#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA7	10347	genome.wustl.edu	37	19	1043466	1043466	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:1043466G>T	ENST00000263094.6	+	9	1155	c.924G>T	c.(922-924)atG>atT	p.M308I	ABCA7_ENST00000433129.1_Missense_Mutation_p.M308I|ABCA7_ENST00000435683.2_Missense_Mutation_p.M170I	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	308					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAGCTCATGGCCCAGGTGG	0.652																																																	0													66.0	76.0	72.0					19																	1043466		2203	4300	6503	SO:0001583	missense	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.924G>T	19.37:g.1043466G>T	ENSP00000263094:p.Met308Ile		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.M308I	ENST00000263094.6	37	c.924	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	G	7.433	0.639164	0.14386	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.84589	-1.87;-1.87	4.25	4.25	0.50352	.	.	.	.	.	T	0.81494	0.4834	L	0.39898	1.24	0.27750	N	0.944195	B;B	0.29988	0.264;0.04	B;B	0.38683	0.279;0.023	T	0.68546	-0.5380	9	0.11182	T	0.66	.	14.1326	0.65266	0.0:0.0:1.0:0.0	.	170;308	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	I	308	ENSP00000263094:M308I;ENSP00000414062:M308I	ENSP00000263094:M308I	M	+	3	0	ABCA7	994466	1.000000	0.71417	1.000000	0.80357	0.584000	0.36387	3.269000	0.51592	1.937000	0.56155	0.313000	0.20887	ATG	ABCA7	-	NULL	ENSG00000064687		0.652	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1		0.00	57	0	G	NM_019112		1043466	+1			no_errors	ENST00000263094	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
ABL2	27	genome.wustl.edu	37	1	179078319	179078319	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:179078319G>T	ENST00000502732.1	-	12	2286	c.2083C>A	c.(2083-2085)Cta>Ata	p.L695I	ABL2_ENST00000504405.1_Intron|ABL2_ENST00000408940.3_Missense_Mutation_p.L659I|ABL2_ENST00000512653.1_Missense_Mutation_p.L680I|ABL2_ENST00000344730.3_Intron|ABL2_ENST00000367623.4_Missense_Mutation_p.L674I|ABL2_ENST00000511413.1_Intron|ABL2_ENST00000507173.1_Intron	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	695	F-actin-binding. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GCATGCTGTAGAGAAGCAACA	0.532			T	ETV6	AML																																			Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0													140.0	145.0	144.0					1																	179078319		2203	4300	6503	SO:0001583	missense	0			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.2083C>A	1.37:g.179078319G>T	ENSP00000427562:p.Leu695Ile		A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_F-actin_binding,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,pfam_SH3-like_bac-type,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.L695I	ENST00000502732.1	37	c.2083	CCDS30947.1	1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720517	0.30503	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000512653;ENST00000367623	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.7	3.8	0.43715	.	0.000000	0.34435	U	0.003979	T	0.17238	0.0414	L	0.50333	1.59	0.45662	D	0.998588	B;B;B;B	0.22146	0.065;0.039;0.065;0.015	B;B;B;B	0.27170	0.077;0.035;0.048;0.015	T	0.08700	-1.0709	10	0.31617	T	0.26	.	4.0811	0.09927	0.2071:0.2082:0.5847:0.0	.	674;695;680;659	P42684-6;P42684;P42684-3;D1MPS6	.;ABL2_HUMAN;.;.	I	695;659;680;674	ENSP00000427562:L695I;ENSP00000386152:L659I;ENSP00000423578:L680I;ENSP00000356595:L674I	ENSP00000356595:L674I	L	-	1	2	ABL2	177344942	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.593000	0.36686	1.386000	0.46466	0.591000	0.81541	CTA	ABL2	-	NULL	ENSG00000143322		0.532	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABL2	HGNC	protein_coding	OTTHUMT00000085174.3	-	0.00	70	0	G	NM_005158		179078319	-1	tier1	-	no_errors	ENST00000502732	ensembl	human	known	74_37	missense	10.20	44	5	SNP	1.000	T
ACACA	31	genome.wustl.edu	37	17	35518897	35518897	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:35518897A>G	ENST00000394406.2	-	42	5226	c.5036T>C	c.(5035-5037)gTt>gCt	p.V1679A	ACACA_ENST00000335166.5_Missense_Mutation_p.V1601A|ACACA_ENST00000361253.5_5'Flank|ACACA_ENST00000353139.5_Missense_Mutation_p.V1716A|ACACA_ENST00000360679.3_Missense_Mutation_p.V1621A	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1679					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	ATTGCCAATAACAATGATATC	0.418																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												0													94.0	86.0	89.0					17																	35518897		2203	4300	6503	SO:0001583	missense	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5036T>C	17.37:g.35518897A>G	ENSP00000377928:p.Val1679Ala		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.V1716A	ENST00000394406.2	37	c.5147	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	A	29.7	5.024533	0.93518	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57	5.28	5.28	0.74379	Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.98551	0.9516	M	0.84156	2.68	0.80722	D	1	P;D;P;D	0.62365	0.917;0.988;0.954;0.991	P;D;P;P	0.65773	0.557;0.938;0.878;0.806	D	0.99211	1.0876	10	0.52906	T	0.07	-18.7795	15.504	0.75722	1.0:0.0:0.0:0.0	.	378;1716;1679;1621	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	A	1716;1621;1679;1703;1601;378	ENSP00000344789:V1716A;ENSP00000353898:V1621A;ENSP00000377928:V1679A;ENSP00000335323:V1601A	ENSP00000335323:V1601A	V	-	2	0	ACACA	32593010	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.287000	0.95975	2.131000	0.65755	0.383000	0.25322	GTT	ACACA	-	pfam_Carboxyl_trans	ENSG00000132142		0.418	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	-	0.00	30	0	A	NM_198836		35518897	-1	tier1	-	no_errors	ENST00000353139	ensembl	human	known	74_37	missense	32.65	33	16	SNP	1.000	G
AFF1	4299	genome.wustl.edu	37	4	87968484	87968484	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:87968484C>T	ENST00000307808.6	+	3	1196	c.776C>T	c.(775-777)cCt>cTt	p.P259L	AFF1_ENST00000395146.4_Missense_Mutation_p.P266L|AFF1_ENST00000544085.1_Intron	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	259					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AAAGAGACCCCTCAAGACAGT	0.537																																																	0													102.0	115.0	111.0					4																	87968484		2203	4300	6503	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.776C>T	4.37:g.87968484C>T	ENSP00000305689:p.Pro259Leu		B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P266L	ENST00000307808.6	37	c.797	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	C	4.317	0.058233	0.08339	.	.	ENSG00000172493	ENST00000395146;ENST00000395142;ENST00000507468;ENST00000503477;ENST00000307808	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.85	2.22	0.28083	.	0.524196	0.19942	N	0.102632	T	0.76695	0.4023	M	0.79258	2.445	0.09310	N	1	P;P;P;D;D;P	0.61080	0.711;0.698;0.811;0.989;0.98;0.711	P;B;B;D;P;P	0.67103	0.603;0.341;0.433;0.949;0.878;0.603	T	0.64622	-0.6364	10	0.51188	T	0.08	-0.5888	6.7588	0.23528	0.0:0.6033:0.1237:0.273	.	266;266;200;259;259;266	E9PBM3;B4DXZ8;B4DJM6;Q14C88;P51825;B4DTU1	.;.;.;.;AFF1_HUMAN;.	L	266;266;266;266;259	ENSP00000378578:P266L;ENSP00000427593:P266L;ENSP00000424483:P266L;ENSP00000305689:P259L	ENSP00000305689:P259L	P	+	2	0	AFF1	88187508	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.436000	0.21526	0.403000	0.25479	0.650000	0.86243	CCT	AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.537	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	-	0.00	37	0	C	NM_005935		87968484	+1	tier1	-	no_errors	ENST00000395146	ensembl	human	known	74_37	missense	26.00	37	13	SNP	0.000	T
AGBL4	84871	genome.wustl.edu	37	1	49511431	49511431	+	Missense_Mutation	SNP	G	G	A	rs370128287		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:49511431G>A	ENST00000371839.1	-	5	535	c.419C>T	c.(418-420)cCg>cTg	p.P140L	RP11-141A19.1_ENST00000456002.1_RNA|AGBL4_ENST00000371838.1_Missense_Mutation_p.P140L|AGBL4_ENST00000371836.1_Missense_Mutation_p.P140L	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	140					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		CCTATGGTCCGGGCAGCGGTA	0.403																																																	0								G	LEU/PRO	1,1383		0,1,691	90.0	75.0	79.0		419	5.6	1.0	1		79	0,3182		0,0,1591	no	missense	AGBL4	NM_032785.3	98	0,1,2282	AA,AG,GG		0.0,0.0723,0.0219	probably-damaging	140/504	49511431	1,4565	692	1591	2283	SO:0001583	missense	0			AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.419C>T	1.37:g.49511431G>A	ENSP00000360905:p.Pro140Leu		B3KT26|B4DG37	Missense_Mutation	SNP	pfam_Peptidase_M14,smart_Peptidase_M14	p.P140L	ENST00000371839.1	37	c.419	CCDS44137.1	1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.824141	0.90873	7.23E-4	0.0	ENSG00000186094	ENST00000371839;ENST00000411952;ENST00000371838;ENST00000371836	T;T;T	0.27402	1.67;1.67;1.67	5.6	5.6	0.85130	.	0.545382	0.17900	N	0.158213	T	0.58581	0.2132	M	0.76433	2.335	0.80722	D	1	D;B	0.89917	1.0;0.236	D;B	0.91635	0.999;0.053	T	0.55860	-0.8074	9	.	.	.	-5.4607	18.6038	0.91259	0.0:0.0:1.0:0.0	.	152;140	Q5VU57-2;Q5VU57	.;CBPC6_HUMAN	L	140;134;140;140	ENSP00000360905:P140L;ENSP00000360904:P140L;ENSP00000360902:P140L	.	P	-	2	0	AGBL4	49284018	1.000000	0.71417	0.994000	0.49952	0.915000	0.54546	9.444000	0.97578	2.640000	0.89533	0.563000	0.77884	CCG	AGBL4	-	NULL	ENSG00000186094		0.403	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL4	HGNC	protein_coding	OTTHUMT00000021346.4	-	0.00	34	0	G	NM_032785		49511431	-1	tier1	-	no_errors	ENST00000371839	ensembl	human	known	74_37	missense	26.83	30	11	SNP	1.000	A
AHNAK	79026	genome.wustl.edu	37	11	62285778	62285778	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:62285778G>A	ENST00000378024.4	-	5	16385	c.16111C>T	c.(16111-16113)Cag>Tag	p.Q5371*	AHNAK_ENST00000525875.1_5'Flank|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5371					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AGATCTCCCTGCAGGCTTGGT	0.532																																																	0													113.0	88.0	97.0					11																	62285778		2202	4299	6501	SO:0001587	stop_gained	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.16111C>T	11.37:g.62285778G>A	ENSP00000367263:p.Gln5371*		A1A586	Nonsense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Q5371*	ENST00000378024.4	37	c.16111	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	G	57	27.410623	0.99971	.	.	ENSG00000124942	ENST00000378024	.	.	.	3.73	2.69	0.31865	.	0.232742	0.21615	U	0.071729	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	8.9071	0.35530	0.0:0.0:0.5431:0.4569	.	.	.	.	X	5371	.	ENSP00000367263:Q5371X	Q	-	1	0	AHNAK	62042354	0.966000	0.33281	1.000000	0.80357	0.993000	0.82548	1.879000	0.39618	2.013000	0.59113	0.453000	0.30009	CAG	AHNAK	-	NULL	ENSG00000124942		0.532	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1		0.00	75	0	G	NM_024060		62285778	-1			no_errors	ENST00000378024	ensembl	human	known	74_37	nonsense	5.06	75	4	SNP	1.000	A
AK5	26289	genome.wustl.edu	37	1	78024350	78024350	+	Missense_Mutation	SNP	T	T	A	rs77417596		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:78024350T>A	ENST00000354567.2	+	14	1947	c.1684T>A	c.(1684-1686)Ttc>Atc	p.F562I	AK5_ENST00000478255.1_Missense_Mutation_p.F77I|AK5_ENST00000344720.5_Missense_Mutation_p.F536I	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	562					ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						TGACTCTATTTTCTGAAGGCA	0.333																																																	0													96.0	84.0	88.0					1																	78024350		2203	4300	6503	SO:0001583	missense	0			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.1684T>A	1.37:g.78024350T>A	ENSP00000346577:p.Phe562Ile		Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_Dpy-30_motif,superfamily_P-loop_NTPase,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin,tigrfam_Adenylate_kin1	p.F562I	ENST00000354567.2	37	c.1684	CCDS675.1	1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.950980	0.73787	.	.	ENSG00000154027	ENST00000354567;ENST00000344720;ENST00000478255	T;T;T	0.77877	-0.68;-0.68;-1.13	5.64	5.64	0.86602	.	0.163070	0.42420	D	0.000709	T	0.63129	0.2485	L	0.50333	1.59	0.40982	D	0.984786	B	0.23891	0.093	B	0.12837	0.008	T	0.64089	-0.6489	10	0.44086	T	0.13	-3.2311	16.1703	0.81808	0.0:0.0:0.0:1.0	rs6485	562	Q9Y6K8	KAD5_HUMAN	I	562;536;77	ENSP00000346577:F562I;ENSP00000341430:F536I;ENSP00000433915:F77I	ENSP00000341430:F536I	F	+	1	0	AK5	77796938	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.544000	0.45761	2.284000	0.76573	0.528000	0.53228	TTC	AK5	-	superfamily_P-loop_NTPase	ENSG00000154027		0.333	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	HGNC	protein_coding	OTTHUMT00000026993.4		0.00	78	0	T	NM_174858		78024350	+1			no_errors	ENST00000354567	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	A
ANK2	287	genome.wustl.edu	37	4	114179302	114179302	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:114179302G>A	ENST00000357077.4	+	12	1338	c.1285G>A	c.(1285-1287)Gag>Aag	p.E429K	ANK2_ENST00000506722.1_Missense_Mutation_p.E408K|ANK2_ENST00000394537.3_Missense_Mutation_p.E429K|ANK2_ENST00000264366.6_Missense_Mutation_p.E429K	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	429					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGCTATAACAGAGGTAGAAAA	0.403																																																	0													114.0	101.0	105.0					4																	114179302		2203	4300	6503	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1285G>A	4.37:g.114179302G>A	ENSP00000349588:p.Glu429Lys		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.E429K	ENST00000357077.4	37	c.1285	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	34	5.312643	0.95655	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.70045	-0.45;2.47;2.47;2.47;-0.45;2.47;2.47	6.04	6.04	0.98038	Ankyrin repeat-containing domain (3);	0.000000	0.56097	D	0.000032	T	0.69540	0.3122	N	0.10629	0.01	0.80722	D	1	D;D;P;P;D	0.60575	0.961;0.982;0.837;0.936;0.988	P;D;B;P;D	0.77557	0.734;0.918;0.381;0.57;0.99	T	0.74836	-0.3529	10	0.54805	T	0.06	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	429;429;429;408;408	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	K	408;408;408;444;429;429;429;408	ENSP00000423799:E408K;ENSP00000421011:E408K;ENSP00000421067:E408K;ENSP00000424722:E444K;ENSP00000378044:E429K;ENSP00000349588:E429K;ENSP00000264366:E429K	ENSP00000264366:E429K	E	+	1	0	ANK2	114398751	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.766000	0.98957	2.873000	0.98535	0.563000	0.77884	GAG	ANK2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145362		0.403	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	49	0	G	NM_001148		114179302	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	missense	14.58	41	7	SNP	1.000	A
ANKRD36C	400986	genome.wustl.edu	37	2	96604610	96604610	+	Silent	SNP	A	A	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:96604610A>G	ENST00000456556.1	-	22	1684	c.1600T>C	c.(1600-1602)Tta>Cta	p.L534L				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	534							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						ATACTTCCTAAGAATCTAGTT	0.318																																																	0																																										SO:0001819	synonymous_variant	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.1600T>C	2.37:g.96604610A>G			C9JZ08|Q15694|Q53S06|Q658V2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L534	ENST00000456556.1	37	c.1600		2																																																																																			ANKRD36C	-	NULL	ENSG00000174501		0.318	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	-	0.00	281	0	A	NM_001010914		96604610	-1	tier1	-	no_errors	ENST00000456556	ensembl	human	known	74_37	silent	6.85	339	25	SNP	0.000	G
APCDD1	147495	genome.wustl.edu	37	18	10487985	10487985	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr18:10487985G>A	ENST00000355285.5	+	5	1849	c.1495G>A	c.(1495-1497)Gct>Act	p.A499T		NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		CCTGCTGCTGGCTGCACTTGC	0.552																																																	0													48.0	57.0	54.0					18																	10487985		2202	4300	6502	SO:0001583	missense	0			AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1495G>A	18.37:g.10487985G>A	ENSP00000347433:p.Ala499Thr			Missense_Mutation	SNP	NULL	p.A499T	ENST00000355285.5	37	c.1495	CCDS11849.1	18	.	.	.	.	.	.	.	.	.	.	G	6.386	0.439382	0.12104	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.36699	1.24	5.53	-0.806	0.10875	.	0.746135	0.12757	N	0.441642	T	0.15176	0.0366	N	0.16478	0.41	0.09310	N	0.999997	B	0.06786	0.001	B	0.06405	0.002	T	0.33214	-0.9877	10	0.02654	T	1	-4.769	5.9369	0.19171	0.3659:0.3002:0.3338:0.0	.	499	Q8J025	APCD1_HUMAN	T	499;550	ENSP00000347433:A499T	ENSP00000347433:A499T	A	+	1	0	APCDD1	10477985	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.186000	0.16978	0.134000	0.18681	-0.244000	0.11960	GCT	APCDD1	-	NULL	ENSG00000154856		0.552	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APCDD1	HGNC	protein_coding	OTTHUMT00000254529.2	-	0.00	53	0	G	NM_153000		10487985	+1	tier1	-	no_errors	ENST00000355285	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.000	A
APOBEC2	10930	genome.wustl.edu	37	6	41029176	41029176	+	Missense_Mutation	SNP	G	G	A	rs144963628		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr6:41029176G>A	ENST00000244669.2	+	2	285	c.241G>A	c.(241-243)Ggc>Agc	p.G81S		NM_006789.3	NP_006780.1	Q9Y235	ABEC2_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2	81					cytidine deamination (GO:0009972)|DNA demethylation (GO:0080111)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)		cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)|skin(1)	10	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGGCAAGGGGGGCCAAGTGCA	0.557																																					Ovarian(118;1320 2185 8096 29684)												0													80.0	77.0	78.0					6																	41029176		2203	4300	6503	SO:0001583	missense	0			AF161698	CCDS4848.1	6p21	2008-02-05			ENSG00000124701	ENSG00000124701		"""Apolipoprotein B mRNA editing enzymes"""	605	protein-coding gene	gene with protein product		604797				10403781	Standard	NM_006789		Approved	ARCD1, ARP1	uc003opl.3	Q9Y235	OTTHUMG00000014670	ENST00000244669.2:c.241G>A	6.37:g.41029176G>A	ENSP00000244669:p.Gly81Ser		B2R899|Q53F28|Q5TGU5|Q5TGU6	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.G81S	ENST00000244669.2	37	c.241	CCDS4848.1	6	.	.	.	.	.	.	.	.	.	.	G	10.97	1.501346	0.26861	.	.	ENSG00000124701	ENST00000244669	T	0.61859	0.07	5.69	4.81	0.61882	APOBEC-like, N-terminal (1);	0.539436	0.21461	N	0.074167	T	0.16557	0.0398	N	0.10707	0.03	0.43703	D	0.996165	B	0.25272	0.122	B	0.20577	0.03	T	0.10451	-1.0629	10	0.08381	T	0.77	.	11.6757	0.51427	0.0847:0.0:0.9153:0.0	.	81	Q9Y235	ABEC2_HUMAN	S	81	ENSP00000244669:G81S	ENSP00000244669:G81S	G	+	1	0	APOBEC2	41137154	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.318000	0.51975	2.676000	0.91093	0.655000	0.94253	GGC	APOBEC2	-	pfam_APOBEC_N	ENSG00000124701		0.557	APOBEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC2	HGNC	protein_coding	OTTHUMT00000040498.1	-	0.00	68	0	G	NM_006789		41029176	+1	tier1	-	no_errors	ENST00000244669	ensembl	human	known	74_37	missense	31.76	58	27	SNP	1.000	A
ARHGAP39	80728	genome.wustl.edu	37	8	145759580	145759580	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:145759580G>A	ENST00000276826.5	-	6	2729	c.2528C>T	c.(2527-2529)gCg>gTg	p.A843V	ARHGAP39_ENST00000377307.2_Missense_Mutation_p.A874V|ARHGAP39_ENST00000540274.1_Missense_Mutation_p.A843V			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	843	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						CGTGCTTATCGCCACCCCTGG	0.642																																																	0													98.0	92.0	94.0					8																	145759580		2203	4300	6503	SO:0001583	missense	0				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2528C>T	8.37:g.145759580G>A	ENSP00000276826:p.Ala843Val		B4E1I1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_MyTH4_dom,superfamily_Rho_GTPase_activation_prot,superfamily_WW_dom,smart_WW_dom,smart_MyTH4_dom,smart_RhoGAP_dom,pfscan_MyTH4_dom,pfscan_WW_dom,pfscan_RhoGAP_dom	p.A874V	ENST00000276826.5	37	c.2621		8	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750905	0.89753	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	D;T;D	0.92048	-2.96;-0.11;-2.96	4.54	4.54	0.55810	MyTH4 domain (2);	0.201492	0.42172	D	0.000754	D	0.93779	0.8011	L	0.47716	1.5	0.42499	D	0.992924	D;D	0.76494	0.999;0.999	D;D	0.66084	0.941;0.926	D	0.94511	0.7718	10	0.66056	D	0.02	-22.4669	14.7964	0.69881	0.0:0.0:1.0:0.0	.	843;874	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	V	843;874;843	ENSP00000276826:A843V;ENSP00000366522:A874V;ENSP00000445075:A843V	ENSP00000276826:A843V	A	-	2	0	ARHGAP39	145730388	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	7.952000	0.87827	2.094000	0.63399	0.455000	0.32223	GCG	ARHGAP39	-	pfscan_MyTH4_dom	ENSG00000147799		0.642	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	ARHGAP39	HGNC	protein_coding	OTTHUMT00000382509.1	-	0.00	74	0	G			145759580	-1	tier1	-	no_errors	ENST00000377307	ensembl	human	known	74_37	missense	8.08	91	8	SNP	1.000	A
ARHGEF9	23229	genome.wustl.edu	37	X	62857924	62857924	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrX:62857924G>T	ENST00000253401.6	-	10	2335	c.1535C>A	c.(1534-1536)aCc>aAc	p.T512N	ARHGEF9_ENST00000374878.1_Intron|ARHGEF9_ENST00000437457.2_Missense_Mutation_p.T459N|ARHGEF9_ENST00000374870.4_Missense_Mutation_p.T410N|ARHGEF9_ENST00000374872.1_Missense_Mutation_p.T491N|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000433323.2_Missense_Mutation_p.T239N	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	512					apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						TTTGAAGGGGGTTAACCTGCT	0.438																																																	0													65.0	58.0	60.0					X																	62857924		2203	4300	6503	SO:0001583	missense	0			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.1535C>A	X.37:g.62857924G>T	ENSP00000253401:p.Thr512Asn		A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.T512N	ENST00000253401.6	37	c.1535	CCDS35315.1	X	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255220	0.80135	.	.	ENSG00000131089	ENST00000253401;ENST00000437457;ENST00000374870;ENST00000433323;ENST00000374872	T;T;T;T;T	0.75050	-0.77;-0.9;-0.63;-0.4;-0.85	5.57	5.57	0.84162	.	0.301527	0.36778	N	0.002403	T	0.80597	0.4653	L	0.49126	1.545	0.58432	D	0.999997	D;P;P	0.53619	0.961;0.932;0.932	P;P;P	0.56398	0.797;0.557;0.635	T	0.82426	-0.0463	10	0.72032	D	0.01	.	17.0261	0.86447	0.0:0.0:1.0:0.0	.	459;512;512	B4DHC7;O43307;A8K1S8	.;ARHG9_HUMAN;.	N	512;459;410;239;491	ENSP00000253401:T512N;ENSP00000399994:T459N;ENSP00000364004:T410N;ENSP00000404478:T239N;ENSP00000364006:T491N	ENSP00000253401:T512N	T	-	2	0	ARHGEF9	62774649	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.197000	0.94985	2.334000	0.79466	0.523000	0.50628	ACC	ARHGEF9	-	NULL	ENSG00000131089		0.438	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	HGNC	protein_coding	OTTHUMT00000056937.1		0.00	67	0	G			62857924	-1			no_errors	ENST00000253401	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
ASB8	140461	genome.wustl.edu	37	12	48543324	48543324	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:48543324G>T	ENST00000317697.3	-	4	861	c.692C>A	c.(691-693)gCc>gAc	p.A231D	ASB8_ENST00000536953.1_3'UTR|ASB8_ENST00000537754.1_5'UTR|ASB8_ENST00000536549.1_Missense_Mutation_p.A231D	NM_024095.3	NP_077000.1	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box containing 8	231					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|large_intestine(2)|lung(5)|soft_tissue(1)	11						CGGGTCTCTGGCCACCTCTCG	0.527																																																	0													78.0	78.0	78.0					12																	48543324		2203	4300	6503	SO:0001583	missense	0			AK024908	CCDS8761.1	12q13.12	2013-01-10	2011-01-25			ENSG00000177981		"""Ankyrin repeat domain containing"""	17183	protein-coding gene	gene with protein product		615053	"""ankyrin repeat and SOCS box-containing 8"""			12076535	Standard	NM_024095		Approved	MGC5540, FLJ21255	uc001rrh.3	Q9H765		ENST00000317697.3:c.692C>A	12.37:g.48543324G>T	ENSP00000320893:p.Ala231Asp		A8K1P2|Q547Q2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.A231D	ENST00000317697.3	37	c.692	CCDS8761.1	12	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017256	0.35606	.	.	ENSG00000177981	ENST00000317697;ENST00000536549;ENST00000446549	T;T	0.42513	0.97;0.97	5.19	4.29	0.51040	Ankyrin repeat-containing domain (1);	0.367046	0.33691	N	0.004649	T	0.28699	0.0711	N	0.24115	0.695	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09618	-1.0666	10	0.87932	D	0	-5.1047	9.503	0.39028	0.0751:0.0:0.7805:0.1444	.	231	Q9H765	ASB8_HUMAN	D	231;231;198	ENSP00000320893:A231D;ENSP00000445622:A231D	ENSP00000320893:A231D	A	-	2	0	ASB8	46829591	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	2.622000	0.46427	1.316000	0.45131	-0.182000	0.12963	GCC	ASB8	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000177981		0.527	ASB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB8	HGNC	protein_coding	OTTHUMT00000396497.1		0.00	69	0	G			48543324	-1			no_errors	ENST00000317697	ensembl	human	known	74_37	missense	8.51	42	4	SNP	1.000	T
ATMIN	23300	genome.wustl.edu	37	16	81078006	81078006	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:81078006G>T	ENST00000299575.4	+	4	1927	c.1903G>T	c.(1903-1905)Gat>Tat	p.D635Y	ATMIN_ENST00000539819.1_3'UTR|ATMIN_ENST00000564241.1_Missense_Mutation_p.D479Y|ATMIN_ENST00000566488.1_Missense_Mutation_p.D479Y	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	635					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						CCCCGGAATCGATTTTGATAT	0.498																																																	0													37.0	40.0	39.0					16																	81078006		2202	4300	6502	SO:0001583	missense	0			BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.1903G>T	16.37:g.81078006G>T	ENSP00000299575:p.Asp635Tyr		A8K4H8|Q68DC9	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.D635Y	ENST00000299575.4	37	c.1903	CCDS32494.1	16	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257489	0.59321	.	.	ENSG00000166454	ENST00000299575;ENST00000539819	T	0.50548	0.74	6.17	6.17	0.99709	.	0.042297	0.85682	D	0.000000	T	0.71660	0.3366	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71616	-0.4539	10	0.87932	D	0	-27.8069	20.8794	0.99867	0.0:0.0:1.0:0.0	.	635	O43313	ATMIN_HUMAN	Y	635;406	ENSP00000299575:D635Y	ENSP00000299575:D635Y	D	+	1	0	ATMIN	79635507	1.000000	0.71417	0.984000	0.44739	0.185000	0.23345	9.298000	0.96132	2.941000	0.99782	0.655000	0.94253	GAT	ATMIN	-	NULL	ENSG00000166454		0.498	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATMIN	HGNC	protein_coding	OTTHUMT00000432140.1	-	0.00	81	0	G	NM_015251		81078006	+1	tier1	-	no_errors	ENST00000299575	ensembl	human	known	74_37	missense	14.13	79	13	SNP	1.000	T
