	50	16	SNP	0.004	A
PDE5A	8654	genome.wustl.edu	37	4	120528199	120528199	+	Missense_Mutation	SNP	G	G	T	rs201954719		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:120528199G>T	ENST00000354960.3	-	2	725	c.406C>A	c.(406-408)Cta>Ata	p.L136I	PDE5A_ENST00000394439.1_Missense_Mutation_p.L84I|PDE5A_ENST00000264805.5_Missense_Mutation_p.L94I	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	136					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	GGAGGGGTTAGAGGCATCTGT	0.458																																																	0													112.0	106.0	108.0					4																	120528199		2203	4300	6503	SO:0001583	missense	0			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.406C>A	4.37:g.120528199G>T	ENSP00000347046:p.Leu136Ile		A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.L136I	ENST00000354960.3	37	c.406	CCDS3713.1	4	.	.	.	.	.	.	.	.	.	.	G	12.27	1.887658	0.33348	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805;ENST00000420633	T;T;T;T	0.08370	3.1;3.1;3.1;3.1	5.64	5.64	0.86602	.	0.478059	0.20039	N	0.100558	T	0.09247	0.0228	L	0.47716	1.5	0.39775	D	0.972228	B;P	0.41848	0.146;0.763	B;B	0.35770	0.119;0.21	T	0.19516	-1.0303	10	0.34782	T	0.22	.	14.871	0.70456	0.0704:0.0:0.9296:0.0	.	136;94	O76074;O76074-2	PDE5A_HUMAN;.	I	136;84;94;84	ENSP00000347046:L136I;ENSP00000377957:L84I;ENSP00000264805:L94I;ENSP00000416309:L84I	ENSP00000264805:L94I	L	-	1	2	PDE5A	120747647	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.066000	0.50002	2.659000	0.90383	0.655000	0.94253	CTA	PDE5A	-	NULL	ENSG00000138735		0.458	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	HGNC	protein_coding	OTTHUMT00000256529.1	-	0.00	60	0	G	NM_001083		120528199	-1	tier1	-	no_errors	ENST00000354960	ensembl	human	known	74_37	missense	16.67	15	3	SNP	1.000	T
PEBP1	5037	genome.wustl.edu	37	12	118582594	118582594	+	Silent	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:118582594C>T	ENST00000261313.2	+	4	902	c.550C>T	c.(550-552)Ctg>Ttg	p.L184L	PEBP1_ENST00000542939.1_3'UTR	NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	184						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTACGAGCAGCTGTCTGGGAA	0.557																																					NSCLC(44;94 1357 12187 49467)												0													69.0	63.0	65.0					12																	118582594		2203	4300	6503	SO:0001819	synonymous_variant	0			X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.550C>T	12.37:g.118582594C>T			B2R4S1	Silent	SNP	pfam_PtdEtn-bd_prot_PEBP,superfamily_PtdEtn-bd_prot_PEBP	p.L184	ENST00000261313.2	37	c.550	CCDS9187.1	12																																																																																			PEBP1	-	superfamily_PtdEtn-bd_prot_PEBP	ENSG00000089220		0.557	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEBP1	HGNC	protein_coding	OTTHUMT00000401405.1	-	0.00	56	0	C	NM_002567		118582594	+1	tier1	-	no_errors	ENST00000261313	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	T
PGK1	5230	genome.wustl.edu	37	X	77369397	77369397	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chrX:77369397G>T	ENST00000373316.4	+	3	439		c.e3+1		PGK1_ENST00000442431.1_Intron|PGK1_ENST00000537456.1_Splice_Site	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1						carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	TGCTGGGCAAGTAAGTGCCAG	0.502																																																	0													81.0	76.0	78.0					X																	77369397		2203	4299	6502	SO:0001630	splice_region_variant	0			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.272+1G>T	X.37:g.77369397G>T			A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Splice_Site	SNP	-	e3+1	ENST00000373316.4	37	c.272+1	CCDS14438.1	X	.	.	.	.	.	.	.	.	.	.	g	20.0	3.930947	0.73327	.	.	ENSG00000102144	ENST00000373316;ENST00000537456	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4077	0.67093	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PGK1	77256053	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.396000	0.97270	2.236000	0.73375	0.597000	0.82753	.	PGK1	-	-	ENSG00000102144		0.502	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK1	HGNC	protein_coding	OTTHUMT00000057310.1		0.00	24	0	G		Intron	77369397	+1			no_errors	ENST00000373316	ensembl	human	known	74_37	splice_site	8.70	42	4	SNP	1.000	T
PIGS	94005	genome.wustl.edu	37	17	26898142	26898142	+	Silent	SNP	C	C	T	rs144271516		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:26898142C>T	ENST00000308360.7	-	2	474	c.99G>A	c.(97-99)ccG>ccA	p.P33P	PIGS_ENST00000543734.1_Intron|RP11-192H23.5_ENST00000585189.1_RNA|PIGS_ENST00000395346.2_Silent_p.P25P	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	33					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					TCCACCAGAGCGGTAGCCCCA	0.662																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	39.0	44.0	42.0		99	-9.6	0.7	17	dbSNP_134	42	0,8600		0,0,4300	no	coding-synonymous	PIGS	NM_033198.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		33/556	26898142	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.99G>A	17.37:g.26898142C>T			Q6UVX6	Silent	SNP	pfam_PtdIno-glycan_biosynth_class_S	p.P33	ENST00000308360.7	37	c.99	CCDS11235.1	17																																																																																			PIGS	-	pfam_PtdIno-glycan_biosynth_class_S	ENSG00000087111		0.662	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGS	HGNC	protein_coding	OTTHUMT00000255833.3		0.00	100	0	C	NM_033198		26898142	-1			no_errors	ENST00000308360	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.077	T
PIPSL	266971	genome.wustl.edu	37	10	95720561	95720561	+	RNA	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr10:95720561G>T	ENST00000480546.1	-	0	736					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										CATTTTTACCGATCTTGGTAA	0.458																																																	0																																												0			BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95720561G>T			Q6NUK8	RNA	SNP	-	NULL	ENST00000480546.1	37	NULL		10																																																																																			PIPSL	-	-	ENSG00000180764		0.458	PIPSL-002	PUTATIVE	basic	processed_transcript	PIPSL	HGNC	pseudogene	OTTHUMT00000351483.1		0.00	109	0	G	NR_002319		95720561	-1			no_errors	ENST00000480546	ensembl	human	putative	74_37	rna	6.90	54	4	SNP	0.004	T
PITPNM3	83394	genome.wustl.edu	37	17	6386932	6386932	+	Silent	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:6386932G>A	ENST00000262483.8	-	6	579	c.492C>T	c.(490-492)gtC>gtT	p.V164V	PITPNM3_ENST00000421306.3_Silent_p.V128V	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	164					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GGGCTCGTGTGACCTTCTCCA	0.612																																																	0													150.0	100.0	117.0					17																	6386932		2203	4300	6503	SO:0001819	synonymous_variant	0			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.492C>T	17.37:g.6386932G>A			A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD	p.V164	ENST00000262483.8	37	c.492	CCDS11076.1	17																																																																																			PITPNM3	-	NULL	ENSG00000091622		0.612	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNM3	HGNC	protein_coding	OTTHUMT00000219824.2	-	0.00	86	0	G	NM_031220		6386932	-1	tier1	-	no_errors	ENST00000262483	ensembl	human	known	74_37	silent	23.33	46	14	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110465003	110465003	+	Frame_Shift_Del	DEL	A	A	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:110465003delA	ENST00000378402.5	+	43	6668	c.6564delA	c.(6562-6564)ggafs	p.G2188fs		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2188	G8 1. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CATGGGGGGGAAAATCTCCCC	0.393										HNSCC(38;0.096)																																							0										31,3475		13,5,1735	42.0	39.0	40.0			5.8	1.0	8		40	75,7737		33,9,3864	no	frameshift	PKHD1L1	NM_177531.4		46,14,5599	A1A1,A1R,RR		0.9601,0.8842,0.9366			110465003	106,11212	1811	4075	5886	SO:0001589	frameshift_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6564delA	8.37:g.110465003delA	ENSP00000367655:p.Gly2188fs		Q567P2|Q9UF27	Frame_Shift_Del	DEL	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.K2189fs	ENST00000378402.5	37	c.6564	CCDS47911.1	8																																																																																			PKHD1L1	-	pfam_G8_domain	ENSG00000205038		0.393	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1		0.00	67	0	A	NM_177531		110465003	+1	tier1		no_errors	ENST00000378402	ensembl	human	known	74_37	frame_shift_del	20.59	27	7	DEL	0.001	-
PLA2G2F	64600	genome.wustl.edu	37	1	20474883	20474883	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:20474883G>A	ENST00000375102.3	+	5	727	c.625G>A	c.(625-627)Gcc>Acc	p.A209T		NM_022819.3	NP_073730.3	Q9BZM2	PA2GF_HUMAN	phospholipase A2, group IIF	166					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		AGCGCCCCCCGCCCCTCCCTA	0.652																																																	0																																										SO:0001583	missense	0			AL158172	CCDS204.2	1p35	2008-09-19			ENSG00000158786	ENSG00000158786	3.1.1.4		30040	protein-coding gene	gene with protein product						11112443	Standard	NM_022819		Approved		uc009vpp.1	Q9BZM2	OTTHUMG00000002704	ENST00000375102.3:c.625G>A	1.37:g.20474883G>A	ENSP00000364243:p.Ala209Thr		Q5R385|Q8N217|Q9H506	Missense_Mutation	SNP	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.A209T	ENST00000375102.3	37	c.625	CCDS204.2	1	.	.	.	.	.	.	.	.	.	.	G	8.756	0.922337	0.17982	.	.	ENSG00000158786	ENST00000375102	T	0.27256	1.68	4.91	-1.35	0.09114	.	1.436000	0.04830	N	0.438544	T	0.10121	0.0248	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24225	-1.0166	10	0.23302	T	0.38	-1.3404	2.3058	0.04173	0.2279:0.1479:0.4885:0.1357	.	209	Q9BZM2-2	.	T	209	ENSP00000364243:A209T	ENSP00000364243:A209T	A	+	1	0	PLA2G2F	20347470	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.316000	0.02710	0.034000	0.15491	-1.320000	0.01293	GCC	PLA2G2F	-	NULL	ENSG00000158786		0.652	PLA2G2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2F	HGNC	protein_coding	OTTHUMT00000007687.1	-	0.00	48	0	G	NM_022819		20474883	+1	tier1	-	no_errors	ENST00000375102	ensembl	human	known	74_37	missense	31.82	29	14	SNP	0.000	A
PLEK2	26499	genome.wustl.edu	37	14	67854146	67854146	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:67854146A>T	ENST00000216446.4	-	9	1102	c.962T>A	c.(961-963)cTc>cAc	p.L321H		NM_016445.1	NP_057529.1	Q9NYT0	PLEK2_HUMAN	pleckstrin 2	321	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	15				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)		CACTTTGAAGAGGTTTCCCTG	0.433																																																	0													170.0	154.0	159.0					14																	67854146		2203	4300	6503	SO:0001583	missense	0			AF228603	CCDS9782.1	14q23.3	2014-08-12			ENSG00000100558	ENSG00000100558		"""Pleckstrin homology (PH) domain containing"""	19238	protein-coding gene	gene with protein product		608007				11911883, 17658464	Standard	NM_016445		Approved		uc001xjh.1	Q9NYT0	OTTHUMG00000171247	ENST00000216446.4:c.962T>A	14.37:g.67854146A>T	ENSP00000216446:p.Leu321His		Q96JT0	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_DEP_dom,smart_Pleckstrin_homology,smart_DEP_dom,pfscan_DEP_dom,pfscan_Pleckstrin_homology	p.L321H	ENST00000216446.4	37	c.962	CCDS9782.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.9|26.9	4.778343|4.778343	0.90195|0.90195	.|.	.|.	ENSG00000100558|ENSG00000100558	ENST00000216446|ENST00000556532	T|.	0.75821|.	-0.97|.	5.85|5.85	5.85|5.85	0.93711|0.93711	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73621|0.73621	0.3610|0.3610	M|M	0.72353|0.72353	2.195|2.195	0.58432|0.58432	D|D	0.999996|0.999996	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.73780|0.73780	-0.3875|-0.3875	10|5	0.52906|.	T|.	0.07|.	-3.3367|-3.3367	14.8066|14.8066	0.69962|0.69962	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	321|.	Q9NYT0|.	PLEK2_HUMAN|.	H|T	321|85	ENSP00000216446:L321H|.	ENSP00000216446:L321H|.	L|S	-|-	2|1	0|0	PLEK2|PLEK2	66923899|66923899	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	8.011000|8.011000	0.88624|0.88624	2.238000|2.238000	0.73509|0.73509	0.533000|0.533000	0.62120|0.62120	CTC|TCT	PLEK2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000100558		0.433	PLEK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEK2	HGNC	protein_coding	OTTHUMT00000412547.2	-	0.00	67	0	A			67854146	-1	tier1	-	no_errors	ENST00000216446	ensembl	human	known	74_37	missense	93.75	1	15	SNP	1.000	T
POM121L9P	29774	genome.wustl.edu	37	22	24657714	24657714	+	RNA	SNP	C	C	G	rs80002636		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr22:24657714C>G	ENST00000414583.2	+	0	2131					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		AGCAGCTGCTCATGGGCAGAG	0.637																																																	0																																												0			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24657714C>G				RNA	SNP	-	NULL	ENST00000414583.2	37	NULL		22																																																																																			POM121L9P	-	-	ENSG00000128262		0.637	POM121L9P-001	KNOWN	basic	processed_transcript	POM121L9P	HGNC	pseudogene	OTTHUMT00000319991.1	-	0.00	67	0	C	NM_014549		24657714	+1	tier1	rs80002636	no_errors	ENST00000414583	ensembl	human	known	74_37	rna	11.86	52	7	SNP	0.000	G
PLXNB2	23654	genome.wustl.edu	37	22	50727557	50727557	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr22:50727557G>T	ENST00000449103.1	-	4	1223	c.1083C>A	c.(1081-1083)agC>agA	p.S361R	PLXNB2_ENST00000359337.4_Missense_Mutation_p.S361R|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	361	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CACATGGGAAGCTCTTGCTGG	0.692																																																	0													9.0	11.0	10.0					22																	50727557		2080	4176	6256	SO:0001583	missense	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.1083C>A	22.37:g.50727557G>T	ENSP00000409171:p.Ser361Arg		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.S361R	ENST00000449103.1	37	c.1083	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	G	9.173	1.021710	0.19433	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000414275;ENST00000411680;ENST00000432455	T;T;T;T	0.10382	2.88;2.88;3.51;2.88	4.58	2.45	0.29901	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.192730	0.36482	N	0.002577	T	0.08358	0.0208	L	0.42487	1.325	0.42717	D	0.993669	B	0.14805	0.011	B	0.15870	0.014	T	0.23655	-1.0182	10	0.18710	T	0.47	.	7.3092	0.26465	0.3854:0.0:0.6146:0.0	.	361	O15031	PLXB2_HUMAN	R	361;361;361;20;361	ENSP00000409171:S361R;ENSP00000352288:S361R;ENSP00000400679:S20R;ENSP00000392620:S361R	ENSP00000352288:S361R	S	-	3	2	PLXNB2	49069684	0.971000	0.33674	0.931000	0.37212	0.258000	0.26162	0.304000	0.19228	0.525000	0.28522	0.561000	0.74099	AGC	PLXNB2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000196576		0.692	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	-	0.00	58	0	G	NM_012401		50727557	-1	tier1	-	no_errors	ENST00000359337	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.975	T
POMGNT1	55624	genome.wustl.edu	37	1	46662690	46662690	+	Nonsense_Mutation	SNP	G	G	A	rs193919337		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:46662690G>A	ENST00000371984.3	-	3	344	c.187C>T	c.(187-189)Cga>Tga	p.R63*	POMGNT1_ENST00000371992.1_Nonsense_Mutation_p.R63*|POMGNT1_ENST00000396420.3_Nonsense_Mutation_p.R63*|POMGNT1_ENST00000535522.1_Nonsense_Mutation_p.R41*|POMGNT1_ENST00000371986.3_Nonsense_Mutation_p.R63*	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)	63					protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					CTGATGGCTCGCCGAGTGTCC	0.547																																																	0			GRCh37	CM030725	POMGNT1	M	rs193919337						178.0	187.0	184.0					1																	46662690		2203	4300	6503	SO:0001587	stop_gained	0				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.187C>T	1.37:g.46662690G>A	ENSP00000361052:p.Arg63*		D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Nonsense_Mutation	SNP	pfam_Glyco_trans_13	p.R63*	ENST00000371984.3	37	c.187	CCDS531.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.579120	0.97680	.	.	ENSG00000085998	ENST00000396420;ENST00000371984;ENST00000371992;ENST00000535522;ENST00000371986	.	.	.	4.96	1.81	0.25067	.	0.229220	0.42964	D	0.000633	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.9773	7.4352	0.27152	0.0847:0.0:0.4291:0.4862	.	.	.	.	X	63;63;63;41;63	.	ENSP00000361052:R63X	R	-	1	2	POMGNT1	46435277	0.981000	0.34729	0.438000	0.26821	0.214000	0.24535	1.804000	0.38873	0.441000	0.26529	-0.258000	0.10820	CGA	POMGNT1	-	NULL	ENSG00000085998		0.547	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT1	HGNC	protein_coding	OTTHUMT00000020146.1	-	0.00	113	0	G	NM_017739		46662690	-1	tier1	rs193919337	no_errors	ENST00000371986	ensembl	human	known	74_37	nonsense	16.84	79	16	SNP	0.535	A
PPCDC	60490	genome.wustl.edu	37	15	75320765	75320765	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:75320765C>A	ENST00000342932.3	+	2	250	c.106C>A	c.(106-108)Ctg>Atg	p.L36M	PPCDC_ENST00000568649.1_Missense_Mutation_p.L36M|PPCDC_ENST00000567336.1_Missense_Mutation_p.L36M|PPCDC_ENST00000564923.1_Missense_Mutation_p.L36M	NM_021823.3	NP_068595.3	Q96CD2	COAC_HUMAN	phosphopantothenoylcysteine decarboxylase	36					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	phosphopantothenoylcysteine decarboxylase activity (GO:0004633)			breast(1)|cervix(1)	2						GTTGCCTCTTCTGGTGTCAAA	0.572																																																	0													148.0	125.0	133.0					15																	75320765		2197	4295	6492	SO:0001583	missense	0			AK027491	CCDS10275.1, CCDS73761.1, CCDS73759.1, CCDS73760.1	15q24.2	2005-08-16			ENSG00000138621	ENSG00000138621	4.1.1.36		28107	protein-coding gene	gene with protein product		609854				12975309, 11923312	Standard	XM_005254579		Approved	MDS018, FLJ14585	uc002azo.3	Q96CD2	OTTHUMG00000142824	ENST00000342932.3:c.106C>A	15.37:g.75320765C>A	ENSP00000343190:p.Leu36Met		Q96SX0|Q9HC17	Missense_Mutation	SNP	pfam_Flavoprotein,superfamily_Flavoprotein	p.L36M	ENST00000342932.3	37	c.106	CCDS10275.1	15	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457369	0.63401	.	.	ENSG00000138621	ENST00000342932	T	0.50277	0.75	5.03	4.11	0.48088	Flavoprotein (3);	0.000000	0.64402	D	0.000003	T	0.70736	0.3258	M	0.90019	3.08	0.80722	D	1	D	0.57899	0.981	D	0.66979	0.948	T	0.75698	-0.3227	10	0.72032	D	0.01	-13.5765	10.9003	0.47047	0.0:0.9132:0.0:0.0868	.	36	Q96CD2	COAC_HUMAN	M	36	ENSP00000343190:L36M	ENSP00000343190:L36M	L	+	1	2	PPCDC	73107818	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.120000	0.41968	1.137000	0.42214	0.462000	0.41574	CTG	PPCDC	-	pfam_Flavoprotein,superfamily_Flavoprotein	ENSG00000138621		0.572	PPCDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPCDC	HGNC	protein_coding	OTTHUMT00000286416.1	-	0.00	52	0	C	NM_021823		75320765	+1	tier1	-	no_errors	ENST00000342932	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	A
PPP1R12A	4659	genome.wustl.edu	37	12	80211231	80211231	+	Silent	SNP	A	A	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:80211231A>G	ENST00000450142.2	-	9	1448	c.1182T>C	c.(1180-1182)gcT>gcC	p.A394A	PPP1R12A_ENST00000261207.5_Silent_p.A394A|PPP1R12A_ENST00000437004.2_Silent_p.A394A|PPP1R12A_ENST00000550107.1_Silent_p.A394A|PPP1R12A_ENST00000546369.1_Silent_p.A307A	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	394					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						GTGTTGTAACAGCTACAGGAG	0.363																																																	0													116.0	114.0	114.0					12																	80211231		1864	4110	5974	SO:0001819	synonymous_variant	0			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1182T>C	12.37:g.80211231A>G			B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Silent	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A394	ENST00000450142.2	37	c.1182	CCDS44947.1	12																																																																																			PPP1R12A	-	pirsf_Pase-1_reg_su_12A/B/C_euk	ENSG00000058272		0.363	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	HGNC	protein_coding	OTTHUMT00000407254.2	-	0.00	26	0	A	NM_002480		80211231	-1	tier1	-	no_errors	ENST00000261207	ensembl	human	known	74_37	silent	16.67	20	4	SNP	1.000	G