ATP10A	57194	genome.wustl.edu	37	15	25925092	25925092	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr15:25925092A>C	ENST00000356865.6	-	21	4007	c.3896T>G	c.(3895-3897)gTt>gGt	p.V1299G		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1299					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TGTGGGGAAAACCCTCCCCTG	0.498																																																	0													63.0	69.0	67.0					15																	25925092		2202	4300	6502	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3896T>G	15.37:g.25925092A>C	ENSP00000349325:p.Val1299Gly		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V1299G	ENST00000356865.6	37	c.3896	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	A	11.54	1.670179	0.29693	.	.	ENSG00000206190	ENST00000356865	T	0.40476	1.03	5.41	5.41	0.78517	.	0.165674	0.41396	D	0.000899	T	0.34600	0.0903	L	0.29908	0.895	0.58432	D	0.999992	B	0.14012	0.009	B	0.12156	0.007	T	0.10800	-1.0614	10	0.56958	D	0.05	-11.9684	15.4508	0.75271	1.0:0.0:0.0:0.0	.	1299	O60312	AT10A_HUMAN	G	1299	ENSP00000349325:V1299G	ENSP00000349325:V1299G	V	-	2	0	ATP10A	23476185	0.962000	0.33011	0.413000	0.26509	0.030000	0.12068	6.988000	0.76212	2.047000	0.60756	0.533000	0.62120	GTT	ATP10A	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000206190		0.498	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1		0.00	42	0	A	NM_024490		25925092	-1			no_errors	ENST00000356865	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.739	C
ATP10B	23120	genome.wustl.edu	37	5	160025796	160025796	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:160025796T>A	ENST00000327245.5	-	22	4391	c.3545A>T	c.(3544-3546)aAg>aTg	p.K1182M		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1182					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGCCACTCTTGTATAGCTC	0.498																																																	0													269.0	255.0	260.0					5																	160025796		1940	4133	6073	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3545A>T	5.37:g.160025796T>A	ENSP00000313600:p.Lys1182Met		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.K1182M	ENST00000327245.5	37	c.3545	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	T	13.86	2.362223	0.41902	.	.	ENSG00000118322	ENST00000327245	T	0.68624	-0.34	5.53	1.82	0.25136	.	0.218042	0.47455	D	0.000236	T	0.70587	0.3241	L	0.52011	1.625	0.42190	D	0.991725	D	0.71674	0.998	D	0.63033	0.91	T	0.67146	-0.5744	9	.	.	.	.	8.9732	0.35919	0.0:0.2155:0.0:0.7845	.	1182	O94823	AT10B_HUMAN	M	1182	ENSP00000313600:K1182M	.	K	-	2	0	ATP10B	159958374	0.967000	0.33354	0.994000	0.49952	0.973000	0.67179	1.326000	0.33735	0.407000	0.25591	0.533000	0.62120	AAG	ATP10B	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000118322		0.498	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	-	0.00	53	0	T	NM_025153		160025796	-1	tier1	-	no_errors	ENST00000327245	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.987	A
BAI1	575	genome.wustl.edu	37	8	143602279	143602279	+	Missense_Mutation	SNP	G	G	A	rs374047873		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:143602279G>A	ENST00000517894.1	+	20	3911	c.3017G>A	c.(3016-3018)cGc>cAc	p.R1006H	BAI1_ENST00000323289.5_Missense_Mutation_p.R1006H			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1006					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ACCCAGACCCGCAACAAGGTA	0.597																																																	0								G	HIS/ARG	0,4342		0,0,2171	112.0	117.0	116.0		3017	2.9	1.0	8		116	1,8525		0,1,4262	no	missense	BAI1	NM_001702.2	29	0,1,6433	AA,AG,GG		0.0117,0.0,0.0078	benign	1006/1585	143602279	1,12867	2171	4263	6434	SO:0001583	missense	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3017G>A	8.37:g.143602279G>A	ENSP00000430945:p.Arg1006His			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.R1006H	ENST00000517894.1	37	c.3017		8	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737299	0.30774	0.0	1.17E-4	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.37058	1.22;1.22	2.86	2.86	0.33363	.	0.428735	0.18894	U	0.128228	T	0.21761	0.0524	N	0.02916	-0.46	0.43632	D	0.996026	P	0.43477	0.808	P	0.46389	0.515	T	0.15492	-1.0435	10	0.39692	T	0.17	.	12.7427	0.57261	0.0:0.0:1.0:0.0	.	1006	E9PBK0	.	H	1006	ENSP00000430945:R1006H;ENSP00000313046:R1006H	ENSP00000313046:R1006H	R	+	2	0	BAI1	143599281	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	4.455000	0.60075	1.406000	0.46857	0.446000	0.29264	CGC	BAI1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000181790		0.597	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	-	0.00	32	0	G	NM_001702		143602279	+1	tier1	-	no_errors	ENST00000323289	ensembl	human	known	74_37	missense	31.82	15	7	SNP	1.000	A
BCL2L11	10018	genome.wustl.edu	37	2	111907707	111907707	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:111907707G>T	ENST00000393256.3	+	3	754	c.481G>T	c.(481-483)Gct>Tct	p.A161S	BCL2L11_ENST00000393253.2_Missense_Mutation_p.A71S|BCL2L11_ENST00000357757.2_Missense_Mutation_p.A161S|BCL2L11_ENST00000308659.8_Missense_Mutation_p.A101S	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	161					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						CGAGTTTAACGCTTACTATGC	0.463																																																	0													164.0	122.0	136.0					2																	111907707		2203	4300	6503	SO:0001583	missense	0			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.481G>T	2.37:g.111907707G>T	ENSP00000376943:p.Ala161Ser		A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	pfam_Bcl-x_interacting_BH3_dom,pfam_Apoptosis_Bim_N,pirsf_Bcl-2-like_11	p.A161S	ENST00000393256.3	37	c.481	CCDS2089.1	2	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718157	0.48622	.	.	ENSG00000153094	ENST00000308659;ENST00000357757;ENST00000393253;ENST00000393256;ENST00000452033	.	.	.	5.89	4.08	0.47627	Bcl-x interacting (1);	0.587171	0.16174	N	0.226132	T	0.25975	0.0633	L	0.27053	0.805	0.21147	N	0.999776	B;B;P	0.35793	0.073;0.089;0.521	B;B;B	0.36134	0.098;0.101;0.218	T	0.13656	-1.0501	9	0.62326	D	0.03	0.112	8.2618	0.31790	0.0832:0.1568:0.76:0.0	.	71;161;101	O43521-3;O43521;O43521-2	.;B2L11_HUMAN;.	S	101;161;71;161;28	.	ENSP00000309226:A101S	A	+	1	0	BCL2L11	111624178	0.653000	0.27358	0.017000	0.16124	0.945000	0.59286	1.918000	0.40006	0.817000	0.34445	0.591000	0.81541	GCT	BCL2L11	-	pfam_Bcl-x_interacting_BH3_dom,pirsf_Bcl-2-like_11	ENSG00000153094		0.463	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L11	HGNC	protein_coding	OTTHUMT00000254022.3	-	0.00	75	0	G			111907707	+1	tier1	-	no_errors	ENST00000393256	ensembl	human	known	74_37	missense	5.68	83	5	SNP	0.063	T
BMS1P8	653557	genome.wustl.edu	37	16	33497283	33497283	+	RNA	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:33497283A>C	ENST00000565156.1	-	0	551									BMS1 pseudogene 8																		TGTTCAATCAAATTTAACGTT	0.323																																																	0																																												0					16p11.2	2013-09-20			ENSG00000260518	ENSG00000260518			49152	pseudogene	pseudogene							Standard	NG_011420		Approved				OTTHUMG00000176352		16.37:g.33497283A>C				RNA	SNP	-	NULL	ENST00000565156.1	37	NULL		16																																																																																			BMS1P8	-	-	ENSG00000260518		0.323	BMS1P8-003	KNOWN	basic	processed_transcript	BMS1P8	HGNC	pseudogene	OTTHUMT00000431810.1	-	0.00	89	0	A			33497283	-1	tier1	-	no_errors	ENST00000565156	ensembl	human	known	74_37	rna	13.75	69	11	SNP	0.301	C
BTAF1	9044	genome.wustl.edu	37	10	93744056	93744056	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:93744056G>T	ENST00000265990.6	+	19	2630	c.2322G>T	c.(2320-2322)atG>atT	p.M774I	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	774					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TCACACGAATGCAGAATGAAT	0.353																																																	0													102.0	90.0	94.0					10																	93744056		2202	4300	6502	SO:0001583	missense	0			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.2322G>T	10.37:g.93744056G>T	ENSP00000265990:p.Met774Ile		B4E0W6|O43578	Missense_Mutation	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M774I	ENST00000265990.6	37	c.2322	CCDS7419.1	10	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047453	0.55110	.	.	ENSG00000095564	ENST00000265990	D	0.89415	-2.51	5.67	5.67	0.87782	Domain of unknown function DUF3535 (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.91389	0.7283	M	0.68952	2.095	0.80722	D	1	P;P	0.38788	0.647;0.647	P;P	0.46718	0.525;0.525	D	0.89693	0.3899	10	0.36615	T	0.2	-12.32	19.7677	0.96349	0.0:0.0:1.0:0.0	.	774;774	Q2M1V9;O14981	.;BTAF1_HUMAN	I	774	ENSP00000265990:M774I	ENSP00000265990:M774I	M	+	3	0	BTAF1	93734036	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.668000	0.90789	0.650000	0.86243	ATG	BTAF1	-	pfam_DUF3535,superfamily_ARM-type_fold	ENSG00000095564		0.353	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	-	0.00	51	0	G	NM_003972		93744056	+1	tier1	-	no_errors	ENST00000265990	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
BZW2	28969	genome.wustl.edu	37	7	16685879	16685879	+	5'UTR	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr7:16685879C>T	ENST00000433922.2	+	0	121				BZW2_ENST00000405202.1_5'UTR|BZW2_ENST00000258761.3_5'UTR|BZW2_ENST00000452975.2_5'UTR|ANKMY2_ENST00000421746.1_5'Flank|BZW2_ENST00000432311.1_3'UTR|ANKMY2_ENST00000306999.2_5'Flank	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2						cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		GCCGCAGCCCCCAGCCTTGCG	0.652																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.-58C>T	7.37:g.16685879C>T			A4D123|Q3B779|Q96JW5|Q9H3F7	RNA	SNP	-	NULL	ENST00000433922.2	37	NULL	CCDS5362.1	7																																																																																			BZW2	-	-	ENSG00000136261		0.652	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BZW2	HGNC	protein_coding	OTTHUMT00000253256.2	-	0.00	60	0	C	NM_014038		16685879	+1	tier1	-	no_errors	ENST00000432311	ensembl	human	known	74_37	rna	6.35	59	4	SNP	0.758	T
C11orf87	399947	genome.wustl.edu	37	11	109294749	109294749	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:109294749G>T	ENST00000327419.6	+	2	793	c.390G>T	c.(388-390)cgG>cgT	p.R130R	RP11-708B6.2_ENST00000532929.1_RNA|RP11-708B6.2_ENST00000532992.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	130						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						AGGAAACCCGGCTGGAGAGGC	0.697																																																	0													50.0	58.0	55.0					11																	109294749		2201	4298	6499	SO:0001819	synonymous_variant	0			AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.390G>T	11.37:g.109294749G>T			B4E169	Silent	SNP	superfamily_MFS_dom_general_subst_transpt	p.R130	ENST00000327419.6	37	c.390	CCDS31672.1	11																																																																																			C11orf87	-	NULL	ENSG00000185742		0.697	C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf87	HGNC	protein_coding	OTTHUMT00000390403.1	-	0.00	21	0	G	NM_207645		109294749	+1	tier1	-	no_errors	ENST00000327419	ensembl	human	known	74_37	silent	20.00	16	4	SNP	1.000	T
C15orf39	56905	genome.wustl.edu	37	15	75498677	75498677	+	Silent	SNP	G	G	T	rs200766020	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr15:75498677G>T	ENST00000360639.2	+	2	608	c.288G>T	c.(286-288)tcG>tcT	p.S96S	C15orf39_ENST00000567617.1_Silent_p.S96S|C15orf39_ENST00000394987.4_Silent_p.S96S			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	96						cytoplasm (GO:0005737)		p.S96S(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						TCTACCGCTCGCCAGCAGAAG	0.622																																																	1	Substitution - coding silent(1)	large_intestine(1)											61.0	49.0	53.0					15																	75498677		2197	4295	6492	SO:0001819	synonymous_variant	0			AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.288G>T	15.37:g.75498677G>T			B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Silent	SNP	NULL	p.S96	ENST00000360639.2	37	c.288	CCDS10276.1	15																																																																																			C15orf39	-	NULL	ENSG00000167173		0.622	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf39	HGNC	protein_coding	OTTHUMT00000286410.1		0.00	46	0	G	NM_015492		75498677	+1			no_errors	ENST00000360639	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.000	T
C16orf78	123970	genome.wustl.edu	37	16	49430393	49430393	+	Nonsense_Mutation	SNP	C	C	T	rs139737719		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:49430393C>T	ENST00000299191.3	+	4	571	c.454C>T	c.(454-456)Cga>Tga	p.R152*		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	152			R -> Q (in dbSNP:rs16947350).			nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						CCCATTCCGTCGACAAAGCAT	0.498																																																	0								C	stop/ARG	0,4398		0,0,2199	103.0	94.0	97.0		454	0.8	0.0	16	dbSNP_134	97	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	C16orf78	NM_144602.2		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		152/266	49430393	1,12997	2199	4300	6499	SO:0001587	stop_gained	0			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.454C>T	16.37:g.49430393C>T	ENSP00000299191:p.Arg152*			Nonsense_Mutation	SNP	NULL	p.R152*	ENST00000299191.3	37	c.454	CCDS10738.1	16	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532305	0.64972	0.0	1.16E-4	ENSG00000166152	ENST00000299191	.	.	.	5.38	0.781	0.18561	.	0.417296	0.17889	N	0.158593	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-19.9266	5.8499	0.18687	0.5203:0.386:0.0:0.0936	.	.	.	.	X	152	.	.	R	+	1	2	C16orf78	47987894	0.000000	0.05858	0.007000	0.13788	0.016000	0.09150	0.323000	0.19593	0.651000	0.30788	0.655000	0.94253	CGA	C16orf78	-	NULL	ENSG00000166152		0.498	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	HGNC	protein_coding	OTTHUMT00000256846.1	-	0.00	42	0	C	NM_144602		49430393	+1	tier1	rs139737719	no_errors	ENST00000299191	ensembl	human	known	74_37	nonsense	22.86	27	8	SNP	0.000	T
CARF	79800	genome.wustl.edu	37	2	203831815	203831815	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:203831815C>T	ENST00000402905.3	+	9	1268	c.947C>T	c.(946-948)cCa>cTa	p.P316L	CARF_ENST00000428585.1_Missense_Mutation_p.P240L|CARF_ENST00000320443.8_Missense_Mutation_p.P316L|CARF_ENST00000438828.2_Missense_Mutation_p.P316L|CARF_ENST00000545262.1_Missense_Mutation_p.P240L|CARF_ENST00000456821.2_3'UTR|CARF_ENST00000545253.1_Missense_Mutation_p.P228L|WDR12_ENST00000477723.1_Intron|CARF_ENST00000414439.1_Missense_Mutation_p.P214L	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	316					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCCACTTGTCCAGCTCGGTAA	0.338																																																	0													157.0	156.0	156.0					2																	203831815		1831	4095	5926	SO:0001583	missense	0			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.947C>T	2.37:g.203831815C>T	ENSP00000384006:p.Pro316Leu		B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	NULL	p.P316L	ENST00000402905.3	37	c.947	CCDS42801.1	2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.961167	0.92791	.	.	ENSG00000138380	ENST00000402905;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000320443;ENST00000438828	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.72993	0.3530	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.70016	0.967;0.944;0.944	T	0.74127	-0.3765	9	0.87932	D	0	-13.6208	19.3813	0.94536	0.0:1.0:0.0:0.0	.	228;240;316	B4DIA7;G3V1K7;Q8N187	.;.;AL2S8_HUMAN	L	316;214;240;228;240;316;316	.	ENSP00000316224:P316L	P	+	2	0	ALS2CR8	203540060	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.017000	0.70805	2.824000	0.97209	0.655000	0.94253	CCA	CARF	-	NULL	ENSG00000138380		0.338	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARF	HGNC	protein_coding	OTTHUMT00000335768.5	-	0.00	53	0	C	NM_001104586		203831815	+1	tier1	-	no_errors	ENST00000320443	ensembl	human	known	74_37	missense	15.52	49	9	SNP	1.000	T
CCL14	6358	genome.wustl.edu	37	17	34311384	34311384	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:34311384G>A	ENST00000394509.4	-	2	292	c.184C>T	c.(184-186)Ccc>Tcc	p.P62S	CTB-186H2.3_ENST00000593057.1_Intron|CCL14_ENST00000586216.1_Missense_Mutation_p.P62S|CTB-186H2.3_ENST00000591669.1_5'Flank|CCL14_ENST00000536149.1_Missense_Mutation_p.P78S|CCL16_ENST00000293275.3_5'Flank|CCL15-CCL14_ENST00000481427.2_3'UTR|CCL14_ENST00000480944.2_Missense_Mutation_p.P84S|CCL14_ENST00000435911.2_Missense_Mutation_p.P78S			Q16627	CCL14_HUMAN	chemokine (C-C motif) ligand 14	62					cell chemotaxis (GO:0060326)|cellular calcium ion homeostasis (GO:0006874)|immune response (GO:0006955)|positive regulation of cell proliferation (GO:0008284)	extracellular space (GO:0005615)				large_intestine(1)|lung(6)	7		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACAATTCCGGGCTTGGAGCAC	0.577																																																	0													101.0	85.0	91.0					17																	34311384		2203	4300	6503	SO:0001583	missense	0			Z49270	CCDS32624.1, CCDS45652.1	17q11.2	2014-04-10	2002-08-22	2002-08-23	ENSG00000213494	ENSG00000276409		"""Chemokine ligands"", ""Endogenous ligands"""	10612	protein-coding gene	gene with protein product		601392	"""small inducible cytokine subfamily A (Cys-Cys), member 14"""	SCYA14		8661057	Standard	NM_032963		Approved	HCC-1, HCC-3, NCC-2, SCYL2, CKb1, MCIF	uc010wcq.1	Q16627	OTTHUMG00000188403	ENST00000394509.4:c.184C>T	17.37:g.34311384G>A	ENSP00000378017:p.Pro62Ser		E1P649|E1P650|Q13954	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.P78S	ENST00000394509.4	37	c.232	CCDS32624.1	17	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642956	0.47153	.	.	ENSG00000213494	ENST00000394509;ENST00000536149;ENST00000435911	T;T;T	0.05382	3.45;3.45;3.45	5.14	1.94	0.25998	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.426103	0.17280	U	0.180059	T	0.07863	0.0197	.	.	.	0.25234	N	0.989806	P;P	0.46912	0.773;0.886	P;P	0.44673	0.453;0.457	T	0.17961	-1.0352	9	0.62326	D	0.03	.	7.5211	0.27629	0.0884:0.3176:0.594:0.0	.	62;78	Q16627;Q16627-2	CCL14_HUMAN;.	S	62;78;78	ENSP00000378017:P62S;ENSP00000441771:P78S;ENSP00000409197:P78S	ENSP00000378017:P62S	P	-	1	0	CCL14	31335497	0.127000	0.22367	0.709000	0.30452	0.603000	0.37013	0.060000	0.14342	0.241000	0.21283	0.563000	0.77884	CCC	CCL14	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000213494		0.577	CCL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL14	HGNC	protein_coding	OTTHUMT00000272892.2		0.00	50	0	G	NM_032962		34311384	-1			no_errors	ENST00000435911	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.992	A
CCT5	22948	genome.wustl.edu	37	5	10260964	10260964	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:10260964C>A	ENST00000280326.4	+	7	1354	c.934C>A	c.(934-936)Cac>Aac	p.H312N	CCT5_ENST00000503026.1_Missense_Mutation_p.H291N|CCT5_ENST00000515676.1_Missense_Mutation_p.H274N|CCT5_ENST00000515390.1_Missense_Mutation_p.H257N|CCT5_ENST00000506600.1_Missense_Mutation_p.H219N	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	312					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						TGAAGCAAATCACTTACTTCT	0.448																																																	0													243.0	251.0	248.0					5																	10260964		2203	4300	6503	SO:0001583	missense	0			D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.934C>A	5.37:g.10260964C>A	ENSP00000280326:p.His312Asn		A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_epsi	p.H312N	ENST00000280326.4	37	c.934	CCDS3877.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.349819	0.95830	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.89033	0.6600	H	0.97390	3.995	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.99;0.99;0.976;1.0;1.0;1.0	D	0.92312	0.5858	10	0.87932	D	0	-28.499	19.0925	0.93233	0.0:1.0:0.0:0.0	.	219;257;161;310;312;312	B4DYD8;E7ENZ3;B4DZY9;Q9BU08;A8K2X8;P48643	.;.;.;.;.;TCPE_HUMAN	N	312;291;257;285;274;219	ENSP00000280326:H312N;ENSP00000423318:H291N;ENSP00000426923:H257N;ENSP00000427297:H274N;ENSP00000423052:H219N	ENSP00000280326:H312N	H	+	1	0	CCT5	10313964	1.000000	0.71417	0.943000	0.38184	0.989000	0.77384	7.319000	0.79040	2.746000	0.94184	0.586000	0.80456	CAC	CCT5	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_epsi	ENSG00000150753		0.448	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT5	HGNC	protein_coding	OTTHUMT00000253688.2	-	0.00	98	0	C			10260964	+1	tier1	-	no_errors	ENST00000280326	ensembl	human	known	74_37	missense	14.81	68	12	SNP	1.000	A
CD22	933	genome.wustl.edu	37	19	35837104	35837104	+	Missense_Mutation	SNP	C	C	T	rs200771320		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:35837104C>T	ENST00000085219.5	+	13	2444	c.2378C>T	c.(2377-2379)aCg>aTg	p.T793M	MIR5196_ENST00000578146.1_RNA|CD22_ENST00000419549.2_Missense_Mutation_p.T621M|CD22_ENST00000341773.6_Missense_Mutation_p.T616M|CD22_ENST00000594250.1_Missense_Mutation_p.T616M|CD22_ENST00000536635.2_Missense_Mutation_p.T705M|CD22_ENST00000544992.2_3'UTR|CD22_ENST00000270311.6_Missense_Mutation_p.T608M	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	793					cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TGCGATGACACGGTCACTTAT	0.597																																					Ovarian(42;1009 1133 23674 26041)												0													117.0	101.0	107.0					19																	35837104		2203	4300	6503	SO:0001583	missense	0			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.2378C>T	19.37:g.35837104C>T	ENSP00000085219:p.Thr793Met		F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T793M	ENST00000085219.5	37	c.2378	CCDS12457.1	19	.	.	.	.	.	.	.	.	.	.	C	9.874	1.199709	0.22121	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000270311;ENST00000419549	T;T;T;T;T	0.56444	0.92;0.51;0.46;0.84;1.0	3.52	-1.79	0.07932	.	1.063330	0.07440	N	0.897106	T	0.51991	0.1707	M	0.65975	2.015	0.09310	N	1	P;P;P;D	0.54207	0.685;0.843;0.685;0.965	B;B;B;P	0.48627	0.036;0.289;0.036;0.584	T	0.48958	-0.8988	10	0.52906	T	0.07	.	3.8351	0.08891	0.0:0.3292:0.4014:0.2694	.	621;705;793;616	Q32M46;F5H7U3;P20273;P20273-2	.;.;CD22_HUMAN;.	M	793;705;616;608;621	ENSP00000085219:T793M;ENSP00000442279:T705M;ENSP00000339349:T616M;ENSP00000270311:T608M;ENSP00000403822:T621M	ENSP00000085219:T793M	T	+	2	0	CD22	40528944	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.367000	0.07553	-0.018000	0.14079	0.313000	0.20887	ACG	CD22	-	NULL	ENSG00000012124		0.597	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1		0.00	31	0	C	NM_001771		35837104	+1			no_errors	ENST00000085219	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.000	T
CDC42BPB	9578	genome.wustl.edu	37	14	103416922	103416922	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr14:103416922G>T	ENST00000361246.2	-	25	3478	c.3190C>A	c.(3190-3192)Cac>Aac	p.H1064N		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CAGGACACGTGGCAAGCAAAG	0.577																																																	0													54.0	45.0	48.0					14																	103416922		2202	4300	6502	SO:0001583	missense	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.3190C>A	14.37:g.103416922G>T	ENSP00000355237:p.His1064Asn			Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_CRIB_dom,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.H1064N	ENST00000361246.2	37	c.3190	CCDS9978.1	14	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290779	0.80914	.	.	ENSG00000198752	ENST00000361246;ENST00000541396	D	0.99557	-6.16	5.52	5.52	0.82312	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.85682	D	0.000000	D	0.99846	0.9929	H	0.99011	4.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96665	0.9492	10	0.87932	D	0	.	19.7885	0.96447	0.0:0.0:1.0:0.0	.	1064;1064	A9JR72;Q9Y5S2	.;MRCKB_HUMAN	N	1064;175	ENSP00000355237:H1064N	ENSP00000355237:H1064N	H	-	1	0	CDC42BPB	102486675	1.000000	0.71417	0.975000	0.42487	0.507000	0.33981	9.813000	0.99286	2.756000	0.94617	0.561000	0.74099	CAC	CDC42BPB	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_DAG/PE-bd	ENSG00000198752		0.577	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	-	0.00	47	0	G	NM_006035		103416922	-1	tier1	-	no_errors	ENST00000361246	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
CDH18	1016	genome.wustl.edu	37	5	19503156	19503156	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:19503156G>A	ENST00000507958.1	-	13	2565	c.1575C>T	c.(1573-1575)ttC>ttT	p.F525F	CDH18_ENST00000274170.4_Silent_p.F525F|CDH18_ENST00000502796.1_Silent_p.F525F|CDH18_ENST00000511273.1_Silent_p.F525F|CDH18_ENST00000506372.1_Silent_p.F525F|CDH18_ENST00000382275.1_Silent_p.F525F			Q13634	CAD18_HUMAN	cadherin 18, type 2	525	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CATCAAGAAAGAAGTTAAACC	0.338																																																	0													135.0	125.0	128.0					5																	19503156		2203	4300	6503	SO:0001819	synonymous_variant	0			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1575C>T	5.37:g.19503156G>A			A8K0I2|B4DHG6|Q8N5Z2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F525	ENST00000507958.1	37	c.1575	CCDS3889.1	5																																																																																			CDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000145526		0.338	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	HGNC	protein_coding	OTTHUMT00000366747.1	-	0.00	55	0	G	NM_004934		19503156	-1	tier1	-	no_errors	ENST00000274170	ensembl	human	known	74_37	silent	7.53	86	7	SNP	1.000	A
CDK13	8621	genome.wustl.edu	37	7	40118419	40118419	+	Missense_Mutation	SNP	G	G	T	rs34759339		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr7:40118419G>T	ENST00000181839.4	+	11	3603	c.2998G>T	c.(2998-3000)Gat>Tat	p.D1000Y	CDK13_ENST00000340829.5_Missense_Mutation_p.D1000Y	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1000					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						GTTCCTCCGAGATGTGGAACC	0.368																																																	0													75.0	73.0	74.0					7																	40118419		2203	4300	6503	SO:0001583	missense	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.2998G>T	7.37:g.40118419G>T	ENSP00000181839:p.Asp1000Tyr		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D1000Y	ENST00000181839.4	37	c.2998	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	G	13.94	2.388287	0.42308	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.47528	0.84;0.84	5.4	4.52	0.55395	Protein kinase-like domain (1);	.	.	.	.	T	0.65144	0.2663	L	0.60455	1.87	0.58432	D	0.999998	D;D	0.89917	1.0;0.982	D;P	0.91635	0.999;0.776	T	0.65668	-0.6112	8	.	.	.	-13.0712	16.6039	0.84823	0.0:0.1303:0.8697:0.0	.	1000;1000	Q14004-2;Q14004	.;CDK13_HUMAN	Y	1000	ENSP00000181839:D1000Y;ENSP00000340557:D1000Y	.	D	+	1	0	CDK13	40084944	1.000000	0.71417	0.992000	0.48379	0.564000	0.35744	8.023000	0.88764	1.408000	0.46895	-0.150000	0.13652	GAT	CDK13	-	superfamily_Kinase-like_dom	ENSG00000065883		0.368	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2	-	0.00	111	0	G	NM_003718		40118419	+1	tier1	-	no_errors	ENST00000181839	ensembl	human	known	74_37	missense	7.69	108	9	SNP	1.000	T
CDK2	1017	genome.wustl.edu	37	12	56364968	56364968	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:56364968G>A	ENST00000266970.4	+	6	969	c.729G>A	c.(727-729)tgG>tgA	p.W243*	RAB5B_ENST00000360299.5_5'Flank|CDK2_ENST00000440311.2_Nonsense_Mutation_p.W183*|CDK2_ENST00000354056.4_Nonsense_Mutation_p.W209*|RAB5B_ENST00000553116.1_5'Flank|CDK2_ENST00000556656.1_3'UTR|RAB5B_ENST00000448789.2_5'Flank|CDK2_ENST00000553376.1_Nonsense_Mutation_p.W291*	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2	243	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	TCCCCAAGTGGGCCCGGCAAG	0.517																																																	0													171.0	177.0	175.0					12																	56364968		2203	4300	6503	SO:0001587	stop_gained	0			M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.729G>A	12.37:g.56364968G>A	ENSP00000266970:p.Trp243*		A8K7C6|O75100	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.W243*	ENST00000266970.4	37	c.729	CCDS8898.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.093394	0.97276	.	.	ENSG00000123374	ENST00000266970;ENST00000553376;ENST00000440311;ENST00000354056	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4701	17.7108	0.88321	0.0:0.0:1.0:0.0	.	.	.	.	X	243;291;183;209	.	ENSP00000266970:W243X	W	+	3	0	CDK2	54651235	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	9.852000	0.99516	2.559000	0.86315	0.591000	0.81541	TGG	CDK2	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000123374		0.517	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK2	HGNC	protein_coding	OTTHUMT00000409650.1	-	0.00	81	0	G			56364968	+1	tier1	-	no_errors	ENST00000266970	ensembl	human	known	74_37	nonsense	15.71	59	11	SNP	1.000	A
CEACAM18	729767	genome.wustl.edu	37	19	51983670	51983670	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:51983670G>T	ENST00000396477.4	+	2	157	c.136G>T	c.(136-138)Gtc>Ttc	p.V46F	CEACAM18_ENST00000451626.1_Missense_Mutation_p.V107F	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	46										breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		ATATCGGACTGTCGTGGCCCT	0.547																																																	0													53.0	51.0	52.0					19																	51983670		1998	4152	6150	SO:0001583	missense	0					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.136G>T	19.37:g.51983670G>T	ENSP00000379738:p.Val46Phe		C9JN24	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V107F	ENST00000396477.4	37	c.319		19	.	.	.	.	.	.	.	.	.	.	.	4.237	0.043000	0.08196	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.05855	3.38	2.79	-5.59	0.02505	.	.	.	.	.	T	0.03136	0.0092	N	0.11427	0.14	0.09310	N	1	B	0.34181	0.44	B	0.36335	0.222	T	0.30880	-0.9963	9	0.59425	D	0.04	-0.0336	4.3077	0.10955	0.1311:0.3234:0.4365:0.109	.	107	A8MTB9	CEA18_HUMAN	F	107;46;46	ENSP00000402203:V107F	ENSP00000379738:V46F	V	+	1	0	CEACAM18	56675482	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.042000	0.00084	-3.681000	0.00122	-2.086000	0.00376	GTC	CEACAM18	-	smart_Ig_sub	ENSG00000213822		0.547	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	HGNC	protein_coding	OTTHUMT00000323114.2		0.00	67	0	G			51983670	+1			no_errors	ENST00000451626	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.000	T
CEP97	79598	genome.wustl.edu	37	3	101474334	101474334	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:101474334C>T	ENST00000341893.3	+	7	1541	c.789C>T	c.(787-789)caC>caT	p.H263H	CEP97_ENST00000327230.4_Silent_p.H263H|CEP97_ENST00000494050.1_Silent_p.H263H			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	263					cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						CTGGCCAGCACATCCAGCTTG	0.473																																																	0													112.0	102.0	106.0					3																	101474334		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.789C>T	3.37:g.101474334C>T			B5MDY8|Q8NA71|Q9H5T9	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.H263	ENST00000341893.3	37	c.789	CCDS2944.1	3																																																																																			CEP97	-	NULL	ENSG00000182504		0.473	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP97	HGNC	protein_coding	OTTHUMT00000353597.2	-	0.00	62	0	C	NM_024548		101474334	+1	tier1	-	no_errors	ENST00000327230	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.844	T
CEPT1	10390	genome.wustl.edu	37	1	111725371	111725371	+	Intron	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:111725371G>T	ENST00000545121.1	+	7	1054				RP5-1180E21.5_ENST00000610049.1_RNA|CEPT1_ENST00000467362.1_Intron|CEPT1_ENST00000357172.4_Intron|RP5-1180E21.4_ENST00000607951.1_RNA	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1						CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	GATCCATGTAGTATCTGATGA	0.388																																																	0													82.0	79.0	80.0					1																	111725371		2202	4300	6502	SO:0001627	intron_variant	0			AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.847-50G>T	1.37:g.111725371G>T			Q69YJ9|Q9P0Y8	RNA	SNP	-	NULL	ENST00000545121.1	37	NULL	CCDS830.1	1																																																																																			CEPT1	-	-	ENSG00000134255		0.388	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEPT1	HGNC	protein_coding	OTTHUMT00000034462.2	-	0.00	38	0	G	NM_006090		111725371	+1	tier1	-	no_errors	ENST00000483427	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.000	T
CHGA	1113	genome.wustl.edu	37	14	93397924	93397926	+	In_Frame_Del	DEL	GAG	GAG	-	rs371215355|rs575196921	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr14:93397924_93397926delGAG	ENST00000216492.5	+	6	965_967	c.685_687delGAG	c.(685-687)gagdel	p.E236del	CHGA_ENST00000334654.4_Intron|CHGA_ENST00000553866.1_3'UTR	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	236					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		AAAGAGAgaagaggaggaggagg	0.645														31	0.0061901	0.0197	0.0029	5008	,	,		19158	0.001		0.0	False		,,,				2504	0.002				Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)												0																																										SO:0001651	inframe_deletion	0				CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.685_687delGAG	14.37:g.93397933_93397935delGAG	ENSP00000216492:p.Glu236del		B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	In_Frame_Del	DEL	pfam_Granin,prints_Chromogranin_AB	p.E232in_frame_del	ENST00000216492.5	37	c.685_687	CCDS9906.1	14																																																																																			CHGA	-	pfam_Granin	ENSG00000100604		0.645	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGA	HGNC	protein_coding	OTTHUMT00000412411.1		0.00	43	0	GAG	NM_001275		93397926	+1	tier1		no_errors	ENST00000216492	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	0.001:0.007:0.019	-
CIC	23152	genome.wustl.edu	37	19	42794952	42794952	+	Frame_Shift_Del	DEL	C	C	-			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:42794952delC	ENST00000575354.2	+	10	2072	c.2032delC	c.(2032-2034)cctfs	p.P678fs	CIC_ENST00000160740.3_Frame_Shift_Del_p.P678fs|CIC_ENST00000572681.2_Frame_Shift_Del_p.P1587fs	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	678	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				TGTGGTGCGGCCTGTCAGCAG	0.662			"""Mis, F, S"""		oligodendroglioma																																			Rec	yes		19	19q13.2	23152	capicua homolog		O	0													15.0	13.0	14.0					19																	42794952		2197	4284	6481	SO:0001589	frameshift_variant	0			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.2032delC	19.37:g.42794952delC	ENSP00000458663:p.Pro678fs		Q7LGI1|Q9UEG5|Q9Y6T1	Frame_Shift_Del	DEL	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.P678fs	ENST00000575354.2	37	c.2032	CCDS12601.1	19																																																																																			CIC	-	NULL	ENSG00000079432		0.662	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	HGNC	protein_coding	OTTHUMT00000438532.2		0.00	57	0	C			42794952	+1	tier1		no_errors	ENST00000575354	ensembl	human	known	74_37	frame_shift_del	43.18	25	19	DEL	1.000	-
CLCA3P	9629	genome.wustl.edu	37	1	87101384	87101384	+	RNA	SNP	A	A	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:87101384A>G	ENST00000456587.1	-	0	294				CLCA3P_ENST00000466454.1_RNA																							ACAAATCAAAATCTGAGTACT	0.343																																																	0													82.0	86.0	85.0					1																	87101384		2203	4296	6499			0																															1.37:g.87101384A>G				RNA	SNP	-	NULL	ENST00000456587.1	37	NULL		1																																																																																			CLCA3P	-	-	ENSG00000153923		0.343	RP4-651E10.4-001	KNOWN	non_canonical_TEC|basic	antisense	CLCA3P	HGNC	antisense	OTTHUMT00000028263.1	-	0.00	77	0	A			87101384	+1	tier1	-	no_errors	ENST00000284054	ensembl	human	known	74_37	rna	5.38	88	5	SNP	0.994	G
CLEC14A	161198	genome.wustl.edu	37	14	38724103	38724103	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr14:38724103G>T	ENST00000342213.2	-	1	1471	c.1125C>A	c.(1123-1125)agC>agA	p.S375R		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	375						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TGGAAATCACGCTCCCTGATG	0.502																																																	0													78.0	65.0	70.0					14																	38724103		2203	4300	6503	SO:0001583	missense	0				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.1125C>A	14.37:g.38724103G>T	ENSP00000353013:p.Ser375Arg		Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S375R	ENST00000342213.2	37	c.1125	CCDS9667.1	14	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300285	0.60195	.	.	ENSG00000176435	ENST00000342213;ENST00000546356	T	0.77489	-1.1	4.14	-3.61	0.04556	.	0.890976	0.09291	N	0.822312	T	0.58119	0.2100	L	0.29908	0.895	0.09310	N	1	B	0.20052	0.041	B	0.13407	0.009	T	0.47749	-0.9093	10	0.87932	D	0	-9.0691	0.2396	0.00191	0.3425:0.1411:0.2307:0.2857	.	375	Q86T13	CLC14_HUMAN	R	375;140	ENSP00000353013:S375R	ENSP00000353013:S375R	S	-	3	2	CLEC14A	37793854	0.000000	0.05858	0.000000	0.03702	0.178000	0.23041	-1.985000	0.01485	-0.730000	0.04869	0.563000	0.77884	AGC	CLEC14A	-	NULL	ENSG00000176435		0.502	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC14A	HGNC	protein_coding	OTTHUMT00000276729.1	-	0.00	55	0	G	NM_175060		38724103	-1	tier1	-	no_errors	ENST00000342213	ensembl	human	known	74_37	missense	8.06	57	5	SNP	0.000	T
CNTN3	5067	genome.wustl.edu	37	3	74349082	74349082	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:74349082T>G	ENST00000263665.6	-	16	2130	c.2103A>C	c.(2101-2103)gaA>gaC	p.E701D		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	701					cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.E701D(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AAGGAGGCACTTCTGGAACTA	0.388																																																	1	Substitution - Missense(1)	large_intestine(1)											85.0	77.0	80.0					3																	74349082		2203	4300	6503	SO:0001583	missense	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2103A>C	3.37:g.74349082T>G	ENSP00000263665:p.Glu701Asp		B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E701D	ENST00000263665.6	37	c.2103	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562107	0.45590	.	.	ENSG00000113805	ENST00000263665	T	0.52295	0.67	5.86	0.678	0.17969	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.048917	0.85682	D	0.000000	T	0.17492	0.0420	N	0.03194	-0.395	0.30596	N	0.761044	B	0.12013	0.005	B	0.17979	0.02	T	0.22103	-1.0226	10	0.10111	T	0.7	.	5.2293	0.15412	0.1186:0.2641:0.0:0.6173	.	701	Q9P232	CNTN3_HUMAN	D	701	ENSP00000263665:E701D	ENSP00000263665:E701D	E	-	3	2	CNTN3	74431772	1.000000	0.71417	0.995000	0.50966	0.953000	0.61014	1.158000	0.31737	-0.095000	0.12351	0.528000	0.53228	GAA	CNTN3	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113805		0.388	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	-	0.00	70	0	T	NM_020872		74349082	-1	tier1	-	no_errors	ENST00000263665	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.939	G
COL14A1	7373	genome.wustl.edu	37	8	121344398	121344398	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:121344398G>T	ENST00000297848.3	+	41	4948	c.4678G>T	c.(4678-4680)Gga>Tga	p.G1560*	COL14A1_ENST00000247781.3_Nonsense_Mutation_p.G1465*|COL14A1_ENST00000309791.4_Nonsense_Mutation_p.G1560*	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGGAAAGGATGGATCCTCGGG	0.463																																																	0													80.0	79.0	79.0					8																	121344398		2203	4300	6503	SO:0001587	stop_gained	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4678G>T	8.37:g.121344398G>T	ENSP00000297848:p.Gly1560*			Nonsense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.G1560*	ENST00000297848.3	37	c.4678	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	G	45	11.626836	0.99584	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.6259	0.76855	0.0:0.0:1.0:0.0	.	.	.	.	X	1560;1560;1465	.	ENSP00000247781:G1465X	G	+	1	0	COL14A1	121413579	1.000000	0.71417	0.786000	0.31890	0.528000	0.34623	4.955000	0.63638	2.676000	0.91093	0.655000	0.94253	GGA	COL14A1	-	pfam_Collagen	ENSG00000187955		0.463	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	-	0.00	44	0	G	NM_021110		121344398	+1	tier1	-	no_errors	ENST00000297848	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	0.992	T
COL18A1	80781	genome.wustl.edu	37	21	46895449	46895449	+	Splice_Site	SNP	G	G	A	rs527870177		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr21:46895449G>A	ENST00000359759.4	+	4	2064	c.2043G>A	c.(2041-2043)acG>acA	p.T681T	COL18A1_ENST00000400337.2_Splice_Site_p.T266T|COL18A1_ENST00000355480.5_Splice_Site_p.T446T			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	681	Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGGAGGAGACGGTGAGTAGCC	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14427	0.0		0.0	False		,,,				2504	0.0																0													12.0	15.0	14.0					21																	46895449		1867	4092	5959	SO:0001630	splice_region_variant	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2043+1G>A	21.37:g.46895449G>A			A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.T681	ENST00000359759.4	37	c.2043		21																																																																																			COL18A1	-	NULL	ENSG00000182871		0.667	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	-	0.00	117	0	G		Silent	46895449	+1	tier1	-	no_errors	ENST00000359759	ensembl	human	known	74_37	silent	38.75	49	31	SNP	0.420	A
CPNE8	144402	genome.wustl.edu	37	12	39047710	39047710	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:39047710T>G	ENST00000331366.5	-	20	1765	c.1669A>C	c.(1669-1671)Aca>Cca	p.T557P	CPNE8_ENST00000538596.2_Missense_Mutation_p.T226P|CPNE8_ENST00000360449.3_Missense_Mutation_p.T545P|CPNE8_ENST00000546603.1_5'UTR	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	557						extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				AACACATGTGTAGGTGGGGTG	0.468																																																	0													93.0	87.0	89.0					12																	39047710		2203	4300	6503	SO:0001583	missense	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.1669A>C	12.37:g.39047710T>G	ENSP00000329748:p.Thr557Pro		Q2TB41|Q86VY2	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.T557P	ENST00000331366.5	37	c.1669	CCDS8733.1	12	.	.	.	.	.	.	.	.	.	.	T	10.67	1.416529	0.25552	.	.	ENSG00000139117	ENST00000331366;ENST00000538596;ENST00000360449	T;T;T	0.25749	1.78;1.91;1.78	4.14	4.14	0.48551	.	0.210998	0.41396	D	0.000886	T	0.10766	0.0263	N	0.04355	-0.22	0.24986	N	0.991567	B	0.22604	0.072	B	0.14578	0.011	T	0.14755	-1.0461	10	0.34782	T	0.22	-17.5788	7.7896	0.29112	0.0:0.0995:0.0:0.9005	.	557	Q86YQ8	CPNE8_HUMAN	P	557;226;545	ENSP00000329748:T557P;ENSP00000439237:T226P;ENSP00000353633:T545P	ENSP00000329748:T557P	T	-	1	0	CPNE8	37333977	0.055000	0.20627	0.838000	0.33150	0.871000	0.50021	0.276000	0.18716	1.810000	0.52873	0.533000	0.62120	ACA	CPNE8	-	NULL	ENSG00000139117		0.468	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	-	0.00	51	0	T	NM_153634		39047710	-1	tier1	-	no_errors	ENST00000331366	ensembl	human	known	74_37	missense	17.19	53	11	SNP	0.733	G
CRB2	286204	genome.wustl.edu	37	9	126133391	126133391	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr9:126133391C>T	ENST00000373631.3	+	8	1971	c.1970C>T	c.(1969-1971)tCt>tTt	p.S657F	CRB2_ENST00000373629.2_Missense_Mutation_p.S325F|CRB2_ENST00000359999.3_Missense_Mutation_p.S657F	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	657	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						GCCCCAAGCTCTGCCTCCTTT	0.607																																																	0													90.0	100.0	97.0					9																	126133391		2203	4300	6503	SO:0001583	missense	0			AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.1970C>T	9.37:g.126133391C>T	ENSP00000362734:p.Ser657Phe		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.S657F	ENST00000373631.3	37	c.1970	CCDS6852.2	9	.	.	.	.	.	.	.	.	.	.	.	0.547	-0.851005	0.02651	.	.	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	T;T;T	0.79749	-1.3;-1.3;-1.3	5.05	2.83	0.33086	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	1.002780	0.08041	N	0.995128	T	0.63510	0.2517	N	0.20986	0.625	0.09310	N	0.999999	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.50065	-0.8871	10	0.10111	T	0.7	.	3.7787	0.08671	0.1913:0.5268:0.0:0.2819	.	657;657	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	F	657;657;325	ENSP00000353092:S657F;ENSP00000362734:S657F;ENSP00000362732:S325F	ENSP00000353092:S657F	S	+	2	0	CRB2	125173212	0.047000	0.20315	0.869000	0.34112	0.041000	0.13682	0.300000	0.19156	1.123000	0.41961	-0.311000	0.09066	TCT	CRB2	-	superfamily_ConA-like_lec_gl_sf	ENSG00000148204		0.607	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB2	HGNC	protein_coding	OTTHUMT00000053990.3	-	0.00	43	0	C	NM_173689		126133391	+1	tier1	-	no_errors	ENST00000373631	ensembl	human	known	74_37	missense	28.57	20	8	SNP	0.132	T
CTNNB1	1499	genome.wustl.edu	37	3	41277242	41277242	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:41277242G>T	ENST00000349496.5	+	11	1991	c.1711G>T	c.(1711-1713)Gaa>Taa	p.E571*	CTNNB1_ENST00000396183.3_Nonsense_Mutation_p.E571*|CTNNB1_ENST00000405570.1_Nonsense_Mutation_p.E571*|CTNNB1_ENST00000396185.3_Nonsense_Mutation_p.E571*|CTNNB1_ENST00000453024.1_Nonsense_Mutation_p.E564*	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	571					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		AGAAATAGTTGAAGGTTGTAC	0.428		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)			Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	0													134.0	134.0	134.0					3																	41277242		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1711G>T	3.37:g.41277242G>T	ENSP00000344456:p.Glu571*		A8K1L7|Q8NEW9|Q8NI94|Q9H391	Nonsense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.E571*	ENST00000349496.5	37	c.1711	CCDS2694.1	3	.	.	.	.	.	.	.	.	.	.	G	43	10.389056	0.99396	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-15.5419	19.661	0.95871	0.0:0.0:1.0:0.0	.	.	.	.	X	571;571;571;564;571	.	ENSP00000344456:E571X	E	+	1	0	CTNNB1	41252246	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.659000	0.90383	0.655000	0.94253	GAA	CTNNB1	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000168036		0.428	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2		0.00	37	0	G	NM_001098210		41277242	+1			no_errors	ENST00000349496	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	1.000	T
CXCL12	6387	genome.wustl.edu	37	10	44871398	44871398	+	Intron	SNP	T	T	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:44871398T>C	ENST00000374429.2	-	4	353				CXCL12_ENST00000496375.1_5'Flank|CXCL12_ENST00000395795.4_Intron|CXCL12_ENST00000395793.3_Intron|CXCL12_ENST00000374426.2_Missense_Mutation_p.R117G|AL137026.1_ENST00000593376.1_5'Flank	NM_000609.5|NM_001277990.1	NP_000600.1|NP_001264919.1	P48061	SDF1_HUMAN	chemokine (C-X-C motif) ligand 12						adult locomotory behavior (GO:0008344)|ameboidal cell migration (GO:0001667)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|motor neuron axon guidance (GO:0008045)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of leukocyte tethering or rolling (GO:1903237)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|patterning of blood vessels (GO:0001569)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of T cell migration (GO:2000406)|regulation of actin polymerization or depolymerization (GO:0008064)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|telencephalon cell migration (GO:0022029)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|CXCR chemokine receptor binding (GO:0045236)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(3)|skin(1)	6					Tinzaparin(DB06822)	TAGTTTTTCCTTTTCTGGGCA	0.458																																																	0													307.0	307.0	307.0					10																	44871398		2203	4298	6501	SO:0001627	intron_variant	0			L36033	CCDS7207.1, CCDS31186.1, CCDS44373.1, CCDS53527.1, CCDS60518.1	10q11.1	2013-02-28	2010-05-11	2002-08-23	ENSG00000107562	ENSG00000107562		"""Endogenous ligands"""	10672	protein-coding gene	gene with protein product		600835	"""stromal cell-derived factor 1"""	SDF1A, SDF1B, SDF1		7490086	Standard	NM_001033886		Approved	SCYB12, SDF-1a, SDF-1b, PBSF, TLSF-a, TLSF-b, TPAR1	uc021ppm.1	P48061	OTTHUMG00000018054	ENST00000374429.2:c.267-2607A>G	10.37:g.44871398T>C			B2R4G0|E7EVL0|H7BYN8|Q2L985|Q2L986|Q2L988|Q5IT36|Q6ICW0|Q9H554	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.R117G	ENST00000374429.2	37	c.349	CCDS44373.1	10	.	.	.	.	.	.	.	.	.	.	T	10.54	1.379462	0.24944	.	.	ENSG00000107562	ENST00000374426	T	0.25749	1.78	5.4	4.26	0.50523	.	.	.	.	.	T	0.20047	0.0482	.	.	.	0.80722	D	1	B	0.19817	0.039	B	0.16289	0.015	T	0.07501	-1.0769	8	0.66056	D	0.02	.	7.4273	0.27107	0.0:0.0958:0.0:0.9042	.	117	P48061-3	.	G	117	ENSP00000363548:R117G	ENSP00000363548:R117G	R	-	1	2	CXCL12	44191404	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.184000	0.42575	2.175000	0.68902	0.533000	0.62120	AGG	CXCL12	-	NULL	ENSG00000107562		0.458	CXCL12-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CXCL12	HGNC	protein_coding	OTTHUMT00000047738.2	-	0.00	102	0	T	NM_000609		44871398	-1	tier1	-	no_errors	ENST00000374426	ensembl	human	known	74_37	missense	24.73	70	23	SNP	1.000	C
CYP7B1	9420	genome.wustl.edu	37	8	65528530	65528530	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:65528530C>G	ENST00000310193.3	-	3	741	c.568G>C	c.(568-570)Gag>Cag	p.E190Q	CYP7B1_ENST00000523954.1_5'Flank	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	190					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				AATGTGATCTCAAATATTATT	0.323																																																	0													50.0	51.0	51.0					8																	65528530		2203	4299	6502	SO:0001583	missense	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.568G>C	8.37:g.65528530C>G	ENSP00000310721:p.Glu190Gln		B2RN07|Q9UNF5	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.E190Q	ENST00000310193.3	37	c.568	CCDS6180.1	8	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432472	0.43224	.	.	ENSG00000172817	ENST00000310193	D	0.85258	-1.96	5.32	5.32	0.75619	.	0.138520	0.64402	D	0.000004	D	0.91102	0.7199	M	0.76002	2.32	0.41624	D	0.988982	P	0.43231	0.801	P	0.55923	0.787	D	0.90164	0.4230	9	.	.	.	-18.0458	19.3561	0.94414	0.0:1.0:0.0:0.0	.	190	O75881	CP7B1_HUMAN	Q	190	ENSP00000310721:E190Q	.	E	-	1	0	CYP7B1	65691084	1.000000	0.71417	0.996000	0.52242	0.477000	0.33069	5.068000	0.64364	2.646000	0.89796	0.655000	0.94253	GAG	CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000172817		0.323	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	-	0.00	76	0	C			65528530	-1	tier1	-	no_errors	ENST00000310193	ensembl	human	known	74_37	missense	12.87	88	13	SNP	1.000	G
DAGLA	747	genome.wustl.edu	37	11	61493471	61493471	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:61493471C>A	ENST00000257215.5	+	6	669	c.553C>A	c.(553-555)Cgc>Agc	p.R185S		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	185					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		TTGCAGGCACCGCTTAGAGGA	0.607																																																	0													86.0	80.0	82.0					11																	61493471		2202	4299	6501	SO:0001583	missense	0			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.553C>A	11.37:g.61493471C>A	ENSP00000257215:p.Arg185Ser		A7E233|Q6WQJ0	Missense_Mutation	SNP	pfam_Lipase_3	p.R185S	ENST00000257215.5	37	c.553	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613627	0.66672	.	.	ENSG00000134780	ENST00000257215	T	0.24908	1.83	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	L	0.41415	1.275	0.54753	D	0.999983	D	0.63880	0.993	D	0.74023	0.982	T	0.34650	-0.9820	10	0.51188	T	0.08	-32.1558	17.2282	0.86977	0.0:1.0:0.0:0.0	.	185	Q9Y4D2	DGLA_HUMAN	S	185	ENSP00000257215:R185S	ENSP00000257215:R185S	R	+	1	0	DAGLA	61250047	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.097000	0.50251	2.151000	0.67156	0.462000	0.41574	CGC	DAGLA	-	NULL	ENSG00000134780		0.607	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	HGNC	protein_coding	OTTHUMT00000398516.1	-	0.00	42	0	C	NM_006133		61493471	+1	tier1	-	no_errors	ENST00000257215	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
DDX58	23586	genome.wustl.edu	37	9	32457349	32457349	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr9:32457349G>T	ENST00000379883.2	-	18	2706	c.2549C>A	c.(2548-2550)cCa>cAa	p.P850Q	DDX58_ENST00000379868.1_Missense_Mutation_p.P647Q|DDX58_ENST00000542096.1_Missense_Mutation_p.P779Q|DDX58_ENST00000379882.1_Missense_Mutation_p.P805Q	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	850	Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		AAACTGCTTTGGCTTGGGATG	0.423																																																	0													87.0	80.0	82.0					9																	32457349		2203	4300	6503	SO:0001583	missense	0			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2549C>A	9.37:g.32457349G>T	ENSP00000369213:p.Pro850Gln		A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_DEATH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P850Q	ENST00000379883.2	37	c.2549	CCDS6526.1	9	.	.	.	.	.	.	.	.	.	.	G	8.976	0.974150	0.18736	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.83	4.88	0.63580	C-terminal domain of RIG-I (1);	0.256218	0.33419	N	0.004938	T	0.38746	0.1052	L	0.48877	1.53	0.80722	D	1	P;P	0.42692	0.454;0.787	B;B	0.41894	0.173;0.369	T	0.08411	-1.0723	10	0.25751	T	0.34	-10.7486	14.6651	0.68901	0.0:0.0:0.854:0.146	.	779;850	B3KWW1;O95786	.;DDX58_HUMAN	Q	805;850;647;779	ENSP00000369212:P805Q;ENSP00000369213:P850Q;ENSP00000369197:P647Q;ENSP00000442160:P779Q	ENSP00000369197:P647Q	P	-	2	0	DDX58	32447349	0.997000	0.39634	0.836000	0.33094	0.215000	0.24574	3.318000	0.51975	2.759000	0.94783	0.650000	0.86243	CCA	DDX58	-	pfam_RIG-I_C-RD	ENSG00000107201		0.423	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	HGNC	protein_coding	OTTHUMT00000052011.1		0.00	60	0	G	NM_014314		32457349	-1			no_errors	ENST00000379883	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.970	T