PPP3CC	5533	genome.wustl.edu	37	8	22398187	22398187	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:22398187G>T	ENST00000240139.5	+	14	1738	c.1411G>T	c.(1411-1413)Gac>Tac	p.D471Y	RP11-582J16.4_ENST00000514980.1_RNA|PPP3CC_ENST00000289963.8_Missense_Mutation_p.D461Y|PPP3CC_ENST00000397775.3_Missense_Mutation_p.D480Y	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	471					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		GCGAGGTCTGGACCGAATTAA	0.517																																																	0													118.0	116.0	116.0					8																	22398187		2203	4300	6503	SO:0001583	missense	0				CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.1411G>T	8.37:g.22398187G>T	ENSP00000240139:p.Asp471Tyr		B4DRT5|Q9BSS6|Q9H4M5	Missense_Mutation	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.D471Y	ENST00000240139.5	37	c.1411	CCDS34859.1	8	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778434	0.90195	.	.	ENSG00000120910	ENST00000240139;ENST00000289963;ENST00000397775	T;T;T	0.05855	3.38;3.38;3.38	5.43	5.43	0.79202	.	0.099065	0.64402	D	0.000002	T	0.28101	0.0693	M	0.78916	2.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.01004	-1.1484	10	0.87932	D	0	-26.1131	18.0311	0.89285	0.0:0.0:1.0:0.0	.	480;461;471	B4DRT5;P48454-2;P48454	.;.;PP2BC_HUMAN	Y	471;461;480	ENSP00000240139:D471Y;ENSP00000289963:D461Y;ENSP00000380878:D480Y	ENSP00000240139:D471Y	D	+	1	0	PPP3CC	22454132	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.647000	0.98478	2.543000	0.85770	0.655000	0.94253	GAC	PPP3CC	-	NULL	ENSG00000120910		0.517	PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP3CC	HGNC	protein_coding	OTTHUMT00000375652.1	-	0.00	23	0	G	NM_005605		22398187	+1	tier1	-	no_errors	ENST00000240139	ensembl	human	known	74_37	missense	57.14	3	4	SNP	1.000	T
PRDM7	11105	genome.wustl.edu	37	16	90128361	90128361	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:90128361C>T	ENST00000449207.2	-	7	869	c.850G>A	c.(850-852)Gaa>Aaa	p.E284K	PRDM7_ENST00000325921.6_Missense_Mutation_p.E78K|PRDM7_ENST00000407825.1_Missense_Mutation_p.E78K	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	284	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		GCTGCCTCTTCGTCTTCTGTA	0.537																																																	0													126.0	123.0	124.0					16																	90128361		2198	4300	6498	SO:0001583	missense	0			AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.850G>A	16.37:g.90128361C>T	ENSP00000396732:p.Glu284Lys		A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_SET_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.E284K	ENST00000449207.2	37	c.850	CCDS45557.1	16	.	.	.	.	.	.	.	.	.	.	.	3.508	-0.100466	0.06967	.	.	ENSG00000126856	ENST00000325921;ENST00000449207;ENST00000407825	T;T;T	0.72505	0.99;-0.66;0.99	2.62	-3.6	0.04570	SET domain (2);	.	.	.	.	T	0.58192	0.2105	M	0.67397	2.05	0.30624	N	0.758143	B;B;B	0.33198	0.401;0.013;0.006	B;B;B	0.23150	0.044;0.009;0.005	T	0.51655	-0.8678	8	.	.	.	-4.0398	6.9714	0.24650	0.0:0.5411:0.0:0.4589	.	78;284;78	Q9NQW5-1;Q9NQW5;Q9NQW5-2	.;PRDM7_HUMAN;.	K	78;284;78	ENSP00000315512:E78K;ENSP00000396732:E284K;ENSP00000385121:E78K	.	E	-	1	0	PRDM7	88655862	0.970000	0.33590	0.022000	0.16811	0.007000	0.05969	1.795000	0.38784	-0.440000	0.07211	-2.686000	0.00141	GAA	PRDM7	-	pfscan_SET_dom	ENSG00000126856		0.537	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM7	HGNC	protein_coding	OTTHUMT00000420560.1	-	0.00	63	0	C			90128361	-1	tier1	-	no_errors	ENST00000449207	ensembl	human	known	74_37	missense	18.75	26	6	SNP	0.376	T
PRKACA	5566	genome.wustl.edu	37	19	14208613	14208613	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:14208613G>T	ENST00000308677.4	-	6	705	c.509C>A	c.(508-510)cCg>cAg	p.P170Q	PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000350356.3_5'UTR|PRKACA_ENST00000589994.1_Missense_Mutation_p.P162Q	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						CAGATTCTCCGGCTTCAGGTC	0.627																																																	0													78.0	77.0	77.0					19																	14208613		2203	4300	6503	SO:0001583	missense	0				CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.509C>A	19.37:g.14208613G>T	ENSP00000309591:p.Pro170Gln		Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P170Q	ENST00000308677.4	37	c.509	CCDS12304.1	19	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357258	0.82243	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695;ENST00000536649	T	0.16597	2.33	4.61	4.61	0.57282	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43747	D	0.000537	T	0.50326	0.1609	M	0.91717	3.235	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.63229	-0.6684	10	0.87932	D	0	.	14.943	0.71009	0.0:0.0:1.0:0.0	.	112;153;170;162	B7Z708;Q15136;P17612;P17612-2	.;.;KAPCA_HUMAN;.	Q	170;162;170;112	ENSP00000309591:P170Q	ENSP00000309591:P170Q	P	-	2	0	PRKACA	14069613	1.000000	0.71417	0.944000	0.38274	0.865000	0.49528	9.649000	0.98487	2.121000	0.65114	0.579000	0.79373	CCG	PRKACA	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000072062		0.627	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	HGNC	protein_coding	OTTHUMT00000459004.1		0.00	62	0	G	NM_002730		14208613	-1			no_errors	ENST00000308677	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.999	T
CERS3	204219	genome.wustl.edu	37	15	101088125	101088126	+	5'Flank	INS	-	-	T	rs532048470|rs574236631|rs111634080	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:101088125_101088126insT	ENST00000560944.1	-	0	0				RP11-526I2.5_ENST00000602585.1_lincRNA			Q8IU89	CERS3_HUMAN	ceramide synthase 3						ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										ACATGCTACAGTTTTTTTTTTC	0.347													|||unknown(HR)	294	0.0587061	0.0204	0.1902	5008	,	,		16134	0.0437		0.0487	False		,,,				2504	0.0429																0																																										SO:0001631	upstream_gene_variant	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568		15.37:g.101088135_101088135dupT	Exception_encountered		Q8NE64|Q8NEN6	RNA	INS	-	NULL	ENST00000560944.1	37	NULL		15																																																																																			RP11-526I2.5	-	-	ENSG00000270127		0.347	CERS3-009	KNOWN	basic	processed_transcript	PRKXP1	Clone_based_vega_gene	protein_coding	OTTHUMT00000417720.1		0.00	21	0	-	NM_178842		101088126	-1	tier1		no_errors	ENST00000602585	ensembl	human	known	74_37	rna	12.50	21	3	INS	0.000:0.000	T
PTPRD	5789	genome.wustl.edu	37	9	8317914	8317914	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:8317914G>T	ENST00000381196.4	-	43	6242	c.5699C>A	c.(5698-5700)gCa>gAa	p.A1900E	PTPRD_ENST00000397617.3_Missense_Mutation_p.A1493E|PTPRD_ENST00000540109.1_Missense_Mutation_p.A1900E|PTPRD_ENST00000356435.5_Missense_Mutation_p.A1900E|PTPRD_ENST00000397606.3_Missense_Mutation_p.A1493E|PTPRD_ENST00000397611.3_Missense_Mutation_p.A1490E|PTPRD_ENST00000537002.1_Missense_Mutation_p.A1490E|PTPRD_ENST00000486161.1_Missense_Mutation_p.A1493E|PTPRD_ENST00000360074.4_Missense_Mutation_p.A1887E|PTPRD_ENST00000358503.5_Missense_Mutation_p.A1878E|PTPRD_ENST00000355233.5_Missense_Mutation_p.A1494E	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1900	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GTACTCTAGTGCGGCACGATA	0.428										TSP Lung(15;0.13)																																							0													135.0	140.0	138.0					9																	8317914		2203	4299	6502	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.5699C>A	9.37:g.8317914G>T	ENSP00000370593:p.Ala1900Glu		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.A1900E	ENST00000381196.4	37	c.5699	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022662	0.54683	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65	6.07	6.07	0.98685	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.103125	0.64402	D	0.000004	T	0.38825	0.1055	M	0.80982	2.52	0.50171	D	0.99985	B;B;B;B;D;B;D;P;D	0.64830	0.037;0.037;0.037;0.037;0.983;0.03;0.994;0.53;0.975	B;B;B;B;P;B;P;B;P	0.62813	0.046;0.046;0.046;0.046;0.871;0.027;0.907;0.28;0.852	T	0.10177	-1.0641	10	0.87932	D	0	.	16.0651	0.80865	0.0:0.1332:0.8668:0.0	.	1493;1484;1493;1494;1490;1490;1887;1900;1900	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	E	1900;1900;1887;1878;1494;1493;1490;1490;1371;1900;1493;1493	ENSP00000370593:A1900E;ENSP00000348812:A1900E;ENSP00000353187:A1887E;ENSP00000351293:A1878E;ENSP00000347373:A1494E;ENSP00000380741:A1493E;ENSP00000380735:A1490E;ENSP00000440515:A1490E;ENSP00000438164:A1900E;ENSP00000417093:A1493E;ENSP00000380731:A1493E	ENSP00000340918:A1371E	A	-	2	0	PTPRD	8307914	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.643000	0.61390	2.885000	0.99019	0.655000	0.94253	GCA	PTPRD	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000153707		0.428	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	20	0	G			8317914	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	T
RAD54B	25788	genome.wustl.edu	37	8	95419670	95419670	+	Missense_Mutation	SNP	G	G	T	rs531560568		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:95419670G>T	ENST00000336148.5	-	5	902	c.778C>A	c.(778-780)Cca>Aca	p.P260T		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	260					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			ATCTTACTTGGCGTATATGGG	0.284								Direct reversal of damage;Homologous recombination																																									0													58.0	57.0	57.0					8																	95419670		2203	4300	6503	SO:0001583	missense	0			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.778C>A	8.37:g.95419670G>T	ENSP00000336606:p.Pro260Thr		F6WBS8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P260T	ENST00000336148.5	37	c.778	CCDS6262.1	8	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648071	0.47258	.	.	ENSG00000197275	ENST00000336148	D	0.93247	-3.19	5.75	4.88	0.63580	.	0.218156	0.47852	D	0.000209	D	0.90611	0.7056	M	0.72894	2.215	0.80722	D	1	P	0.42961	0.795	B	0.35727	0.209	D	0.89036	0.3445	10	0.40728	T	0.16	.	10.58	0.45250	0.0704:0.0:0.7897:0.1399	.	260	Q9Y620	RA54B_HUMAN	T	260	ENSP00000336606:P260T	ENSP00000336606:P260T	P	-	1	0	RAD54B	95488846	1.000000	0.71417	0.886000	0.34754	0.830000	0.47004	2.221000	0.42917	1.427000	0.47276	-0.145000	0.13849	CCA	RAD54B	-	superfamily_P-loop_NTPase	ENSG00000197275		0.284	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54B	HGNC	protein_coding	OTTHUMT00000257806.3	-	0.00	35	0	G	NM_012415		95419670	-1	tier1	-	no_errors	ENST00000336148	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
RALGAPA1	253959	genome.wustl.edu	37	14	36153162	36153162	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:36153162delT	ENST00000389698.3	-	20	3196	c.2806delA	c.(2806-2808)acgfs	p.T936fs	RALGAPA1_ENST00000382366.3_Frame_Shift_Del_p.T949fs|RALGAPA1_ENST00000307138.6_Frame_Shift_Del_p.T936fs|RALGAPA1_ENST00000258840.6_Frame_Shift_Del_p.T983fs	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	936					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCAGAGGACGTAACCCCAGTG	0.398																																																	0													43.0	53.0	50.0					14																	36153162		2203	4300	6503	SO:0001589	frameshift_variant	0			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.2806delA	14.37:g.36153162delT	ENSP00000374348:p.Thr936fs		A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Frame_Shift_Del	DEL	pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.T983fs	ENST00000389698.3	37	c.2947	CCDS32065.1	14																																																																																			RALGAPA1	-	NULL	ENSG00000174373		0.398	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	RALGAPA1	HGNC	protein_coding	OTTHUMT00000409829.1		0.00	28	0	T	XM_210022		36153162	-1	tier1		no_errors	ENST00000258840	ensembl	human	known	74_37	frame_shift_del	28.57	5	2	DEL	0.000	-
RAPGEF4	11069	genome.wustl.edu	37	2	173679105	173679105	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:173679105C>A	ENST00000397081.3	+	4	539	c.396C>A	c.(394-396)agC>agA	p.S132R	RAPGEF4_ENST00000264111.6_Missense_Mutation_p.S132R|RAPGEF4_ENST00000409036.1_Missense_Mutation_p.S132R	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	132					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			CCAGGGAGAGCAGTGAACTGC	0.517																																																	0													101.0	97.0	98.0					2																	173679105		1930	4149	6079	SO:0001583	missense	0			U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.396C>A	2.37:g.173679105C>A	ENSP00000380271:p.Ser132Arg		B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_cNMP-bd_dom,pfam_DEP_dom,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_DEP_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_DEP_dom,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_cAMP/cGMP_kin	p.S132R	ENST00000397081.3	37	c.396	CCDS42775.1	2	.	.	.	.	.	.	.	.	.	.	C	11.02	1.514828	0.27123	.	.	ENSG00000091428	ENST00000264111;ENST00000397081;ENST00000409036	D;D;D	0.92397	-3.03;-3.03;-3.03	5.93	5.04	0.67666	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.366690	0.36482	N	0.002574	D	0.82674	0.5088	N	0.11756	0.17	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.76353	-0.2990	10	0.25106	T	0.35	.	11.0153	0.47685	0.0:0.8098:0.0:0.1902	.	132;132;132	E7EVE5;Q8WZA2;E9PB94	.;RPGF4_HUMAN;.	R	132	ENSP00000264111:S132R;ENSP00000380271:S132R;ENSP00000387104:S132R	ENSP00000264111:S132R	S	+	3	2	RAPGEF4	173387351	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.804000	0.27098	2.805000	0.96524	0.655000	0.94253	AGC	RAPGEF4	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000091428		0.517	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	HGNC	protein_coding	OTTHUMT00000257864.2	-	0.00	37	0	C	NM_007023		173679105	+1	tier1	-	no_errors	ENST00000397081	ensembl	human	known	74_37	missense	25.00	15	5	SNP	1.000	A
RARS	5917	genome.wustl.edu	37	5	167915644	167915644	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:167915644G>T	ENST00000231572.3	+	2	137	c.83G>T	c.(82-84)cGg>cTg	p.R28L	RARS_ENST00000538719.1_5'UTR	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	28	Could be involved in the assembly of the multisynthetase complex.				arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		GAAATTGACCGGTTGAAAAAC	0.368																																																	0													64.0	69.0	67.0					5																	167915644		2203	4300	6503	SO:0001583	missense	0			BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.83G>T	5.37:g.167915644G>T	ENSP00000231572:p.Arg28Leu		B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	pfam_Arg-tRNA-synth_Ia_core,pfam_DALR_anticod-bd,pfam_Arg-tRNA-synth_N,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Arg-tRNA-synth_N,smart_DALR_anticod-bd,prints_Arg-tRNA-synth_Ia_core,tigrfam_Arg-tRNA-ligase_Ia	p.R28L	ENST00000231572.3	37	c.83	CCDS4367.1	5	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090710	0.36855	.	.	ENSG00000113643	ENST00000231572	T	0.60548	0.18	5.64	2.82	0.32997	.	0.311519	0.33895	N	0.004450	T	0.48295	0.1492	L	0.55103	1.725	0.48452	D	0.999654	B	0.06786	0.001	B	0.04013	0.001	T	0.31364	-0.9946	10	0.23302	T	0.38	-16.6409	9.9954	0.41896	0.2917:0.0:0.7083:0.0	.	28	P54136	SYRC_HUMAN	L	28	ENSP00000231572:R28L	ENSP00000231572:R28L	R	+	2	0	RARS	167848222	0.044000	0.20184	0.833000	0.33012	0.883000	0.51084	0.575000	0.23729	0.291000	0.22468	0.462000	0.41574	CGG	RARS	-	NULL	ENSG00000113643		0.368	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS	HGNC	protein_coding	OTTHUMT00000252794.2	-	0.00	89	0	G	NM_002887		167915644	+1	tier1	-	no_errors	ENST00000231572	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.565	T
RAVER2	55225	genome.wustl.edu	37	1	65268729	65268729	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:65268729G>T	ENST00000294428.3	+	6	1254	c.1176G>T	c.(1174-1176)ttG>ttT	p.L392F	RAVER2_ENST00000371072.4_Missense_Mutation_p.L392F|RAVER2_ENST00000430964.2_Missense_Mutation_p.L98F			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	392						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L392F(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						TTTTACATTTGAATAAAGCAC	0.323																																																	1	Substitution - Missense(1)	breast(1)											104.0	99.0	100.0					1																	65268729		1848	4103	5951	SO:0001583	missense	0			AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.1176G>T	1.37:g.65268729G>T	ENSP00000294428:p.Leu392Phe		Q6P141|Q9NPV7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L392F	ENST00000294428.3	37	c.1176		1	.	.	.	.	.	.	.	.	.	.	G	7.347	0.622122	0.14193	.	.	ENSG00000162437	ENST00000371072;ENST00000294428;ENST00000430964	T;T	0.47528	0.9;0.84	5.67	2.72	0.32119	.	0.279835	0.34200	N	0.004172	T	0.17109	0.0411	L	0.31752	0.955	0.38976	D	0.958851	B;B	0.24368	0.061;0.102	B;B	0.27380	0.036;0.079	T	0.03910	-1.0993	10	0.29301	T	0.29	-15.093	9.3352	0.38045	0.0746:0.2834:0.642:0.0	.	392;392	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	F	392;392;98	ENSP00000360112:L392F;ENSP00000294428:L392F	ENSP00000294428:L392F	L	+	3	2	RAVER2	65041317	1.000000	0.71417	0.804000	0.32291	0.003000	0.03518	3.148000	0.50647	0.303000	0.22785	-0.179000	0.13096	TTG	RAVER2	-	NULL	ENSG00000162437		0.323	RAVER2-201	KNOWN	basic	protein_coding	RAVER2	HGNC	protein_coding			0.00	55	0	G	NM_018211		65268729	+1			no_errors	ENST00000294428	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.994	T
RBM27	54439	genome.wustl.edu	37	5	145651199	145651199	+	Frame_Shift_Del	DEL	A	A	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:145651199delA	ENST00000265271.5	+	19	3116	c.2950delA	c.(2950-2952)attfs	p.I984fs	RBM27_ENST00000506502.1_Frame_Shift_Del_p.I929fs	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	984					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGAGGATTCATTGAGGAAGA	0.448																																																	0													134.0	129.0	131.0					5																	145651199		1568	3582	5150	SO:0001589	frameshift_variant	0			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.2950delA	5.37:g.145651199delA	ENSP00000265271:p.Ile984fs		Q8IYW9	Frame_Shift_Del	DEL	pfam_PWI_dom,pfam_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.I984fs	ENST00000265271.5	37	c.2950	CCDS43378.1	5																																																																																			RBM27	-	NULL	ENSG00000091009		0.448	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	HGNC	protein_coding	OTTHUMT00000373420.1		0.00	41	0	A	XM_291128		145651199	+1	tier1		no_errors	ENST00000265271	ensembl	human	known	74_37	frame_shift_del	13.33	13	2	DEL	0.297	-
RMND5A	64795	genome.wustl.edu	37	2	86980658	86980658	+	Silent	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:86980658C>T	ENST00000283632.4	+	4	993	c.498C>T	c.(496-498)gtC>gtT	p.V166V		NM_022780.3	NP_073617.1	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog A (S. cerevisiae)	166	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.							p.V166V(1)		kidney(1)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	17						CATTAAAGGTCAGAGTTCTGA	0.373																																																	1	Substitution - coding silent(1)	kidney(1)											129.0	128.0	128.0					2																	86980658		2203	4300	6503	SO:0001819	synonymous_variant	0			BC012165	CCDS1991.1	2p11.2	2012-07-20			ENSG00000153561	ENSG00000153561			25850	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog A"""					12477932	Standard	NM_022780		Approved	FLJ13910, RMD5, GID2, GID2A	uc002srs.4	Q9H871	OTTHUMG00000130262	ENST00000283632.4:c.498C>T	2.37:g.86980658C>T			D6W5M6|Q6NTF0|Q9H6W5|Q9H9H2	Silent	SNP	smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.V166	ENST00000283632.4	37	c.498	CCDS1991.1	2																																																																																			RMND5A	-	smart_CTLH_C,pfscan_CTLH_C	ENSG00000153561		0.373	RMND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND5A	HGNC	protein_coding	OTTHUMT00000252591.2	-	0.00	37	0	C	NM_022780		86980658	+1	tier1	-	no_errors	ENST00000283632	ensembl	human	known	74_37	silent	28.57	10	4	SNP	1.000	T
RGPD3	653489	genome.wustl.edu	37	2	107040824	107040824	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:107040824C>T	ENST00000409886.3	-	20	3686	c.3599G>A	c.(3598-3600)aGt>aAt	p.S1200N	RGPD3_ENST00000304514.7_Missense_Mutation_p.S1200N	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1200					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTTCAGTCCACTCTTCATTTC	0.438																																																	0													1.0	1.0	1.0					2																	107040824		78	386	464	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.3599G>A	2.37:g.107040824C>T	ENSP00000386588:p.Ser1200Asn		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.S1200N	ENST00000409886.3	37	c.3599	CCDS46379.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.13|12.13	1.844625|1.844625	0.32606|0.32606	.|.	.|.	ENSG00000153165|ENSG00000153165	ENST00000452099|ENST00000409886;ENST00000304514	.|T;T	.|0.49432	.|0.78;0.78	2.35|2.35	2.35|2.35	0.29111|0.29111	.|.	.|.	.|.	.|.	.|.	.|T	.|0.48642	.|0.1511	L|L	0.34521|0.34521	1.04|1.04	0.22745|0.22745	N|N	0.998787|0.998787	.|D	.|0.69078	.|0.997	.|P	.|0.60173	.|0.87	.|T	.|0.23368	.|-1.0190	.|9	.|0.41790	.|T	.|0.15	.|-25.7003	7.081|7.081	0.25231|0.25231	0.0:0.7152:0.2848:0.0|0.0:0.7152:0.2848:0.0	.|.	.|1200	.|A6NKT7	.|RGPD3_HUMAN	.|N	-1|1200	.|ENSP00000386588:S1200N;ENSP00000303659:S1200N	.|ENSP00000303659:S1200N	.|S	-|-	.|2	.|0	RGPD3|RGPD3	106407256|106407256	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.761000|0.761000	0.43186|0.43186	1.826000|1.826000	0.39092|0.39092	1.314000|1.314000	0.45095|0.45095	0.186000|0.186000	0.17326|0.17326	.|AGT	RGPD3	-	NULL	ENSG00000153165		0.438	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	-	0.00	63	0	C	XM_929931		107040824	-1	tier1	-	no_errors	ENST00000304514	ensembl	human	known	74_37	missense	54.69	29	35	SNP	1.000	T