DLGAP1	9229	genome.wustl.edu	37	18	3845292	3845292	+	Intron	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr18:3845292C>T	ENST00000315677.3	-	5	1553				DLGAP1_ENST00000478161.1_Intron|DLGAP1_ENST00000581699.1_Intron|DLGAP1_ENST00000400155.1_Intron|DLGAP1_ENST00000581527.1_Intron|DLGAP1_ENST00000534970.1_Intron|DLGAP1_ENST00000584874.1_Intron|DLGAP1_ENST00000539435.1_5'UTR|DLGAP1_ENST00000400150.3_Intron|DLGAP1_ENST00000515196.2_Intron|DLGAP1_ENST00000400147.2_5'UTR|DLGAP1_ENST00000400149.3_Intron|DLGAP1_ENST00000400145.2_5'UTR	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1						synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				TTATTCATCTCAGCTTTGATT	0.388																																																	0													118.0	109.0	112.0					18																	3845292		1864	4102	5966	SO:0001627	intron_variant	0			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.958-31019G>A	18.37:g.3845292C>T			A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	RNA	SNP	-	NULL	ENST00000315677.3	37	NULL	CCDS11836.1	18																																																																																			DLGAP1	-	-	ENSG00000170579		0.388	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	HGNC	protein_coding	OTTHUMT00000254394.4	-	0.00	65	0	C			3845292	-1	tier1	-	no_errors	ENST00000484845	ensembl	human	known	74_37	rna	12.73	48	7	SNP	1.000	T
DNAH2	146754	genome.wustl.edu	37	17	7646279	7646279	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:7646279G>T	ENST00000572933.1	+	12	3183	c.1723G>T	c.(1723-1725)Ggg>Tgg	p.G575W	DNAH2_ENST00000082259.3_Missense_Mutation_p.G657W|DNAH2_ENST00000389173.2_Missense_Mutation_p.G575W|DNAH2_ENST00000570791.1_Missense_Mutation_p.G657W			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	575	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCCCCGTATTGGGACTGGAAA	0.557																																																	0													72.0	58.0	63.0					17																	7646279		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1723G>T	17.37:g.7646279G>T	ENSP00000458355:p.Gly575Trp		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G575W	ENST00000572933.1	37	c.1723	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521727	0.64747	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.55413	0.52;0.52	5.34	5.34	0.76211	Dynein heavy chain, domain-1 (1);	0.297481	0.33834	N	0.004502	T	0.71195	0.3311	M	0.72118	2.19	0.25173	N	0.990267	D;D	0.69078	0.993;0.997	D;D	0.65573	0.913;0.936	T	0.66340	-0.5948	10	0.72032	D	0.01	.	17.8064	0.88602	0.0:0.0:1.0:0.0	.	575;657	Q9P225;Q9P225-3	DYH2_HUMAN;.	W	575;575;657	ENSP00000373825:G575W;ENSP00000082259:G657W	ENSP00000082259:G657W	G	+	1	0	DNAH2	7587004	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	3.360000	0.52299	2.513000	0.84729	0.563000	0.77884	GGG	DNAH2	-	pfam_Dynein_heavy_dom-1	ENSG00000183914		0.557	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	-	0.00	41	0	G	NM_020877		7646279	+1	tier1	-	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.962	T
DNAH5	1767	genome.wustl.edu	37	5	13871844	13871844	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:13871844G>A	ENST00000265104.4	-	23	3531	c.3427C>T	c.(3427-3429)Cgc>Tgc	p.R1143C	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1143	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGATTGTAGCGTTTGAAGCAA	0.343									Kartagener syndrome																																								0													93.0	102.0	99.0					5																	13871844		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3427C>T	5.37:g.13871844G>A	ENSP00000265104:p.Arg1143Cys		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1143C	ENST00000265104.4	37	c.3427	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	11.52	1.661732	0.29515	.	.	ENSG00000039139	ENST00000265104	T	0.24723	1.84	5.99	-5.37	0.02681	.	0.707817	0.15428	N	0.262858	T	0.09642	0.0237	N	0.04768	-0.165	0.31283	N	0.690324	B	0.02656	0.0	B	0.04013	0.001	T	0.10520	-1.0626	10	0.44086	T	0.13	.	8.9435	0.35745	0.648:0.0:0.1547:0.1972	.	1143	Q8TE73	DYH5_HUMAN	C	1143	ENSP00000265104:R1143C	ENSP00000265104:R1143C	R	-	1	0	DNAH5	13924844	0.002000	0.14202	0.866000	0.34008	0.959000	0.62525	-0.835000	0.04386	-0.866000	0.04068	-0.748000	0.03510	CGC	DNAH5	-	NULL	ENSG00000039139		0.343	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	66	0	G	NM_001369		13871844	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	13.76	93	15	SNP	0.356	A
DNAH9	1770	genome.wustl.edu	37	17	11778484	11778484	+	Silent	SNP	G	G	T	rs547085612		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:11778484G>T	ENST00000262442.4	+	53	10529	c.10461G>T	c.(10459-10461)acG>acT	p.T3487T	RP11-628O18.1_ENST00000579621.1_RNA|DNAH9_ENST00000454412.2_Silent_p.T3487T	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3487	AAA 5. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCCGGGTCACGCAGATTGGTC	0.458																																																	0													72.0	62.0	65.0					17																	11778484		2203	4300	6503	SO:0001819	synonymous_variant	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10461G>T	17.37:g.11778484G>T			A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T3487	ENST00000262442.4	37	c.10461	CCDS11160.1	17																																																																																			DNAH9	-	superfamily_P-loop_NTPase	ENSG00000007174		0.458	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2		0.00	32	0	G	NM_001372		11778484	+1			no_errors	ENST00000262442	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.991	T
DOK4	55715	genome.wustl.edu	37	16	57507547	57507547	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:57507547G>A	ENST00000340099.4	-	8	1211	c.840C>T	c.(838-840)atC>atT	p.I280I	DOK4_ENST00000569548.1_Silent_p.I280I|DOK4_ENST00000561918.1_5'Flank|DOK4_ENST00000566936.1_Silent_p.I280I	NM_018110.3	NP_060580.2	Q8TEW6	DOK4_HUMAN	docking protein 4	280					MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	6						AGGCTTCGGCGATGTTCTGGG	0.592																																																	0													158.0	141.0	147.0					16																	57507547		2198	4300	6498	SO:0001819	synonymous_variant	0			BC003541	CCDS10783.1	16q13	2013-01-10			ENSG00000125170	ENSG00000125170		"""Pleckstrin homology (PH) domain containing"""	19868	protein-coding gene	gene with protein product		608333				10493829	Standard	NM_018110		Approved	FLJ10488	uc002elv.4	Q8TEW6	OTTHUMG00000133460	ENST00000340099.4:c.840C>T	16.37:g.57507547G>A			O75209|Q9BTP2|Q9NVV3	Silent	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.I280	ENST00000340099.4	37	c.840	CCDS10783.1	16																																																																																			DOK4	-	NULL	ENSG00000125170		0.592	DOK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK4	HGNC	protein_coding	OTTHUMT00000257335.3	-	0.00	35	0	G			57507547	-1	tier1	-	no_errors	ENST00000340099	ensembl	human	known	74_37	silent	11.90	37	5	SNP	0.611	A
DPP10	57628	genome.wustl.edu	37	2	116447262	116447262	+	Splice_Site	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:116447262G>T	ENST00000410059.1	+	6	921		c.e6-1		DPP10_ENST00000488208.1_Splice_Site|DPP10_ENST00000393147.2_Splice_Site|DPP10_ENST00000409163.1_Splice_Site|DPP10_ENST00000310323.8_Splice_Site	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)							integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TTTAATTTCAGATTTTTCATT	0.264																																																	0													70.0	68.0	69.0					2																	116447262		2197	4291	6488	SO:0001630	splice_region_variant	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.442-1G>T	2.37:g.116447262G>T			A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Splice_Site	SNP	-	e6-1	ENST00000410059.1	37	c.454-1	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920073	0.73098	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000476155	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2739	0.73726	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DPP10	116163732	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.767000	0.85331	2.515000	0.84797	0.650000	0.86243	.	DPP10	-	-	ENSG00000175497		0.264	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	-	0.00	57	0	G	NM_020868	Intron	116447262	+1	tier1	-	no_errors	ENST00000393147	ensembl	human	known	74_37	splice_site	17.65	56	12	SNP	1.000	T
DPYSL2	1808	genome.wustl.edu	37	8	26505224	26505224	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:26505224C>T	ENST00000311151.5	+	11	1601	c.1189C>T	c.(1189-1191)Cgg>Tgg	p.R397W	DPYSL2_ENST00000523027.1_Missense_Mutation_p.R361W|DPYSL2_ENST00000521913.1_Missense_Mutation_p.R361W	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	397					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)			breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		CCTTTACCCCCGGAAAGGCCG	0.547																																																	0													107.0	100.0	102.0					8																	26505224		2203	4300	6503	SO:0001583	missense	0			D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.1189C>T	8.37:g.26505224C>T	ENSP00000309539:p.Arg397Trp		A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.R397W	ENST00000311151.5	37	c.1189	CCDS6051.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.389851	0.95988	.	.	ENSG00000092964	ENST00000545637;ENST00000521913;ENST00000311151;ENST00000522745;ENST00000523027	D;D;D;D	0.91295	-2.82;-2.82;-2.82;-2.82	5.07	5.07	0.68467	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.96589	0.8887	M	0.92649	3.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	D	0.97152	0.9832	10	0.87932	D	0	-24.5714	19.0071	0.92856	0.0:1.0:0.0:0.0	.	397;453	Q16555;Q59GB4	DPYL2_HUMAN;.	W	36;361;397;397;361	ENSP00000427985:R361W;ENSP00000309539:R397W;ENSP00000428909:R397W;ENSP00000431117:R361W	ENSP00000309539:R397W	R	+	1	2	DPYSL2	26561141	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.609000	0.82925	2.793000	0.96121	0.563000	0.77884	CGG	DPYSL2	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000092964		0.547	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL2	HGNC	protein_coding	OTTHUMT00000216904.3	-	0.00	64	0	C	NM_001386		26505224	+1	tier1	-	no_errors	ENST00000311151	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
DSEL	92126	genome.wustl.edu	37	18	65180052	65180052	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr18:65180052G>T	ENST00000310045.7	-	2	3297	c.1824C>A	c.(1822-1824)gtC>gtA	p.V608V	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	598					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				AGAAGGCACTGACAGAATTTA	0.348																																																	0													46.0	47.0	46.0					18																	65180052		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1824C>A	18.37:g.65180052G>T			Q17RH1|Q6P5Z3	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.V608	ENST00000310045.7	37	c.1824	CCDS11995.1	18																																																																																			DSEL	-	NULL	ENSG00000171451		0.348	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1		0.00	65	0	G	NM_032160		65180052	-1			no_errors	ENST00000310045	ensembl	human	known	74_37	silent	5.66	50	3	SNP	1.000	T
DSTYK	25778	genome.wustl.edu	37	1	205156711	205156711	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:205156711G>T	ENST00000367162.3	-	2	519	c.489C>A	c.(487-489)gtC>gtA	p.V163V	DSTYK_ENST00000367160.4_Silent_p.V163V|DSTYK_ENST00000367161.3_Silent_p.V163V	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	163					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						GCGCCAGGCTGACCCGAGTCT	0.602																																																	0													63.0	53.0	56.0					1																	205156711		2203	4300	6503	SO:0001819	synonymous_variant	0			AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.489C>A	1.37:g.205156711G>T			B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V163	ENST00000367162.3	37	c.489	CCDS1451.1	1																																																																																			DSTYK	-	NULL	ENSG00000133059		0.602	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSTYK	HGNC	protein_coding	OTTHUMT00000090345.1		0.00	46	0	G	NM_015375		205156711	-1			no_errors	ENST00000367162	ensembl	human	known	74_37	silent	6.90	27	2	SNP	1.000	T
DUS1L	64118	genome.wustl.edu	37	17	80016125	80016125	+	Nonsense_Mutation	SNP	C	C	A	rs144652762		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:80016125C>A	ENST00000354321.7	-	13	1773	c.1288G>T	c.(1288-1290)Gga>Tga	p.G430*	DUS1L_ENST00000306796.5_Nonsense_Mutation_p.G430*			Q6P1R4	DUS1L_HUMAN	dihydrouridine synthase 1-like (S. cerevisiae)	430							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	6	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			AAAAGCAATCCGTGACCTGGC	0.627																																																	0													48.0	59.0	56.0					17																	80016125		2203	4298	6501	SO:0001587	stop_gained	0				CCDS32775.1	17q25.3	2005-08-09				ENSG00000169718			30086	protein-coding gene	gene with protein product						12477932	Standard	NM_022156		Approved	PP3111, DUS1	uc002kdr.4	Q6P1R4		ENST00000354321.7:c.1288G>T	17.37:g.80016125C>A	ENSP00000346280:p.Gly430*		A6NHV4|Q96AI3	Nonsense_Mutation	SNP	pfam_tRNA_hU_synthase	p.G430*	ENST00000354321.7	37	c.1288	CCDS32775.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.072895|6.072895	0.97256|0.97256	.|.	.|.	ENSG00000169718|ENSG00000169718	ENST00000354321;ENST00000306796;ENST00000542088|ENST00000538833	.|.	.|.	.|.	4.65|4.65	2.67|2.67	0.31697|0.31697	.|.	0.052973|.	0.85682|.	D|.	0.000000|.	.|T	.|0.48714	.|0.1515	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B	.|0.28713	.|0.22	.|B	.|0.25987	.|0.065	.|T	.|0.48502	.|-0.9030	.|7	0.24483|0.66056	T|D	0.36|0.02	-11.5868|-11.5868	10.7123|10.7123	0.45990|0.45990	0.0:0.8438:0.0:0.1562|0.0:0.8438:0.0:0.1562	.|.	.|296	.|Q9BTJ3	.|.	X|L	430;430;293|294	.|.	ENSP00000303515:G430X|ENSP00000445110:R294L	G|R	-|-	1|2	0|0	DUS1L|DUS1L	77609414|77609414	0.984000|0.984000	0.35163|0.35163	0.707000|0.707000	0.30419|0.30419	0.952000|0.952000	0.60782|0.60782	4.060000|4.060000	0.57477|0.57477	0.584000|0.584000	0.29591|0.29591	-0.253000|-0.253000	0.11424|0.11424	GGA|CGG	DUS1L	-	NULL	ENSG00000169718		0.627	DUS1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUS1L	HGNC	protein_coding	OTTHUMT00000442347.1	-	0.00	79	0	C	NM_022156		80016125	-1	tier1	-	no_errors	ENST00000306796	ensembl	human	known	74_37	nonsense	8.70	41	4	SNP	0.995	A
DUSP6	1848	genome.wustl.edu	37	12	89743266	89743266	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:89743266G>T	ENST00000279488.7	-	3	2142	c.911C>A	c.(910-912)aCt>aAt	p.T304N	DUSP6_ENST00000308385.6_Missense_Mutation_p.T158N|DUSP6_ENST00000547140.1_5'UTR|DUSP6_ENST00000547291.1_Missense_Mutation_p.T179N	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	304	Tyrosine-protein phosphatase.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)	p.T304I(1)		large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						GTAAGCCACAGTCACAGTGAC	0.448																																					Colon(132;3456 5224)												1	Substitution - Missense(1)	large_intestine(1)											104.0	98.0	100.0					12																	89743266		2203	4300	6503	SO:0001583	missense	0			BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.911C>A	12.37:g.89743266G>T	ENSP00000279488:p.Thr304Asn		O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.T304N	ENST00000279488.7	37	c.911	CCDS9033.1	12	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514445	0.85389	.	.	ENSG00000139318	ENST00000279488;ENST00000308385;ENST00000547291	T;T;T	0.60672	0.17;0.17;0.17	5.68	5.68	0.88126	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.046598	0.85682	D	0.000000	T	0.82204	0.4986	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.81914	0.991;0.995	D	0.84736	0.0748	10	0.62326	D	0.03	.	20.1615	0.98135	0.0:0.0:1.0:0.0	.	158;304	Q16828-2;Q16828	.;DUS6_HUMAN	N	304;158;179	ENSP00000279488:T304N;ENSP00000307835:T158N;ENSP00000449838:T179N	ENSP00000279488:T304N	T	-	2	0	DUSP6	88267397	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	9.835000	0.99442	2.835000	0.97688	0.650000	0.86243	ACT	DUSP6	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000139318		0.448	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP6	HGNC	protein_coding	OTTHUMT00000406534.2		0.00	32	0	G	NM_001946, NM_022652		89743266	-1			no_errors	ENST00000279488	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
ECE2	9718	genome.wustl.edu	37	3	183967586	183967586	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:183967586A>C	ENST00000402825.3	+	1	104	c.104A>C	c.(103-105)gAt>gCt	p.D35A	ALG3_ENST00000455059.1_5'Flank|ALG3_ENST00000418734.2_5'Flank|ALG3_ENST00000397676.3_5'Flank|ALG3_ENST00000445626.2_5'Flank|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000324557.4_Missense_Mutation_p.D35A	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	35	Methyltransferase-like region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGCGCAGCCGATTCTGCCCCC	0.647											OREG0015944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													56.0	55.0	55.0					3																	183967586		2203	4300	6503	SO:0001583	missense	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.104A>C	3.37:g.183967586A>C	ENSP00000384223:p.Asp35Ala	1988	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.D35A	ENST00000402825.3	37	c.104	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	A	11.71	1.721044	0.30503	.	.	ENSG00000145194	ENST00000324557;ENST00000402825	T;T	0.63744	-0.06;-0.06	5.57	4.41	0.53225	.	.	.	.	.	T	0.45115	0.1326	L	0.52364	1.645	0.51233	D	0.999915	B;P	0.41929	0.031;0.765	B;B	0.27887	0.009;0.084	T	0.46978	-0.9152	9	0.36615	T	0.2	-16.2783	6.4293	0.21788	0.8278:0.0:0.1722:0.0	.	35;35	O60344;O60344-4	ECE2_HUMAN;.	A	35	ENSP00000314295:D35A;ENSP00000384223:D35A	ENSP00000314295:D35A	D	+	2	0	ECE2	185450280	0.109000	0.22037	0.892000	0.35008	0.820000	0.46376	1.763000	0.38461	2.244000	0.73946	0.482000	0.46254	GAT	ECE2	-	NULL	ENSG00000145194		0.647	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	-	0.00	95	0	A	NM_014693		183967586	+1	tier1	-	no_errors	ENST00000402825	ensembl	human	known	74_37	missense	39.74	47	31	SNP	0.413	C
ECE2	9718	genome.wustl.edu	37	3	184007255	184007255	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:184007255G>A	ENST00000402825.3	+	12	1759	c.1759G>A	c.(1759-1761)Gca>Aca	p.A587T	ECE2_ENST00000359140.4_Missense_Mutation_p.A440T|ECE2_ENST00000404464.3_Missense_Mutation_p.A469T|ECE2_ENST00000357474.5_Missense_Mutation_p.A515T|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	587	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AATCCGGACCGCATTTGAGGA	0.607											OREG0015946	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													49.0	44.0	46.0					3																	184007255		2203	4300	6503	SO:0001583	missense	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1759G>A	3.37:g.184007255G>A	ENSP00000384223:p.Ala587Thr	1988	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.A587T	ENST00000402825.3	37	c.1759	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	G	33	5.214386	0.95104	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	5.03	5.03	0.67393	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88822	0.6541	M	0.85542	2.76	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.929;1.0;1.0;1.0	D	0.90190	0.4249	10	0.72032	D	0.01	-19.2359	15.2198	0.73303	0.0:0.0:1.0:0.0	.	189;440;458;469;515;440;587	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	T	587;440;469;515;461	ENSP00000384223:A587T;ENSP00000352052:A440T;ENSP00000385846:A469T;ENSP00000350066:A515T;ENSP00000398444:A461T	ENSP00000350066:A515T	A	+	1	0	ECE2	185489949	1.000000	0.71417	0.946000	0.38457	0.906000	0.53458	7.450000	0.80656	2.631000	0.89168	0.549000	0.68633	GCA	ECE2	-	pfam_Peptidase_M13_N	ENSG00000145194		0.607	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	-	0.00	71	0	G	NM_014693		184007255	+1	tier1	-	no_errors	ENST00000402825	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
RP11-121M22.1	0	genome.wustl.edu	37	11	130263672	130263672	+	lincRNA	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:130263672C>T	ENST00000532116.3	+	0	653																											CAAGTGATGCCCCCAGTCTCC	0.393																																																	0																																												0																															11.37:g.130263672C>T				RNA	SNP	-	NULL	ENST00000532116.3	37	NULL		11																																																																																			RP11-121M22.1	-	-	ENSG00000175773		0.393	RP11-121M22.1-004	KNOWN	basic	lincRNA	ENSG00000175773	Clone_based_vega_gene	lincRNA	OTTHUMT00000468111.1		0.00	11	0	C			130263672	+1			no_errors	ENST00000532116	ensembl	human	known	74_37	rna	44.44	10	8	SNP	0.000	T
CUBNP1	728064	genome.wustl.edu	37	10	43197461	43197461	+	lincRNA	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:43197461G>T	ENST00000439913.1	+	0	689																											GCTCACTGTTGCAGGACGGAT	0.473																																																	0																																												0																															10.37:g.43197461G>T				RNA	SNP	-	NULL	ENST00000439913.1	37	NULL		10																																																																																			AL022344.5	-	-	ENSG00000234864		0.473	AL022344.5-001	KNOWN	basic	lincRNA	ENSG00000234864	Clone_based_vega_gene	lincRNA	OTTHUMT00000047688.1	-	0.00	65	0	G			43197461	+1	tier1	-	no_errors	ENST00000439913	ensembl	human	known	74_37	rna	5.33	70	4	SNP	0.844	T
ALG10	84920	genome.wustl.edu	37	12	34176825	34176825	+	Intron	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:34176825G>A	ENST00000266483.2	+	2	490				RP11-847H18.2_ENST00000501954.2_RNA|ALG10_ENST00000538927.1_Intron	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				GATGAGACTTGGGCTTGACAT	0.353																																																	0																																										SO:0001627	intron_variant	0			AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.172-72G>A	12.37:g.34176825G>A			Q6NS98|Q96DU0|Q96SM6	RNA	SNP	-	NULL	ENST00000266483.2	37	NULL	CCDS41769.1	12																																																																																			RP11-847H18.2	-	-	ENSG00000245482		0.353	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000245482	Clone_based_vega_gene	protein_coding	OTTHUMT00000403309.1	-	0.00	127	0	G	NM_032834		34176825	-1	tier1	-	no_errors	ENST00000501954	ensembl	human	known	74_37	rna	6.56	114	8	SNP	0.001	A
PCDHA9	9752	genome.wustl.edu	37	5	140242566	140242566	+	Intron	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:140242566G>A	ENST00000532602.1	+	1	3427				PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA14_ENST00000562220.1_RNA|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|AC005609.1_ENST00000502505.1_Missense_Mutation_p.S137L|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTGGTGGCGAAGGTGCGCA	0.637																																					Melanoma(55;1800 1972 14909)												0																																										SO:0001627	intron_variant	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2394+12092G>A	5.37:g.140242566G>A			O15053|Q2M3S5	Missense_Mutation	SNP	NULL	p.S137L	ENST00000532602.1	37	c.410	CCDS54920.1	5	.	.	.	.	.	.	.	.	.	.	G	7.069	0.567967	0.13560	.	.	ENSG00000249034	ENST00000502505	.	.	.	4.02	-1.84	0.07809	.	.	.	.	.	T	0.41096	0.1144	.	.	.	0.80722	D	1	B	0.28470	0.213	B	0.15484	0.013	T	0.28106	-1.0054	7	0.87932	D	0	.	7.7716	0.29012	0.0871:0.6223:0.1827:0.1079	.	137	Q8NB83	.	L	137	.	ENSP00000424817:S137L	S	-	2	0	AC005609.17	140222750	0.009000	0.17119	0.999000	0.59377	0.023000	0.10783	-0.921000	0.04008	-0.006000	0.14370	0.313000	0.20887	TCG	AC005609.1	-	NULL	ENSG00000249034		0.637	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000249034	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000372896.2	-	0.00	84	0	G	NM_031857		140242566	-1	tier1	-	no_errors	ENST00000502505	ensembl	human	known	74_37	missense	10.94	57	7	SNP	0.970	A
RP11-597A11.6	0	genome.wustl.edu	37	14	20145919	20145919	+	lincRNA	SNP	G	G	C	rs61978425	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr14:20145919G>C	ENST00000555580.1	-	0	446				RP11-597A11.1_ENST00000548261.1_RNA																							GTGTATGTGCGGGGGAGAAGA	0.488													.|||	918	0.183307	0.0711	0.2536	5008	,	,		32171	0.2798		0.161	False		,,,				2504	0.2086																0																																												0																															14.37:g.20145919G>C				RNA	SNP	-	NULL	ENST00000555580.1	37	NULL		14																																																																																			RP11-597A11.1	-	-	ENSG00000258027		0.488	RP11-597A11.6-001	KNOWN	basic	lincRNA	ENSG00000258027	Clone_based_vega_gene	lincRNA	OTTHUMT00000409767.1	-	0.00	9	0	G			20145919	+1	tier1	rs200309628	no_errors	ENST00000548217	ensembl	human	known	74_37	rna	46.15	7	6	SNP	0.952	C
ENTPD4	9583	genome.wustl.edu	37	8	23290607	23290607	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:23290607G>T	ENST00000358689.4	-	13	1918	c.1683C>A	c.(1681-1683)gtC>gtA	p.V561V	ENTPD4_ENST00000521321.1_Intron|ENTPD4_ENST00000356206.6_Intron|ENTPD4_ENST00000417069.2_Silent_p.V553V	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	561					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		AGTGGTTGTAGACAAAGGAAA	0.602																																																	0													59.0	62.0	61.0					8																	23290607		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1683C>A	8.37:g.23290607G>T			D3DSS3|O15092	Silent	SNP	pfam_GDA1_CD39_NTPase	p.V561	ENST00000358689.4	37	c.1683	CCDS6041.1	8																																																																																			ENTPD4	-	NULL	ENSG00000197217		0.602	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	HGNC	protein_coding	OTTHUMT00000215142.1	-	0.00	146	0	G	NM_004901		23290607	-1	tier1	-	no_errors	ENST00000358689	ensembl	human	known	74_37	silent	5.23	144	8	SNP	1.000	T
EPG5	57724	genome.wustl.edu	37	18	43496130	43496130	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr18:43496130G>T	ENST00000282041.5	-	19	3460	c.3426C>A	c.(3424-3426)ccC>ccA	p.P1142P	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1142					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						ACACAGCAACGGGGCCCACTT	0.478																																																	0													67.0	66.0	66.0					18																	43496130		1919	4118	6037	SO:0001819	synonymous_variant	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.3426C>A	18.37:g.43496130G>T			A2BDF3|Q9H8C8	Silent	SNP	NULL	p.P1142	ENST00000282041.5	37	c.3426	CCDS11926.2	18																																																																																			EPG5	-	NULL	ENSG00000152223		0.478	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1		0.00	32	0	G	NM_020964		43496130	-1			no_errors	ENST00000282041	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.173	T