RBM45	129831	genome.wustl.edu	37	2	178981028	178981028	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:178981028G>T	ENST00000286070.5	+	2	432	c.340G>T	c.(340-342)Gat>Tat	p.D114Y		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	114					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.D114Y(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			AAGTCACCGAGATGTTGAAGA	0.333																																																	1	Substitution - Missense(1)	endometrium(1)											136.0	138.0	137.0					2																	178981028		2203	4300	6503	SO:0001583	missense	0			AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.340G>T	2.37:g.178981028G>T	ENSP00000286070:p.Asp114Tyr		Q6NYL0|Q8NFC9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D114Y	ENST00000286070.5	37	c.340	CCDS33335.1	2	.	.	.	.	.	.	.	.	.	.	G	29.5	5.015566	0.93404	.	.	ENSG00000155636	ENST00000286070	D	0.85702	-2.02	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.91270	0.7248	M	0.64404	1.975	0.80722	D	1	D	0.76494	0.999	D	0.66497	0.944	D	0.91345	0.5100	10	0.87932	D	0	-25.2722	19.3813	0.94536	0.0:0.0:1.0:0.0	.	114	Q8IUH3-3	.	Y	114	ENSP00000286070:D114Y	ENSP00000286070:D114Y	D	+	1	0	RBM45	178689274	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.785000	0.85724	2.824000	0.97209	0.655000	0.94253	GAT	RBM45	-	NULL	ENSG00000155636		0.333	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM45	HGNC	protein_coding	OTTHUMT00000334375.2		0.00	37	0	G	NM_152945		178981028	+1			no_errors	ENST00000286070	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
RPAP1	26015	genome.wustl.edu	37	15	41827072	41827072	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:41827072G>T	ENST00000304330.4	-	6	719	c.603C>A	c.(601-603)agC>agA	p.S201R	RPAP1_ENST00000561603.1_Missense_Mutation_p.S201R|RPAP1_ENST00000568413.1_5'Flank	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	201						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GAAAGCTGTGGCTGCTCCCAG	0.547																																																	0													85.0	77.0	80.0					15																	41827072		2203	4300	6503	SO:0001583	missense	0			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.603C>A	15.37:g.41827072G>T	ENSP00000306123:p.Ser201Arg		Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	pfam_RNA_pol_II_AP1_C,pfam_RNA_pol_II_AP1_N,superfamily_ARM-type_fold	p.S201R	ENST00000304330.4	37	c.603	CCDS10079.1	15	.	.	.	.	.	.	.	.	.	.	G	11.58	1.682066	0.29872	.	.	ENSG00000103932	ENST00000304330	T	0.13196	2.61	5.22	3.17	0.36434	.	0.404999	0.28021	N	0.016917	T	0.10895	0.0266	L	0.54323	1.7	0.09310	N	1	P	0.42409	0.779	B	0.36030	0.216	T	0.28618	-1.0038	10	0.87932	D	0	-12.9108	3.8749	0.09051	0.0902:0.1587:0.5875:0.1635	.	201	Q9BWH6	RPAP1_HUMAN	R	201	ENSP00000306123:S201R	ENSP00000306123:S201R	S	-	3	2	RPAP1	39614364	0.845000	0.29573	0.177000	0.23020	0.115000	0.19883	2.687000	0.46976	1.168000	0.42723	0.491000	0.48974	AGC	RPAP1	-	NULL	ENSG00000103932		0.547	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP1	HGNC	protein_coding	OTTHUMT00000252694.2	-	0.00	47	0	G	NM_015540		41827072	-1	tier1	-	no_errors	ENST00000304330	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.001	T
RPL7L1	285855	genome.wustl.edu	37	6	42852469	42852469	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:42852469G>T	ENST00000493763.1	+	4	706	c.403G>T	c.(403-405)Gaa>Taa	p.E135*	RPL7L1_ENST00000424341.2_Nonsense_Mutation_p.E135*|RPL7L1_ENST00000602561.1_Nonsense_Mutation_p.E135*|RPL7L1_ENST00000304734.5_Nonsense_Mutation_p.E135*|RPL7L1_ENST00000397415.3_3'UTR	NM_198486.2	NP_940888.2	Q6DKI1	RL7L_HUMAN	ribosomal protein L7-like 1	135						ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)	6	Colorectal(47;0.196)		Colorectal(64;0.00237)|all cancers(41;0.00288)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.088)			GCGTATAGTGGAACCTTATGT	0.433																																																	0													54.0	58.0	57.0					6																	42852469		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4873.1	6p21.1	2011-01-14			ENSG00000146223	ENSG00000146223		"""L ribosomal proteins"""	21370	protein-coding gene	gene with protein product							Standard	NM_198486		Approved	dJ475N16.4	uc003osq.1	Q6DKI1	OTTHUMG00000014710	ENST00000493763.1:c.403G>T	6.37:g.42852469G>T	ENSP00000418221:p.Glu135*		A8K7D4|B7Z652|Q5TFZ5|Q6PEK3	Nonsense_Mutation	SNP	pfam_Ribosomal_L30_ferredoxin-like,pfam_Ribosomal_L30_N,superfamily_Ribosomal_L30_ferredoxin-like,tigrfam_Ribosomal_L7_euk	p.E135*	ENST00000493763.1	37	c.403	CCDS4873.1	6	.	.	.	.	.	.	.	.	.	.	G	38	6.751860	0.97813	.	.	ENSG00000146223	ENST00000493763;ENST00000304734;ENST00000424341	.	.	.	5.01	5.01	0.66863	.	0.052139	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.1811	0.81903	0.0:0.0:1.0:0.0	.	.	.	.	X	135	.	ENSP00000346063:E135X	E	+	1	0	RPL7L1	42960447	1.000000	0.71417	0.996000	0.52242	0.743000	0.42351	9.325000	0.96381	2.474000	0.83562	0.591000	0.81541	GAA	RPL7L1	-	pfam_Ribosomal_L30_ferredoxin-like,superfamily_Ribosomal_L30_ferredoxin-like,tigrfam_Ribosomal_L7_euk	ENSG00000146223		0.433	RPL7L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL7L1	HGNC	protein_coding	OTTHUMT00000314417.1	-	0.00	94	0	G	XM_209769		42852469	+1	tier1	-	no_errors	ENST00000304734	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	1.000	T
RTN1	6252	genome.wustl.edu	37	14	60212584	60212584	+	Missense_Mutation	SNP	G	G	T	rs377312291		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:60212584G>T	ENST00000267484.5	-	2	1192	c.857C>A	c.(856-858)aCg>aAg	p.T286K		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	286					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TTCTATTTCCGTCAGTGTGAT	0.458																																																	0								G	LYS/THR	0,4406		0,0,2203	113.0	106.0	109.0		857	5.5	1.0	14		109	1,8599	1.2+/-3.3	0,1,4299	no	missense	RTN1	NM_021136.2	78	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	286/777	60212584	1,13005	2203	4300	6503	SO:0001583	missense	0			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.857C>A	14.37:g.60212584G>T	ENSP00000267484:p.Thr286Lys		Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.T286K	ENST00000267484.5	37	c.857	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	G	21.2	4.106839	0.77096	0.0	1.16E-4	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.38722	1.12	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.66944	0.2841	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67608	-0.5627	10	0.52906	T	0.07	.	19.4571	0.94897	0.0:0.0:1.0:0.0	.	286	Q16799	RTN1_HUMAN	K	286;212	ENSP00000267484:T286K	ENSP00000267484:T286K	T	-	2	0	RTN1	59282337	1.000000	0.71417	0.956000	0.39512	0.775000	0.43874	5.413000	0.66399	2.588000	0.87417	0.557000	0.71058	ACG	RTN1	-	NULL	ENSG00000139970		0.458	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2		0.00	30	0	G			60212584	-1			no_errors	ENST00000267484	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.998	T
RTN4	57142	genome.wustl.edu	37	2	55200965	55200965	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:55200965G>A	ENST00000337526.6	-	7	3712	c.3469C>T	c.(3469-3471)Cgg>Tgg	p.R1157W	RTN4_ENST00000402434.2_Missense_Mutation_p.R310W|RTN4_ENST00000394609.2_Missense_Mutation_p.R164W|RTN4_ENST00000394611.2_Missense_Mutation_p.R951W|RTN4_ENST00000354474.6_Missense_Mutation_p.R925W|RTN4_ENST00000486085.1_Intron|RTN4_ENST00000405240.1_Missense_Mutation_p.R951W|RTN4_ENST00000317610.7_Missense_Mutation_p.R338W|RTN4_ENST00000357376.3_Missense_Mutation_p.R951W|RTN4_ENST00000357732.4_Missense_Mutation_p.R357W|RTN4_ENST00000404909.1_Missense_Mutation_p.R951W	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	1157	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						ACCTGATGCCGTTCATAAATA	0.368																																																	0													82.0	86.0	85.0					2																	55200965		2203	4300	6503	SO:0001583	missense	0			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.3469C>T	2.37:g.55200965G>A	ENSP00000337838:p.Arg1157Trp		O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.R1157W	ENST00000337526.6	37	c.3469	CCDS42684.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.654487|4.654487	0.88056|0.88056	.|.	.|.	ENSG00000115310|ENSG00000115310	ENST00000394609;ENST00000405240;ENST00000357376;ENST00000337526;ENST00000317610;ENST00000357732;ENST00000394611;ENST00000404909;ENST00000402434;ENST00000354474|ENST00000438462	T;T;T;T;T;T;T;T;T;T|.	0.46819|.	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86|.	5.96|5.96	5.01|5.01	0.66863|0.66863	.|.	0.046199|.	0.85682|.	D|.	0.000000|.	T|T	0.52240|0.52240	0.1722|0.1722	L|L	0.28458|0.28458	0.855|0.855	0.49389|0.49389	D|D	0.99978|0.99978	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.998|.	D;D;D;D|.	0.97110|.	0.993;0.988;1.0;0.968|.	T|T	0.41680|0.41680	-0.9495|-0.9495	10|5	0.87932|.	D|.	0|.	-6.4701|-6.4701	11.7147|11.7147	0.51645|0.51645	0.0:0.0:0.6232:0.3768|0.0:0.0:0.6232:0.3768	.|.	338;357;1157;164|.	Q7L7Q6;Q9NQC3-5;Q9NQC3;Q7L7Q5|.	.;.;RTN4_HUMAN;.|.	W|M	164;951;951;1157;338;357;951;951;310;925|180	ENSP00000378107:R164W;ENSP00000384471:R951W;ENSP00000349944:R951W;ENSP00000337838:R1157W;ENSP00000322147:R338W;ENSP00000350365:R357W;ENSP00000378109:R951W;ENSP00000385650:R951W;ENSP00000384825:R310W;ENSP00000346465:R925W|.	ENSP00000322147:R338W|.	R|T	-|-	1|2	2|0	RTN4|RTN4	55054469|55054469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.626000|5.626000	0.67777|0.67777	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	CGG|ACG	RTN4	-	pfam_Reticulon,pfscan_Reticulon	ENSG00000115310		0.368	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1		0.00	42	0	G			55200965	-1			no_errors	ENST00000337526	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	A
RWDD2A	112611	genome.wustl.edu	37	6	83904241	83904241	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:83904241C>A	ENST00000369724.4	+	2	276	c.71C>A	c.(70-72)cCt>cAt	p.P24H	RWDD2A_ENST00000539997.1_Intron|PGM3_ENST00000506587.1_5'Flank|PGM3_ENST00000513973.1_5'Flank|PGM3_ENST00000512866.1_5'Flank|PGM3_ENST00000283977.4_5'Flank	NM_033411.3	NP_219479.2	Q9UIY3	RWD2A_HUMAN	RWD domain containing 2A	24	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.									cervix(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	5		all_cancers(76;2.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00217)		BRCA - Breast invasive adenocarcinoma(397;0.045)		TCTATGTTTCCTAACCAAGGA	0.448																																																	0													100.0	93.0	95.0					6																	83904241		2203	4300	6503	SO:0001583	missense	0			BC010930	CCDS4998.1	6q15	2012-12-07	2007-07-17	2007-07-17	ENSG00000013392	ENSG00000013392			21385	protein-coding gene	gene with protein product			"""RWD domain containing 2"""	RWDD2			Standard	NM_033411		Approved	MGC13523, dJ747H23.2	uc003pjx.4	Q9UIY3	OTTHUMG00000015109	ENST00000369724.4:c.71C>A	6.37:g.83904241C>A	ENSP00000358739:p.Pro24His		B4DIQ3|E1P548|Q2M3R3|Q96FH1	Missense_Mutation	SNP	pfam_DUF1115,pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pirsf_UCP038021_RWD,pfscan_RWD-domain	p.P24H	ENST00000369724.4	37	c.71	CCDS4998.1	6	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588219	0.86851	.	.	ENSG00000013392	ENST00000369724	T	0.26660	1.72	5.03	5.03	0.67393	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.000000	0.64402	D	0.000002	T	0.47911	0.1471	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52616	-0.8552	10	0.87932	D	0	-16.1458	18.5631	0.91108	0.0:1.0:0.0:0.0	.	24	Q9UIY3	RWD2A_HUMAN	H	24	ENSP00000358739:P24H	ENSP00000358739:P24H	P	+	2	0	RWDD2A	83960960	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.315000	0.72853	2.596000	0.87737	0.655000	0.94253	CCT	RWDD2A	-	pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pirsf_UCP038021_RWD,pfscan_RWD-domain	ENSG00000013392		0.448	RWDD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RWDD2A	HGNC	protein_coding	OTTHUMT00000041348.2	-	0.00	76	0	C	NM_033411		83904241	+1	tier1	-	no_errors	ENST00000369724	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
RXFP3	51289	genome.wustl.edu	37	5	33937128	33937128	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:33937128G>T	ENST00000330120.3	+	1	638	c.283G>T	c.(283-285)Ggg>Tgg	p.G95W		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	95					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						GTGCGCCCTGGGGTTGGCGGG	0.652																																																	0													75.0	75.0	75.0					5																	33937128		2203	4300	6503	SO:0001583	missense	0			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.283G>T	5.37:g.33937128G>T	ENSP00000328708:p.Gly95Trp		Q14DA5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt	p.G95W	ENST00000330120.3	37	c.283	CCDS3900.1	5	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487592	0.84854	.	.	ENSG00000182631	ENST00000330120	T	0.53857	0.6	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.64649	0.2617	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67550	-0.5642	10	0.87932	D	0	-30.3042	19.5993	0.95554	0.0:0.0:1.0:0.0	.	95	Q9NSD7	RL3R1_HUMAN	W	95	ENSP00000328708:G95W	ENSP00000328708:G95W	G	+	1	0	RXFP3	33972885	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.911000	0.87458	2.704000	0.92352	0.655000	0.94253	GGG	RXFP3	-	prints_GPCR_Rhodpsn	ENSG00000182631		0.652	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP3	HGNC	protein_coding	OTTHUMT00000207369.1	-	0.00	59	0	G	NM_016568		33937128	+1	tier1	-	no_errors	ENST00000330120	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237758806	237758806	+	Missense_Mutation	SNP	G	G	A	rs373024059		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:237758806G>A	ENST00000366574.2	+	34	4762	c.4445G>A	c.(4444-4446)cGc>cAc	p.R1482H	RYR2_ENST00000360064.6_Missense_Mutation_p.R1480H|RYR2_ENST00000542537.1_Missense_Mutation_p.R1466H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1482	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R1480P(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGCATCAAACGCAGCAACTGC	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		20895	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)						G	HIS/ARG	0,4036		0,0,2018	79.0	81.0	80.0		4445	5.0	1.0	1		80	2,8344		0,2,4171	no	missense	RYR2	NM_001035.2	29	0,2,6189	AA,AG,GG		0.024,0.0,0.0162	benign	1482/4968	237758806	2,12380	2018	4173	6191	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4445G>A	1.37:g.237758806G>A	ENSP00000355533:p.Arg1482His		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R1480H	ENST00000366574.2	37	c.4439	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781147	0.49891	0.0	2.4E-4	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.61627	0.09;0.09;0.09	5.0	5.0	0.66597	SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.267390	0.30446	N	0.009610	T	0.58666	0.2138	M	0.66378	2.025	0.80722	D	1	B	0.18863	0.031	B	0.12156	0.007	T	0.56902	-0.7902	10	0.41790	T	0.15	.	18.4746	0.90788	0.0:0.0:1.0:0.0	.	1482	Q92736	RYR2_HUMAN	H	1482;1480;1466	ENSP00000355533:R1482H;ENSP00000353174:R1480H;ENSP00000443798:R1466H	ENSP00000353174:R1480H	R	+	2	0	RYR2	235825429	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.560000	0.73950	2.598000	0.87819	0.655000	0.94253	CGC	RYR2	-	pfam_SPRY_rcpt,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000198626		0.443	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2		0.00	29	0	G	NM_001035		237758806	+1			no_errors	ENST00000360064	ensembl	human	known	74_37	missense	20.00	8	2	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237936939	237936939	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:237936939G>T	ENST00000366574.2	+	87	12083	c.11766G>T	c.(11764-11766)gaG>gaT	p.E3922D	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.E3928D|RYR2_ENST00000542537.1_Missense_Mutation_p.E3906D	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3922					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTCTTACAGAGTATATTCAGG	0.363																																																	0													82.0	79.0	80.0					1																	237936939		1845	4090	5935	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11766G>T	1.37:g.237936939G>T	ENSP00000355533:p.Glu3922Asp		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.E3928D	ENST00000366574.2	37	c.11784	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611083	0.66558	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97642	-4.47;-4.47;-4.47	5.04	1.57	0.23409	RyR/IP3R Homology associated domain (1);	0.000000	0.64402	U	0.000011	D	0.98451	0.9484	H	0.94734	3.575	0.80722	D	1	D;P	0.71674	0.998;0.937	D;P	0.83275	0.996;0.615	D	0.97655	1.0157	10	0.87932	D	0	-16.5542	7.5386	0.27725	0.4853:0.0:0.5147:0.0	.	896;3922	B4DGV4;Q92736	.;RYR2_HUMAN	D	3922;3928;3906;896	ENSP00000355533:E3922D;ENSP00000353174:E3928D;ENSP00000443798:E3906D	ENSP00000353174:E3928D	E	+	3	2	RYR2	236003562	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	0.553000	0.23391	0.620000	0.30215	0.579000	0.79373	GAG	RYR2	-	pfam_RIH_assoc-dom	ENSG00000198626		0.363	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	45	0	G	NM_001035		237936939	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.999	T
SARDH	1757	genome.wustl.edu	37	9	136559399	136559399	+	Silent	SNP	C	C	A	rs377363025		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:136559399C>A	ENST00000371872.4	-	15	2159	c.1902G>T	c.(1900-1902)ccG>ccT	p.P634P	SARDH_ENST00000439388.1_Silent_p.P634P|SARDH_ENST00000422262.2_Silent_p.P466P|SARDH_ENST00000371868.1_Silent_p.P62P	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	634					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CGGGGGCCAGCGGGGAGGCCT	0.662																																																	0													21.0	19.0	20.0					9																	136559399		1993	3841	5834	SO:0001819	synonymous_variant	0				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1902G>T	9.37:g.136559399C>A			B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.P634	ENST00000371872.4	37	c.1902	CCDS6978.1	9																																																																																			SARDH	-	pfam_GCV_T_N	ENSG00000123453		0.662	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	HGNC	protein_coding	OTTHUMT00000054931.1	-	0.00	155	0	C			136559399	-1	tier1	-	no_errors	ENST00000371872	ensembl	human	known	74_37	silent	50.55	41	46	SNP	0.284	A
SCN3A	6328	genome.wustl.edu	37	2	165986560	165986560	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:165986560G>A	ENST00000360093.3	-	17	3303	c.2812C>T	c.(2812-2814)Cgc>Tgc	p.R938C	SCN3A_ENST00000409101.3_Missense_Mutation_p.R889C|SCN3A_ENST00000283254.7_Missense_Mutation_p.R938C	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	938					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R938C(1)|p.R889C(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CACAGCACGCGGAACACAATC	0.493																																																	2	Substitution - Missense(2)	endometrium(2)											167.0	160.0	163.0					2																	165986560		2203	4297	6500	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2812C>T	2.37:g.165986560G>A	ENSP00000353206:p.Arg938Cys		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.R938C	ENST00000360093.3	37	c.2812		2	.	.	.	.	.	.	.	.	.	.	G	34	5.297909	0.95574	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.98901	-5.22;-5.22;-5.22;-5.22	5.63	5.63	0.86233	Ion transport (1);	0.000000	0.64402	D	0.000013	D	0.99588	0.9851	H	0.98802	4.335	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;0.996;0.996;1.0	D	0.97675	1.0169	10	0.87932	D	0	.	19.6755	0.95930	0.0:0.0:1.0:0.0	.	938;889;889;889;938	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	C	938;938;889;889	ENSP00000353206:R938C;ENSP00000283254:R938C;ENSP00000386726:R889C;ENSP00000403348:R889C	ENSP00000283254:R938C	R	-	1	0	SCN3A	165694806	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.813000	0.99286	2.652000	0.90054	0.563000	0.77884	CGC	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.493	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	83	0	G	NM_006922		165986560	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	41.46	24	17	SNP	1.000	A
SCN3A	6328	genome.wustl.edu	37	2	166018865	166018865	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:166018865C>G	ENST00000360093.3	-	9	1475	c.984G>C	c.(982-984)ttG>ttC	p.L328F	SCN3A_ENST00000409101.3_Missense_Mutation_p.L328F|SCN3A_ENST00000283254.7_Missense_Mutation_p.L328F	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	328					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTGCCCATCCAAAACATAAA	0.284																																																	0													84.0	102.0	96.0					2																	166018865		2200	4298	6498	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.984G>C	2.37:g.166018865C>G	ENSP00000353206:p.Leu328Phe		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.L328F	ENST00000360093.3	37	c.984		2	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235448	0.39498	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.96685	-4.09;-4.09;-4.05;-3.93	5.52	4.64	0.57946	Ion transport (1);	0.144445	0.31989	N	0.006750	D	0.97939	0.9322	M	0.88310	2.945	0.80722	D	1	P;B;B;B;P	0.52577	0.954;0.001;0.001;0.001;0.944	P;B;B;B;P	0.60012	0.867;0.015;0.006;0.006;0.79	D	0.98210	1.0472	10	0.59425	D	0.04	.	14.0737	0.64877	0.0:0.9277:0.0:0.0723	.	328;328;328;328;328	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	F	328	ENSP00000353206:L328F;ENSP00000283254:L328F;ENSP00000386726:L328F;ENSP00000403348:L328F	ENSP00000283254:L328F	L	-	3	2	SCN3A	165727111	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.616000	0.46376	1.302000	0.44855	0.650000	0.86243	TTG	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.284	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	46	0	C	NM_006922		166018865	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	37.50	20	12	SNP	1.000	G
SCN9A	6335	genome.wustl.edu	37	2	167083216	167083216	+	Splice_Site	SNP	T	T	C			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:167083216T>C	ENST00000409435.1	-	23	4260		c.e23-2		SCN9A_ENST00000303354.6_Splice_Site|SCN9A_ENST00000409672.1_Splice_Site|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000375387.4_Splice_Site			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit						behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.?(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTGTCTACCTATAAAATTTA	0.313																																																	1	Unknown(1)	breast(1)											49.0	46.0	47.0					2																	167083216		1938	4167	6105	SO:0001630	splice_region_variant	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4261-2A>G	2.37:g.167083216T>C			A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Splice_Site	SNP	-	e23-2	ENST00000409435.1	37	c.4264-2	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	T	26.6	4.750425	0.89753	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5302	0.75952	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCN9A	166791462	1.000000	0.71417	0.969000	0.41365	0.610000	0.37248	7.939000	0.87685	2.069000	0.61940	0.482000	0.46254	.	SCN9A	-	-	ENSG00000169432		0.313	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1		0.00	44	0	T	NM_002977	Intron	167083216	-1			no_errors	ENST00000303354	ensembl	human	known	74_37	splice_site	5.71	33	2	SNP	1.000	C
SDK1	221935	genome.wustl.edu	37	7	3990596	3990596	+	Missense_Mutation	SNP	G	G	T	rs367915297		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:3990596G>T	ENST00000404826.2	+	6	1028	c.889G>T	c.(889-891)Gtt>Ttt	p.V297F	SDK1_ENST00000389531.3_Missense_Mutation_p.V297F	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	297	Ig-like C2-type 3.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AACCATTGTGGTTCCCCCGGG	0.557																																																	0													105.0	80.0	89.0					7																	3990596		2203	4300	6503	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.889G>T	7.37:g.3990596G>T	ENSP00000385899:p.Val297Phe		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V297F	ENST00000404826.2	37	c.889	CCDS34590.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.05|14.05	2.419649|2.419649	0.42918|0.42918	.|.	.|.	ENSG00000146555|ENSG00000146555	ENST00000404826;ENST00000389531|ENST00000426596	T;T|.	0.03524|.	3.9;3.9|.	5.61|5.61	0.167|0.167	0.15006|0.15006	Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.256457|.	0.29676|.	N|.	0.011493|.	T|T	0.45895|0.45895	0.1365|0.1365	L|L	0.55017|0.55017	1.72|1.72	0.29079|0.29079	N|N	0.88281|0.88281	P|.	0.44877|.	0.845|.	P|.	0.47346|.	0.544|.	T|T	0.44390|0.44390	-0.9331|-0.9331	10|5	0.72032|.	D|.	0.01|.	.|.	8.3659|8.3659	0.32387|0.32387	0.4882:0.0:0.5118:0.0|0.4882:0.0:0.5118:0.0	.|.	297|.	Q7Z5N4|.	SDK1_HUMAN|.	F|C	297|15	ENSP00000385899:V297F;ENSP00000374182:V297F|.	ENSP00000374182:V297F|.	V|W	+|+	1|3	0|0	SDK1|SDK1	3957122|3957122	0.229000|0.229000	0.23729|0.23729	0.163000|0.163000	0.22734|0.22734	0.714000|0.714000	0.41099|0.41099	0.048000|0.048000	0.14078|0.14078	-0.186000|-0.186000	0.10533|0.10533	0.655000|0.655000	0.94253|0.94253	GTT|TGG	SDK1	-	pfscan_Ig-like_dom	ENSG00000146555		0.557	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1		0.00	91	0	G	NM_152744		3990596	+1			no_errors	ENST00000404826	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.881	T
SEMA4D	10507	genome.wustl.edu	37	9	91993636	91993636	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:91993636C>T	ENST00000450295.1	-	16	3348	c.2572G>A	c.(2572-2574)Gac>Aac	p.D858N	SEMA4D_ENST00000356444.2_Missense_Mutation_p.D858N|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000343780.4_Intron|SEMA4D_ENST00000422704.2_Missense_Mutation_p.D858N|SEMA4D_ENST00000438547.2_Missense_Mutation_p.D858N|SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000455551.2_Intron			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	858					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						CCATCTGCGTCTGAGTCAGCG	0.582																																																	0													91.0	70.0	77.0					9																	91993636		2203	4300	6503	SO:0001583	missense	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.2572G>A	9.37:g.91993636C>T	ENSP00000416523:p.Asp858Asn		B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,pfam_Immunoglobulin,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.D858N	ENST00000450295.1	37	c.2572	CCDS6685.1	9	.	.	.	.	.	.	.	.	.	.	C	19.92	3.915717	0.73098	.	.	ENSG00000187764	ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	4.88	4.88	0.63580	.	0.288297	0.27572	N	0.018773	T	0.48150	0.1484	L	0.36672	1.1	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.48790	-0.9004	10	0.87932	D	0	.	18.601	0.91247	0.0:1.0:0.0:0.0	.	858	Q92854	SEM4D_HUMAN	N	858	ENSP00000416523:D858N;ENSP00000405102:D858N;ENSP00000348822:D858N;ENSP00000388768:D858N	ENSP00000348822:D858N	D	-	1	0	SEMA4D	91183456	1.000000	0.71417	0.842000	0.33263	0.009000	0.06853	6.976000	0.76135	2.707000	0.92482	0.561000	0.74099	GAC	SEMA4D	-	NULL	ENSG00000187764		0.582	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000342411.1	-	0.00	59	0	C	NM_006378		91993636	-1	tier1	-	no_errors	ENST00000356444	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.997	T
SERPINA3	12	genome.wustl.edu	37	14	95090124	95090124	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:95090124C>A	ENST00000467132.1	+	5	2393	c.1245C>A	c.(1243-1245)agC>agA	p.S415R	SERPINA3_ENST00000482740.1_Missense_Mutation_p.S197R|SERPINA3_ENST00000393080.4_Missense_Mutation_p.S415R|RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393078.3_Missense_Mutation_p.S415R			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	415					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S415R(1)		NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		TCTTCATGAGCAAAGTCACCA	0.507																																																	1	Substitution - Missense(1)	ovary(1)											166.0	146.0	153.0					14																	95090124		2203	4300	6503	SO:0001583	missense	0			K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.1245C>A	14.37:g.95090124C>A	ENSP00000450540:p.Ser415Arg		B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S415R	ENST00000467132.1	37	c.1245	CCDS32150.1	14	.	.	.	.	.	.	.	.	.	.	C	14.52	2.558727	0.45590	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000467132;ENST00000482740	D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27	4.99	3.04	0.35103	Serpin domain (3);	0.652042	0.14557	N	0.312326	T	0.79986	0.4541	L	0.31926	0.97	0.28089	N	0.931888	B;P	0.50710	0.358;0.938	B;B	0.42282	0.378;0.382	T	0.74702	-0.3576	10	0.62326	D	0.03	.	9.1458	0.36933	0.2206:0.6465:0.1329:0.0	.	415;440	P01011;G3V5I3	AACT_HUMAN;.	R	440;415;415;415;197	ENSP00000452367:S440R;ENSP00000376793:S415R;ENSP00000376795:S415R;ENSP00000450540:S415R;ENSP00000451119:S197R	ENSP00000376793:S415R	S	+	3	2	SERPINA3	94159877	0.086000	0.21541	0.027000	0.17364	0.008000	0.06430	-0.584000	0.05800	2.460000	0.83146	0.563000	0.77884	AGC	SERPINA3	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000196136		0.507	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA3	HGNC	protein_coding	OTTHUMT00000268080.3		0.00	47	0	C	NM_001085		95090124	+1			no_errors	ENST00000393078	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.997	A
SF3A1	10291	genome.wustl.edu	37	22	30736220	30736220	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr22:30736220C>T	ENST00000215793.8	-	9	1494	c.1340G>A	c.(1339-1341)cGt>cAt	p.R447H	SF3A1_ENST00000439242.1_Missense_Mutation_p.R382H	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	447					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						CTGCTTCTCACGGATGGAGCG	0.562																																																	0													48.0	47.0	47.0					22																	30736220		2203	4300	6503	SO:0001583	missense	0			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.1340G>A	22.37:g.30736220C>T	ENSP00000215793:p.Arg447His		E9PAW1	Missense_Mutation	SNP	pfam_PRP21-like,pfam_Surp,pfam_Ubiquitin_dom,superfamily_Surp,smart_Surp,smart_Ubiquitin_dom,pfscan_Surp,pfscan_Ubiquitin_supergroup	p.R447H	ENST00000215793.8	37	c.1340	CCDS13875.1	22	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584671	0.86748	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049;ENST00000444440	T;T	0.31510	1.49;1.49	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.52933	0.1765	L	0.52364	1.645	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.33548	-0.9864	10	0.42905	T	0.14	-6.2693	20.6439	0.99570	0.0:1.0:0.0:0.0	.	447	Q15459	SF3A1_HUMAN	H	382;447;344;143	ENSP00000390336:R382H;ENSP00000215793:R447H	ENSP00000215793:R447H	R	-	2	0	SF3A1	29066220	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	7.684000	0.84104	2.884000	0.98904	0.655000	0.94253	CGT	SF3A1	-	pfam_PRP21-like	ENSG00000099995		0.562	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3A1	HGNC	protein_coding	OTTHUMT00000320916.2	-	0.00	40	0	C	NM_005877		30736220	-1	tier1	-	no_errors	ENST00000215793	ensembl	human	known	74_37	missense	57.14	12	16	SNP	1.000	T
SIK3	23387	genome.wustl.edu	37	11	116730026	116730026	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:116730026C>T	ENST00000292055.4	-	19	2437	c.2402G>A	c.(2401-2403)cGt>cAt	p.R801H	SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000375288.1_Missense_Mutation_p.R196H|SIK3_ENST00000542607.1_Missense_Mutation_p.R801H|SIK3_ENST00000446921.2_Missense_Mutation_p.R859H|SIK3_ENST00000434315.2_Missense_Mutation_p.R700H|SIK3_ENST00000375300.1_Missense_Mutation_p.R859H	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	801	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GGACAAGGGACGGTGCCCATA	0.607																																																	0													108.0	79.0	88.0					11																	116730026		2201	4296	6497	SO:0001583	missense	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2402G>A	11.37:g.116730026C>T	ENSP00000292055:p.Arg801His		A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.R859H	ENST00000292055.4	37	c.2576	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.243575	0.95272	.	.	ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000375288;ENST00000542607;ENST00000434315	T;D;T;T;T	0.81499	-1.49;-1.5;0.56;-1.29;-0.96	5.43	5.43	0.79202	.	0.000000	0.37577	U	0.002022	D	0.85792	0.5779	L	0.34521	1.04	0.33927	D	0.641558	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.998;0.999	D	0.89613	0.3843	10	0.87932	D	0	.	19.2354	0.93856	0.0:1.0:0.0:0.0	.	801;801;700;801;196	Q9Y2K2-3;A1A5A8;A1A5A9;Q9Y2K2;Q9Y2K2-2	.;.;.;SIK3_HUMAN;.	H	859;801;196;801;700	ENSP00000364449:R859H;ENSP00000292055:R801H;ENSP00000364437:R196H;ENSP00000438108:R801H;ENSP00000415873:R700H	ENSP00000292055:R801H	R	-	2	0	SIK3	116235236	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	6.786000	0.75094	2.527000	0.85204	0.561000	0.74099	CGT	SIK3	-	NULL	ENSG00000160584		0.607	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding			0.00	9	0	C	NM_025164		116730026	-1			no_errors	ENST00000375300	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	T
SLC19A1	6573	genome.wustl.edu	37	21	46951916	46951918	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr21:46951916_46951918delCAG	ENST00000311124.4	-	3	486_488	c.334_336delCTG	c.(334-336)ctgdel	p.L112del	SLC19A1_ENST00000567670.1_In_Frame_Del_p.L112del|SLC19A1_ENST00000380010.4_In_Frame_Del_p.L112del|SLC19A1_ENST00000485649.2_In_Frame_Del_p.L72del	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	112					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	CCGAGTGGCCCAGCAGCAGCAGC	0.645																																																	0									,,	149,4097		7,135,1981					,,	4.9	0.2			27	310,7916		6,298,3809	no	coding,coding,coding	SLC19A1	NM_194255.2,NM_001205207.1,NM_001205206.1	,,	13,433,5790	A1A1,A1R,RR		3.7685,3.5092,3.6802	,,	,,		459,12013				SO:0001651	inframe_deletion	0			U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.334_336delCTG	21.37:g.46951925_46951927delCAG	ENSP00000308895:p.Leu112del		B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	In_Frame_Del	DEL	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.L112in_frame_del	ENST00000311124.4	37	c.336_334	CCDS13725.1	21																																																																																			SLC19A1	-	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	ENSG00000173638		0.645	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206796.1		0.00	40	0	CAG			46951918	-1	tier1		no_errors	ENST00000311124	ensembl	human	known	74_37	in_frame_del	16.67	15	3	DEL	0.002:0.005:0.002	-
SLC27A3	11000	genome.wustl.edu	37	1	153747831	153747831	+	5'UTR	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:153747831G>T	ENST00000368661.3	+	0	64				SLC27A3_ENST00000484014.1_3'UTR|SLC27A3_ENST00000271857.2_Missense_Mutation_p.G81V	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GCCTGGGTGGGAATGGGCGTG	0.682																																																	0													37.0	43.0	41.0					1																	153747831		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.-2G>T	1.37:g.153747831G>T			Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.G81V	ENST00000368661.3	37	c.242	CCDS1053.1	1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029398	0.54790	.	.	ENSG00000143554	ENST00000271857	T	0.62232	0.04	4.32	1.99	0.26369	.	.	.	.	.	T	0.54382	0.1855	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58923	-0.7550	6	0.72032	D	0.01	-4.6903	7.163	0.25675	0.2556:0.0:0.7444:0.0	.	.	.	.	V	81	ENSP00000271857:G81V	ENSP00000271857:G81V	G	+	2	0	SLC27A3	152014455	0.997000	0.39634	1.000000	0.80357	0.886000	0.51366	0.645000	0.24782	0.819000	0.34492	0.462000	0.41574	GGA	SLC27A3	-	NULL	ENSG00000143554		0.682	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A3	HGNC	protein_coding			0.00	37	0	G	NM_024330		153747831	+1			no_errors	ENST00000271857	ensembl	human	novel	74_37	missense	10.53	34	4	SNP	0.999	T
SLC38A10	124565	genome.wustl.edu	37	17	79225168	79225168	+	Intron	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:79225168C>T	ENST00000374759.3	-	14	2449				SLC38A10_ENST00000288439.5_Silent_p.P730P	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10						amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GCTCAGCAGGCGGCTGGAAAG	0.637																																																	0													18.0	26.0	23.0					17																	79225168		2191	4290	6481	SO:0001627	intron_variant	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.2065+124G>A	17.37:g.79225168C>T			Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	pfam_AA_transpt_TM	p.P730	ENST00000374759.3	37	c.2190	CCDS42397.1	17																																																																																			SLC38A10	-	NULL	ENSG00000157637		0.637	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1		0.00	64	0	C	NM_138570		79225168	-1			no_errors	ENST00000288439	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.000	T
SLC7A2	6542	genome.wustl.edu	37	8	17400943	17400943	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:17400943G>T	ENST00000494857.1	+	3	313	c.95G>T	c.(94-96)cGc>cTc	p.R32L	SLC7A2_ENST00000398090.3_Missense_Mutation_p.R72L|SLC7A2_ENST00000522656.1_Missense_Mutation_p.R32L|SLC7A2_ENST00000004531.10_Missense_Mutation_p.R72L|SLC7A2_ENST00000470360.1_Missense_Mutation_p.R72L	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	32					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)	p.R72H(1)|p.R32H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	AAATTATGCCGCTGCTTATCC	0.577																																																	2	Substitution - Missense(2)	large_intestine(2)											93.0	84.0	87.0					8																	17400943		2203	4300	6503	SO:0001583	missense	0			D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.95G>T	8.37:g.17400943G>T	ENSP00000419140:p.Arg32Leu		B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,tigrfam_Cat_AA_permease	p.R72L	ENST00000494857.1	37	c.215	CCDS34852.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.417886	0.96092	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	D;D;D;D;D	0.95447	-3.47;-3.47;-3.71;-3.51;-3.71	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.97511	0.9185	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.85130	0.971;0.997;0.991	D	0.97969	1.0342	10	0.72032	D	0.01	.	19.2514	0.93926	0.0:0.0:1.0:0.0	.	72;72;32	P52569-3;P52569-2;P52569	.;.;CTR2_HUMAN	L	32;32;72;72;72	ENSP00000419140:R32L;ENSP00000430464:R32L;ENSP00000419873:R72L;ENSP00000004531:R72L;ENSP00000381164:R72L	ENSP00000004531:R72L	R	+	2	0	SLC7A2	17445322	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.823000	0.99369	2.630000	0.89119	0.655000	0.94253	CGC	SLC7A2	-	tigrfam_Cat_AA_permease	ENSG00000003989		0.577	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A2	HGNC	protein_coding	OTTHUMT00000253367.3		0.00	88	0	G	NM_003046		17400943	+1			no_errors	ENST00000004531	ensembl	human	known	74_37	missense	5.66	49	3	SNP	1.000	T
SLC8A2	6543	genome.wustl.edu	37	19	47960696	47960696	+	Silent	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:47960696C>T	ENST00000236877.6	-	3	1226	c.831G>A	c.(829-831)ccG>ccA	p.P277P	SLC8A2_ENST00000542837.1_Silent_p.P33P|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	277					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CGATGCTCTTCGGGGGGTCGC	0.711																																																	0													11.0	16.0	15.0					19																	47960696		2190	4281	6471	SO:0001819	synonymous_variant	0			AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.831G>A	19.37:g.47960696C>T			B4DYQ9	Silent	SNP	pfam_Calx_beta,pfam_NaCa_Exmemb,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.P277	ENST00000236877.6	37	c.831	CCDS33065.1	19																																																																																			SLC8A2	-	tigrfam_Na_Ca_Ex	ENSG00000118160		0.711	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A2	HGNC	protein_coding	OTTHUMT00000466997.1	-	0.00	24	0	C			47960696	-1	tier1	-	no_errors	ENST00000236877	ensembl	human	known	74_37	silent	76.19	5	16	SNP	0.993	T
SLCO1C1	53919	genome.wustl.edu	37	12	20903702	20903702	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:20903702G>T	ENST00000266509.2	+	14	2260	c.1892G>T	c.(1891-1893)aGa>aTa	p.R631I	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.R631I|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.R582I|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.R631I|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.R513I	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	631					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	GGATCATGCAGATTATATGAT	0.408																																																	0													133.0	123.0	126.0					12																	20903702		2203	4300	6503	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1892G>T	12.37:g.20903702G>T	ENSP00000266509:p.Arg631Ile		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.R631I	ENST00000266509.2	37	c.1892	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	G	28.5	4.929821	0.92389	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	5.32	5.32	0.75619	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.70945	0.3282	M	0.92219	3.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.991;0.998	T	0.71530	-0.4565	10	0.19590	T	0.45	.	16.962	0.86274	0.0:0.0:1.0:0.0	.	513;582;631;631	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	I	631;582;631;631;513	ENSP00000444149:R631I;ENSP00000438665:R582I;ENSP00000266509:R631I;ENSP00000370964:R631I;ENSP00000444527:R513I	ENSP00000266509:R631I	R	+	2	0	SLCO1C1	20794969	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.173000	0.89680	2.761000	0.94854	0.655000	0.94253	AGA	SLCO1C1	-	pfam_OA_transporter,tigrfam_OA_transporter	ENSG00000139155		0.408	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1		0.00	46	0	G	NM_017435		20903702	+1			no_errors	ENST00000381552	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	T