ESPNP	284729	genome.wustl.edu	37	1	17023042	17023042	+	RNA	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:17023042C>T	ENST00000492551.1	-	0	1821					NR_026567.1				espin pseudogene																		ATGAGCGCCTCCACGTCCAGC	0.672																																																	0																																												0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17023042C>T				RNA	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			ESPNP	-	-	ENSG00000268869		0.672	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1	-	0.00	381	0	C			17023042	-1	tier1	-	no_errors	ENST00000492551	ensembl	human	known	74_37	rna	6.55	256	18	SNP	1.000	T
ESX1	80712	genome.wustl.edu	37	X	103499076	103499076	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrX:103499076G>A	ENST00000372588.4	-	2	348	c.265C>T	c.(265-267)Ccg>Tcg	p.P89S		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	89					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						GTCAGGGGCGGCTCCTCCTGC	0.682																																					Pancreas(200;1705 2227 25194 28471 45274)												0													55.0	64.0	61.0					X																	103499076		2170	4215	6385	SO:0001583	missense	0			AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.265C>T	X.37:g.103499076G>A	ENSP00000361669:p.Pro89Ser		B0QYU3|Q7Z6K7	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.P89S	ENST00000372588.4	37	c.265	CCDS14516.1	X	.	.	.	.	.	.	.	.	.	.	g	9.127	1.010508	0.19277	.	.	ENSG00000123576	ENST00000372588	D	0.92199	-2.99	0.801	-0.312	0.12758	.	.	.	.	.	D	0.88043	0.6331	N	0.24115	0.695	0.19300	N	0.999972	D	0.57571	0.98	P	0.59424	0.857	T	0.78257	-0.2274	9	0.08599	T	0.76	.	6.0732	0.19901	0.0:0.3214:0.6786:0.0	.	89	Q8N693	ESX1_HUMAN	S	89	ENSP00000361669:P89S	ENSP00000361669:P89S	P	-	1	0	ESX1	103385732	0.031000	0.19500	0.004000	0.12327	0.018000	0.09664	-0.840000	0.04363	-0.183000	0.10585	0.411000	0.27672	CCG	ESX1	-	NULL	ENSG00000123576		0.682	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	HGNC	protein_coding	OTTHUMT00000057763.2		0.00	28	0	G	NM_153448		103499076	-1			no_errors	ENST00000372588	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.439	A
FAM135B	51059	genome.wustl.edu	37	8	139164797	139164797	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:139164797A>T	ENST00000395297.1	-	13	2091	c.1921T>A	c.(1921-1923)Tgt>Agt	p.C641S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	641										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGTGGATCACAGGGCTCAGAG	0.478										HNSCC(54;0.14)																																							0													92.0	93.0	93.0					8																	139164797		1882	4121	6003	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1921T>A	8.37:g.139164797A>T	ENSP00000378710:p.Cys641Ser		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.C641S	ENST00000395297.1	37	c.1921	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	A	10.04	1.241514	0.22711	.	.	ENSG00000147724	ENST00000395297	T	0.13307	2.6	5.51	1.89	0.25635	.	0.750110	0.13009	N	0.420982	T	0.16896	0.0406	M	0.67953	2.075	0.09310	N	1	P;P;B	0.40731	0.728;0.557;0.148	P;B;B	0.44359	0.447;0.372;0.027	T	0.15607	-1.0431	10	0.15499	T	0.54	-1.6814	7.4042	0.26981	0.5885:0.329:0.0825:0.0	.	641;641;641	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	S	641	ENSP00000378710:C641S	ENSP00000276737:C641S	C	-	1	0	FAM135B	139233979	0.000000	0.05858	0.564000	0.28396	0.102000	0.19082	0.818000	0.27295	0.377000	0.24735	0.533000	0.62120	TGT	FAM135B	-	NULL	ENSG00000147724		0.478	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	-	0.00	103	0	A	NM_015912		139164797	-1	tier1	-	no_errors	ENST00000395297	ensembl	human	known	74_37	missense	15.38	88	16	SNP	0.000	T
FAM19A5	25817	genome.wustl.edu	37	22	49146040	49146040	+	3'UTR	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr22:49146040G>T	ENST00000402357.1	+	0	913				FAM19A5_ENST00000473898.1_3'UTR|FAM19A5_ENST00000358295.5_3'UTR|FAM19A5_ENST00000406880.1_3'UTR	NM_001082967.1	NP_001076436.1	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A5							extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(6)	7		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		CACGACGCCTGCCCCAGGGGA	0.602																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY325118	CCDS46728.1, CCDS46729.1	22q13.32	2005-09-20			ENSG00000219438	ENSG00000219438			21592	protein-coding gene	gene with protein product						15028294	Standard	NM_015381		Approved	TAFA-5	uc003bim.4	Q7Z5A7	OTTHUMG00000150308	ENST00000402357.1:c.*381G>T	22.37:g.49146040G>T			A6NII9|B0QZ13|B0QZ14|B0QZ15|O95902|Q5H9C4|Q6UWC9|Q8IXR8	RNA	SNP	-	NULL	ENST00000402357.1	37	NULL	CCDS46728.1	22																																																																																			FAM19A5	-	-	ENSG00000219438		0.602	FAM19A5-003	PUTATIVE	basic|CCDS	protein_coding	FAM19A5	HGNC	protein_coding	OTTHUMT00000317504.1	-	0.00	84	0	G	NM_015381		49146040	+1	tier1	-	no_errors	ENST00000473898	ensembl	human	known	74_37	rna	6.90	54	4	SNP	0.000	T
FAM204A	63877	genome.wustl.edu	37	10	120085671	120085671	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:120085671G>A	ENST00000369183.4	-	7	797	c.538C>T	c.(538-540)Cga>Tga	p.R180*	FAM204A_ENST00000369172.4_Nonsense_Mutation_p.R180*|FAM204A_ENST00000469758.1_5'UTR	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A	180								p.R180R(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						CTCACCTCTCGAGTAGCTAGC	0.348																																																	1	Substitution - coding silent(1)	kidney(1)											107.0	104.0	105.0					10																	120085671		2203	4300	6503	SO:0001587	stop_gained	0			AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.538C>T	10.37:g.120085671G>A	ENSP00000358183:p.Arg180*		D3DRC6|Q5T373|Q9H5V5	Nonsense_Mutation	SNP	NULL	p.R180*	ENST00000369183.4	37	c.538	CCDS7605.1	10	.	.	.	.	.	.	.	.	.	.	G	38	7.235534	0.98154	.	.	ENSG00000165669	ENST00000369183;ENST00000369172	.	.	.	5.72	4.81	0.61882	.	0.062204	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.6837	16.4299	0.83839	0.0:0.0:0.8674:0.1326	.	.	.	.	X	180	.	ENSP00000358170:R180X	R	-	1	2	FAM204A	120075661	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.700000	0.91322	1.548000	0.49413	0.650000	0.86243	CGA	FAM204A	-	NULL	ENSG00000165669		0.348	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM204A	HGNC	protein_coding	OTTHUMT00000050596.2	-	0.00	82	0	G	NM_022063		120085671	-1	tier1	-	no_errors	ENST00000369172	ensembl	human	known	74_37	nonsense	21.51	73	20	SNP	1.000	A
FAM90A28P	100128254	genome.wustl.edu	37	19	53805402	53805402	+	RNA	SNP	T	T	C	rs2865250		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:53805402T>C	ENST00000596881.1	-	0	461									family with sequence similarity 90, member A28, pseudogene																		CTTGAACTTCTGATCATTCTT	0.512																																																	0																																												0					19q13.42	2013-02-15			ENSG00000269118	ENSG00000269118			43747	pseudogene	pseudogene							Standard	NG_028700		Approved						19.37:g.53805402T>C				RNA	SNP	-	NULL	ENST00000596881.1	37	NULL		19																																																																																			FAM90A28P	-	-	ENSG00000269118		0.512	FAM90A28P-002	KNOWN	basic	processed_transcript	FAM90A28P	HGNC	pseudogene	OTTHUMT00000464406.1	-	0.00	79	0	T	NG_028700		53805402	-1	tier1	rs2865250	no_errors	ENST00000596881	ensembl	human	known	74_37	rna	22.22	35	10	SNP	0.003	C
FBXW7	55294	genome.wustl.edu	37	4	153249360	153249361	+	Splice_Site	INS	-	-	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:153249360_153249361insT	ENST00000281708.4	-	9	2646_2647	c.1417_1418insA	c.(1417-1419)aga>aAga	p.R473fs	FBXW7_ENST00000603548.1_Splice_Site_p.R473fs|FBXW7_ENST00000263981.5_Splice_Site_p.R393fs|FBXW7_ENST00000393956.3_Splice_Site_p.R297fs|FBXW7_ENST00000603841.1_Splice_Site_p.R473fs|FBXW7_ENST00000296555.5_Splice_Site_p.R355fs	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	473					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R473fs*25(4)|p.R473fs*4(3)|p.R234fs*25(1)|p.R393fs*25(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TTTCCCTTACCTTTTTTCATGA	0.416			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	10	Deletion - Frameshift(6)|Insertion - Frameshift(3)|Unknown(1)	large_intestine(6)|NS(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|endometrium(1)																																								SO:0001630	splice_region_variant	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1418+1->A	4.37:g.153249366_153249366dupT			B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Frame_Shift_Ins	INS	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R473fs	ENST00000281708.4	37	c.1418_1417	CCDS3777.1	4																																																																																			FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.416	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1		0.00	69	0	-		Frame_Shift_Ins	153249361	-1	tier1		no_errors	ENST00000281708	ensembl	human	known	74_37	frame_shift_ins	18.37	80	18	INS	1.000:1.000	T
FERMT2	10979	genome.wustl.edu	37	14	53324444	53324444	+	3'UTR	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr14:53324444G>T	ENST00000395631.2	-	0	2910				FERMT2_ENST00000557255.1_5'UTR|FERMT2_ENST00000343279.4_3'UTR|FERMT2_ENST00000341590.3_3'UTR			Q96AC1	FERM2_HUMAN	fermitin family member 2						cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					CATATTTTAGGCAGACAGTGA	0.274																																																	0																																										SO:0001624	3_prime_UTR_variant	0			Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.*651C>A	14.37:g.53324444G>T			B5TJY2|Q14840|Q86TY7	RNA	SNP	-	NULL	ENST00000395631.2	37	NULL	CCDS9713.1	14																																																																																			FERMT2	-	-	ENSG00000073712		0.274	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FERMT2	HGNC	protein_coding	OTTHUMT00000276907.2	-	0.00	23	0	G	NM_006832		53324444	-1	tier1	-	no_errors	ENST00000557255	ensembl	human	known	74_37	rna	13.51	32	5	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152283911	152283911	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:152283911C>T	ENST00000368799.1	-	3	3486	c.3451G>A	c.(3451-3453)Gac>Aac	p.D1151N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1151	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGAGCTGTCTCGTGCCTGC	0.602									Ichthyosis																																								0													201.0	242.0	228.0					1																	152283911		2203	4296	6499	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3451G>A	1.37:g.152283911C>T	ENSP00000357789:p.Asp1151Asn		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.D1151N	ENST00000368799.1	37	c.3451	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	9.729	1.161652	0.21538	.	.	ENSG00000143631	ENST00000368799	T	0.04454	3.62	3.18	1.11	0.20524	.	.	.	.	.	T	0.06234	0.0161	M	0.69248	2.105	0.09310	N	1	D	0.89917	1.0	D	0.77004	0.989	T	0.39702	-0.9601	9	0.25751	T	0.34	.	4.916	0.13846	0.2437:0.5186:0.2377:0.0	.	1151	P20930	FILA_HUMAN	N	1151	ENSP00000357789:D1151N	ENSP00000357789:D1151N	D	-	1	0	FLG	150550535	0.003000	0.15002	0.086000	0.20670	0.189000	0.23516	0.665000	0.25083	1.626000	0.50381	0.186000	0.17326	GAC	FLG	-	NULL	ENSG00000143631		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	168	0	C	NM_002016		152283911	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	23.11	163	49	SNP	0.004	T
FLG	2312	genome.wustl.edu	37	1	152287150	152287150	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:152287150A>C	ENST00000368799.1	-	3	247	c.212T>G	c.(211-213)tTc>tGc	p.F71C	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	71	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAACTCAGTGAAGTCAATTTT	0.413									Ichthyosis																																								0													110.0	110.0	110.0					1																	152287150		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.212T>G	1.37:g.152287150A>C	ENSP00000357789:p.Phe71Cys		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.F71C	ENST00000368799.1	37	c.212	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	A	10.65	1.409102	0.25378	.	.	ENSG00000143631	ENST00000368799	T	0.22945	1.93	5.09	5.09	0.68999	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	.	.	.	.	T	0.54208	0.1844	H	0.96943	3.91	0.28226	N	0.926307	D	0.89917	1.0	D	0.91635	0.999	T	0.62220	-0.6900	9	0.87932	D	0	-14.0653	11.2283	0.48897	1.0:0.0:0.0:0.0	.	71	P20930	FILA_HUMAN	C	71	ENSP00000357789:F71C	ENSP00000357789:F71C	F	-	2	0	FLG	150553774	0.930000	0.31532	0.882000	0.34594	0.300000	0.27592	3.999000	0.57031	2.142000	0.66516	0.477000	0.44152	TTC	FLG	-	pfscan_EF_hand_dom	ENSG00000143631		0.413	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1		0.00	55	0	A	NM_002016		152287150	-1			no_errors	ENST00000368799	ensembl	human	known	74_37	missense	5.61	101	6	SNP	0.927	C
FMO4	2329	genome.wustl.edu	37	1	171306535	171306535	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:171306535G>T	ENST00000367749.3	+	9	1551	c.1221G>T	c.(1219-1221)gaG>gaT	p.E407D		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	407					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TGATGATGGAGGCTACTGAAA	0.353																																					Pancreas(24;816 862 7754 7993 32832)												0													107.0	102.0	103.0					1																	171306535		2203	4300	6503	SO:0001583	missense	0			BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.1221G>T	1.37:g.171306535G>T	ENSP00000356723:p.Glu407Asp		Q53XR0	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_4,prints_Flavin_mOase_1,prints_Flavin_mOase_3	p.E407D	ENST00000367749.3	37	c.1221	CCDS1295.1	1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.702563	0.00719	.	.	ENSG00000076258	ENST00000367749	T	0.54071	0.59	4.85	-4.82	0.03171	.	0.339515	0.32175	N	0.006475	T	0.07503	0.0189	N	0.16602	0.42	0.09310	N	1	B	0.09022	0.002	B	0.23419	0.046	T	0.35919	-0.9769	10	0.02654	T	1	-9.0465	4.1774	0.10358	0.4287:0.0:0.2291:0.3422	.	407	P31512	FMO4_HUMAN	D	407	ENSP00000356723:E407D	ENSP00000356723:E407D	E	+	3	2	FMO4	169573159	0.007000	0.16637	0.034000	0.17996	0.120000	0.20174	-0.616000	0.05591	-0.548000	0.06199	0.655000	0.94253	GAG	FMO4	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase	ENSG00000076258		0.353	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO4	HGNC	protein_coding	OTTHUMT00000086223.1	-	0.00	72	0	G	NM_002022		171306535	+1	tier1	-	no_errors	ENST00000367749	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.005	T
FRMD4A	55691	genome.wustl.edu	37	10	13696433	13696433	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:13696433G>T	ENST00000357447.2	-	23	3401	c.3033C>A	c.(3031-3033)atC>atA	p.I1011I	FRMD4A_ENST00000378503.1_Silent_p.I1011I|FRMD4A_ENST00000358621.4_Silent_p.I996I	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	1011					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GCCAGGTTAGGATGTGGTGGG	0.517																																																	0													80.0	77.0	78.0					10																	13696433		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.3033C>A	10.37:g.13696433G>T			A7E2Y3|Q5T377	Silent	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.I1011	ENST00000357447.2	37	c.3033	CCDS7101.1	10																																																																																			FRMD4A	-	NULL	ENSG00000151474		0.517	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	-	0.00	69	0	G	NM_018027		13696433	-1	tier1	-	no_errors	ENST00000357447	ensembl	human	known	74_37	silent	7.27	51	4	SNP	1.000	T
FRMPD3	84443	genome.wustl.edu	37	X	106841057	106841059	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrX:106841057_106841059delGAG	ENST00000276185.4	+	15	2047_2049	c.2047_2049delGAG	c.(2047-2049)gagdel	p.E689del				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	689	Poly-Glu.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						ACCTGGGAGTgaggaggaggagg	0.567																																																	0										335,2014		59,101,116,836,241						-0.1	1.0			9	594,3667		10,384,190,1224,835	no	coding	FRMPD3	XM_042978.7		69,485,306,2060,1076	A1A1,A1R,A1,RR,R		13.9404,14.2614,14.0545				929,5681				SO:0001651	inframe_deletion	0			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.2047_2049delGAG	X.37:g.106841066_106841068delGAG	ENSP00000276185:p.Glu689del		Q96JK8	In_Frame_Del	DEL	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.E686in_frame_del	ENST00000276185.4	37	c.2047_2049		X																																																																																			FRMPD3	-	NULL	ENSG00000147234		0.567	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	HGNC	protein_coding			0.00	33	0	GAG	XM_042978		106841059	+1	tier1		no_errors	ENST00000276185	ensembl	human	known	74_37	in_frame_del	17.86	23	5	DEL	1.000:1.000:1.000	-
GABRG1	2565	genome.wustl.edu	37	4	46099235	46099235	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:46099235A>C	ENST00000295452.4	-	2	403	c.236T>G	c.(235-237)cTt>cGt	p.L79R		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	79					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATCTGGACGAAGTTTATTGTC	0.348																																																	0													148.0	144.0	146.0					4																	46099235		2203	4299	6502	SO:0001583	missense	0			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.236T>G	4.37:g.46099235A>C	ENSP00000295452:p.Leu79Arg		Q5H9T8	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg1_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.L79R	ENST00000295452.4	37	c.236	CCDS3470.1	4	.	.	.	.	.	.	.	.	.	.	A	20.5	3.999735	0.74818	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.79454	-1.27	4.83	4.83	0.62350	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.64402	D	0.000001	D	0.89234	0.6657	M	0.88241	2.94	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.91268	0.5042	10	0.87932	D	0	.	13.7529	0.62919	1.0:0.0:0.0:0.0	.	79	Q8N1C3	GBRG1_HUMAN	R	79	ENSP00000295452:L79R	ENSP00000295452:L79R	L	-	2	0	GABRG1	45793992	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.732000	0.91534	2.032000	0.59987	0.533000	0.62120	CTT	GABRG1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABBAg_rcpt,tigrfam_Neur_channel	ENSG00000163285		0.348	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG1	HGNC	protein_coding	OTTHUMT00000250470.1	-	0.00	61	0	A	NM_173536		46099235	-1	tier1	-	no_errors	ENST00000295452	ensembl	human	known	74_37	missense	10.96	65	8	SNP	1.000	C
GLYATL2	219970	genome.wustl.edu	37	11	58602155	58602155	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:58602155A>C	ENST00000287275.1	-	6	1022	c.632T>G	c.(631-633)cTt>cGt	p.L211R	GLYATL2_ENST00000533636.1_5'Flank|GLYATL2_ENST00000532258.1_Missense_Mutation_p.L211R	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	211						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	CCAAGAGACAAGCTGGCCCTC	0.458																																																	0													71.0	74.0	73.0					11																	58602155		2136	4264	6400	SO:0001583	missense	0			AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.632T>G	11.37:g.58602155A>C	ENSP00000287275:p.Leu211Arg		A5LGC7|Q86WC3|Q96AT2	Missense_Mutation	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.L211R	ENST00000287275.1	37	c.632	CCDS41649.1	11	.	.	.	.	.	.	.	.	.	.	A	10.30	1.311605	0.23821	.	.	ENSG00000156689	ENST00000287275;ENST00000532258	T;T	0.22945	1.93;1.93	4.34	2.41	0.29592	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	0.085587	0.47455	U	0.000222	T	0.16896	0.0406	L	0.38175	1.15	0.09310	N	1	P	0.37176	0.586	B	0.36378	0.223	T	0.11743	-1.0575	10	0.49607	T	0.09	.	4.956	0.14041	0.1167:0.0:0.6778:0.2056	.	211	Q8WU03	GLYL2_HUMAN	R	211	ENSP00000287275:L211R;ENSP00000434277:L211R	ENSP00000287275:L211R	L	-	2	0	GLYATL2	58358731	0.049000	0.20398	0.002000	0.10522	0.080000	0.17528	0.546000	0.23284	0.273000	0.22049	-0.516000	0.04426	CTT	GLYATL2	-	pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	ENSG00000156689		0.458	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL2	HGNC	protein_coding	OTTHUMT00000394599.1	-	0.00	42	0	A	NM_145016		58602155	-1	tier1	-	no_errors	ENST00000287275	ensembl	human	known	74_37	missense	25.49	38	13	SNP	0.011	C
GOLGA7B	401647	genome.wustl.edu	37	10	99619286	99619286	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:99619286C>T	ENST00000370602.1	+	2	149	c.84C>T	c.(82-84)agC>agT	p.S28S		NM_001010917.2	NP_001010917.1	Q2TAP0	GOG7B_HUMAN	golgin A7 family, member B	28						Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|prostate(1)	5						GAGACTACAGCGATGGGACCA	0.577																																																	0													84.0	78.0	80.0					10																	99619286		2203	4300	6503	SO:0001819	synonymous_variant	0			BC008047	CCDS31265.1	10q24.2	2011-10-25	2010-02-12	2008-10-03	ENSG00000155265	ENSG00000155265			31668	protein-coding gene	gene with protein product		614189	"""chromosome 10 open reading frame 133"", ""chromosome 10 open reading frame 132"", ""golgi autoantigen, golgin subfamily a, 7B"""	C10orf133, C10orf132			Standard	NM_001010917		Approved	bA459F3.4, bA451M19.3	uc001kos.3	Q2TAP0	OTTHUMG00000018869	ENST00000370602.1:c.84C>T	10.37:g.99619286C>T			Q5T4F5	Silent	SNP	pfam_Golgin_A_7/ERF4	p.S28	ENST00000370602.1	37	c.84	CCDS31265.1	10																																																																																			GOLGA7B	-	pfam_Golgin_A_7/ERF4	ENSG00000155265		0.577	GOLGA7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA7B	HGNC	protein_coding	OTTHUMT00000049752.1	-	0.00	54	0	C	NM_001010917		99619286	+1	tier1	-	no_errors	ENST00000370602	ensembl	human	known	74_37	silent	31.25	44	20	SNP	0.992	T
GPR26	2849	genome.wustl.edu	37	10	125426476	125426476	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:125426476T>C	ENST00000284674.1	+	1	606	c.553T>C	c.(553-555)Ttc>Ctc	p.F185L		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	185					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				CCTGCTCTCCTTCGTCGTGCT	0.642																																																	0													36.0	27.0	30.0					10																	125426476		2203	4299	6502	SO:0001583	missense	0				CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.553T>C	10.37:g.125426476T>C	ENSP00000284674:p.Phe185Leu		Q2M2E2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.F185L	ENST00000284674.1	37	c.553	CCDS7636.1	10	.	.	.	.	.	.	.	.	.	.	T	0.036	-1.306569	0.01353	.	.	ENSG00000154478	ENST00000284674	T	0.32988	1.43	4.02	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.124528	0.53938	D	0.000049	T	0.07638	0.0192	N	0.01091	-1.02	0.36456	D	0.866409	B	0.09022	0.002	B	0.14023	0.01	T	0.28138	-1.0053	10	0.05525	T	0.97	-35.956	6.172	0.20422	0.0:0.2705:0.0:0.7295	.	185	Q8NDV2	GPR26_HUMAN	L	185	ENSP00000284674:F185L	ENSP00000284674:F185L	F	+	1	0	GPR26	125416466	1.000000	0.71417	0.996000	0.52242	0.132000	0.20833	1.419000	0.34793	0.600000	0.29862	-0.256000	0.11100	TTC	GPR26	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000154478		0.642	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR26	HGNC	protein_coding	OTTHUMT00000050850.1	-	0.00	38	0	T			125426476	+1	tier1	-	no_errors	ENST00000284674	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	C
GRIA4	2893	genome.wustl.edu	37	11	105850808	105850808	+	3'UTR	SNP	A	A	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:105850808A>T	ENST00000530497.1	+	0	3051				GRIA4_ENST00000533094.1_3'UTR|GRIA4_ENST00000282499.5_3'UTR|GRIA4_ENST00000393127.2_3'UTR			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TAAACTGTGAAGTTCTTGCTC	0.423																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.*342A>T	11.37:g.105850808A>T			Q86XE8	RNA	SNP	-	NULL	ENST00000530497.1	37	NULL	CCDS8333.1	11																																																																																			GRIA4	-	-	ENSG00000152578		0.423	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	HGNC	protein_coding	OTTHUMT00000388593.1	-	0.00	24	0	A			105850808	+1	tier1	-	no_errors	ENST00000533094	ensembl	human	putative	74_37	rna	43.33	17	13	SNP	1.000	T
GRK7	131890	genome.wustl.edu	37	3	141497562	141497562	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:141497562G>T	ENST00000264952.2	+	1	573	c.436G>T	c.(436-438)Gca>Tca	p.A146S		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	146	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						GCGAGTGGCTGCAGTGACGCT	0.607																																																	0													43.0	44.0	44.0					3																	141497562		2203	4300	6503	SO:0001583	missense	0				CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.436G>T	3.37:g.141497562G>T	ENSP00000264952:p.Ala146Ser			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.A146S	ENST00000264952.2	37	c.436	CCDS3120.1	3	.	.	.	.	.	.	.	.	.	.	G	0.104	-1.148028	0.01714	.	.	ENSG00000114124	ENST00000264952	T	0.01981	4.52	4.79	-6.02	0.02192	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.610854	0.16666	N	0.204563	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B	0.24317	0.101	B	0.25506	0.061	T	0.43147	-0.9409	10	0.72032	D	0.01	0.0631	5.1323	0.14917	0.1974:0.2133:0.4637:0.1256	.	146	Q8WTQ7	GRK7_HUMAN	S	146	ENSP00000264952:A146S	ENSP00000264952:A146S	A	+	1	0	GRK7	142980252	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.207000	0.03008	-0.923000	0.03785	-0.253000	0.11424	GCA	GRK7	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	ENSG00000114124		0.607	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK7	HGNC	protein_coding	OTTHUMT00000353168.1	-	0.00	68	0	G	NM_139209		141497562	+1	tier1	-	no_errors	ENST00000264952	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.000	T
HCN1	348980	genome.wustl.edu	37	5	45645495	45645495	+	Missense_Mutation	SNP	T	T	G	rs527655367		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:45645495T>G	ENST00000303230.4	-	2	698	c.641A>C	c.(640-642)aAg>aCg	p.K214T		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	214					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						ATAATTCATCTTGATCACTTT	0.373																																																	0													88.0	83.0	85.0					5																	45645495		2203	4300	6503	SO:0001583	missense	0			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.641A>C	5.37:g.45645495T>G	ENSP00000307342:p.Lys214Thr			Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.K214T	ENST00000303230.4	37	c.641	CCDS3952.1	5	.	.	.	.	.	.	.	.	.	.	T	17.96	3.516650	0.64634	.	.	ENSG00000164588	ENST00000303230	D	0.97959	-4.63	5.37	5.37	0.77165	Ion transport (1);	0.000000	0.64402	D	0.000009	D	0.96185	0.8756	L	0.35854	1.095	0.80722	D	1	B	0.33777	0.425	B	0.40940	0.344	D	0.96155	0.9111	10	0.62326	D	0.03	.	15.3658	0.74519	0.0:0.0:0.0:1.0	.	214	O60741	HCN1_HUMAN	T	214	ENSP00000307342:K214T	ENSP00000307342:K214T	K	-	2	0	HCN1	45681252	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.038000	0.60285	0.454000	0.30748	AAG	HCN1	-	pfam_Ion_trans_dom	ENSG00000164588		0.373	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	-	0.00	90	0	T	NM_021072		45645495	-1	tier1	-	no_errors	ENST00000303230	ensembl	human	known	74_37	missense	6.67	70	5	SNP	1.000	G