SLCO3A1	28232	genome.wustl.edu	37	15	92706314	92706314	+	Silent	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr15:92706314C>A	ENST00000318445.6	+	10	2296	c.2082C>A	c.(2080-2082)atC>atA	p.I694I	RP11-152L20.3_ENST00000561674.1_RNA|SLCO3A1_ENST00000424469.2_Intron|SLCO3A1_ENST00000555549.1_3'UTR|RP11-24J19.1_ENST00000557683.1_RNA	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	694					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CAAAGTTTATCTATAACCTGG	0.478																																																	0													98.0	106.0	103.0					15																	92706314		2198	4298	6496	SO:0001819	synonymous_variant	0			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.2082C>A	15.37:g.92706314C>A			A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.I694	ENST00000318445.6	37	c.2082	CCDS10371.1	15																																																																																			SLCO3A1	-	NULL	ENSG00000176463		0.478	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	HGNC	protein_coding	OTTHUMT00000313529.1	-	0.00	64	0	C	NM_013272		92706314	+1	tier1	-	no_errors	ENST00000318445	ensembl	human	known	74_37	silent	10.53	34	4	SNP	1.000	A
SLITRK6	84189	genome.wustl.edu	37	13	86369531	86369531	+	Silent	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr13:86369531C>A	ENST00000400286.2	-	2	1711	c.1113G>T	c.(1111-1113)gcG>gcT	p.A371A		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	371					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TAATATTTCCCGCTAGAATGA	0.388																																																	0													78.0	72.0	74.0					13																	86369531		1830	4086	5916	SO:0001819	synonymous_variant	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1113G>T	13.37:g.86369531C>A			A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.A371	ENST00000400286.2	37	c.1113	CCDS41903.1	13																																																																																			SLITRK6	-	NULL	ENSG00000184564		0.388	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2		0.00	32	0	C	NM_032229		86369531	-1			no_errors	ENST00000400286	ensembl	human	known	74_37	silent	28.57	5	2	SNP	0.294	A
SMPDL3A	10924	genome.wustl.edu	37	6	123122527	123122527	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:123122527G>T	ENST00000368440.4	+	4	721	c.544G>T	c.(544-546)Gaa>Taa	p.E182*	SMPDL3A_ENST00000539041.1_Nonsense_Mutation_p.E51*	NM_006714.3	NP_006705.1	Q92484	ASM3A_HUMAN	sphingomyelin phosphodiesterase, acid-like 3A	182					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|cervix(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(226;0.236)		GCTAGATGAAGAAGCTATTAG	0.338																																																	0													148.0	138.0	142.0					6																	123122527		2203	4300	6503	SO:0001587	stop_gained	0			AK000184	CCDS5128.1, CCDS69190.1	6q22.32	2006-04-12			ENSG00000172594	ENSG00000172594			17389	protein-coding gene	gene with protein product	"""acid sphingomyelinase-like phosphodiesterase 3a"""	610728				12442002	Standard	XM_005266798		Approved	FLJ20177, ASM3A, ASML3a, yR36GH4.1	uc003pzg.3	Q92484	OTTHUMG00000015490	ENST00000368440.4:c.544G>T	6.37:g.123122527G>T	ENSP00000357425:p.Glu182*		B7Z729|Q8WV13	Nonsense_Mutation	SNP	pfam_PEstase_dom,pirsf_ASM-like_Pdiesterase_prd	p.E182*	ENST00000368440.4	37	c.544	CCDS5128.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.744451	0.96882	.	.	ENSG00000172594	ENST00000368440;ENST00000539041	.	.	.	5.72	5.72	0.89469	.	0.228395	0.52532	D	0.000078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-16.7957	20.2406	0.98372	0.0:0.0:1.0:0.0	.	.	.	.	X	182;51	.	ENSP00000357425:E182X	E	+	1	0	SMPDL3A	123164226	1.000000	0.71417	1.000000	0.80357	0.497000	0.33675	6.417000	0.73337	2.857000	0.98124	0.650000	0.86243	GAA	SMPDL3A	-	pfam_PEstase_dom,pirsf_ASM-like_Pdiesterase_prd	ENSG00000172594		0.338	SMPDL3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPDL3A	HGNC	protein_coding	OTTHUMT00000042039.1		0.00	88	0	G	NM_006714		123122527	+1			no_errors	ENST00000368440	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	1.000	T
SNCAIP	9627	genome.wustl.edu	37	5	121786373	121786373	+	Frame_Shift_Del	DEL	G	G	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr5:121786373delG	ENST00000261368.8	+	10	2093	c.1831delG	c.(1831-1833)gcafs	p.A611fs	CTC-210G5.1_ENST00000503529.1_RNA|SNCAIP_ENST00000379536.2_Frame_Shift_Del_p.A551fs|SNCAIP_ENST00000261367.7_Frame_Shift_Del_p.A658fs|SNCAIP_ENST00000414317.2_Frame_Shift_Del_p.A213fs|CTC-210G5.1_ENST00000509993.1_RNA|SNCAIP_ENST00000503116.2_3'UTR|CTC-210G5.1_ENST00000506053.1_RNA|SNCAIP_ENST00000542191.1_Frame_Shift_Del_p.A169fs|CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000379533.2_Frame_Shift_Del_p.A658fs|CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000379538.3_Frame_Shift_Del_p.A245fs|SNCAIP_ENST00000504884.2_3'UTR	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	611					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TAGACCCAAAGCAAAAGATGA	0.463																																																	0													60.0	70.0	67.0					5																	121786373		2202	4300	6502	SO:0001589	frameshift_variant	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1831delG	5.37:g.121786373delG	ENSP00000261368:p.Ala611fs		D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A658fs	ENST00000261368.8	37	c.1972	CCDS4131.1	5																																																																																			SNCAIP	-	NULL	ENSG00000064692		0.463	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1		0.00	52	0	G			121786373	+1	tier1		no_errors	ENST00000379533	ensembl	human	known	74_37	frame_shift_del	11.11	16	2	DEL	0.838	-
SNX29	92017	genome.wustl.edu	37	16	12136831	12136831	+	Missense_Mutation	SNP	G	G	T	rs200498279	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:12136831G>T	ENST00000566228.1	+	5	394	c.325G>T	c.(325-327)Gcc>Tcc	p.A109S	SNX29_ENST00000568359.1_3'UTR	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	109	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)	p.A109S(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						GCGCCACATCGCCTCAGACGT	0.657																																																	1	Substitution - Missense(1)	kidney(1)											43.0	36.0	38.0					16																	12136831		2197	4300	6497	SO:0001583	missense	0			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.325G>T	16.37:g.12136831G>T	ENSP00000456480:p.Ala109Ser		B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	pfam_Run,pfam_Phox,superfamily_Phox,smart_Run,smart_Phox,pfscan_Phox,pfscan_Run	p.A109S	ENST00000566228.1	37	c.325	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	G	8.219	0.801987	0.16397	.	.	ENSG00000140660	ENST00000268271	.	.	.	4.64	-1.3	0.09259	.	0.486656	0.20636	N	0.088489	T	0.07683	0.0193	N	0.00368	-1.59	0.80722	D	1	.	.	.	.	.	.	T	0.15694	-1.0428	7	0.10636	T	0.68	3.6012	2.7979	0.05406	0.4239:0.0:0.2267:0.3493	.	.	.	.	S	109	.	ENSP00000268271:A109S	A	+	1	0	RUNDC2A	12044332	0.534000	0.26362	0.792000	0.32020	0.953000	0.61014	0.807000	0.27140	-0.060000	0.13132	-0.521000	0.04368	GCC	SNX29	-	pfam_Run,pfscan_Run	ENSG00000048471		0.657	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNX29	HGNC	protein_coding	OTTHUMT00000422622.1		0.00	94	0	G			12136831	+1			no_errors	ENST00000566228	ensembl	human	putative	74_37	missense	5.56	51	3	SNP	0.946	T
SPAG9	9043	genome.wustl.edu	37	17	49059942	49059942	+	Silent	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:49059942G>A	ENST00000262013.7	-	25	3388	c.3180C>T	c.(3178-3180)gtC>gtT	p.V1060V	SPAG9_ENST00000357122.4_Silent_p.V1046V|SPAG9_ENST00000505279.1_Silent_p.V1050V|SPAG9_ENST00000510283.1_Silent_p.V903V	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	1060					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			AGCCACACCAGACTTTGTCAT	0.403																																																	0													162.0	149.0	154.0					17																	49059942		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.3180C>T	17.37:g.49059942G>A			A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.V1060	ENST00000262013.7	37	c.3180	CCDS45740.1	17																																																																																			SPAG9	-	superfamily_WD40_repeat_dom	ENSG00000008294		0.403	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	-	0.00	50	0	G	NM_003971		49059942	-1	tier1	-	no_errors	ENST00000262013	ensembl	human	known	74_37	silent	45.45	12	10	SNP	1.000	A
SPATA2	9825	genome.wustl.edu	37	20	48522354	48522354	+	Silent	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:48522354C>A	ENST00000422556.1	-	3	1714	c.1365G>T	c.(1363-1365)acG>acT	p.T455T	SPATA2_ENST00000289431.5_Silent_p.T455T|SPATA2_ENST00000543716.1_Silent_p.T318T	NM_001135773.1	NP_001129245.1	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	455					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	20	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			GGGAAGTGGGCGTGGTGGAGG	0.637																																																	0													100.0	92.0	95.0					20																	48522354		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018300	CCDS13422.1	20q13.13	2014-06-13			ENSG00000158480	ENSG00000158480			14681	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 145"""	607662					Standard	NM_001135773		Approved	KIAA0757, PD1, tamo, PPP1R145	uc002xuw.3	Q9UM82	OTTHUMG00000032704	ENST00000422556.1:c.1365G>T	20.37:g.48522354C>A			E1P626|O94857	Silent	SNP	NULL	p.T455	ENST00000422556.1	37	c.1365	CCDS13422.1	20																																																																																			SPATA2	-	NULL	ENSG00000158480		0.637	SPATA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA2	HGNC	protein_coding	OTTHUMT00000079658.1		0.00	21	0	C	NM_006038		48522354	-1			no_errors	ENST00000289431	ensembl	human	known	74_37	silent	6.45	28	2	SNP	0.062	A
SPON1	10418	genome.wustl.edu	37	11	14284473	14284473	+	RNA	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:14284473C>T	ENST00000534587.1	-	0	158				SPON1_ENST00000310358.7_RNA														p.R737W(1)									CCGAGAGAGCCGGCGGAGTGA	0.587																																																	1	Substitution - Missense(1)	large_intestine(1)											38.0	40.0	39.0					11																	14284473		1919	4114	6033			0																															11.37:g.14284473C>T				RNA	SNP	-	NULL	ENST00000534587.1	37	NULL		11	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872510	0.72180	.	.	ENSG00000152268	ENST00000310358	.	.	.	6.04	1.34	0.21922	.	0.045895	0.85682	D	0.000000	T	0.77068	0.4076	.	.	.	0.53005	D	0.999969	D	0.89917	1.0	D	0.72075	0.976	D	0.83492	0.0070	7	0.66056	D	0.02	.	14.4744	0.67537	0.5911:0.4089:0.0:0.0	.	738	Q9HCB6	SPON1_HUMAN	W	737	.	ENSP00000309297:R737W	R	+	1	2	SPON1	14241049	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.383000	0.34385	0.361000	0.24292	0.561000	0.74099	CGG	SPON1	-	-	ENSG00000152268		0.587	RP11-21L19.1-001	KNOWN	basic	antisense	SPON1	HGNC	antisense	OTTHUMT00000386031.1	-	0.00	50	0	C			14284473	+1	tier1	-	no_errors	ENST00000310358	ensembl	human	known	74_37	rna	36.00	16	9	SNP	0.998	T
ST7	7982	genome.wustl.edu	37	7	116759698	116759698	+	Silent	SNP	A	A	T	rs35416096		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:116759698A>T	ENST00000393446.2	+	3	621	c.318A>T	c.(316-318)ggA>ggT	p.G106G	ST7_ENST00000393449.1_Silent_p.G106G|ST7-AS2_ENST00000432541.1_RNA|ST7_ENST00000393444.3_Silent_p.G63G|ST7_ENST00000487459.1_3'UTR|ST7_ENST00000393443.1_Silent_p.G56G|ST7_ENST00000465133.1_Silent_p.G63G|ST7_ENST00000393447.4_Silent_p.G63G|ST7_ENST00000432298.1_Silent_p.G60G|ST7-AS2_ENST00000434993.1_RNA|ST7_ENST00000265437.5_Silent_p.G106G|ST7_ENST00000393451.3_Silent_p.G106G|ST7_ENST00000422922.1_Silent_p.G60G|ST7-AS2_ENST00000442719.1_RNA|ST7_ENST00000323984.3_Silent_p.G106G			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CCCTTCTGGGAGGGGTTGACA	0.413																																																	0													107.0	108.0	107.0					7																	116759698		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.318A>T	7.37:g.116759698A>T			A8K137|B4DRQ2	Silent	SNP	pfam_ST7	p.G106	ENST00000393446.2	37	c.318		7																																																																																			ST7	-	pfam_ST7	ENSG00000004866		0.413	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	ST7	HGNC	protein_coding	OTTHUMT00000319687.1	-	0.00	27	0	A	NM_021908		116759698	+1	tier1	-	no_errors	ENST00000265437	ensembl	human	known	74_37	silent	41.18	9	7	SNP	0.999	T
STAB2	55576	genome.wustl.edu	37	12	104152935	104152935	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:104152935C>T	ENST00000388887.2	+	65	7336	c.7132C>T	c.(7132-7134)Cac>Tac	p.H2378Y	RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GGACATCGAGCACCACCTCGC	0.488																																																	0													157.0	137.0	144.0					12																	104152935		2203	4300	6503	SO:0001583	missense	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7132C>T	12.37:g.104152935C>T	ENSP00000373539:p.His2378Tyr			Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.H2378Y	ENST00000388887.2	37	c.7132	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	C	0.320	-0.962319	0.02249	.	.	ENSG00000136011	ENST00000388887	D	0.87412	-2.25	4.77	2.91	0.33838	FAS1 domain (4);	0.219749	0.39909	N	0.001238	T	0.70902	0.3277	N	0.11000	0.08	0.35712	D	0.816475	B	0.02656	0.0	B	0.06405	0.002	T	0.66372	-0.5940	10	0.35671	T	0.21	.	5.6866	0.17807	0.0:0.637:0.0:0.363	.	2378	Q8WWQ8	STAB2_HUMAN	Y	2378	ENSP00000373539:H2378Y	ENSP00000373539:H2378Y	H	+	1	0	STAB2	102677065	1.000000	0.71417	1.000000	0.80357	0.426000	0.31534	1.305000	0.33493	1.124000	0.41980	0.655000	0.94253	CAC	STAB2	-	superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain	ENSG00000136011		0.488	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	-	0.00	55	0	C			104152935	+1	tier1	-	no_errors	ENST00000388887	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
STX17	55014	genome.wustl.edu	37	9	102730928	102730928	+	Silent	SNP	C	C	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:102730928C>G	ENST00000259400.6	+	8	1018	c.882C>G	c.(880-882)ccC>ccG	p.P294P	STX17_ENST00000534052.1_Silent_p.P294P|STX17_ENST00000525640.1_Silent_p.P294P	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	294					autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CAGATCTTCCCAGCCAAACTG	0.443																																																	0													73.0	76.0	75.0					9																	102730928		2203	4300	6503	SO:0001819	synonymous_variant	0			AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.882C>G	9.37:g.102730928C>G			Q4VXC2	Silent	SNP	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.P294	ENST00000259400.6	37	c.882	CCDS6745.1	9																																																																																			STX17	-	NULL	ENSG00000136874		0.443	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	STX17	HGNC	protein_coding	OTTHUMT00000053398.3	-	0.00	45	0	C	NM_017919		102730928	+1	tier1	-	no_errors	ENST00000259400	ensembl	human	known	74_37	silent	75.00	3	9	SNP	0.995	G
SYNE2	23224	genome.wustl.edu	37	14	64619312	64619312	+	Frame_Shift_Del	DEL	A	A	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:64619312delA	ENST00000344113.4	+	85	15882	c.15670delA	c.(15670-15672)aaafs	p.K5224fs	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Frame_Shift_Del_p.K1858fs|SYNE2_ENST00000358025.3_Frame_Shift_Del_p.K5224fs|SYNE2_ENST00000357395.3_Frame_Shift_Del_p.K1609fs|SYNE2_ENST00000394768.2_Frame_Shift_Del_p.K1609fs|SYNE2_ENST00000554584.1_Frame_Shift_Del_p.K5141fs	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5224					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AATTAAATCCAAAGCACTAGA	0.353																																																	0													77.0	77.0	77.0					14																	64619312		2203	4300	6503	SO:0001589	frameshift_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.15670delA	14.37:g.64619312delA	ENSP00000341781:p.Lys5224fs		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Frame_Shift_Del	DEL	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A5225fs	ENST00000344113.4	37	c.15670	CCDS41963.1	14																																																																																			SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.353	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2		0.00	18	0	A	NM_182914		64619312	+1	tier1		no_errors	ENST00000358025	ensembl	human	known	74_37	frame_shift_del	40.00	3	2	DEL	0.994	-
SYNE3	161176	genome.wustl.edu	37	14	95932292	95932292	+	Nonsense_Mutation	SNP	G	G	T	rs149765715		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr14:95932292G>T	ENST00000334258.5	-	3	617	c.603C>A	c.(601-603)taC>taA	p.Y201*	SYNE3_ENST00000553340.1_Nonsense_Mutation_p.Y201*|SYNE3_ENST00000557275.1_Nonsense_Mutation_p.Y201*	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	201					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						TCACTGCATCGTACTCAGCCT	0.597																																																	0													139.0	109.0	119.0					14																	95932292		2203	4300	6503	SO:0001587	stop_gained	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.603C>A	14.37:g.95932292G>T	ENSP00000334308:p.Tyr201*		A6H8H3|Q86SX5|Q8N7G8	Nonsense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.Y201*	ENST00000334258.5	37	c.603	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	g	13.46	2.243694	0.39697	.	.	ENSG00000176438	ENST00000334258;ENST00000557275;ENST00000553340	.	.	.	4.06	-0.87	0.10646	.	0.000000	0.34853	N	0.003624	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2042	11.2725	0.49147	0.4544:0.0:0.5456:0.0	.	.	.	.	X	201	.	ENSP00000334308:Y201X	Y	-	3	2	C14orf49	95002045	0.998000	0.40836	0.009000	0.14445	0.045000	0.14185	0.929000	0.28844	-0.384000	0.07845	-1.902000	0.00527	TAC	SYNE3	-	NULL	ENSG00000176438		0.597	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2		0.00	42	0	G	NM_152592		95932292	-1			no_errors	ENST00000334258	ensembl	human	known	74_37	nonsense	6.90	27	2	SNP	0.659	T
SYT2	127833	genome.wustl.edu	37	1	202571541	202571541	+	Missense_Mutation	SNP	G	G	T	rs551242051		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:202571541G>T	ENST00000367267.1	-	5	790	c.598C>A	c.(598-600)Ctg>Atg	p.L200M	SYT2_ENST00000367268.4_Missense_Mutation_p.L200M|RP11-569A11.1_ENST00000428573.1_RNA	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	200	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000250}.				neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	GCAGGGTTCAGTGTCTTCCGA	0.522																																																	0													158.0	150.0	153.0					1																	202571541		2203	4300	6503	SO:0001583	missense	0			AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.598C>A	1.37:g.202571541G>T	ENSP00000356236:p.Leu200Met		Q496K5|Q8NBE5	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.L200M	ENST00000367267.1	37	c.598	CCDS1427.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990762	0.74589	.	.	ENSG00000143858	ENST00000367268;ENST00000367267	T;T	0.11712	2.75;2.75	5.58	3.72	0.42706	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.41673	0.1169	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.52495	-0.8568	10	0.87932	D	0	.	12.1788	0.54199	0.1407:0.0:0.8593:0.0	.	200	Q8N9I0	SYT2_HUMAN	M	200	ENSP00000356237:L200M;ENSP00000356236:L200M	ENSP00000356236:L200M	L	-	1	2	SYT2	200838164	1.000000	0.71417	0.693000	0.30195	0.957000	0.61999	5.768000	0.68858	0.726000	0.32339	-0.137000	0.14449	CTG	SYT2	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_C2_dom	ENSG00000143858		0.522	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT2	HGNC	protein_coding	OTTHUMT00000099157.1		0.00	45	0	G	NM_177402		202571541	-1			no_errors	ENST00000367267	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.997	T
TBC1D30	23329	genome.wustl.edu	37	12	65264400	65264400	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:65264400G>T	ENST00000229088.6	+	12	1799	c.1799G>T	c.(1798-1800)aGt>aTt	p.S600I	TBC1D30_ENST00000539867.1_Missense_Mutation_p.S437I|TBC1D30_ENST00000542120.1_Missense_Mutation_p.S323I			Q9Y2I9	TBC30_HUMAN	TBC1 domain family, member 30	600					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)	ciliary basal body (GO:0036064)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			NS(3)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	5						GAGGAGCAGAGTCTGAGATCT	0.453																																																	0																																										SO:0001583	missense	0			AB023201	CCDS53813.1	12q14.3	2013-07-10			ENSG00000111490	ENSG00000111490			29164	protein-coding gene	gene with protein product		615077				12618308, 17646400	Standard	NM_015279		Approved	KIAA0984	uc010sst.2	Q9Y2I9	OTTHUMG00000168824	ENST00000229088.6:c.1799G>T	12.37:g.65264400G>T	ENSP00000229088:p.Ser600Ile		B3KP01|B9A6M9|E7EMW4|F5GYJ9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S600I	ENST00000229088.6	37	c.1799		12	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720893	0.30503	.	.	ENSG00000111490	ENST00000229088;ENST00000542120;ENST00000539867;ENST00000455166;ENST00000411580	T;T;T	0.08807	3.05;3.09;3.09	5.94	2.05	0.26809	.	0.155299	0.56097	D	0.000025	T	0.09598	0.0236	M	0.65498	2.005	0.41632	D	0.989028	P;P;P	0.40266	0.651;0.71;0.579	B;B;B	0.38712	0.28;0.235;0.169	T	0.13818	-1.0495	9	.	.	.	-8.2938	7.0228	0.24924	0.1958:0.2379:0.5663:0.0	.	437;600;437	F5GYJ9;Q9Y2I9;E7EMW4	.;TBC30_HUMAN;.	I	600;323;437;437;395	ENSP00000229088:S600I;ENSP00000440640:S323I;ENSP00000440207:S437I	.	S	+	2	0	TBC1D30	63550667	1.000000	0.71417	0.875000	0.34327	0.188000	0.23474	3.124000	0.50461	0.106000	0.17784	0.591000	0.81541	AGT	TBC1D30	-	NULL	ENSG00000111490		0.453	TBC1D30-201	KNOWN	basic	protein_coding	TBC1D30	HGNC	protein_coding		-	0.00	38	0	G	XM_037557		65264400	+1	tier1	-	no_errors	ENST00000229088	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.998	T
TBC1D15	64786	genome.wustl.edu	37	12	72287037	72287037	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:72287037G>T	ENST00000550746.1	+	6	654	c.590G>T	c.(589-591)tGt>tTt	p.C197F	TBC1D15_ENST00000485960.2_Missense_Mutation_p.C197F|TBC1D15_ENST00000393309.3_5'UTR|TBC1D15_ENST00000319106.8_Missense_Mutation_p.C205F	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	197					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTTGTGAATTGTCAGAATAAG	0.303																																																	0													77.0	77.0	77.0					12																	72287037		2202	4291	6493	SO:0001583	missense	0			AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.590G>T	12.37:g.72287037G>T	ENSP00000448182:p.Cys197Phe		B4DMT9|B9A6L6|J3KNI9|Q9HA83	Missense_Mutation	SNP	pfam_DUF3548,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.C197F	ENST00000550746.1	37	c.590	CCDS31858.1	12	.	.	.	.	.	.	.	.	.	.	G	9.907	1.208389	0.22205	.	.	ENSG00000121749	ENST00000482439;ENST00000550746;ENST00000491063;ENST00000319106;ENST00000485960	T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56	5.5	4.55	0.56014	Domain of unknown function DUF3548 (1);	0.314708	0.37955	N	0.001871	T	0.16599	0.0399	N	0.08118	0	0.80722	D	1	B;B;B	0.11235	0.004;0.002;0.002	B;B;B	0.12156	0.007;0.004;0.007	T	0.04607	-1.0939	10	0.49607	T	0.09	-5.4804	11.075	0.48025	0.0:0.1195:0.6494:0.2311	.	205;197;197	E9PH93;Q8TC07-2;Q8TC07	.;.;TBC15_HUMAN	F	98;197;98;205;197	ENSP00000449643:C98F;ENSP00000448182:C197F;ENSP00000418091:C98F;ENSP00000318262:C205F;ENSP00000420678:C197F	ENSP00000318262:C205F	C	+	2	0	TBC1D15	70573304	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	0.915000	0.28638	2.579000	0.87056	0.591000	0.81541	TGT	TBC1D15	-	pfam_DUF3548	ENSG00000121749		0.303	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	TBC1D15	HGNC	protein_coding	OTTHUMT00000351266.2	-	0.00	12	0	G	NM_022771		72287037	+1	tier1	-	no_errors	ENST00000550746	ensembl	human	known	74_37	missense	44.44	5	4	SNP	1.000	T
TEKT1	83659	genome.wustl.edu	37	17	6733588	6733588	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:6733588G>T	ENST00000338694.2	-	2	237	c.108C>A	c.(106-108)cgC>cgA	p.R36R	TEKT1_ENST00000535086.1_5'UTR	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	36						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				CTGCGACCAGGCGTTCTGATC	0.473																																																	0													98.0	93.0	95.0					17																	6733588		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.108C>A	17.37:g.6733588G>T			D3DTM7	Silent	SNP	pfam_Tektin,prints_Tektin	p.R36	ENST00000338694.2	37	c.108	CCDS11083.1	17																																																																																			TEKT1	-	pfam_Tektin	ENSG00000167858		0.473	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT1	HGNC	protein_coding	OTTHUMT00000219867.2	-	0.00	40	0	G	NM_053285		6733588	-1	tier1	-	no_errors	ENST00000338694	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.998	T
TENM4	26011	genome.wustl.edu	37	11	78369591	78369591	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:78369591G>T	ENST00000278550.7	-	34	8284	c.7822C>A	c.(7822-7824)Cac>Aac	p.H2608N		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2608					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										ATGGTGAAGTGCAGGTTCTCT	0.562																																																	0													43.0	45.0	45.0					11																	78369591		2043	4196	6239	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.7822C>A	11.37:g.78369591G>T	ENSP00000278550:p.His2608Asn		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.H2608N	ENST00000278550.7	37	c.7822	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269381	0.80469	.	.	ENSG00000149256	ENST00000278550	D	0.90133	-2.62	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.94945	0.8365	M	0.72894	2.215	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	D	0.93733	0.7043	9	.	.	.	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	2608	Q6N022	TEN4_HUMAN	N	2608	ENSP00000278550:H2608N	.	H	-	1	0	ODZ4	78047239	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.601000	0.98297	2.941000	0.99782	0.655000	0.94253	CAC	TENM4	-	NULL	ENSG00000149256		0.562	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	60	0	G			78369591	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	59.26	11	16	SNP	1.000	T
TMEM50A	23585	genome.wustl.edu	37	1	25669536	25669536	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:25669536G>T	ENST00000374358.4	+	3	731	c.178G>T	c.(178-180)Ggt>Tgt	p.G60C	RNU6-1171P_ENST00000516706.1_RNA|TMEM50A_ENST00000480937.1_3'UTR	NM_014313.3	NP_055128.1	O95807	TM50A_HUMAN	transmembrane protein 50A	60						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;3.47e-27)|Colorectal(126;1.1e-08)|COAD - Colon adenocarcinoma(152;7.48e-07)|STAD - Stomach adenocarcinoma(196;0.00035)|BRCA - Breast invasive adenocarcinoma(304;0.00047)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|GBM - Glioblastoma multiforme(114;0.00106)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.204)		CCATGCCTGTGGTGTTATAGC	0.358																																																	0													152.0	137.0	142.0					1																	25669536		2203	4300	6503	SO:0001583	missense	0			AY071927	CCDS264.1	1p36.11	2008-02-05			ENSG00000183726	ENSG00000183726			30590	protein-coding gene	gene with protein product	"""small membrane protein 1"""	605348				10938938, 10845894	Standard	NM_014313		Approved	SMP1	uc001bke.3	O95807	OTTHUMG00000007651	ENST00000374358.4:c.178G>T	1.37:g.25669536G>T	ENSP00000363478:p.Gly60Cys			Missense_Mutation	SNP	pfam_UPF0220	p.G60C	ENST00000374358.4	37	c.178	CCDS264.1	1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848267	0.91277	.	.	ENSG00000183726	ENST00000374358	T	0.34275	1.37	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.68742	0.3034	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75099	-0.3437	10	0.72032	D	0.01	.	18.2472	0.89991	0.0:0.0:1.0:0.0	.	60;60	B7Z5M7;O95807	.;TM50A_HUMAN	C	60	ENSP00000363478:G60C	ENSP00000363478:G60C	G	+	1	0	TMEM50A	25542123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.745000	0.91600	2.641000	0.89580	0.563000	0.77884	GGT	TMEM50A	-	pfam_UPF0220	ENSG00000183726		0.358	TMEM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM50A	HGNC	protein_coding	OTTHUMT00000020313.1	-	0.00	75	0	G			25669536	+1	tier1	-	no_errors	ENST00000374358	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
TNRC18	84629	genome.wustl.edu	37	7	5360056	5360056	+	Splice_Site	SNP	A	A	G			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:5360056A>G	ENST00000430969.1	-	24	6986	c.6638T>C	c.(6637-6639)aTc>aCc	p.I2213T	TNRC18_ENST00000399537.4_Splice_Site_p.I2213T	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2213							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CACATCGATGATCTAGAAGGG	0.627																																																	0													40.0	39.0	39.0					7																	5360056		1559	3567	5126	SO:0001630	splice_region_variant	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.6637-1T>C	7.37:g.5360056A>G			A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.I2213T	ENST00000430969.1	37	c.6638	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	a	18.39	3.614596	0.66672	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	T;T	0.42131	0.98;0.98	4.4	4.4	0.53042	.	.	.	.	.	T	0.58323	0.2114	L	0.54323	1.7	0.58432	D	0.999996	D	0.71674	0.998	D	0.78314	0.991	T	0.61936	-0.6960	9	0.72032	D	0.01	.	13.245	0.60018	1.0:0.0:0.0:0.0	.	2213	O15417	TNC18_HUMAN	T	2213	ENSP00000382452:I2213T;ENSP00000395538:I2213T	ENSP00000382452:I2213T	I	-	2	0	TNRC18	5326582	1.000000	0.71417	0.983000	0.44433	0.724000	0.41520	4.485000	0.60279	1.609000	0.50190	0.456000	0.33151	ATC	TNRC18	-	NULL	ENSG00000182095		0.627	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding			0.00	93	0	A		Missense_Mutation	5360056	-1			no_errors	ENST00000399537	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	G
TOP2B	7155	genome.wustl.edu	37	3	25651062	25651062	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr3:25651062G>T	ENST00000264331.4	-	29	3927	c.3928C>A	c.(3928-3930)Cct>Act	p.P1310T	TOP2B_ENST00000542520.1_Missense_Mutation_p.P162T|TOP2B_ENST00000475717.1_5'Flank|TOP2B_ENST00000435706.2_Missense_Mutation_p.P1305T|TOP2B_ENST00000540199.1_Missense_Mutation_p.P162T	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	1310					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	TTCTCACCAGGCTCCTTCTTC	0.388																																																	0													59.0	52.0	54.0					3																	25651062		1844	4090	5934	SO:0001583	missense	0			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.3928C>A	3.37:g.25651062G>T	ENSP00000264331:p.Pro1310Thr		Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.P1310T	ENST00000264331.4	37	c.3928		3	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309920	0.60414	.	.	ENSG00000077097	ENST00000542520;ENST00000435706;ENST00000264331;ENST00000540199	T;T;T;T	0.50001	0.76;0.99;0.99;0.76	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	L	0.52126	1.63	0.80722	D	1	P;P	0.40398	0.594;0.716	B;B	0.39840	0.164;0.311	T	0.46610	-0.9179	10	0.46703	T	0.11	.	19.4672	0.94948	0.0:0.0:1.0:0.0	.	1310;1305	Q02880;Q02880-2	TOP2B_HUMAN;.	T	162;1305;1310;162	ENSP00000446023:P162T;ENSP00000396704:P1305T;ENSP00000264331:P1310T;ENSP00000437352:P162T	ENSP00000264331:P1310T	P	-	1	0	TOP2B	25626066	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	8.278000	0.89899	2.700000	0.92200	0.585000	0.79938	CCT	TOP2B	-	NULL	ENSG00000077097		0.388	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	HGNC	protein_coding		-	0.00	47	0	G			25651062	-1	tier1	-	no_errors	ENST00000264331	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248Q	ENST00000269305.4	37	c.743	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	58	0	C	NM_000546		7577538	-1	tier1	rs11540652	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	93.55	2	29	SNP	1.000	T
TRERF1	55809	genome.wustl.edu	37	6	42227217	42227217	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr6:42227217G>A	ENST00000372922.4	-	9	2691	c.2129C>T	c.(2128-2130)cCc>cTc	p.P710L	TRERF1_ENST00000354325.2_Missense_Mutation_p.P627L|TRERF1_ENST00000541110.1_Missense_Mutation_p.P730L|TRERF1_ENST00000372917.4_Missense_Mutation_p.P627L|TRERF1_ENST00000340840.2_Missense_Mutation_p.P627L	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	710	Interacts with CREBBP.|Pro-rich.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CATGGGTGGGGGCGTGTAAGG	0.726																																																	0													10.0	15.0	13.0					6																	42227217		2131	4185	6316	SO:0001583	missense	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2129C>T	6.37:g.42227217G>A	ENSP00000362013:p.Pro710Leu		Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.P730L	ENST00000372922.4	37	c.2189	CCDS4867.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.616225	0.96649	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.37058	1.22;1.34;1.34;1.34;1.35	5.41	5.41	0.78517	.	0.000000	0.56097	D	0.000021	T	0.59046	0.2165	M	0.80332	2.49	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.997;0.999;0.999	T	0.64736	-0.6337	10	0.87932	D	0	-20.3857	19.209	0.93747	0.0:0.0:1.0:0.0	.	627;730;710;466;466	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	L	730;627;710;627;627	ENSP00000439689:P730L;ENSP00000362008:P627L;ENSP00000362013:P710L;ENSP00000339438:P627L;ENSP00000346285:P627L	ENSP00000339438:P627L	P	-	2	0	TRERF1	42335195	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.636000	0.98440	2.519000	0.84933	0.655000	0.94253	CCC	TRERF1	-	NULL	ENSG00000124496		0.726	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	-	0.00	34	0	G	NM_033502		42227217	-1	tier1	-	no_errors	ENST00000541110	ensembl	human	known	74_37	missense	85.29	5	29	SNP	1.000	A
TRIM17	51127	genome.wustl.edu	37	1	228595948	228595948	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:228595948G>T	ENST00000366697.2	-	6	2344	c.1388C>A	c.(1387-1389)tCt>tAt	p.S463Y	TRIM11_ENST00000493030.2_5'Flank|RP11-245P10.4_ENST00000436779.1_RNA|TRIM17_ENST00000366698.2_Missense_Mutation_p.S463Y|TRIM17_ENST00000295033.3_Missense_Mutation_p.S463Y|TRIM11_ENST00000284551.6_5'Flank|TRIM11_ENST00000366699.3_5'Flank			Q9Y577	TRI17_HUMAN	tripartite motif containing 17	463	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				CATCTGACCAGACTTCGGAGC	0.607																																																	0													68.0	75.0	73.0					1																	228595948		2203	4300	6503	SO:0001583	missense	0			AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.1388C>A	1.37:g.228595948G>T	ENSP00000355658:p.Ser463Tyr		B4DVJ2|Q5VST8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S463Y	ENST00000366697.2	37	c.1388	CCDS1571.1	1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741440	0.69304	.	.	ENSG00000162931	ENST00000366697;ENST00000366698;ENST00000295033	T;T;T	0.71103	-0.54;-0.54;-0.54	4.16	4.16	0.48862	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.36374	N	0.002629	T	0.81153	0.4763	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82621	-0.0367	10	0.87932	D	0	.	12.2736	0.54721	0.0:0.0:1.0:0.0	.	463	Q9Y577	TRI17_HUMAN	Y	463	ENSP00000355658:S463Y;ENSP00000355659:S463Y;ENSP00000295033:S463Y	ENSP00000295033:S463Y	S	-	2	0	TRIM17	226662571	0.743000	0.28239	0.412000	0.26496	0.854000	0.48673	3.314000	0.51943	2.585000	0.87301	0.655000	0.94253	TCT	TRIM17	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000162931		0.607	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM17	HGNC	protein_coding	OTTHUMT00000096439.2		0.00	90	0	G	NM_016102		228595948	-1			no_errors	ENST00000295033	ensembl	human	known	74_37	missense	6.58	71	5	SNP	0.477	T
TRIM43	129868	genome.wustl.edu	37	2	96265165	96265165	+	Silent	SNP	C	C	T	rs200456827		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:96265165C>T	ENST00000272395.2	+	7	1321	c.1185C>T	c.(1183-1185)taC>taT	p.Y395Y		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	395	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						TTCCTCACTACATAGAGAAAC	0.418																																																	0													1.0	1.0	1.0					2																	96265165		500	1208	1708	SO:0001819	synonymous_variant	0			BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.1185C>T	2.37:g.96265165C>T			Q53TJ7	Silent	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Y395	ENST00000272395.2	37	c.1185	CCDS2015.1	2																																																																																			TRIM43	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000144015		0.418	TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM43	HGNC	protein_coding	OTTHUMT00000252784.1	-	0.00	12	0	C	NM_138800		96265165	+1	tier1	rs200456827	no_errors	ENST00000272395	ensembl	human	known	74_37	silent	52.94	8	9	SNP	0.000	T
TRIM63	84676	genome.wustl.edu	37	1	26387815	26387815	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:26387815G>T	ENST00000374272.3	-	3	481	c.343C>A	c.(343-345)Cag>Aag	p.Q115K	TRIM63_ENST00000483052.1_5'UTR	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	115	Interaction with TTN.				cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q115K(1)		kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCCCTTCTGCAGCGGCCGA	0.577																																																	1	Substitution - Missense(1)	large_intestine(1)											101.0	77.0	85.0					1																	26387815		2203	4300	6503	SO:0001583	missense	0			AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.343C>A	1.37:g.26387815G>T	ENSP00000363390:p.Gln115Lys		B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.Q115K	ENST00000374272.3	37	c.343	CCDS273.1	1	.	.	.	.	.	.	.	.	.	.	G	4.470	0.087078	0.08583	.	.	ENSG00000158022	ENST00000374272	T	0.40225	1.04	5.33	4.41	0.53225	Zinc finger, RING/FYVE/PHD-type (1);	0.094270	0.64402	N	0.000001	T	0.12561	0.0305	N	0.00707	-1.245	0.29996	N	0.81642	B	0.02656	0.0	B	0.04013	0.001	T	0.17837	-1.0356	10	0.02654	T	1	.	12.6674	0.56849	0.0:0.0:0.5587:0.4413	.	115	Q969Q1	TRI63_HUMAN	K	115	ENSP00000363390:Q115K	ENSP00000363390:Q115K	Q	-	1	0	TRIM63	26260402	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.033000	0.49743	1.370000	0.46153	0.591000	0.81541	CAG	TRIM63	-	NULL	ENSG00000158022		0.577	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM63	HGNC	protein_coding	OTTHUMT00000019750.1		0.00	43	0	G	NM_032588		26387815	-1			no_errors	ENST00000374272	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
TRO	7216	genome.wustl.edu	37	X	54951451	54951451	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chrX:54951451G>A	ENST00000173898.7	+	6	1547	c.1435G>A	c.(1435-1437)Gat>Aat	p.D479N	TRO_ENST00000420798.2_Missense_Mutation_p.D10N|TRO_ENST00000484031.1_3'UTR|TRO_ENST00000375022.4_Missense_Mutation_p.D479N|TRO_ENST00000375041.2_Missense_Mutation_p.D82N|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000399736.1_Missense_Mutation_p.D82N|TRO_ENST00000319167.8_Missense_Mutation_p.D479N	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	479	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CCAAGAATATGATGAATATTT	0.512																																																	0													64.0	57.0	60.0					X																	54951451		2139	4242	6381	SO:0001583	missense	0			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1435G>A	X.37:g.54951451G>A	ENSP00000173898:p.Asp479Asn		B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.D479N	ENST00000173898.7	37	c.1435	CCDS43959.1	X	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079411	0.55753	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022;ENST00000399736;ENST00000319179;ENST00000420798;ENST00000431115;ENST00000375041	T;T;T;T;T;T;T	0.04654	3.58;3.58;3.58;3.58;3.58;3.58;3.58	2.66	1.79	0.24919	.	.	.	.	.	T	0.08313	0.0207	N	0.22421	0.69	0.21762	N	0.999557	P;B;D;P	0.64830	0.877;0.268;0.994;0.877	P;B;D;P	0.67231	0.635;0.21;0.95;0.635	T	0.31364	-0.9946	9	0.66056	D	0.02	.	4.3175	0.11000	0.341:0.0:0.659:0.0	.	82;82;479;479	B1AKE9;B1AKF1;Q96SX2;Q12816	.;.;.;TROP_HUMAN	N	479;479;479;82;82;10;82;82	ENSP00000173898:D479N;ENSP00000318278:D479N;ENSP00000364162:D479N;ENSP00000382641:D82N;ENSP00000405126:D10N;ENSP00000407996:D82N;ENSP00000364181:D82N	ENSP00000173898:D479N	D	+	1	0	TRO	54968176	1.000000	0.71417	0.993000	0.49108	0.921000	0.55340	1.234000	0.32660	0.520000	0.28426	0.422000	0.28245	GAT	TRO	-	pfam_MAGE,pfscan_MAGE	ENSG00000067445		0.512	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	HGNC	protein_coding	OTTHUMT00000056837.3		0.00	21	0	G	NM_016157		54951451	+1			no_errors	ENST00000173898	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.991	A