HDAC4	9759	genome.wustl.edu	37	2	240016733	240016733	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:240016733G>T	ENST00000345617.3	-	17	3029	c.2238C>A	c.(2236-2238)ttC>ttA	p.F746L	HDAC4_ENST00000541256.1_Missense_Mutation_p.F720L|HDAC4_ENST00000543185.1_Missense_Mutation_p.F330L	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	746	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGAGCCGGACGAACACGGAGG	0.612																																																	0													77.0	85.0	82.0					2																	240016733		2203	4300	6503	SO:0001583	missense	0			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2238C>A	2.37:g.240016733G>T	ENSP00000264606:p.Phe746Leu		Q9UND6	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.F746L	ENST00000345617.3	37	c.2238	CCDS2529.1	2	.	.	.	.	.	.	.	.	.	.	G	8.926	0.962203	0.18583	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185;ENST00000541256;ENST00000393621	T;T;T	0.65364	0.22;-0.15;0.73	4.46	-8.93	0.00771	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	L	0.48935	1.535	0.40990	D	0.984848	D;B;B;B;B;B	0.54601	0.967;0.222;0.013;0.014;0.016;0.2	P;B;B;B;B;B	0.58577	0.841;0.094;0.016;0.005;0.037;0.146	T	0.79305	-0.1858	10	0.56958	D	0.05	.	20.7024	0.99706	0.2754:0.0:0.7246:0.0	.	746;629;720;720;714;746	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	L	746;634;330;720;629	ENSP00000264606:F746L;ENSP00000440481:F330L;ENSP00000443057:F720L	ENSP00000264606:F746L	F	-	3	2	HDAC4	239681670	0.411000	0.25384	0.125000	0.21846	0.040000	0.13550	-0.171000	0.09883	-2.355000	0.00614	-0.768000	0.03414	TTC	HDAC4	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000068024		0.612	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC4	HGNC	protein_coding	OTTHUMT00000257174.2	-	0.00	180	0	G	NM_006037		240016733	-1	tier1	-	no_errors	ENST00000345617	ensembl	human	known	74_37	missense	5.46	172	10	SNP	0.191	T
HELZ2	85441	genome.wustl.edu	37	20	62191383	62191383	+	Missense_Mutation	SNP	G	G	A	rs148612902	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr20:62191383G>A	ENST00000467148.1	-	18	7792	c.7723C>T	c.(7723-7725)Cgg>Tgg	p.R2575W	HELZ2_ENST00000427522.2_Missense_Mutation_p.R2006W	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2575	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R2575W(1)									TTGGTGGGCCGCTGGTCCAGG	0.652													G|||	2	0.000399361	0.0	0.0	5008	,	,		13835	0.001		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	breast(1)						G	TRP/ARG,TRP/ARG	0,4398		0,0,2199	54.0	45.0	48.0		7723,6016	2.9	1.0	20	dbSNP_134	48	5,8593	4.3+/-15.6	0,5,4294	yes	missense,missense	PRIC285	NM_001037335.2,NM_033405.3	101,101	0,5,6493	AA,AG,GG		0.0582,0.0,0.0385	probably-damaging,probably-damaging	2575/2650,2006/2081	62191383	5,12991	2199	4299	6498	SO:0001583	missense	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7723C>T	20.37:g.62191383G>A	ENSP00000417401:p.Arg2575Trp		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R2575W	ENST00000467148.1	37	c.7723	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350878	0.61183	0.0	5.82E-4	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.80738	-1.41;-1.3	3.94	2.88	0.33553	.	0.460591	0.20765	N	0.086081	D	0.86260	0.5890	M	0.72894	2.215	0.28827	N	0.897344	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.982	T	0.78534	-0.2167	10	0.87932	D	0	-32.889	8.156	0.31169	0.0:0.0:0.5369:0.4631	.	2575;2006	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	W	2006;2575	ENSP00000393257:R2006W;ENSP00000417401:R2575W	ENSP00000393257:R2006W	R	-	1	2	RP4-697K14.7	61661827	0.000000	0.05858	0.997000	0.53966	0.839000	0.47603	0.153000	0.16323	1.763000	0.52060	0.561000	0.74099	CGG	HELZ2	-	superfamily_P-loop_NTPase	ENSG00000130589		0.652	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1		0.00	54	0	G	NM_001037335		62191383	-1			no_errors	ENST00000467148	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.745	A
HERC1	8925	genome.wustl.edu	37	15	63961885	63961885	+	Silent	SNP	A	A	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr15:63961885A>G	ENST00000443617.2	-	40	8145	c.8058T>C	c.(8056-8058)tcT>tcC	p.S2686S		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2686					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTGGGTAACTAGAGAACATTT	0.388																																																	0													129.0	131.0	131.0					15																	63961885		1899	4127	6026	SO:0001819	synonymous_variant	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8058T>C	15.37:g.63961885A>G			Q8IW65	Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.S2686	ENST00000443617.2	37	c.8058	CCDS45277.1	15																																																																																			HERC1	-	NULL	ENSG00000103657		0.388	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	47	0	A	NM_003922		63961885	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	silent	39.62	32	21	SNP	0.999	G
HERC2P4	100289574	genome.wustl.edu	37	16	32128508	32128508	+	IGR	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:32128508G>A								RP11-1166P10.6 (32402 upstream) : HERC2P4 (52796 downstream)																							GGTGGGCTGCGCGAGGACATC	0.622																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.32128508G>A				RNA	SNP	-	NULL		37	NULL		16																																																																																			HERC2P4	-	-	ENSG00000230267	0	0.622					HERC2P4	HGNC			-	0.00	14	0	G			32128508	-1	tier1	-	no_errors	ENST00000564145	ensembl	human	known	74_37	rna	50.00	4	4	SNP	0.387	A
HIVEP3	59269	genome.wustl.edu	37	1	41979411	41979411	+	Silent	SNP	G	G	A	rs372654136		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:41979411G>A	ENST00000372583.1	-	8	6366	c.5481C>T	c.(5479-5481)gaC>gaT	p.D1827D	HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000429157.2_Silent_p.D1827D|HIVEP3_ENST00000372584.1_Silent_p.D1827D|HIVEP3_ENST00000247584.5_Silent_p.D1827D	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1827	Acidic 3.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GGAACAGGTCGTCACTGGTTC	0.602																																																	0													38.0	40.0	40.0					1																	41979411		2203	4300	6503	SO:0001819	synonymous_variant	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5481C>T	1.37:g.41979411G>A			A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D1827	ENST00000372583.1	37	c.5481	CCDS463.1	1																																																																																			HIVEP3	-	NULL	ENSG00000127124		0.602	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1		0.00	41	0	G	NM_024503		41979411	-1			no_errors	ENST00000247584	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.727	A
HK3	3101	genome.wustl.edu	37	5	176314483	176314483	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:176314483G>T	ENST00000292432.5	-	11	1660	c.1569C>A	c.(1567-1569)ccC>ccA	p.P523P		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	523	Catalytic.|Hexokinase type-1 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGACGAAAGTGGGCAGCATGC	0.657																																																	0													35.0	35.0	35.0					5																	176314483		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.1569C>A	5.37:g.176314483G>T			Q8N1E7	Silent	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.P523	ENST00000292432.5	37	c.1569	CCDS4407.1	5																																																																																			HK3	-	pfam_Hexokinase_N	ENSG00000160883		0.657	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK3	HGNC	protein_coding	OTTHUMT00000253428.1	-	0.00	100	0	G			176314483	-1	tier1	-	no_errors	ENST00000292432	ensembl	human	known	74_37	silent	17.05	73	15	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186158649	186158649	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:186158649G>T	ENST00000271588.4	+	107	16776	c.16547G>T	c.(16546-16548)tGc>tTc	p.C5516F	HMCN1_ENST00000367492.2_Missense_Mutation_p.C5399F	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5516					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTTAGGTTCTGCCTCAAGAAC	0.428																																																	0													95.0	87.0	90.0					1																	186158649		2176	4266	6442	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16547G>T	1.37:g.186158649G>T	ENSP00000271588:p.Cys5516Phe		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.C5516F	ENST00000271588.4	37	c.16547	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581139	0.86748	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	D;D;D	0.99914	-7.98;-7.98;-7.98	5.75	5.75	0.90469	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.99926	0.9966	M	0.86178	2.8	0.52501	D	0.99995	D	0.76494	0.999	D	0.85130	0.997	D	0.96179	0.9129	10	0.66056	D	0.02	.	19.9598	0.97242	0.0:0.0:1.0:0.0	.	5516	Q96RW7	HMCN1_HUMAN	F	5516;5399;191	ENSP00000271588:C5516F;ENSP00000356462:C5399F;ENSP00000406205:C191F	ENSP00000271588:C5516F	C	+	2	0	HMCN1	184425272	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.765000	0.98953	2.716000	0.92895	0.655000	0.94253	TGC	HMCN1	-	pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000143341		0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	67	0	G	NM_031935		186158649	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
HOOK2	29911	genome.wustl.edu	37	19	12883647	12883647	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:12883647C>T	ENST00000397668.3	-	5	408	c.335G>A	c.(334-336)gGc>gAc	p.G112D	HOOK2_ENST00000264827.5_Missense_Mutation_p.G112D|HOOK2_ENST00000589965.1_Intron	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	112	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						AAGCAGCTTGCCGAGCTCTGC	0.602																																																	0													53.0	55.0	54.0					19																	12883647		1939	4148	6087	SO:0001583	missense	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.335G>A	19.37:g.12883647C>T	ENSP00000380785:p.Gly112Asp		O60562	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_UBA-like	p.G112D	ENST00000397668.3	37	c.335	CCDS42508.1	19	.	.	.	.	.	.	.	.	.	.	C	23.7	4.446336	0.84101	.	.	ENSG00000095066	ENST00000397668;ENST00000264827	T;T	0.20463	2.07;2.07	3.64	3.64	0.41730	.	0.073235	0.53938	D	0.000051	T	0.48314	0.1493	M	0.83118	2.625	0.50632	D	0.999888	D;D	0.71674	0.998;0.998	D;D	0.74674	0.973;0.984	T	0.58284	-0.7663	10	0.72032	D	0.01	-20.9783	14.4602	0.67442	0.0:1.0:0.0:0.0	.	112;112	Q96ED9-2;Q96ED9	.;HOOK2_HUMAN	D	112	ENSP00000380785:G112D;ENSP00000264827:G112D	ENSP00000264827:G112D	G	-	2	0	HOOK2	12744647	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	5.651000	0.67951	1.734000	0.51633	0.455000	0.32223	GGC	HOOK2	-	pfam_Hook-related_fam	ENSG00000095066		0.602	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1	-	0.00	66	0	C	NM_013312		12883647	-1	tier1	-	no_errors	ENST00000397668	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
HSD17B11	51170	genome.wustl.edu	37	4	88312183	88312183	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:88312183G>C	ENST00000358290.4	-	1	355	c.40C>G	c.(40-42)Ctg>Gtg	p.L14V	HSD17B11_ENST00000507286.1_Missense_Mutation_p.L14V	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	14					androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)			cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		CAGACGATCAGTAACGGGAGA	0.453																																																	0													54.0	63.0	60.0					4																	88312183		2203	4300	6503	SO:0001583	missense	0			AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.40C>G	4.37:g.88312183G>C	ENSP00000351035:p.Leu14Val		Q96HF6|Q9UKU4	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.L14V	ENST00000358290.4	37	c.40	CCDS3619.1	4	.	.	.	.	.	.	.	.	.	.	G	6.853	0.526616	0.13066	.	.	ENSG00000198189	ENST00000358290;ENST00000507286	D;D	0.85339	-1.97;-1.76	5.98	5.98	0.97165	.	0.118405	0.38837	N	0.001551	T	0.72542	0.3473	L	0.41573	1.285	0.09310	N	1	P	0.40083	0.702	B	0.30495	0.116	T	0.64879	-0.6303	10	0.06236	T	0.91	.	11.3812	0.49759	0.0:0.1355:0.7243:0.1403	.	14	Q8NBQ5	DHB11_HUMAN	V	14	ENSP00000351035:L14V;ENSP00000423775:L14V	ENSP00000351035:L14V	L	-	1	2	HSD17B11	88531207	0.662000	0.27439	0.103000	0.21229	0.035000	0.12851	1.399000	0.34566	2.838000	0.97847	0.655000	0.94253	CTG	HSD17B11	-	NULL	ENSG00000198189		0.453	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B11	HGNC	protein_coding	OTTHUMT00000253041.1	-	0.00	115	0	G	NM_016245		88312183	-1	tier1	-	no_errors	ENST00000358290	ensembl	human	known	74_37	missense	30.53	66	29	SNP	0.069	C
HTRA2	27429	genome.wustl.edu	37	2	74758174	74758174	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:74758174G>T	ENST00000258080.3	+	3	1478	c.848G>T	c.(847-849)aGa>aTa	p.R283I	AUP1_ENST00000377526.3_5'Flank|HTRA2_ENST00000467961.1_3'UTR|HTRA2_ENST00000352222.3_Intron	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	283	Serine protease.				adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						CGTCCAGCCAGAGACCTGGGA	0.517																																																	0													130.0	136.0	134.0					2																	74758174		2203	4300	6503	SO:0001583	missense	0				CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.848G>T	2.37:g.74758174G>T	ENSP00000258080:p.Arg283Ile		Q9HBZ4|Q9P0Y3|Q9P0Y4	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_PDZ,superfamily_Trypsin-like_Pept_dom,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_Peptidase_S1C	p.R283I	ENST00000258080.3	37	c.848	CCDS1951.1	2	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604597	0.66445	.	.	ENSG00000115317	ENST00000258080;ENST00000437202	D;D	0.88277	-2.36;-2.36	4.94	2.11	0.27256	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	0.295460	0.36665	N	0.002461	D	0.88955	0.6578	L	0.56396	1.775	0.80722	D	1	B;P;P;P	0.48911	0.049;0.845;0.917;0.845	B;P;P;P	0.53988	0.061;0.739;0.622;0.739	D	0.85734	0.1333	10	0.56958	D	0.05	-3.1098	6.5693	0.22529	0.3988:0.0:0.6012:0.0	.	283;283;283;283	O43464-4;A8K7G2;O43464-3;O43464	.;.;.;HTRA2_HUMAN	I	283;270	ENSP00000258080:R283I;ENSP00000399166:R270I	ENSP00000258080:R283I	R	+	2	0	HTRA2	74611682	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.257000	0.32932	0.267000	0.21916	0.462000	0.41574	AGA	HTRA2	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	ENSG00000115317		0.517	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTRA2	HGNC	protein_coding	OTTHUMT00000252219.2	-	0.00	49	0	G	NM_013247		74758174	+1	tier1	-	no_errors	ENST00000258080	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.990	T
IL20RA	53832	genome.wustl.edu	37	6	137323122	137323122	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr6:137323122G>A	ENST00000316649.5	-	7	1470	c.1235C>T	c.(1234-1236)gCg>gTg	p.A412V	IL20RA_ENST00000468393.1_5'Flank|IL20RA_ENST00000367748.1_Missense_Mutation_p.A301V|IL20RA_ENST00000541547.1_Missense_Mutation_p.A363V|RP11-204P2.3_ENST00000458017.1_RNA	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	412					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)		p.A412V(2)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		TTCAGGCCCCGCACAAATGTC	0.517																																																	2	Substitution - Missense(2)	large_intestine(2)											62.0	55.0	58.0					6																	137323122		2203	4300	6503	SO:0001583	missense	0			AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.1235C>T	6.37:g.137323122G>A	ENSP00000314976:p.Ala412Val		B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.A412V	ENST00000316649.5	37	c.1235	CCDS5181.1	6	.	.	.	.	.	.	.	.	.	.	G	8.540	0.873131	0.17322	.	.	ENSG00000016402	ENST00000316649;ENST00000367748;ENST00000541547	T;T;T	0.59502	0.53;1.96;0.26	5.96	-6.15	0.02105	.	5.070270	0.00166	N	0.000001	T	0.08758	0.0217	N	0.02011	-0.69	0.09310	N	1	B;B	0.12630	0.004;0.006	B;B	0.04013	0.001;0.001	T	0.04840	-1.0923	10	0.25751	T	0.34	0.9627	4.7419	0.13017	0.1682:0.1241:0.5321:0.1756	.	301;412	Q9UHF4-2;Q9UHF4	.;I20RA_HUMAN	V	412;301;363	ENSP00000314976:A412V;ENSP00000356722:A301V;ENSP00000437843:A363V	ENSP00000314976:A412V	A	-	2	0	IL20RA	137364815	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.034000	0.03567	-0.989000	0.03485	-0.793000	0.03317	GCG	IL20RA	-	NULL	ENSG00000016402		0.517	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20RA	HGNC	protein_coding	OTTHUMT00000042393.1		0.00	63	0	G	NM_014432		137323122	-1			no_errors	ENST00000316649	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.000	A
INTS10	55174	genome.wustl.edu	37	8	19700427	19700427	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:19700427G>T	ENST00000397977.3	+	14	2106	c.1708G>T	c.(1708-1710)Gcc>Tcc	p.A570S		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	570					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		TTTAATGTTAGCCTGTTTTAA	0.373																																																	0													140.0	129.0	133.0					8																	19700427		1860	4116	5976	SO:0001583	missense	0			AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.1708G>T	8.37:g.19700427G>T	ENSP00000381064:p.Ala570Ser		Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Missense_Mutation	SNP	NULL	p.A570S	ENST00000397977.3	37	c.1708	CCDS6011.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.565049|4.565049	0.86439|0.86439	.|.	.|.	ENSG00000104613|ENSG00000104613	ENST00000397977|ENST00000520670;ENST00000523772	T|.	0.51325|.	0.71|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.69486|.	0.3116|.	L|L	0.50333|0.50333	1.59|1.59	0.58432|0.58432	D|D	0.999998|0.999998	D|.	0.64830|.	0.994|.	P|.	0.60789|.	0.879|.	T|.	0.66320|.	-0.5953|.	9|.	.|.	.|.	.|.	-14.9538|-14.9538	17.7168|17.7168	0.88340|0.88340	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	570|.	Q9NVR2|.	INT10_HUMAN|.	S|Y	570|59;6	ENSP00000381064:A570S|.	.|.	A|X	+|+	1|3	0|2	INTS10|INTS10	19744707|19744707	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	8.992000|8.992000	0.93519|0.93519	2.512000|2.512000	0.84698|0.84698	0.655000|0.655000	0.94253|0.94253	GCC|TAG	INTS10	-	NULL	ENSG00000104613		0.373	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS10	HGNC	protein_coding	OTTHUMT00000253724.2		0.00	48	0	G	NM_018142		19700427	+1			no_errors	ENST00000397977	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
IQGAP3	128239	genome.wustl.edu	37	1	156542318	156542318	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:156542318C>T	ENST00000361170.2	-	1	14	c.4G>A	c.(4-6)Gag>Aag	p.E2K		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	2					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCTCTCCTCTCCATGTTCCTC	0.672																																																	0													121.0	128.0	126.0					1																	156542318		2203	4300	6503	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4G>A	1.37:g.156542318C>T	ENSP00000354451:p.Glu2Lys		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.E2K	ENST00000361170.2	37	c.4	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582988	0.46006	.	.	ENSG00000183856	ENST00000361170	T	0.02631	4.22	4.03	3.11	0.35812	.	0.534882	0.16321	N	0.219546	T	0.00637	0.0021	N	0.14661	0.345	0.28904	N	0.893098	B	0.26081	0.141	B	0.25759	0.063	T	0.48747	-0.9008	10	0.28530	T	0.3	-0.0255	7.141	0.25556	0.0:0.8778:0.0:0.1222	.	2	Q86VI3	IQGA3_HUMAN	K	2	ENSP00000354451:E2K	ENSP00000354451:E2K	E	-	1	0	IQGAP3	154808942	0.994000	0.37717	0.956000	0.39512	0.806000	0.45545	1.957000	0.40392	0.882000	0.36016	0.563000	0.77884	GAG	IQGAP3	-	NULL	ENSG00000183856		0.672	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	-	0.00	117	0	C	NM_178229		156542318	-1	tier1	-	no_errors	ENST00000361170	ensembl	human	known	74_37	missense	15.86	122	23	SNP	0.986	T
IRS2	8660	genome.wustl.edu	37	13	110436619	110436619	+	Silent	SNP	C	C	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr13:110436619C>A	ENST00000375856.3	-	1	2296	c.1782G>T	c.(1780-1782)tcG>tcT	p.S594S		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	594					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			ATTCATCCAGCGAGGCAGAGG	0.726																																					Melanoma(100;613 2409 40847)												0													9.0	14.0	12.0					13																	110436619		2161	4274	6435	SO:0001819	synonymous_variant	0			AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.1782G>T	13.37:g.110436619C>A			Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.S594	ENST00000375856.3	37	c.1782	CCDS9510.1	13																																																																																			IRS2	-	NULL	ENSG00000185950		0.726	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS2	HGNC	protein_coding	OTTHUMT00000045755.1	-	0.00	22	0	C	NM_003749		110436619	-1	tier1	-	no_errors	ENST00000375856	ensembl	human	known	74_37	silent	17.24	24	5	SNP	0.987	A
KIFC3	3801	genome.wustl.edu	37	16	57789353	57789353	+	IGR	SNP	C	C	T	rs373753943		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:57789353C>T	ENST00000379655.4	-	0	3427				KATNB1_ENST00000379661.3_Missense_Mutation_p.R505C	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3						ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				GCTCACCAGCCGCCACAAGAA	0.642																																																	0								C	CYS/ARG	1,4395	2.1+/-5.4	0,1,2197	104.0	93.0	96.0		1513	5.1	1.0	16		96	0,8598		0,0,4299	no	missense	KATNB1	NM_005886.2	180	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	505/656	57789353	1,12993	2198	4299	6497	SO:0001628	intergenic_variant	0			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455		16.37:g.57789353C>T			A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R505C	ENST00000379655.4	37	c.1513	CCDS10789.2	16	.	.	.	.	.	.	.	.	.	.	C	32	5.111581	0.94339	2.27E-4	0.0	ENSG00000140854	ENST00000379661	T	0.79554	-1.28	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.91593	0.7344	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93359	0.6725	10	0.87932	D	0	-14.678	17.4143	0.87495	0.0:1.0:0.0:0.0	.	505	Q9BVA0	KTNB1_HUMAN	C	505	ENSP00000368982:R505C	ENSP00000368982:R505C	R	+	1	0	KATNB1	56346854	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.414000	0.80117	2.371000	0.80710	0.561000	0.74099	CGC	KATNB1	-	NULL	ENSG00000140854		0.642	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KATNB1	HGNC	protein_coding	OTTHUMT00000257329.2		0.00	53	0	C	NM_005550		57789353	+1			no_errors	ENST00000379661	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
KCNG2	26251	genome.wustl.edu	37	18	77624216	77624216	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr18:77624216C>T	ENST00000316249.3	+	1	549	c.549C>T	c.(547-549)tcC>tcT	p.S183S		NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	183					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CCTGCGTGTCCGTGTCCTTCG	0.766																																																	0													17.0	16.0	16.0					18																	77624216		1955	3928	5883	SO:0001819	synonymous_variant	0			AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.549C>T	18.37:g.77624216C>T				Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv	p.S183	ENST00000316249.3	37	c.549	CCDS12019.1	18																																																																																			KCNG2	-	prints_K_chnl	ENSG00000178342		0.766	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG2	HGNC	protein_coding	OTTHUMT00000103906.1		0.00	25	0	C	NM_012283		77624216	+1			no_errors	ENST00000316249	ensembl	human	known	74_37	silent	20.00	12	3	SNP	0.507	T
KCNIP1	30820	genome.wustl.edu	37	5	169780917	169780917	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:169780917G>A	ENST00000377360.4	+	1	427	c.37G>A	c.(37-39)Gtg>Atg	p.V13M	KCNIP1_ENST00000518527.1_3'UTR	NM_001034838.2	NP_001030010.1	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1	0					detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)			autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTTGGGTTCGTGAAATTTGC	0.557																																																	0													103.0	85.0	91.0					5																	169780917		2203	4300	6503	SO:0001583	missense	0			AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000377360.4:c.37G>A	5.37:g.169780917G>A	ENSP00000366577:p.Val13Met		B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Missense_Mutation	SNP	pfam_EF_hand_dom,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.V13M	ENST00000377360.4	37	c.37	CCDS34285.1	5	.	.	.	.	.	.	.	.	.	.	G	7.021	0.558734	0.13436	.	.	ENSG00000182132	ENST00000377360	T	0.69926	-0.44	5.16	2.3	0.28687	.	.	.	.	.	T	0.36717	0.0977	N	0.08118	0	0.80722	D	1	B	0.31968	0.349	B	0.18871	0.023	T	0.06250	-1.0837	8	.	.	.	.	7.2599	0.26197	0.0902:0.3267:0.5831:0.0	.	13	Q3YAD3	.	M	13	ENSP00000366577:V13M	.	V	+	1	0	KCNIP1	169713495	1.000000	0.71417	0.470000	0.27216	0.112000	0.19704	1.957000	0.40392	0.170000	0.19704	0.561000	0.74099	GTG	KCNIP1	-	NULL	ENSG00000182132		0.557	KCNIP1-005	KNOWN	basic|CCDS	protein_coding	KCNIP1	HGNC	protein_coding	OTTHUMT00000371845.1		0.00	126	0	G			169780917	+1			no_errors	ENST00000377360	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.909	A
KIAA1033	23325	genome.wustl.edu	37	12	105519872	105519872	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:105519872C>T	ENST00000332180.5	+	11	964	c.877C>T	c.(877-879)Cgg>Tgg	p.R293W		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						ACATAGTATTCGGTCAATTTT	0.323																																																	0													110.0	99.0	102.0					12																	105519872		1818	4075	5893	SO:0001583	missense	0			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.877C>T	12.37:g.105519872C>T	ENSP00000328062:p.Arg293Trp			Missense_Mutation	SNP	NULL	p.R293W	ENST00000332180.5	37	c.877	CCDS41826.1	12	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656037	0.88056	.	.	ENSG00000136051	ENST00000332180	T	0.35973	1.28	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.62539	0.2436	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70227	0.968;0.968	T	0.65154	-0.6237	10	0.72032	D	0.01	.	19.5177	0.95171	0.0:1.0:0.0:0.0	.	293;293	B7ZKT9;Q2M389	.;WASH7_HUMAN	W	293	ENSP00000328062:R293W	ENSP00000328062:R293W	R	+	1	2	KIAA1033	104044002	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.950000	0.70265	2.605000	0.88082	0.557000	0.71058	CGG	KIAA1033	-	NULL	ENSG00000136051		0.323	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	HGNC	protein_coding	OTTHUMT00000406138.4	-	0.00	98	0	C	NM_015275		105519872	+1	tier1	-	no_errors	ENST00000332180	ensembl	human	known	74_37	missense	8.42	87	8	SNP	1.000	T