TSFM	10102	genome.wustl.edu	37	12	58180908	58180908	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:58180908G>T	ENST00000550559.1	+	4	461	c.446G>T	c.(445-447)tGt>tTt	p.C149F	TSFM_ENST00000497617.1_3'UTR|TSFM_ENST00000540550.1_Missense_Mutation_p.C149F|TSFM_ENST00000454289.3_Missense_Mutation_p.C149F|TSFM_ENST00000543727.1_Missense_Mutation_p.C149F|TSFM_ENST00000548851.1_Missense_Mutation_p.C149F|TSFM_ENST00000323833.8_Missense_Mutation_p.C149F|TSFM_ENST00000350762.5_Missense_Mutation_p.C109F					Ts translation elongation factor, mitochondrial											endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)	8	all_cancers(7;6.31e-80)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					ATGATGCATTGTCAGACCCTA	0.408																																																	0													90.0	72.0	78.0					12																	58180908		2199	4300	6499	SO:0001583	missense	0			L37936	CCDS8958.2, CCDS53809.1, CCDS53810.1, CCDS53811.1	12q14.1	2006-06-10			ENSG00000123297	ENSG00000123297			12367	protein-coding gene	gene with protein product		604723				7615523	Standard	NM_005726		Approved	EF-Tsmt, EF-TS	uc001sqh.3	P43897	OTTHUMG00000153042	ENST00000550559.1:c.446G>T	12.37:g.58180908G>T	ENSP00000448575:p.Cys149Phe			Missense_Mutation	SNP	pfam_Transl_elong_EFTs/EF1B_dimer,pfam_UBA/Ts_N,superfamily_Transl_elong_EFTs/EF1B_dimer,superfamily_UBA-like	p.C149F	ENST00000550559.1	37	c.446		12	.	.	.	.	.	.	.	.	.	.	G	1.747	-0.490231	0.04322	.	.	ENSG00000123297	ENST00000454289;ENST00000543727;ENST00000540550;ENST00000323833;ENST00000350762;ENST00000550559;ENST00000548851;ENST00000434359;ENST00000457189	.	.	.	5.42	5.42	0.78866	Translation elongation factor EFTs/EF1B, dimerisation (2);	0.256618	0.44097	D	0.000494	T	0.50922	0.1644	L	0.50333	1.59	0.36140	D	0.846742	P;P;B;P	0.41265	0.744;0.47;0.347;0.465	P;B;B;B	0.45119	0.47;0.055;0.092;0.077	T	0.58261	-0.7667	8	.	.	.	.	10.5891	0.45300	0.089:0.0:0.911:0.0	.	149;109;149;149	B4E391;F8W6R3;P43897;P43897-2	.;.;EFTS_HUMAN;.	F	149;149;149;149;109;149;149;99;99	.	.	C	+	2	0	TSFM	56467175	1.000000	0.71417	0.990000	0.47175	0.081000	0.17604	3.149000	0.50655	2.686000	0.91538	0.655000	0.94253	TGT	TSFM	-	pfam_Transl_elong_EFTs/EF1B_dimer,superfamily_Transl_elong_EFTs/EF1B_dimer	ENSG00000123297		0.408	TSFM-008	PUTATIVE	basic|exp_conf	protein_coding	TSFM	HGNC	protein_coding	OTTHUMT00000409343.1	-	0.00	77	0	G	NM_005726		58180908	+1	tier1	-	no_errors	ENST00000323833	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
TSHZ2	128553	genome.wustl.edu	37	20	51871739	51871739	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:51871739A>T	ENST00000371497.5	+	2	2629	c.1742A>T	c.(1741-1743)aAg>aTg	p.K581M	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.K578M|TSHZ2_ENST00000329613.6_Missense_Mutation_p.K578M	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	581					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			ATTGCACCAAAGTGGAAAGTG	0.527																																																	0													115.0	105.0	108.0					20																	51871739		2203	4300	6503	SO:0001583	missense	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1742A>T	20.37:g.51871739A>T	ENSP00000360552:p.Lys581Met		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.K581M	ENST00000371497.5	37	c.1742	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	A	14.21	2.468671	0.43839	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.30182	1.54;1.54	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.55305	0.1912	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.57906	-0.7730	10	0.72032	D	0.01	-3.1918	16.1307	0.81436	1.0:0.0:0.0:0.0	.	581	Q9NRE2	TSH2_HUMAN	M	581;578;107	ENSP00000360552:K581M;ENSP00000333114:K578M	ENSP00000333114:K578M	K	+	2	0	TSHZ2	51305146	1.000000	0.71417	0.988000	0.46212	0.108000	0.19459	8.956000	0.93066	2.220000	0.72140	0.523000	0.50628	AAG	TSHZ2	-	NULL	ENSG00000182463		0.527	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	-	0.00	43	0	A	NM_173485		51871739	+1	tier1	-	no_errors	ENST00000371497	ensembl	human	known	74_37	missense	13.04	40	6	SNP	1.000	T
TSKU	25987	genome.wustl.edu	37	11	76506673	76506675	+	In_Frame_Del	DEL	CTG	CTG	-	rs149062181		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr11:76506673_76506675delCTG	ENST00000527881.1	+	2	1039_1041	c.13_15delCTG	c.(13-15)ctgdel	p.L9del	TSKU_ENST00000333090.4_In_Frame_Del_p.L9del			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	9					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					GCCGTGGCCCCTGCTGCTGCTGC	0.616																																																	0																																										SO:0001651	inframe_deletion	0			AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.13_15delCTG	11.37:g.76506682_76506684delCTG	ENSP00000434847:p.Leu9del		B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	In_Frame_Del	DEL	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L8in_frame_del	ENST00000527881.1	37	c.13_15	CCDS8246.1	11																																																																																			TSKU	-	NULL	ENSG00000182704		0.616	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TSKU	HGNC	protein_coding	OTTHUMT00000382871.1		0.00	69	0	CTG	NM_015516		76506675	+1	tier1		no_errors	ENST00000333090	ensembl	human	known	74_37	in_frame_del	6.06	31	2	DEL	0.997:1.000:0.997	-
TUBGCP2	10844	genome.wustl.edu	37	10	135095762	135095762	+	Missense_Mutation	SNP	C	C	A	rs373693348		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr10:135095762C>A	ENST00000252936.3	-	15	2413	c.2374G>T	c.(2374-2376)Gcc>Tcc	p.A792S	TUBGCP2_ENST00000543663.1_Missense_Mutation_p.A820S|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.A662S|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.A792S|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.A385S			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	792					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CGCTCCTCGGCCCCTGCGGGC	0.667																																																	0								C	SER/ALA	2,4402		0,2,2200	19.0	23.0	22.0		2374	3.1	0.0	10		22	0,8594		0,0,4297	no	missense	TUBGCP2	NM_006659.2	99	0,2,6497	AA,AC,CC		0.0,0.0454,0.0154	benign	792/903	135095762	2,12996	2202	4297	6499	SO:0001583	missense	0			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.2374G>T	10.37:g.135095762C>A	ENSP00000252936:p.Ala792Ser		B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	pfam_TUBGCP,superfamily_Ocr	p.A820S	ENST00000252936.3	37	c.2458	CCDS7676.1	10	.	.	.	.	.	.	.	.	.	.	C	2.642	-0.283935	0.05642	4.54E-4	0.0	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.29142	2.58;2.32;2.58;1.58;2.58	4.98	3.08	0.35506	.	0.614745	0.16852	N	0.196882	T	0.10895	0.0266	N	0.03115	-0.41	0.25110	N	0.990723	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.10450	0.005;0.004;0.002	T	0.34153	-0.9840	10	0.07175	T	0.84	-13.6135	6.7554	0.23510	0.1758:0.7316:0.0:0.0926	.	820;820;792	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	S	792;662;792;385;820	ENSP00000252936:A792S;ENSP00000395666:A662S;ENSP00000357551:A792S;ENSP00000357550:A385S;ENSP00000446093:A820S	ENSP00000252936:A792S	A	-	1	0	TUBGCP2	134945752	0.866000	0.29940	0.046000	0.18839	0.005000	0.04900	0.366000	0.20365	0.776000	0.33473	0.561000	0.74099	GCC	TUBGCP2	-	NULL	ENSG00000130640		0.667	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1		0.00	66	0	C			135095762	-1			no_errors	ENST00000543663	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.504	A
TUSC1	286319	genome.wustl.edu	37	9	25677715	25677715	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr9:25677715G>T	ENST00000358022.3	-	1	1141	c.605C>A	c.(604-606)tCc>tAc	p.S202Y		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	202										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		CGAGTCCCGGGAGCGGAGGCC	0.736																																					Pancreas(19;648 672 25630 30820 31331)												0													8.0	8.0	8.0					9																	25677715		2054	4040	6094	SO:0001583	missense	0			AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.605C>A	9.37:g.25677715G>T	ENSP00000350716:p.Ser202Tyr		A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Missense_Mutation	SNP	NULL	p.S202Y	ENST00000358022.3	37	c.605	CCDS34999.1	9	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928446	0.52759	.	.	ENSG00000198680	ENST00000358022	T	0.52526	0.66	3.83	1.92	0.25849	.	0.567462	0.12512	U	0.462365	T	0.34454	0.0898	L	0.36672	1.1	0.09310	N	1	P	0.36249	0.545	B	0.35607	0.206	T	0.19844	-1.0293	10	0.59425	D	0.04	.	5.4441	0.16524	0.1083:0.0:0.6948:0.1969	.	202	Q2TAM9	TUSC1_HUMAN	Y	202	ENSP00000350716:S202Y	ENSP00000350716:S202Y	S	-	2	0	TUSC1	25667715	0.001000	0.12720	0.002000	0.10522	0.014000	0.08584	0.613000	0.24299	0.120000	0.18254	0.462000	0.41574	TCC	TUSC1	-	NULL	ENSG00000198680		0.736	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUSC1	HGNC	protein_coding	OTTHUMT00000356351.1		0.00	22	0	G	NM_001004125		25677715	-1			no_errors	ENST00000358022	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.007	T
UBTF	7343	genome.wustl.edu	37	17	42284616	42284616	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr17:42284616G>T	ENST00000302904.4	-	21	2781	c.2289C>A	c.(2287-2289)tcC>tcA	p.S763S	UBTF_ENST00000527034.1_Missense_Mutation_p.P725Q|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000529383.1_Silent_p.S763S|UBTF_ENST00000526094.1_Silent_p.S726S|UBTF_ENST00000393606.3_Silent_p.S726S|UBTF_ENST00000533177.1_Silent_p.S726S|UBTF_ENST00000343638.5_Silent_p.S726S|UBTF_ENST00000436088.1_Silent_p.S763S			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	763	Asp/Glu/Ser-rich (acidic).				chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AGCCTCAGTTGGAGTCAGAGT	0.607																																																	0													65.0	51.0	56.0					17																	42284616		2203	4300	6503	SO:0001819	synonymous_variant	0			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.2289C>A	17.37:g.42284616G>T			A8K6R8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.P725Q	ENST00000302904.4	37	c.2174	CCDS11480.1	17	.	.	.	.	.	.	.	.	.	.	G	14.47	2.545523	0.45280	.	.	ENSG00000108312	ENST00000527034	D	0.98717	-5.09	5.4	5.4	0.78164	.	.	.	.	.	D	0.98754	0.9581	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.98789	1.0735	6	0.87932	D	0	-14.6699	13.9264	0.63966	0.0:0.1523:0.8477:0.0	.	.	.	.	Q	725	ENSP00000431539:P725Q	ENSP00000431539:P725Q	P	-	2	0	UBTF	39640142	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.174000	0.31932	2.813000	0.96785	0.561000	0.74099	CCA	UBTF	-	NULL	ENSG00000108312		0.607	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	HGNC	protein_coding	OTTHUMT00000395205.1	-	0.00	89	0	G	NM_014233		42284616	-1	tier1	-	no_errors	ENST00000527034	ensembl	human	novel	74_37	missense	7.14	52	4	SNP	1.000	T
UNC13A	23025	genome.wustl.edu	37	19	17760330	17760330	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:17760330G>T	ENST00000519716.2	-	13	1505	c.1506C>A	c.(1504-1506)ctC>ctA	p.L502L	UNC13A_ENST00000428389.2_Silent_p.L590L|UNC13A_ENST00000551649.1_Silent_p.L502L|UNC13A_ENST00000552293.1_Silent_p.L502L|UNC13A_ENST00000550896.1_Silent_p.L502L|UNC13A_ENST00000252773.7_Silent_p.L502L	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	502					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						AGTCGCTCACGAGTGGGATAG	0.577																																																	0													158.0	161.0	160.0					19																	17760330		2116	4234	6350	SO:0001819	synonymous_variant	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1506C>A	19.37:g.17760330G>T			E5RHY9	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_dom,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.L590	ENST00000519716.2	37	c.1770	CCDS46013.2	19																																																																																			UNC13A	-	NULL	ENSG00000130477		0.577	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2		0.00	72	0	G	XM_038604		17760330	-1			no_errors	ENST00000428389	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.990	T
UROD	7389	genome.wustl.edu	37	1	45479967	45479967	+	Intron	DEL	T	T	-	rs57055690|rs575204537	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:45479967delT	ENST00000246337.4	+	7	755				UROD_ENST00000494399.1_3'UTR|HECTD3_ENST00000372172.4_5'Flank	NM_000374.4	NP_000365.3	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase						heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	uroporphyrinogen decarboxylase activity (GO:0004853)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					GGAAAGtaaattttttttttt	0.423									Porphyria Cutanea Tarda, Type II		OREG0013449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0	Familial Cancer Database	PCT-II	BC001778	CCDS518.1	1p34	2012-10-02			ENSG00000126088	ENSG00000126088	4.1.1.37		12591	protein-coding gene	gene with protein product		613521				3015909, 3460962	Standard	NM_000374		Approved		uc001cna.2	P06132	OTTHUMG00000008949	ENST00000246337.4:c.637-144T>-	1.37:g.45479967delT		931	A8K762|Q16863|Q16883|Q53YB8|Q53ZP6|Q6IB28|Q9BUZ0	RNA	DEL	-	NULL	ENST00000246337.4	37	NULL	CCDS518.1	1																																																																																			UROD	-	-	ENSG00000126088		0.423	UROD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROD	HGNC	protein_coding	OTTHUMT00000024803.1		0.00	21	0	T	NM_000374		45479967	+1	tier1		no_errors	ENST00000472254	ensembl	human	known	74_37	rna	17.24	24	5	DEL	0.007	-
USH2A	7399	genome.wustl.edu	37	1	215802171	215802171	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr1:215802171G>T	ENST00000307340.3	-	71	15890	c.15504C>A	c.(15502-15504)ggC>ggA	p.G5168G	SNORD116_ENST00000365628.1_RNA|USH2A_ENST00000366943.2_Silent_p.G5192G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	5168					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G5168G(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CACTGTTGTGGCCCATGATGG	0.493										HNSCC(13;0.011)																																							1	Substitution - coding silent(1)	lung(1)											95.0	98.0	97.0					1																	215802171		2203	4300	6503	SO:0001819	synonymous_variant	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.15504C>A	1.37:g.215802171G>T			Q5VVM9|Q6S362|Q9NS27	Silent	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.G5192	ENST00000307340.3	37	c.15576	CCDS31025.1	1																																																																																			USH2A	-	NULL	ENSG00000042781		0.493	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	50	0	G	NM_007123		215802171	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.998	T
UTP20	27340	genome.wustl.edu	37	12	101706008	101706008	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr12:101706008G>T	ENST00000261637.4	+	21	2680	c.2506G>T	c.(2506-2508)Gag>Tag	p.E836*		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	836					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AGAAAGAGTAGAGCCACGGTC	0.458																																																	0													109.0	113.0	112.0					12																	101706008		2203	4300	6503	SO:0001587	stop_gained	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.2506G>T	12.37:g.101706008G>T	ENSP00000261637:p.Glu836*		Q9H3H4	Nonsense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.E836*	ENST00000261637.4	37	c.2506	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	42	9.517313	0.99193	.	.	ENSG00000120800	ENST00000261637	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-22.3739	19.6584	0.95853	0.0:0.0:1.0:0.0	.	.	.	.	X	836	.	ENSP00000261637:E836X	E	+	1	0	UTP20	100230139	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	8.925000	0.92832	2.646000	0.89796	0.655000	0.94253	GAG	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.458	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	-	0.00	51	0	G	NM_014503		101706008	+1	tier1	-	no_errors	ENST00000261637	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	1.000	T
VKORC1L1	154807	genome.wustl.edu	37	7	65419356	65419356	+	3'UTR	SNP	A	A	T	rs577125188	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr7:65419356A>T	ENST00000360768.3	+	0	705				VKORC1L1_ENST00000434382.2_Missense_Mutation_p.I164F	NM_001284342.1|NM_173517.4	NP_001271271.1|NP_775788.2	Q8N0U8	VKORL_HUMAN	vitamin K epoxide reductase complex, subunit 1-like 1						cellular response to oxidative stress (GO:0034599)|peptidyl-glutamic acid carboxylation (GO:0017187)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			large_intestine(1)|prostate(1)	2		Lung NSC(55;0.197)			Menadione(DB00170)	GCAGGTTTttattattattat	0.408													A|||	11	0.00219649	0.0076	0.0	5008	,	,		13092	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0				CCDS5529.1, CCDS64663.1	7q11.21	2013-10-07			ENSG00000196715	ENSG00000196715			21492	protein-coding gene	gene with protein product		608838				23928358	Standard	NM_001284342		Approved		uc003tul.3	Q8N0U8	OTTHUMG00000129449	ENST00000360768.3:c.*69A>T	7.37:g.65419356A>T			B4E222|E7ETM5|Q6AHW9|Q6TEK6	Missense_Mutation	SNP	pfam_VKOR	p.I164F	ENST00000360768.3	37	c.490	CCDS5529.1	7	.	.	.	.	.	.	.	.	.	.	A	7.617	0.676111	0.14841	.	.	ENSG00000196715	ENST00000434382	D	0.97430	-4.38	5.65	1.79	0.24919	.	.	.	.	.	D	0.92857	0.7728	.	.	.	0.25418	N	0.988296	B	0.02656	0.0	B	0.01281	0.0	D	0.85460	0.1166	8	0.87932	D	0	.	1.9096	0.03284	0.2817:0.0775:0.1411:0.4996	.	164	E7ETM5	.	F	164	ENSP00000403077:I164F	ENSP00000403077:I164F	I	+	1	0	VKORC1L1	65056791	0.731000	0.28111	0.428000	0.26697	0.234000	0.25298	-0.423000	0.07034	0.134000	0.18681	-0.417000	0.06048	ATT	VKORC1L1	-	NULL	ENSG00000196715		0.408	VKORC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VKORC1L1	HGNC	protein_coding	OTTHUMT00000251612.3		0.00	33	0	A	NM_173517		65419356	+1			no_errors	ENST00000434382	ensembl	human	novel	74_37	missense	12.00	21	3	SNP	0.932	T
WDR17	116966	genome.wustl.edu	37	4	177072975	177072975	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:177072975G>T	ENST00000280190.4	+	18	2545	c.2389G>T	c.(2389-2391)Gaa>Taa	p.E797*	WDR17_ENST00000393643.2_Nonsense_Mutation_p.E773*|WDR17_ENST00000507824.2_Nonsense_Mutation_p.E780*|WDR17_ENST00000508596.1_Nonsense_Mutation_p.E773*			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	797										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGAAGCTCAAGAACTAACAAC	0.318																																																	0													92.0	93.0	93.0					4																	177072975		2203	4300	6503	SO:0001587	stop_gained	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2389G>T	4.37:g.177072975G>T	ENSP00000280190:p.Glu797*		E7EQX0|Q0QD35	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E797*	ENST00000280190.4	37	c.2389	CCDS3825.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	9.137389|9.137389	0.99078|0.99078	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824|ENST00000443118	.|.	.|.	.|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.76543	.|0.4002	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74928	.|-0.3497	.|3	0.72032|.	D|.	0.01|.	-33.1868|-33.1868	19.5608|19.5608	0.95371|0.95371	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	773;773;797;780|39	.|.	ENSP00000280190:E797X|.	E|R	+|+	1|2	0|0	WDR17|WDR17	177309969|177309969	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.936000|0.936000	0.57629|0.57629	9.357000|9.357000	0.97099|0.97099	2.631000|2.631000	0.89168|0.89168	0.549000|0.549000	0.68633|0.68633	GAA|AGA	WDR17	-	NULL	ENSG00000150627		0.318	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2		0.00	45	0	G			177072975	+1			no_errors	ENST00000280190	ensembl	human	known	74_37	nonsense	25.00	6	2	SNP	1.000	T
WDR33	55339	genome.wustl.edu	37	2	128477225	128477225	+	Frame_Shift_Del	DEL	C	C	-			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:128477225delC	ENST00000322313.4	-	16	2532	c.2374delG	c.(2374-2376)gagfs	p.E792fs		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	792					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CCCTGGTTCTCCCGGGGGCCT	0.617																																																	0													24.0	29.0	27.0					2																	128477225		2201	4299	6500	SO:0001589	frameshift_variant	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.2374delG	2.37:g.128477225delC	ENSP00000325377:p.Glu792fs		Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_Collagen,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E792fs	ENST00000322313.4	37	c.2374	CCDS2150.1	2																																																																																			WDR33	-	NULL	ENSG00000136709		0.617	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2		0.00	54	0	C	NM_018383		128477225	-1	tier1		no_errors	ENST00000322313	ensembl	human	known	74_37	frame_shift_del	13.16	33	5	DEL	1.000	-
WDR33	55339	genome.wustl.edu	37	2	128522385	128522385	+	Intron	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:128522385G>T	ENST00000322313.4	-	6	785				WDR33_ENST00000393006.1_Intron|WDR33_ENST00000409658.3_Missense_Mutation_p.P215T	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33						mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		ACAGAAAATGGTATATTGTGT	0.423																																																	0													142.0	122.0	129.0					2																	128522385		2203	4300	6503	SO:0001627	intron_variant	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.626+16C>A	2.37:g.128522385G>T			Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P215T	ENST00000322313.4	37	c.643	CCDS2150.1	2	.	.	.	.	.	.	.	.	.	.	G	12.68	2.009728	0.35415	.	.	ENSG00000136709	ENST00000409658	T	0.30448	1.53	5.7	4.83	0.62350	.	.	.	.	.	T	0.20007	0.0481	.	.	.	0.35411	D	0.792475	B	0.30634	0.288	B	0.32342	0.144	T	0.11891	-1.0569	8	0.08179	T	0.78	.	14.8852	0.70564	0.069:0.0:0.931:0.0	.	215	Q9C0J8-2	.	T	215	ENSP00000387186:P215T	ENSP00000387186:P215T	P	-	1	0	WDR33	128238855	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.005000	0.70716	1.419000	0.47118	0.655000	0.94253	CCA	WDR33	-	NULL	ENSG00000136709		0.423	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2		0.00	64	0	G	NM_018383		128522385	-1			no_errors	ENST00000409658	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
WDR59	79726	genome.wustl.edu	37	16	74943462	74943462	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:74943462C>T	ENST00000262144.6	-	16	1709	c.1579G>A	c.(1579-1581)Ggg>Agg	p.G527R		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	527										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						TGGTACGACCCGTAAGCCGTG	0.557																																																	0													84.0	89.0	87.0					16																	74943462		2198	4300	6498	SO:0001583	missense	0			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1579G>A	16.37:g.74943462C>T	ENSP00000262144:p.Gly527Arg		B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_UBQ-conjugating_enzyme/RWD,smart_WD40_repeat,smart_RWD-domain,pfscan_RWD-domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G527R	ENST00000262144.6	37	c.1579	CCDS32488.1	16	.	.	.	.	.	.	.	.	.	.	C	22.3	4.272354	0.80580	.	.	ENSG00000103091	ENST00000262144	T	0.67345	-0.26	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.79215	0.4408	L	0.52364	1.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75233	-0.3390	10	0.39692	T	0.17	-27.5587	20.1581	0.98126	0.0:1.0:0.0:0.0	.	527	Q6PJI9	WDR59_HUMAN	R	527	ENSP00000262144:G527R	ENSP00000262144:G527R	G	-	1	0	WDR59	73500963	1.000000	0.71417	0.988000	0.46212	0.016000	0.09150	7.052000	0.76634	2.937000	0.99478	0.650000	0.86243	GGG	WDR59	-	NULL	ENSG00000103091		0.557	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR59	HGNC	protein_coding	OTTHUMT00000410601.3	-	0.00	79	0	C	NM_030581		74943462	-1	tier1	-	no_errors	ENST00000262144	ensembl	human	known	74_37	missense	29.41	24	10	SNP	1.000	T
WFDC1	58189	genome.wustl.edu	37	16	84360521	84360521	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:84360521G>T	ENST00000219454.5	+	6	964	c.638G>T	c.(637-639)aGg>aTg	p.R213M	WFDC1_ENST00000568638.1_Missense_Mutation_p.R213M	NM_001282466.1|NM_001282467.1	NP_001269395.1|NP_001269396.1	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1	213					negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|response to drug (GO:0042493)|response to estradiol (GO:0032355)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)	9						GAACCTGGAAGGGGACAACAG	0.527																																																	0													135.0	122.0	126.0					16																	84360521		2200	4300	6500	SO:0001583	missense	0			AF302109	CCDS10946.1	16q24.1	2013-01-21			ENSG00000103175	ENSG00000103175		"""WAP four-disulfide core domain containing"""	15466	protein-coding gene	gene with protein product		605322				10967136	Standard	NM_021197		Approved	PS20	uc002fhw.3	Q9HC57	OTTHUMG00000137641	ENST00000219454.5:c.638G>T	16.37:g.84360521G>T	ENSP00000219454:p.Arg213Met		D3DUL7|Q8NC27|Q9HAU1	Missense_Mutation	SNP	pfam_WAP-type_4-diS_core,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core	p.R213M	ENST00000219454.5	37	c.638	CCDS10946.1	16	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650926	0.47362	.	.	ENSG00000103175	ENST00000219454	T	0.33438	1.41	3.46	-3.86	0.04230	.	0.295676	0.30667	N	0.009140	T	0.12902	0.0313	N	0.14661	0.345	0.09310	N	1	B	0.28512	0.214	B	0.25405	0.06	T	0.07927	-1.0747	10	0.87932	D	0	-2.9339	5.7013	0.17883	0.4612:0.1466:0.3922:0.0	.	213	Q9HC57	WFDC1_HUMAN	M	213	ENSP00000219454:R213M	ENSP00000219454:R213M	R	+	2	0	WFDC1	82918022	0.776000	0.28616	0.000000	0.03702	0.790000	0.44656	1.667000	0.37471	-0.889000	0.03950	0.453000	0.30009	AGG	WFDC1	-	NULL	ENSG00000103175		0.527	WFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC1	HGNC	protein_coding	OTTHUMT00000269083.2		0.00	47	0	G			84360521	+1			no_errors	ENST00000219454	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.000	T
WFS1	7466	genome.wustl.edu	37	4	6304133	6304133	+	Missense_Mutation	SNP	G	G	T	rs71532874	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr4:6304133G>T	ENST00000226760.1	+	8	2781	c.2611G>T	c.(2611-2613)Gtg>Ttg	p.V871L	WFS1_ENST00000503569.1_Missense_Mutation_p.V871L	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	871			V -> M (in dbSNP:rs71532874). {ECO:0000269|PubMed:11709538, ECO:0000269|PubMed:15605410}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		GCGCAGCACCGTGCATGGCGC	0.617																																																	0			GRCh37	CM021367	WFS1	M	rs71532874						53.0	51.0	51.0					4																	6304133		2203	4300	6503	SO:0001583	missense	0			AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.2611G>T	4.37:g.6304133G>T	ENSP00000226760:p.Val871Leu		B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	NULL	p.V871L	ENST00000226760.1	37	c.2611	CCDS3386.1	4	.	.	.	.	.	.	.	.	.	.	G	14.31	2.498658	0.44455	.	.	ENSG00000109501	ENST00000503569;ENST00000226760;ENST00000540337	D;D	0.93247	-3.19;-3.19	4.68	4.68	0.58851	.	0.137530	0.49916	D	0.000134	D	0.87030	0.6076	N	0.19112	0.55	0.42153	D	0.991568	B	0.26400	0.148	B	0.23275	0.045	D	0.83726	0.0195	10	0.17832	T	0.49	-23.7543	16.7484	0.85479	0.0:0.0:1.0:0.0	.	871	O76024	WFS1_HUMAN	L	871;871;249	ENSP00000423337:V871L;ENSP00000226760:V871L	ENSP00000226760:V871L	V	+	1	0	WFS1	6355034	1.000000	0.71417	0.970000	0.41538	0.990000	0.78478	3.900000	0.56295	2.440000	0.82611	0.561000	0.74099	GTG	WFS1	-	NULL	ENSG00000109501		0.617	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFS1	HGNC	protein_coding	OTTHUMT00000206863.1		0.00	47	0	G			6304133	+1			no_errors	ENST00000226760	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.997	T
TSIX	9383	genome.wustl.edu	37	X	73045040	73045040	+	lincRNA	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chrX:73045040G>T	ENST00000604411.1	+	0	33001				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		CAGTTTCCATGTGTTTTCGTT	0.343																																																	0													25.0	25.0	25.0					X																	73045040		875	1990	2865			0					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73045040G>T				RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.343	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	-	0.00	19	0	G	NR_003255		73045040	-1	tier1	-	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	21.05	15	4	SNP	0.001	T
XKR7	343702	genome.wustl.edu	37	20	30584665	30584665	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:30584665G>A	ENST00000562532.2	+	3	1319	c.1145G>A	c.(1144-1146)cGc>cAc	p.R382H		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	382						integral component of membrane (GO:0016021)		p.R382H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CGCAGCCGCCGCCGCATGACC	0.582																																																	1	Substitution - Missense(1)	large_intestine(1)											45.0	39.0	41.0					20																	30584665		2203	4300	6503	SO:0001583	missense	0			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1145G>A	20.37:g.30584665G>A	ENSP00000477059:p.Arg382His		Q9NUG5	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.R382H	ENST00000562532.2	37	c.1145	CCDS33459.1	20	.	.	.	.	.	.	.	.	.	.	G	4.845	0.157145	0.09236	.	.	ENSG00000101321	ENST00000217299	T	0.63744	-0.06	5.16	3.2	0.36748	.	0.376195	0.30620	N	0.009230	T	0.42177	0.1191	N	0.16656	0.425	0.22127	N	0.999341	B	0.15930	0.015	B	0.12156	0.007	T	0.17992	-1.0351	10	0.15952	T	0.53	.	11.3416	0.49535	0.2394:0.0:0.7606:0.0	.	382	Q5GH72	XKR7_HUMAN	H	382	ENSP00000217299:R382H	ENSP00000217299:R382H	R	+	2	0	XKR7	30048326	0.889000	0.30405	0.998000	0.56505	0.713000	0.41058	0.755000	0.26405	0.207000	0.20607	-1.134000	0.01955	CGC	XKR7	-	pfam_Transport_prot_XK	ENSG00000260903		0.582	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	HGNC	protein_coding	OTTHUMT00000078597.3	-	0.00	52	0	G	NM_001011718		30584665	+1	tier1	-	no_errors	ENST00000562532	ensembl	human	known	74_37	missense	47.89	37	34	SNP	0.998	A
XPNPEP1	7511	genome.wustl.edu	37	10	111640657	111640657	+	Silent	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr10:111640657G>T	ENST00000502935.1	-	11	1193	c.1074C>A	c.(1072-1074)atC>atA	p.I358I	XPNPEP1_ENST00000430337.1_5'Flank|XPNPEP1_ENST00000322238.8_Silent_p.I358I|XPNPEP1_ENST00000369680.4_Silent_p.I315I|XPNPEP1_ENST00000369683.1_Silent_p.I244I					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble									p.I358I(1)|p.I315I(1)		endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TGGCGATGCAGATGGGGGTGT	0.567																																																	2	Substitution - coding silent(2)	urinary_tract(2)											110.0	86.0	94.0					10																	111640657		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1074C>A	10.37:g.111640657G>T				Silent	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.I358	ENST00000502935.1	37	c.1074	CCDS7560.2	10																																																																																			XPNPEP1	-	NULL	ENSG00000108039		0.567	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	HGNC	protein_coding	OTTHUMT00000050264.2		0.00	47	0	G			111640657	-1			no_errors	ENST00000502935	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.999	T
ZFHX3	463	genome.wustl.edu	37	16	72984827	72984827	+	Silent	SNP	G	G	A	rs141768802	byFrequency	TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr16:72984827G>A	ENST00000268489.5	-	3	3429	c.2757C>T	c.(2755-2757)ggC>ggT	p.G919G	ZFHX3_ENST00000397992.5_Silent_p.G5G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	919					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCAGCTGCCCGCCCCCGAGCC	0.622																																																	0								G	,	1,4395	2.1+/-5.4	0,1,2197	49.0	47.0	48.0		15,2757	2.0	1.0	16	dbSNP_134	48	0,8600	1.2+/-3.3	0,0,4300	no	coding-synonymous,coding-synonymous	ZFHX3	NM_001164766.1,NM_006885.3	,	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	,	5/2790,919/3704	72984827	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2757C>T	16.37:g.72984827G>A			D3DWS8|O15101|Q13719	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.G919	ENST00000268489.5	37	c.2757	CCDS10908.1	16																																																																																			ZFHX3	-	NULL	ENSG00000140836		0.622	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	-	0.00	64	0	G	NM_006885		72984827	-1	tier1	rs141768802	no_errors	ENST00000268489	ensembl	human	known	74_37	silent	44.44	15	12	SNP	1.000	A
ZFHX4	79776	genome.wustl.edu	37	8	77765710	77765710	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:77765710C>T	ENST00000521891.2	+	10	7001	c.6553C>T	c.(6553-6555)Cga>Tga	p.R2185*	ZFHX4_ENST00000455469.2_Nonsense_Mutation_p.R2140*|ZFHX4_ENST00000518282.1_Nonsense_Mutation_p.R2159*|ZFHX4_ENST00000050961.6_Nonsense_Mutation_p.R2140*	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.R2169R(1)|p.R2169*(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTTTAAGGAACGACAGAGAAA	0.378										HNSCC(33;0.089)																																							2	Substitution - Nonsense(1)|Substitution - coding silent(1)	lung(1)|endometrium(1)											128.0	124.0	125.0					8																	77765710		1844	4090	5934	SO:0001587	stop_gained	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6553C>T	8.37:g.77765710C>T	ENSP00000430497:p.Arg2185*		G3V138|Q18PS0|Q6ZN20	Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.R2185*	ENST00000521891.2	37	c.6553	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	47	13.547881	0.99749	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	.	.	.	3.92	0.775	0.18527	.	0.000000	0.38381	U	0.001717	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2325	0.54497	0.4463:0.5537:0.0:0.0	.	.	.	.	X	2185;2169;2140;2140;2159	.	ENSP00000050961:R2140X	R	+	1	2	ZFHX4	77928265	0.775000	0.28604	0.974000	0.42286	0.623000	0.37688	0.376000	0.20535	0.036000	0.15547	0.455000	0.32223	CGA	ZFHX4	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000091656		0.378	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	56	0	C	NM_024721		77765710	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	nonsense	25.00	18	6	SNP	1.000	T
ZNF345	25850	genome.wustl.edu	37	19	37368066	37368066	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:37368066C>A	ENST00000529555.1	+	2	1122	c.334C>A	c.(334-336)Cat>Aat	p.H112N	ZNF345_ENST00000420450.1_Missense_Mutation_p.H112N|ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000589046.1_Missense_Mutation_p.H112N|ZNF345_ENST00000526123.1_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	112					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCAAAGAATTCATACTGGTGA	0.428																																																	0													64.0	66.0	65.0					19																	37368066		2203	4300	6503	SO:0001583	missense	0			X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.334C>A	19.37:g.37368066C>A	ENSP00000431202:p.His112Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H112N	ENST00000529555.1	37	c.334	CCDS12497.1	19	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261848	0.59431	.	.	ENSG00000251247	ENST00000420450;ENST00000529555;ENST00000331800	T;T;T	0.67345	-0.26;-0.26;3.19	3.58	3.58	0.41010	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.82783	0.5112	M	0.86805	2.84	0.32276	N	0.568277	D	0.64830	0.994	D	0.79784	0.993	D	0.85688	0.1305	8	.	.	.	.	13.4821	0.61342	0.0:1.0:0.0:0.0	.	112	Q14585	ZN345_HUMAN	N	112	ENSP00000431216:H112N;ENSP00000431202:H112N;ENSP00000331120:H112N	.	H	+	1	0	ZNF345	42059906	0.965000	0.33210	1.000000	0.80357	0.908000	0.53690	2.899000	0.48679	2.280000	0.76307	0.561000	0.74099	CAT	ZNF345	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000251247		0.428	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF345	HGNC	protein_coding	OTTHUMT00000388258.1		0.00	49	0	C			37368066	+1			no_errors	ENST00000420450	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	A
ZNF473	25888	genome.wustl.edu	37	19	50545064	50545064	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:50545064G>T	ENST00000595661.1	+	5	709	c.214G>T	c.(214-216)Gca>Tca	p.A72S	ZNF473_ENST00000601364.1_Missense_Mutation_p.A72S|ZNF473_ENST00000270617.3_Missense_Mutation_p.A72S|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000391821.2_Missense_Mutation_p.A72S|ZNF473_ENST00000445728.3_Missense_Mutation_p.A60S|CTD-2126E3.3_ENST00000599410.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	72	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		AAGCCCAGAAGCAACAAGCCC	0.587																																																	0													73.0	74.0	73.0					19																	50545064		2203	4300	6503	SO:0001583	missense	0			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.214G>T	19.37:g.50545064G>T	ENSP00000472808:p.Ala72Ser		A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A72S	ENST00000595661.1	37	c.214	CCDS33077.1	19	.	.	.	.	.	.	.	.	.	.	G	3.261	-0.151260	0.06585	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.09163	3.19;3.19;3.01	5.05	2.88	0.33553	Krueppel-associated box (1);	1.336410	0.05322	N	0.526751	T	0.04770	0.0129	N	0.02142	-0.665	0.09310	N	0.999999	B	0.17038	0.02	B	0.19391	0.025	T	0.30592	-0.9973	10	0.07644	T	0.81	-0.025	10.8269	0.46638	0.0:0.0:0.6135:0.3865	.	72	Q8WTR7	ZN473_HUMAN	S	72;72;60	ENSP00000270617:A72S;ENSP00000375697:A72S;ENSP00000388961:A60S	ENSP00000270617:A72S	A	+	1	0	ZNF473	55236876	0.230000	0.23740	0.193000	0.23327	0.070000	0.16714	1.883000	0.39658	0.738000	0.32606	0.561000	0.74099	GCA	ZNF473	-	pfscan_Krueppel-associated_box	ENSG00000142528		0.587	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF473	HGNC	protein_coding	OTTHUMT00000464833.1	-	0.00	62	0	G	XM_046390		50545064	+1	tier1	-	no_errors	ENST00000270617	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.278	T
ZNF512B	57473	genome.wustl.edu	37	20	62594454	62594454	+	Silent	SNP	C	C	A	rs147556068		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr20:62594454C>A	ENST00000450537.1	-	12	2022	c.1962G>T	c.(1960-1962)acG>acT	p.T654T	ZNF512B_ENST00000217130.3_Silent_p.T654T|ZNF512B_ENST00000369888.1_Silent_p.T654T			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	654					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCACGGGGGCCGTGTGCTCCG	0.622																																																	0													45.0	29.0	34.0					20																	62594454		2191	4289	6480	SO:0001819	synonymous_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1962G>T	20.37:g.62594454C>A			Q08AK9|Q9ULM4	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T654	ENST00000450537.1	37	c.1962	CCDS13548.1	20																																																																																			ZNF512B	-	pfscan_Znf_C2H2	ENSG00000196700		0.622	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF512B	HGNC	protein_coding	OTTHUMT00000080246.1		0.00	57	0	C	NM_020713		62594454	-1			no_errors	ENST00000217130	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.083	A
ZNF638	27332	genome.wustl.edu	37	2	71615603	71615603	+	Intron	SNP	G	G	T			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr2:71615603G>T	ENST00000409544.1	+	11	3007				ZNF638_ENST00000410075.1_Intron|ZNF638_ENST00000377802.2_Missense_Mutation_p.C813F|ZNF638_ENST00000355812.3_Intron|ZNF638_ENST00000264447.4_Intron	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638						regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						ccaggcctttgtcattaaatc	0.522																																																	0																																										SO:0001627	intron_variant	0			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2378-7668G>T	2.37:g.71615603G>T			B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.C813F	ENST00000409544.1	37	c.2438	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.059801	0.00386	.	.	ENSG00000075292	ENST00000377802	T	0.63913	-0.07	0.158	-0.317	0.12736	.	.	.	.	.	T	0.56016	0.1957	.	.	.	0.09310	N	1	P	0.42518	0.782	P	0.46172	0.506	T	0.50550	-0.8815	7	0.87932	D	0	.	.	.	.	.	813	Q14966-2	.	F	813	ENSP00000367033:C813F	ENSP00000367033:C813F	C	+	2	0	ZNF638	71469111	0.180000	0.23148	0.154000	0.22540	0.155000	0.21991	-0.810000	0.04505	-1.029000	0.03317	-1.021000	0.02439	TGT	ZNF638	-	NULL	ENSG00000075292		0.522	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	-	0.00	34	0	G	NM_014497		71615603	+1	tier1	-	no_errors	ENST00000377802	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.204	T
ZNF704	619279	genome.wustl.edu	37	8	81550824	81550825	+	3'UTR	INS	-	-	A			TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr8:81550824_81550825insA	ENST00000327835.3	-	0	4246_4247					NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704								metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			ATGCTACGTTTAAAAAAAAAAA	0.371																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.*2777->T	8.37:g.81550835_81550835dupA			B2RNE6|B9EGW6	RNA	INS	-	NULL	ENST00000327835.3	37	NULL	CCDS34913.1	8																																																																																			ZNF704	-	-	ENSG00000164684		0.371	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF704	HGNC	protein_coding	OTTHUMT00000379964.2		0.00	28	0	-	NM_001033723		81550825	-1	tier1		no_errors	ENST00000517379	ensembl	human	putative	74_37	rna	15.38	22	4	INS	0.000:0.000	A
ZNF813	126017	genome.wustl.edu	37	19	53994704	53994704	+	Silent	SNP	C	C	T	rs372871030		TCGA-R6-A6XQ-01B-11D-A33E-09	TCGA-R6-A6XQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	054b1b1a-f530-4fa5-badc-e4fca6d2b898	cf40064b-0e80-4dea-ae65-c6db0c79d07d	g.chr19:53994704C>T	ENST00000396403.4	+	4	1346	c.1218C>T	c.(1216-1218)acC>acT	p.T406T	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		GACTTCATACCGGAGAGAAGC	0.403																																																	0								T		1,4399	2.1+/-5.4	0,1,2199	64.0	68.0	66.0		1218	0.1	0.1	19		66	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous	ZNF813	NM_001004301.3		0,3,6496	TT,TC,CC		0.0233,0.0227,0.0231		406/618	53994704	3,12995	2200	4299	6499	SO:0001819	synonymous_variant	0			AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1218C>T	19.37:g.53994704C>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T406	ENST00000396403.4	37	c.1218	CCDS46172.1	19																																																																																			ZNF813	-	pfscan_Znf_C2H2	ENSG00000198346		0.403	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF813	HGNC	protein_coding	OTTHUMT00000350638.1	-	0.00	103	0	C	NM_001004301		53994704	+1	tier1	-	no_errors	ENST00000396403	ensembl	human	known	74_37	silent	23.08	40	12	SNP	0.994	T