KIF17	57576	genome.wustl.edu	37	1	21036160	21036160	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:21036160G>T	ENST00000247986.2	-	4	952	c.642C>A	c.(640-642)ttC>ttA	p.F214L	KIF17_ENST00000400463.3_Missense_Mutation_p.F214L|KIF17_ENST00000375044.1_Missense_Mutation_p.F114L			Q9P2E2	KIF17_HUMAN	kinesin family member 17	214	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGCTGATGGTGAAGATGGAGT	0.597																																																	0													164.0	111.0	129.0					1																	21036160		2203	4300	6503	SO:0001583	missense	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.642C>A	1.37:g.21036160G>T	ENSP00000247986:p.Phe214Leu		A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.F214L	ENST00000247986.2	37	c.642	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918921	0.73098	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.76316	-1.01;-1.01;-1.01	4.63	3.7	0.42460	Kinesin, motor domain (5);	0.000000	0.34046	U	0.004311	T	0.80894	0.4711	L	0.43554	1.36	0.49798	D	0.999825	D;D	0.71674	0.994;0.998	D;D	0.72982	0.932;0.979	T	0.80627	-0.1298	10	0.87932	D	0	.	7.4186	0.27059	0.1977:0.0:0.8023:0.0	.	214;214	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	L	114;214;214	ENSP00000364184:F114L;ENSP00000383311:F214L;ENSP00000247986:F214L	ENSP00000247986:F214L	F	-	3	2	KIF17	20908747	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	2.206000	0.42779	1.139000	0.42245	0.462000	0.41574	TTC	KIF17	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000117245		0.597	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	-	0.00	51	0	G	NM_020816		21036160	-1	tier1	-	no_errors	ENST00000247986	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
KLHL28	54813	genome.wustl.edu	37	14	45400591	45400591	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr14:45400591G>A	ENST00000396128.4	-	4	1616	c.1497C>T	c.(1495-1497)taC>taT	p.Y499Y	KLHL28_ENST00000355081.2_Silent_p.Y513Y	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	499										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GATGAGGATCGTATCTTTCAA	0.378																																																	0													107.0	99.0	102.0					14																	45400591		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.1497C>T	14.37:g.45400591G>A			Q0VAL5	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Y499	ENST00000396128.4	37	c.1497	CCDS9680.1	14																																																																																			KLHL28	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000179454		0.378	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL28	HGNC	protein_coding	OTTHUMT00000276790.3	-	0.00	59	0	G			45400591	-1	tier1	-	no_errors	ENST00000396128	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.993	A
KRT12	3859	genome.wustl.edu	37	17	39020032	39020032	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:39020032G>T	ENST00000251643.4	-	4	915	c.892C>A	c.(892-894)Ctc>Atc	p.L298I	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	298	Coil 2.|Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	ATATCATTGAGGAGCCTGGTG	0.567																																																	0													52.0	54.0	54.0					17																	39020032		2203	4300	6503	SO:0001583	missense	0				CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.892C>A	17.37:g.39020032G>T	ENSP00000251643:p.Leu298Ile		B2R9E0	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.L298I	ENST00000251643.4	37	c.892	CCDS11378.1	17	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339974	0.81911	.	.	ENSG00000187242	ENST00000251643	D	0.92299	-3.01	5.58	4.6	0.57074	Filament (1);	0.000000	0.45361	D	0.000368	D	0.95188	0.8440	M	0.79343	2.45	0.41057	D	0.985347	D	0.76494	0.999	D	0.68943	0.961	D	0.95321	0.8420	10	0.87932	D	0	.	12.2711	0.54706	0.1353:0.0:0.8647:0.0	.	298	Q99456	K1C12_HUMAN	I	298	ENSP00000251643:L298I	ENSP00000251643:L298I	L	-	1	0	KRT12	36273558	0.472000	0.25870	1.000000	0.80357	0.987000	0.75469	0.598000	0.24074	2.611000	0.88343	0.591000	0.81541	CTC	KRT12	-	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	ENSG00000187242		0.567	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT12	HGNC	protein_coding	OTTHUMT00000257214.2	-	0.00	36	0	G	NM_000223		39020032	-1	tier1	-	no_errors	ENST00000251643	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
KRT6B	3854	genome.wustl.edu	37	12	52841347	52841347	+	Missense_Mutation	SNP	C	C	T	rs369418982	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:52841347C>T	ENST00000252252.3	-	8	1482	c.1435G>A	c.(1435-1437)Gaa>Aaa	p.E479K		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	479	Tail.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.E479K(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CCAACGCCTTCGCCATTCAGC	0.552													C|||	3	0.000599042	0.0	0.0	5008	,	,		22490	0.0		0.001	False		,,,				2504	0.002																1	Substitution - Missense(1)	lung(1)						C	LYS/GLU	1,4405		0,1,2202	141.0	110.0	120.0		1435	2.9	1.0	12		120	0,8600		0,0,4300	no	missense	KRT6B	NM_005555.3	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	479/565	52841347	1,13005	2203	4300	6503	SO:0001583	missense	0			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1435G>A	12.37:g.52841347C>T	ENSP00000252252:p.Glu479Lys		P48669	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.E479K	ENST00000252252.3	37	c.1435	CCDS8828.1	12	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546388	0.45383	2.27E-4	0.0	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.86164	-2.08	2.93	2.93	0.34026	.	0.000000	0.56097	D	0.000026	D	0.93154	0.7820	M	0.91090	3.175	0.38261	D	0.941888	D	0.89917	1.0	D	0.64877	0.93	D	0.94314	0.7548	10	0.87932	D	0	.	10.0312	0.42101	0.0:0.896:0.0:0.104	.	479	P04259	K2C6B_HUMAN	K	479;439	ENSP00000252252:E479K	ENSP00000252252:E479K	E	-	1	0	KRT6B	51127614	0.956000	0.32656	0.991000	0.47740	0.227000	0.25037	5.082000	0.64450	1.971000	0.57363	0.305000	0.20034	GAA	KRT6B	-	NULL	ENSG00000185479		0.552	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6B	HGNC	protein_coding	OTTHUMT00000404969.1		0.00	84	0	C	NM_005555		52841347	-1			no_errors	ENST00000252252	ensembl	human	known	74_37	missense	7.84	46	4	SNP	0.985	T
ZNRF1	84937	genome.wustl.edu	37	16	75146326	75146326	+	IGR	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:75146326G>A	ENST00000335325.4	+	0	4620				LDHD_ENST00000300051.4_Silent_p.G484G|LDHD_ENST00000450168.2_Silent_p.G461G|RP11-252E2.1_ENST00000499110.1_RNA	NM_032268.4	NP_115644.1	Q8ND25	ZNRF1_HUMAN	zinc and ring finger 1, E3 ubiquitin protein ligase						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)	1						TGGTCTCCACGCCCACGGCGC	0.657																																																	0													31.0	32.0	31.0					16																	75146326		2197	4299	6496	SO:0001628	intergenic_variant	0			AF378524	CCDS10912.1	16q22.3	2013-01-09	2012-02-23		ENSG00000186187	ENSG00000186187		"""RING-type (C3HC4) zinc fingers"""	18452	protein-coding gene	gene with protein product		612060	"""zinc and ring finger 1"""				Standard	NM_032268		Approved	nin283, FLJ14846, DKFZp434E229	uc002fdl.1	Q8ND25	OTTHUMG00000137606		16.37:g.75146326G>A			D3DUJ9|Q9H083	Silent	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-linked_Oxase-like_C,superfamily_FAD-bd_2	p.G484	ENST00000335325.4	37	c.1452	CCDS10912.1	16																																																																																			LDHD	-	pfam_FAD-linked_oxidase_C,superfamily_FAD-linked_Oxase-like_C	ENSG00000166816		0.657	ZNRF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDHD	HGNC	protein_coding	OTTHUMT00000269020.2	-	0.00	43	0	G			75146326	-1	tier1	-	no_errors	ENST00000300051	ensembl	human	known	74_37	silent	11.76	60	8	SNP	0.009	A
LIMS2	55679	genome.wustl.edu	37	2	128397909	128397909	+	Intron	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:128397909G>T	ENST00000355119.4	-	8	919				LIMS2_ENST00000409455.1_Intron|LIMS2_ENST00000409754.1_Intron|LIMS2_ENST00000494613.1_5'UTR|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000545738.2_Intron|LIMS2_ENST00000409286.1_Intron|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000409254.1_Intron|LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000410038.1_Intron	NM_001161403.1	NP_001154875.1	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2						cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		GGCCGAGCAGGCTGTCAGAGT	0.652																																																	0													51.0	36.0	41.0					2																	128397909		2202	4300	6502	SO:0001627	intron_variant	0			AF520987	CCDS2147.1, CCDS54394.1, CCDS54395.1, CCDS54396.1, CCDS58725.1	2q21.1	2008-02-05			ENSG00000072163	ENSG00000072163			16084	protein-coding gene	gene with protein product		607908					Standard	NM_017980		Approved		uc002tox.3	Q7Z4I7	OTTHUMG00000131529	ENST00000355119.4:c.754-16C>A	2.37:g.128397909G>T			A6NLH0|B4DMV1|F5H6E6|Q7Z4I2|Q7Z4I6|Q7Z4I8|Q8NFE7|Q9HA13	RNA	SNP	-	NULL	ENST00000355119.4	37	NULL	CCDS54395.1	2																																																																																			LIMS2	-	-	ENSG00000072163		0.652	LIMS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LIMS2	HGNC	protein_coding	OTTHUMT00000331133.2	-	0.00	77	0	G	NM_017980		128397909	-1	tier1	-	no_errors	ENST00000494613	ensembl	human	known	74_37	rna	32.81	43	21	SNP	0.000	T
FAM91A3P	729182	genome.wustl.edu	37	1	149261581	149261581	+	lincRNA	SNP	G	G	C	rs77998576	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:149261581G>C	ENST00000325963.8	+	0	1128																											TGAAGAGCTTGAGCATAACAC	0.408																																																	0																																												0																															1.37:g.149261581G>C				RNA	SNP	-	NULL	ENST00000325963.8	37	NULL		1																																																																																			RP11-403I13.4	-	-	ENSG00000223779		0.408	RP11-403I13.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC100293748	Clone_based_vega_gene	lincRNA	OTTHUMT00000099551.1	-	0.00	26	0	G			149261581	+1	tier1	rs77998576	no_errors	ENST00000325963	ensembl	human	known	74_37	rna	20.00	36	9	SNP	1.000	C
LRIT2	340745	genome.wustl.edu	37	10	85984470	85984470	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:85984470A>T	ENST00000372113.4	-	2	516	c.511T>A	c.(511-513)Ttc>Atc	p.F171I	LRIT2_ENST00000538192.1_Missense_Mutation_p.F171I	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	171						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						CAGTTCAGGAAGACACTCTTG	0.542																																																	0													72.0	67.0	69.0					10																	85984470		2203	4300	6503	SO:0001583	missense	0				CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.511T>A	10.37:g.85984470A>T	ENSP00000361185:p.Phe171Ile		B7ZME6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F171I	ENST00000372113.4	37	c.511	CCDS31234.1	10	.	.	.	.	.	.	.	.	.	.	A	18.82	3.705877	0.68615	.	.	ENSG00000204033	ENST00000372113;ENST00000538192	T;T	0.57752	0.38;0.38	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.71745	0.3376	M	0.71920	2.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71790	-0.4486	10	0.45353	T	0.12	.	15.8048	0.78491	1.0:0.0:0.0:0.0	.	171;171	B7ZME6;A6NDA9	.;LRIT2_HUMAN	I	171	ENSP00000361185:F171I;ENSP00000438264:F171I	ENSP00000361185:F171I	F	-	1	0	LRIT2	85974450	1.000000	0.71417	0.997000	0.53966	0.244000	0.25665	9.053000	0.93860	2.371000	0.80710	0.533000	0.62120	TTC	LRIT2	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000204033		0.542	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT2	HGNC	protein_coding	OTTHUMT00000049110.4	-	0.00	54	0	A	XM_291697		85984470	-1	tier1	-	no_errors	ENST00000538192	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
LRRC29	26231	genome.wustl.edu	37	16	67244377	67244377	+	5'UTR	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:67244377C>T	ENST00000409037.1	-	0	611				AC040160.1_ENST00000454102.2_3'UTR|LRRC29_ENST00000462169.1_5'UTR|LRRC29_ENST00000409509.1_Intron|LRRC29_ENST00000393992.1_Intron|LRRC29_ENST00000341546.3_Intron			Q8WV35	LRC29_HUMAN	leucine rich repeat containing 29											autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		ACGCAGCCTGCCAGCCCGCTC	0.667																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF176701	CCDS32465.1	16q22.1	2008-02-05	2004-08-23	2004-08-26	ENSG00000125122	ENSG00000125122			13605	protein-coding gene	gene with protein product			"""F-box and leucine-rich repeat protein 9"""	FBXL9		10531037	Standard	NM_012163		Approved	FBL9	uc002esf.3	Q8WV35	OTTHUMG00000154403	ENST00000409037.1:c.-286G>A	16.37:g.67244377C>T			B2RE92|Q9UKA0	RNA	SNP	-	NULL	ENST00000409037.1	37	NULL	CCDS32465.1	16																																																																																			LRRC29	-	-	ENSG00000125122		0.667	LRRC29-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC29	HGNC	protein_coding	OTTHUMT00000335073.1	-	0.00	77	0	C	NM_012163		67244377	-1	tier1	-	no_errors	ENST00000462169	ensembl	human	putative	74_37	rna	8.00	46	4	SNP	0.013	T
LRRC49	54839	genome.wustl.edu	37	15	71329592	71329592	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr15:71329592G>A	ENST00000260382.5	+	15	2038	c.1778G>A	c.(1777-1779)aGc>aAc	p.S593N	LRRC49_ENST00000544974.2_Missense_Mutation_p.S583N|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000560691.1_Missense_Mutation_p.S299N|LRRC49_ENST00000560158.2_Missense_Mutation_p.S281N|LRRC49_ENST00000443425.2_Missense_Mutation_p.S549N|LRRC49_ENST00000560369.1_Missense_Mutation_p.S598N	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	593						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						AATAATGACAGCAAAAGACTT	0.303																																																	0													85.0	93.0	90.0					15																	71329592		2199	4295	6494	SO:0001583	missense	0				CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1778G>A	15.37:g.71329592G>A	ENSP00000260382:p.Ser593Asn		B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S593N	ENST00000260382.5	37	c.1778	CCDS32282.1	15	.	.	.	.	.	.	.	.	.	.	G	9.504	1.103877	0.20632	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.34275	1.38;1.39;1.37	5.04	2.1	0.27182	.	0.227387	0.43919	N	0.000503	T	0.13200	0.0320	N	0.02960	-0.455	0.24599	N	0.993781	B;B;B;B;B	0.12630	0.002;0.004;0.006;0.002;0.001	B;B;B;B;B	0.13407	0.004;0.009;0.009;0.004;0.004	T	0.25950	-1.0117	10	0.18276	T	0.48	-8.3176	7.4702	0.27344	0.3528:0.0:0.6472:0.0	.	598;565;549;593;583	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	N	583;593;549;565	ENSP00000439600:S583N;ENSP00000260382:S593N;ENSP00000414065:S549N	ENSP00000260382:S593N	S	+	2	0	LRRC49	69116646	1.000000	0.71417	0.989000	0.46669	0.974000	0.67602	1.833000	0.39161	0.523000	0.28482	0.655000	0.94253	AGC	LRRC49	-	NULL	ENSG00000137821		0.303	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRC49	HGNC	protein_coding	OTTHUMT00000417209.3	-	0.00	37	0	G	NM_017691		71329592	+1	tier1	-	no_errors	ENST00000260382	ensembl	human	known	74_37	missense	31.67	41	19	SNP	0.972	A
LRRK2	120892	genome.wustl.edu	37	12	40734196	40734196	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:40734196G>T	ENST00000298910.7	+	41	6107	c.6049G>T	c.(6049-6051)Gac>Tac	p.D2017Y		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2017	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.D2017H(1)|p.D2024H(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AAAGATTGCTGACTACGGCAT	0.453																																																	2	Substitution - Missense(2)	upper_aerodigestive_tract(2)											207.0	177.0	187.0					12																	40734196		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6049G>T	12.37:g.40734196G>T	ENSP00000298910:p.Asp2017Tyr		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.D2017Y	ENST00000298910.7	37	c.6049	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899937	0.92035	.	.	ENSG00000188906	ENST00000298910	D	0.93076	-3.16	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98327	0.9445	H	0.98407	4.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99305	1.0902	10	0.87932	D	0	.	19.8215	0.96599	0.0:0.0:1.0:0.0	.	2017;2017	Q17RV3;Q5S007	.;LRRK2_HUMAN	Y	2017	ENSP00000298910:D2017Y	ENSP00000298910:D2017Y	D	+	1	0	LRRK2	39020463	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	9.527000	0.98044	2.679000	0.91253	0.650000	0.86243	GAC	LRRK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000188906		0.453	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1		0.00	56	0	G	XM_058513		40734196	+1			no_errors	ENST00000298910	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
LRRTM3	347731	genome.wustl.edu	37	10	68687289	68687289	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:68687289C>T	ENST00000361320.4	+	2	1193	c.615C>T	c.(613-615)atC>atT	p.I205I	CTNNA3_ENST00000373744.4_Intron|CTNNA3_ENST00000433211.2_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	205					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						CTGGCATGATCAGACTCAAAG	0.478																																																	0													99.0	101.0	101.0					10																	68687289		2203	4300	6503	SO:0001819	synonymous_variant	0			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.615C>T	10.37:g.68687289C>T			A8K2A3|Q2NKX7|Q6N0A3	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.I205	ENST00000361320.4	37	c.615	CCDS7270.1	10																																																																																			LRRTM3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000198739		0.478	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM3	HGNC	protein_coding	OTTHUMT00000048277.2	-	0.00	31	0	C	NM_178011		68687289	+1	tier1	-	no_errors	ENST00000361320	ensembl	human	known	74_37	silent	25.00	24	8	SNP	1.000	T
LTA4H	4048	genome.wustl.edu	37	12	96412682	96412682	+	Splice_Site	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:96412682C>T	ENST00000228740.2	-	8	853		c.e8-1		LTA4H_ENST00000413268.2_Splice_Site|LTA4H_ENST00000552789.1_Splice_Site	NM_000895.2	NP_000886.1	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase						arachidonic acid metabolic process (GO:0019369)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|peptide catabolic process (GO:0043171)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|leukotriene-A4 hydrolase activity (GO:0004463)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(3)|lung(4)|skin(2)|stomach(1)	12					Captopril(DB01197)	TAGATTCAGTCTGAAAAATCA	0.363																																																	0													62.0	60.0	61.0					12																	96412682		2203	4300	6503	SO:0001630	splice_region_variant	0			BC032528	CCDS9059.1, CCDS58266.1, CCDS58267.1	12q22	2005-10-06				ENSG00000111144	3.3.2.6		6710	protein-coding gene	gene with protein product		151570				7628486	Standard	NM_000895		Approved		uc001ten.2	P09960	OTTHUMG00000170355	ENST00000228740.2:c.712-1G>A	12.37:g.96412682C>T			B4DNQ9|F8VV40|Q6IAT6|Q9UCT7	Splice_Site	SNP	-	e8-1	ENST00000228740.2	37	c.712-1	CCDS9059.1	12	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043487	0.75732	.	.	ENSG00000111144	ENST00000228740;ENST00000552789;ENST00000413268	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2883	0.94087	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LTA4H	94936813	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	7.667000	0.83888	2.646000	0.89796	0.591000	0.81541	.	LTA4H	-	-	ENSG00000111144		0.363	LTA4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTA4H	HGNC	protein_coding	OTTHUMT00000408655.1	-	0.00	53	0	C	NM_000895	Intron	96412682	-1	tier1	-	no_errors	ENST00000228740	ensembl	human	known	74_37	splice_site	14.58	41	7	SNP	1.000	T
MCTP1	79772	genome.wustl.edu	37	5	94230447	94230447	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:94230447G>T	ENST00000515393.1	-	11	1745	c.1746C>A	c.(1744-1746)gtC>gtA	p.V582V	MCTP1_ENST00000312216.8_Silent_p.V361V|MCTP1_ENST00000505078.1_Silent_p.V98V|MCTP1_ENST00000505208.1_Silent_p.V361V|MCTP1_ENST00000429576.2_Silent_p.V315V	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	582					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		CTGTCAGAGTGACCAGCAGCA	0.542																																																	0													96.0	78.0	84.0					5																	94230447		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1746C>A	5.37:g.94230447G>T			Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Silent	SNP	pfam_C2_dom,pfam_PRibTrfase_C,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_C2_dom	p.V582	ENST00000515393.1	37	c.1746	CCDS34203.1	5																																																																																			MCTP1	-	NULL	ENSG00000175471		0.542	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCTP1	HGNC	protein_coding	OTTHUMT00000370280.3	-	0.00	37	0	G	NM_024717		94230447	-1	tier1	-	no_errors	ENST00000515393	ensembl	human	known	74_37	silent	21.05	30	8	SNP	1.000	T
MED12L	116931	genome.wustl.edu	37	3	151097977	151097977	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:151097977G>T	ENST00000474524.1	+	30	4488	c.4450G>T	c.(4450-4452)Ggc>Tgc	p.G1484C	MED12L_ENST00000273432.4_Missense_Mutation_p.G1344C|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1484						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACAAAGGGAAGGCCTCCTAAC	0.368																																																	0													120.0	119.0	119.0					3																	151097977		2203	4300	6503	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4450G>T	3.37:g.151097977G>T	ENSP00000417235:p.Gly1484Cys		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.G1484C	ENST00000474524.1	37	c.4450	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	G	24.6	4.548649	0.86127	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.27402	1.67;1.67	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.55561	0.1928	L	0.60845	1.875	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.98;0.97	T	0.53802	-0.8387	10	0.87932	D	0	-20.9801	19.874	0.96863	0.0:0.0:1.0:0.0	.	1344;1483;1484	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	C	1484;1344	ENSP00000417235:G1484C;ENSP00000273432:G1344C	ENSP00000273432:G1344C	G	+	1	0	MED12L	152580667	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.650000	0.83521	2.788000	0.95919	0.650000	0.86243	GGC	MED12L	-	NULL	ENSG00000144893		0.368	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	-	0.00	46	0	G	NM_053002		151097977	+1	tier1	-	no_errors	ENST00000474524	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
MEX3B	84206	genome.wustl.edu	37	15	82335815	82335815	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr15:82335815C>A	ENST00000329713.4	-	2	1831	c.1396G>T	c.(1396-1398)Gga>Tga	p.G466*	MEX3B_ENST00000558133.1_3'UTR|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	466					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						AGGCCTCCTCCACCCGGGTCG	0.726																																																	0													13.0	14.0	14.0					15																	82335815		2081	4042	6123	SO:0001587	stop_gained	0			AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.1396G>T	15.37:g.82335815C>A	ENSP00000329918:p.Gly466*		Q4G0W1|Q8IVG2|Q9H0J0	Nonsense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.G466*	ENST00000329713.4	37	c.1396	CCDS10319.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.618598	0.97709	.	.	ENSG00000183496	ENST00000329713	.	.	.	4.7	4.7	0.59300	.	0.212799	0.40908	D	0.000990	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-3.0031	16.5729	0.84629	0.0:1.0:0.0:0.0	.	.	.	.	X	466	.	ENSP00000329918:G466X	G	-	1	0	MEX3B	80122870	0.492000	0.26027	0.974000	0.42286	0.195000	0.23768	1.218000	0.32467	2.440000	0.82611	0.561000	0.74099	GGA	MEX3B	-	NULL	ENSG00000183496		0.726	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEX3B	HGNC	protein_coding	OTTHUMT00000304000.1		0.00	31	0	C	XM_290645		82335815	-1			no_errors	ENST00000329713	ensembl	human	known	74_37	nonsense	11.54	23	3	SNP	0.989	A
MFHAS1	9258	genome.wustl.edu	37	8	8750480	8750480	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:8750480C>T	ENST00000276282.6	-	1	675	c.89G>A	c.(88-90)cGc>cAc	p.R30H	RNU6-682P_ENST00000363843.1_RNA	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	30										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CGTGAGCTGGCGCAGGTTGCT	0.766																																					Melanoma(103;1201 2045 17515 28966)												0													3.0	4.0	4.0					8																	8750480		1952	3888	5840	SO:0001583	missense	0			AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.89G>A	8.37:g.8750480C>T	ENSP00000276282:p.Arg30His		Q96CI0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_typical-subtyp	p.R30H	ENST00000276282.6	37	c.89	CCDS34844.1	8	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286891	0.80803	.	.	ENSG00000147324	ENST00000276282	T	0.36699	1.24	4.53	3.65	0.41850	.	0.158566	0.41396	D	0.000882	T	0.23249	0.0562	N	0.24115	0.695	0.54753	D	0.999984	B	0.24317	0.101	B	0.15484	0.013	T	0.04333	-1.0959	10	0.45353	T	0.12	.	10.1776	0.42948	0.0:0.8997:0.0:0.1003	.	30	Q9Y4C4	MFHA1_HUMAN	H	30	ENSP00000276282:R30H	ENSP00000276282:R30H	R	-	2	0	MFHAS1	8787890	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.971000	0.70440	0.883000	0.36040	0.557000	0.71058	CGC	MFHAS1	-	NULL	ENSG00000147324		0.766	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFHAS1	HGNC	protein_coding	OTTHUMT00000374724.2		0.00	42	0	C	NM_004225		8750480	-1			no_errors	ENST00000276282	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
MGAM	8972	genome.wustl.edu	37	7	141708480	141708480	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr7:141708480G>T	ENST00000549489.2	+	3	397	c.302G>T	c.(301-303)tGc>tTc	p.C101F	MGAM_ENST00000475668.2_Missense_Mutation_p.C101F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	101	P-type 1. {ECO:0000255|PROSITE- ProRule:PRU00779}.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CGAATTAATTGCATCCCTGAC	0.388																																																	0													75.0	75.0	75.0					7																	141708480		1877	4105	5982	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.302G>T	7.37:g.141708480G>T	ENSP00000447378:p.Cys101Phe		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.C101F	ENST00000549489.2	37	c.302	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350802	0.61183	.	.	ENSG00000257335	ENST00000465654;ENST00000549489;ENST00000497673;ENST00000475668	D;D;D	0.89415	-2.51;-2.51;-2.51	4.33	4.33	0.51752	P-type trefoil, conserved site (1);P-type trefoil (4);	0.000000	0.49305	D	0.000150	D	0.95573	0.8561	H	0.94503	3.545	0.42605	D	0.993298	D	0.89917	1.0	D	0.85130	0.997	D	0.96039	0.9023	10	0.87932	D	0	.	12.6238	0.56618	0.0:0.0:1.0:0.0	.	101	O43451	MGA_HUMAN	F	101	ENSP00000419372:C101F;ENSP00000447378:C101F;ENSP00000417103:C101F	ENSP00000373973:C101F	C	+	2	0	MGAM	141354949	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	2.603000	0.46266	2.707000	0.92482	0.655000	0.94253	TGC	MGAM	-	pfam_P_trefoil,smart_P_trefoil	ENSG00000257335		0.388	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	70	0	G			141708480	+1	tier1	-	no_errors	ENST00000549489	ensembl	human	known	74_37	missense	5.48	68	4	SNP	1.000	T
STRN3	29966	genome.wustl.edu	37	14	31483858	31483858	+	Intron	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr14:31483858G>T	ENST00000357479.5	-	1	479				MIR624_ENST00000385217.1_RNA|STRN3_ENST00000355683.5_Intron	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AAACCACTTAGGTGTAATGCT	0.313																																																	0													47.0	42.0	43.0					14																	31483858		1502	3414	4916	SO:0001627	intron_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.282+11251C>A	14.37:g.31483858G>T			A2RTX7|A6NHZ7|Q9NRA5	RNA	SNP	-	NULL	ENST00000357479.5	37	NULL	CCDS41938.1	14																																																																																			MIR624	-	-	ENSG00000207952		0.313	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MIR624	HGNC	protein_coding	OTTHUMT00000409713.1	-	0.00	77	0	G	NM_014574		31483858	-1	tier1	-	no_errors	ENST00000385217	ensembl	human	known	74_37	rna	6.85	68	5	SNP	0.001	T
MN1	4330	genome.wustl.edu	37	22	28195603	28195605	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr22:28195603_28195605delTGC	ENST00000302326.4	-	1	1881_1883	c.927_929delGCA	c.(925-930)cagcat>cat	p.Q309del		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	309					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GAACACACCAtgctgctgctgct	0.64			T	ETV6	"""AML, meningioma"""																																			Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0										53,2821		10,33,1394						2.8	0.9			2	95,5897		15,65,2916	no	coding	MN1	NM_002430.2		25,98,4310	A1A1,A1R,RR		1.5854,1.8441,1.6693				148,8718				SO:0001651	inframe_deletion	0			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.927_929delGCA	22.37:g.28195612_28195614delTGC	ENSP00000304956:p.Gln309del		A9Z1V9	In_Frame_Del	DEL	NULL	p.Q309in_frame_del	ENST00000302326.4	37	c.929_927	CCDS42998.1	22																																																																																			MN1	-	NULL	ENSG00000169184		0.640	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1		0.00	44	0	TGC	NM_002430		28195605	-1	tier1		no_errors	ENST00000302326	ensembl	human	known	74_37	in_frame_del	11.54	23	3	DEL	1.000:1.000:1.000	-
MSH4	4438	genome.wustl.edu	37	1	76365303	76365303	+	Splice_Site	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:76365303G>A	ENST00000263187.3	+	19	2635	c.2531G>A	c.(2530-2532)gGa>gAa	p.G844E		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	844					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.G844E(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						ATAATTCTAGGATTAAAAGCT	0.313								Mismatch excision repair (MMR)																																									1	Substitution - Missense(1)	skin(1)											79.0	84.0	82.0					1																	76365303		2203	4298	6501	SO:0001630	splice_region_variant	0			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2531-1G>A	1.37:g.76365303G>A			Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.G844E	ENST00000263187.3	37	c.2531	CCDS670.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132192	0.77662	.	.	ENSG00000057468	ENST00000263187	D	0.95272	-3.66	5.61	5.61	0.85477	DNA mismatch repair protein MutS, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98617	0.9537	H	0.98754	4.32	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.99731	1.1012	9	.	.	.	.	17.8182	0.88642	0.0:0.0:1.0:0.0	.	844	O15457	MSH4_HUMAN	E	844	ENSP00000263187:G844E	.	G	+	2	0	MSH4	76137891	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.777000	0.85628	2.643000	0.89663	0.467000	0.42956	GGA	MSH4	-	pfam_DNA_mismatch_repair_MutS_C,superfamily_P-loop_NTPase,smart_DNA_mismatch_repair_MutS_C	ENSG00000057468		0.313	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH4	HGNC	protein_coding	OTTHUMT00000026983.1	-	0.00	100	0	G	NM_002440	Missense_Mutation	76365303	+1	tier1	-	no_errors	ENST00000263187	ensembl	human	known	74_37	missense	8.00	91	8	SNP	1.000	A
MT-CO1	4512	genome.wustl.edu	37	M	5631	5631	+	5'Flank	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrM:5631G>A	ENST00000361624.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AACGCAAATCAGCCACTTTAA	0.428																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.5631G>A	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-TA	-	-	ENSG00000210127		0.428	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-TA	HGNC	protein_coding		-	0.00	1069	0	G	YP_003024028		5631	-1	tier1	-	no_errors	ENST00000387392	ensembl	human	known	74_37	rna	88.24	96	720	SNP	NULL	A
MUC12	10071	genome.wustl.edu	37	7	100638792	100638792	+	Missense_Mutation	SNP	A	A	C	rs542072875		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr7:100638792A>C	ENST00000379442.3	+	5	5377	c.5377A>C	c.(5377-5379)Aac>Cac	p.N1793H	MUC12_ENST00000536621.1_Missense_Mutation_p.N1650H			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1793	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CTTACCTGACAACACCACAGC	0.552													-|||	1	0.000199681	0.0	0.0	5008	,	,		37669	0.0		0.001	False		,,,				2504	0.0																0													58.0	79.0	73.0					7																	100638792		692	1591	2283	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.5377A>C	7.37:g.100638792A>C	ENSP00000368755:p.Asn1793His		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.N1650H	ENST00000379442.3	37	c.4948		7	.	.	.	.	.	.	.	.	.	.	-	2.216	-0.379572	0.05000	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12361	2.7;2.69	1.17	1.17	0.20885	.	.	.	.	.	T	0.06735	0.0172	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.35351	-0.9792	7	0.42905	T	0.14	.	4.5407	0.12056	1.0:0.0:0.0:0.0	.	.	.	.	H	1793;1650	ENSP00000368755:N1793H;ENSP00000441929:N1650H	ENSP00000368755:N1793H	N	+	1	0	MUC12	100425512	0.000000	0.05858	0.005000	0.12908	0.031000	0.12232	0.122000	0.15687	0.794000	0.33899	0.163000	0.16589	AAC	MUC12	-	NULL	ENSG00000205277		0.552	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	94	0	A	XM_379904		100638792	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	11.59	61	8	SNP	0.005	C
MUC16	94025	genome.wustl.edu	37	19	9056542	9056542	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:9056542C>A	ENST00000397910.4	-	3	31107	c.30904G>T	c.(30904-30906)Ggt>Tgt	p.G10302C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10304	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AATGGACTACCTGAACCTGAG	0.527																																																	0													105.0	106.0	106.0					19																	9056542		2074	4208	6282	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30904G>T	19.37:g.9056542C>A	ENSP00000381008:p.Gly10302Cys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.G10302C	ENST00000397910.4	37	c.30904	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	6.644	0.487272	0.12641	.	.	ENSG00000181143	ENST00000397910	T	0.03663	3.85	3.31	-5.77	0.02369	.	.	.	.	.	T	0.02649	0.0080	N	0.08118	0	.	.	.	D	0.55605	0.972	P	0.51385	0.668	T	0.30416	-0.9979	8	0.87932	D	0	.	3.3213	0.07052	0.4301:0.2717:0.0:0.2982	.	10302	B5ME49	.	C	10302	ENSP00000381008:G10302C	ENSP00000381008:G10302C	G	-	1	0	MUC16	8917542	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-2.977000	0.00664	-1.012000	0.03387	-0.457000	0.05445	GGT	MUC16	-	NULL	ENSG00000181143		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1		0.00	50	0	C	NM_024690		9056542	-1			no_errors	ENST00000397910	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.000	A
MUC5AC	4586	genome.wustl.edu	37	11	1215739	1215739	+	3'UTR	DEL	C	C	-			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:1215739delC	ENST00000358378.6	+	0	1644							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		AGGTGGTCAGCCCCGGCTTCC	0.637																																																	0													23.0	22.0	22.0					11																	1215739		867	1988	2855	SO:0001624	3_prime_UTR_variant	0			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*1641C>-	11.37:g.1215739delC			O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	RNA	DEL	-	NULL	ENST00000358378.6	37	NULL		11																																																																																			MUC5AC	-	-	ENSG00000215182		0.637	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC5AC	HGNC	protein_coding	OTTHUMT00000396096.2		0.00	58	0	C	XM_001130382		1215739	+1	tier1		no_errors	ENST00000358378	ensembl	human	putative	74_37	rna	6.25	30	2	DEL	0.000	-
MUM1L1	139221	genome.wustl.edu	37	X	105450129	105450129	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrX:105450129A>C	ENST00000357175.2	+	4	1353	c.704A>C	c.(703-705)aAg>aCg	p.K235T	MUM1L1_ENST00000337685.2_Missense_Mutation_p.K235T|MUM1L1_ENST00000372552.1_Missense_Mutation_p.K235T	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	235						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						AAAGATGAAAAGTTTGCTCCA	0.403																																																	0													95.0	82.0	86.0					X																	105450129		1935	4130	6065	SO:0001583	missense	0			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.704A>C	X.37:g.105450129A>C	ENSP00000349699:p.Lys235Thr		D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase	p.K235T	ENST00000357175.2	37	c.704	CCDS55469.1	X	.	.	.	.	.	.	.	.	.	.	A	8.105	0.777470	0.16120	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.23950	1.88;1.88;1.88	5.45	1.85	0.25348	.	0.327543	0.21899	N	0.067461	T	0.31606	0.0802	L	0.60455	1.87	0.09310	N	1	D	0.61697	0.99	P	0.56865	0.808	T	0.14090	-1.0485	10	0.16896	T	0.51	-12.8489	5.9476	0.19227	0.6884:0.0:0.3116:0.0	.	235	Q5H9M0	MUML1_HUMAN	T	235	ENSP00000349699:K235T;ENSP00000338641:K235T;ENSP00000361632:K235T	ENSP00000338641:K235T	K	+	2	0	MUM1L1	105336785	0.915000	0.31059	0.000000	0.03702	0.293000	0.27360	1.806000	0.38892	0.388000	0.25054	0.486000	0.48141	AAG	MUM1L1	-	NULL	ENSG00000157502		0.403	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	HGNC	protein_coding	OTTHUMT00000057795.1	-	0.00	23	0	A	NM_152423		105450129	+1	tier1	-	no_errors	ENST00000337685	ensembl	human	known	74_37	missense	52.17	11	12	SNP	0.000	C
NALCN	259232	genome.wustl.edu	37	13	101833397	101833397	+	Intron	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr13:101833397G>A	ENST00000251127.6	-	15	1846				NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_3'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective						calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTTAGACTTGGAGAGCCCATC	0.498																																																	0													161.0	153.0	155.0					13																	101833397		876	1991	2867	SO:0001627	intron_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1765-4672C>T	13.37:g.101833397G>A			Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	RNA	SNP	-	NULL	ENST00000251127.6	37	NULL	CCDS9498.1	13																																																																																			NALCN	-	-	ENSG00000102452		0.498	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	29	0	G	NM_052867		101833397	-1	tier1	-	no_errors	ENST00000470333	ensembl	human	known	74_37	rna	22.86	27	8	SNP	0.006	A
NAMPTL	646309	genome.wustl.edu	37	10	36811744	36811744	+	Silent	SNP	C	C	T	rs543837824		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:36811744C>T	ENST00000543053.1	-	1	579	c.363G>A	c.(361-363)taG>taA	p.*121*						nicotinamide phosphoribosyltransferase-like											biliary_tract(1)|breast(3)|lung(9)|stomach(1)	14						GTCATAAAGCCTAATGATGTG	0.383													C|||	1	0.000199681	0.0	0.0	5008	,	,		15373	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001819	synonymous_variant	0					10p11.21	2013-03-27	2008-11-06	2008-11-06	ENSG00000229644	ENSG00000229644			17633	other	unknown			"""pre-B-cell colony enhancing factor 2"""	PBEF2		8289818	Standard	NG_005593		Approved	bA92J19.4			OTTHUMG00000017964	ENST00000543053.1:c.363G>A	10.37:g.36811744C>T				Silent	SNP	pfam_Nic_PRibTrfase-Fam,superfamily_Quinolinate_PRibosylTrfase_C	p.*121	ENST00000543053.1	37	c.363		10																																																																																			NAMPTL	-	NULL	ENSG00000229644		0.383	NAMPTL-201	KNOWN	basic|appris_principal	protein_coding	NAMPTL	HGNC	protein_coding		-	0.00	84	0	C	NG_005593		36811744	-1	tier1	-	no_errors	ENST00000543053	ensembl	human	known	74_37	silent	22.99	67	20	SNP	0.691	T
NCOR2	9612	genome.wustl.edu	37	12	124817728	124817728	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:124817728G>C	ENST00000405201.1	-	42	6703	c.6703C>G	c.(6703-6705)Cgg>Ggg	p.R2235G	NCOR2_ENST00000404621.1_Missense_Mutation_p.R2225G|NCOR2_ENST00000429285.2_Missense_Mutation_p.R2225G|NCOR2_ENST00000397355.1_Missense_Mutation_p.R2226G|NCOR2_ENST00000404121.2_Missense_Mutation_p.R1796G|NCOR2_ENST00000356219.3_Missense_Mutation_p.R2242G			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2246					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		ACAGCACTCCGGGAGTGCCCT	0.632																																																	0													50.0	59.0	56.0					12																	124817728		2081	4206	6287	SO:0001583	missense	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6703C>G	12.37:g.124817728G>C	ENSP00000384018:p.Arg2235Gly		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R2242G	ENST00000405201.1	37	c.6724	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	G	8.740	0.918810	0.17982	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000447675;ENST00000429285	T;T;T;T;T;T	0.18810	2.19;2.45;2.19;2.45;2.19;2.45	4.8	3.9	0.45041	.	0.246048	0.33092	N	0.005296	T	0.32912	0.0845	L	0.48362	1.52	0.30632	N	0.757408	D;D;P	0.69078	0.993;0.997;0.603	P;D;B	0.67725	0.827;0.953;0.201	T	0.17561	-1.0365	10	0.46703	T	0.11	-26.065	7.7801	0.29060	0.0817:0.0:0.6532:0.2652	.	2226;2235;2246	C9J239;C9JFD3;Q9Y618	.;.;NCOR2_HUMAN	G	2235;2225;2242;2226;2234;1796;327;2225	ENSP00000384018:R2235G;ENSP00000384202:R2225G;ENSP00000348551:R2242G;ENSP00000380513:R2226G;ENSP00000385618:R1796G;ENSP00000400281:R2225G	ENSP00000348551:R2242G	R	-	1	2	NCOR2	123383681	0.983000	0.35010	0.144000	0.22314	0.155000	0.21991	2.478000	0.45189	0.991000	0.38814	0.650000	0.86243	CGG	NCOR2	-	NULL	ENSG00000196498		0.632	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	-	0.00	44	0	G	NM_006312		124817728	-1	tier1	-	no_errors	ENST00000356219	ensembl	human	known	74_37	missense	13.51	32	5	SNP	0.733	C
NDST4	64579	genome.wustl.edu	37	4	115997561	115997561	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:115997561T>A	ENST00000264363.2	-	2	1310	c.632A>T	c.(631-633)gAg>gTg	p.E211V		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	211	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AGGGCCTTTCTCAACCTTGGG	0.408																																																	0													72.0	73.0	73.0					4																	115997561		2203	4300	6503	SO:0001583	missense	0			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.632A>T	4.37:g.115997561T>A	ENSP00000264363:p.Glu211Val		Q2KHM8	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.E211V	ENST00000264363.2	37	c.632	CCDS3706.1	4	.	.	.	.	.	.	.	.	.	.	T	13.04	2.118143	0.37339	.	.	ENSG00000138653	ENST00000264363	T	0.37235	1.21	5.25	2.7	0.31948	.	0.098721	0.64402	D	0.000002	T	0.29976	0.0750	L	0.58810	1.83	0.37435	D	0.914208	B	0.18461	0.028	B	0.22880	0.042	T	0.14896	-1.0456	10	0.13853	T	0.58	.	8.3748	0.32436	0.1313:0.0:0.1378:0.7309	.	211	Q9H3R1	NDST4_HUMAN	V	211	ENSP00000264363:E211V	ENSP00000264363:E211V	E	-	2	0	NDST4	116217010	1.000000	0.71417	0.461000	0.27105	0.986000	0.74619	2.897000	0.48664	0.268000	0.21939	0.482000	0.46254	GAG	NDST4	-	pfam_Heparan_SO4_deacetylase	ENSG00000138653		0.408	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	HGNC	protein_coding	OTTHUMT00000256427.1	-	0.00	46	0	T	NM_022569		115997561	-1	tier1	-	no_errors	ENST00000264363	ensembl	human	known	74_37	missense	38.24	21	13	SNP	0.584	A
NFAT5	10725	genome.wustl.edu	37	16	69726422	69726422	+	Silent	SNP	G	G	A	rs369235958		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:69726422G>A	ENST00000354436.2	+	12	2958	c.2640G>A	c.(2638-2640)caG>caA	p.Q880Q	NFAT5_ENST00000432919.1_Silent_p.Q898Q|NFAT5_ENST00000567239.1_Silent_p.Q897Q|NFAT5_ENST00000566899.1_Silent_p.Q804Q|NFAT5_ENST00000393742.2_Silent_p.Q804Q|NFAT5_ENST00000349945.1_Silent_p.Q804Q	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	880	Poly-Gln.				cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q804Q(1)|p.Q898Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CTAATcaacagcagcagcagc	0.478																																																	2	Substitution - coding silent(2)	endometrium(2)											44.0	43.0	43.0					16																	69726422		2198	4300	6498	SO:0001819	synonymous_variant	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2640G>A	16.37:g.69726422G>A			A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Silent	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.Q898	ENST00000354436.2	37	c.2694	CCDS10881.1	16																																																																																			NFAT5	-	NULL	ENSG00000102908		0.478	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2		0.00	28	0	G	NM_138714		69726422	+1			no_errors	ENST00000432919	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.988	A
NFATC2	4773	genome.wustl.edu	37	20	50049181	50049181	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr20:50049181G>A	ENST00000396009.3	-	9	2364	c.2145C>T	c.(2143-2145)gcC>gcT	p.A715A	NFATC2_ENST00000609507.1_Silent_p.A496A|NFATC2_ENST00000609943.1_Silent_p.A695A|NFATC2_ENST00000610033.1_Silent_p.A496A|NFATC2_ENST00000371564.3_Silent_p.A715A|NFATC2_ENST00000414705.1_Silent_p.A695A	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	715					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					AGGGGGACTCGGCCACCATCG	0.667																																																	0													21.0	25.0	24.0					20																	50049181		2198	4289	6487	SO:0001819	synonymous_variant	0			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2145C>T	20.37:g.50049181G>A			B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Silent	SNP	pfam_RHD,pfam_IPT,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.A715	ENST00000396009.3	37	c.2145	CCDS13437.1	20																																																																																			NFATC2	-	NULL	ENSG00000101096		0.667	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	HGNC	protein_coding	OTTHUMT00000079730.2	-	0.00	96	0	G	NM_012340		50049181	-1	tier1	-	no_errors	ENST00000396009	ensembl	human	known	74_37	silent	5.43	87	5	SNP	0.965	A
NFE2L1	4779	genome.wustl.edu	37	17	46133894	46133894	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:46133894G>T	ENST00000362042.3	+	3	1273	c.657G>T	c.(655-657)gaG>gaT	p.E219D	NFE2L1_ENST00000357480.5_Missense_Mutation_p.E219D|NFE2L1_ENST00000582155.1_Missense_Mutation_p.E61D|NFE2L1_ENST00000361665.3_Missense_Mutation_p.E208D|NFE2L1_ENST00000583378.1_Missense_Mutation_p.E50D|NFE2L1_ENST00000536222.1_Missense_Mutation_p.E93D|NFE2L1_ENST00000585291.1_Missense_Mutation_p.E219D	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	219	Asp/Glu-rich (acidic).				anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.E219D(1)		cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGCAGGCGAGGGCGCGGAAG	0.617																																																	1	Substitution - Missense(1)	lung(1)											129.0	130.0	130.0					17																	46133894		2203	4300	6503	SO:0001583	missense	0			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.657G>T	17.37:g.46133894G>T	ENSP00000354855:p.Glu219Asp		D3DTU3|D3DTU5|Q12877|Q96FN6	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.E219D	ENST00000362042.3	37	c.657	CCDS11524.1	17	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445439	0.63178	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480;ENST00000536222	T;T	0.23147	2.32;1.92	5.41	3.39	0.38822	.	0.313169	0.27549	N	0.018864	T	0.17408	0.0418	L	0.27053	0.805	0.26801	N	0.969201	P;B;B;B	0.40794	0.729;0.247;0.175;0.369	B;B;B;B	0.38264	0.269;0.05;0.069;0.101	T	0.08722	-1.0708	10	0.59425	D	0.04	-37.7129	9.8693	0.41164	0.1674:0.0:0.8326:0.0	.	93;61;219;219	F5H1B7;B4DYE1;Q14494-2;Q14494	.;.;.;NF2L1_HUMAN	D	238;219;219;93	ENSP00000350072:E219D;ENSP00000445811:E93D	ENSP00000350072:E219D	E	+	3	2	NFE2L1	43488893	0.974000	0.33945	0.998000	0.56505	0.965000	0.64279	0.160000	0.16462	1.288000	0.44600	0.591000	0.81541	GAG	NFE2L1	-	NULL	ENSG00000082641		0.617	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L1	HGNC	protein_coding	OTTHUMT00000443019.1		0.00	66	0	G	NM_003204		46133894	+1			no_errors	ENST00000362042	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
NOLC1	9221	genome.wustl.edu	37	10	103919295	103919295	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:103919295G>T	ENST00000605788.1	+	7	1064	c.829G>T	c.(829-831)Gag>Tag	p.E277*	NOLC1_ENST00000488254.2_Nonsense_Mutation_p.E278*|NOLC1_ENST00000603742.1_5'UTR|NOLC1_ENST00000405356.1_Nonsense_Mutation_p.E287*	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	277	11 X 12 AA approximate repeats of an acidic serine cluster.|Interacts with RPA194.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		CGAGGAAGAGGAGCAAAAAAA	0.527																																																	0													105.0	115.0	112.0					10																	103919295		2203	4300	6503	SO:0001587	stop_gained	0			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.829G>T	10.37:g.103919295G>T	ENSP00000474710:p.Glu277*		Q15030|Q5VV70|Q9BUV3	Nonsense_Mutation	SNP	pfam_SRP40_C,pfscan_LisH_dimerisation	p.E287*	ENST00000605788.1	37	c.859	CCDS7530.1	10	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622439	0.28889	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	.	.	.	5.97	-0.761	0.11038	.	0.461581	0.21708	N	0.070315	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-3.6745	14.3563	0.66740	0.0617:0.5635:0.3748:0.0	.	.	.	.	X	287;277	.	ENSP00000359024:E277X	E	+	1	0	NOLC1	103909285	0.863000	0.29885	0.111000	0.21465	0.040000	0.13550	0.714000	0.25808	-0.097000	0.12307	-0.150000	0.13652	GAG	NOLC1	-	NULL	ENSG00000166197		0.527	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NOLC1	HGNC	protein_coding	OTTHUMT00000050012.2	-	0.00	40	0	G	NM_004741		103919295	+1	tier1	-	no_errors	ENST00000405356	ensembl	human	known	74_37	nonsense	32.50	27	13	SNP	0.673	T
NOS2	4843	genome.wustl.edu	37	17	26115859	26115859	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:26115859G>T	ENST00000313735.6	-	4	527	c.294C>A	c.(292-294)gaC>gaA	p.D98E		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	98					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GGTGAAGTGTGTCTTGGAAAG	0.537																																																	0													159.0	155.0	157.0					17																	26115859		2203	4300	6503	SO:0001583	missense	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.294C>A	17.37:g.26115859G>T	ENSP00000327251:p.Asp98Glu		A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.D98E	ENST00000313735.6	37	c.294	CCDS11223.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051151	0.75960	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.25912	1.77	5.95	2.89	0.33648	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.85682	D	0.000000	T	0.50446	0.1616	M	0.82823	2.61	0.45118	D	0.998135	P;D	0.69078	0.951;0.997	P;D	0.79784	0.664;0.993	T	0.54450	-0.8292	10	0.62326	D	0.03	.	10.9549	0.47351	0.2045:0.0:0.7955:0.0	.	98;98	F8WEM3;P35228	.;NOS2_HUMAN	E	98	ENSP00000327251:D98E	ENSP00000305638:D98E	D	-	3	2	NOS2	23139986	1.000000	0.71417	0.981000	0.43875	0.914000	0.54420	1.162000	0.31786	0.866000	0.35629	-0.142000	0.14014	GAC	NOS2	-	superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk	ENSG00000007171		0.537	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	-	0.00	57	0	G	NM_000625		26115859	-1	tier1	-	no_errors	ENST00000313735	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
NRP2	8828	genome.wustl.edu	37	2	206659485	206659485	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:206659485C>T	ENST00000357785.5	+	17	2515	c.2484C>T	c.(2482-2484)taC>taT	p.Y828Y	NRP2_ENST00000412873.2_Silent_p.Y811Y|NRP2_ENST00000540178.1_Silent_p.Y828Y|NRP2_ENST00000360409.3_Silent_p.Y833Y|NRP2_ENST00000540841.1_Silent_p.Y811Y			Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CAGATGAATACGAGGTGGACT	0.537																																																	0													80.0	78.0	79.0					2																	206659485		2203	4300	6503	SO:0001819	synonymous_variant	0			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.2484C>T	2.37:g.206659485C>T			B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	pirsf_Neuropilin,pfam_CUB_dom,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.Y833	ENST00000357785.5	37	c.2499	CCDS46496.1	2																																																																																			NRP2	-	pirsf_Neuropilin	ENSG00000118257		0.537	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1	-	0.00	50	0	C			206659485	+1	tier1	-	no_errors	ENST00000360409	ensembl	human	known	74_37	silent	21.43	33	9	SNP	0.134	T
NTRK3	4916	genome.wustl.edu	37	15	88799367	88799367	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr15:88799367G>A	ENST00000360948.2	-	2	179	c.18C>T	c.(16-18)tgC>tgT	p.C6C	NTRK3_ENST00000557856.1_Silent_p.C6C|NTRK3_ENST00000357724.2_Silent_p.C6C|NTRK3_ENST00000540489.2_Silent_p.C6C|NTRK3-AS1_ENST00000569588.1_lincRNA|NTRK3_ENST00000317501.3_Silent_p.C6C|NTRK3_ENST00000558676.1_Silent_p.C6C|NTRK3_ENST00000394480.2_Silent_p.C6C|NTRK3_ENST00000355254.2_Silent_p.C6C	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	6					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			ACTTGGCTGGGCAAAGAGAGA	0.587			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													156.0	134.0	141.0					15																	88799367		2201	4299	6500	SO:0001819	synonymous_variant	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.18C>T	15.37:g.88799367G>A			B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C6	ENST00000360948.2	37	c.18	CCDS32322.1	15																																																																																			NTRK3	-	prints_Tyr_kin_neurotrophic_rcpt_3	ENSG00000140538		0.587	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		-	0.00	64	0	G			88799367	-1	tier1	-	no_errors	ENST00000360948	ensembl	human	known	74_37	silent	9.76	37	4	SNP	1.000	A
NUP37	79023	genome.wustl.edu	37	12	102471235	102471235	+	Frame_Shift_Del	DEL	A	A	-			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:102471235delA	ENST00000552283.1	-	7	726	c.587delT	c.(586-588)ttgfs	p.L196fs	RP11-554E23.4_ENST00000552707.1_RNA|NUP37_ENST00000251074.1_Frame_Shift_Del_p.L196fs|NUP37_ENST00000543021.1_5'Flank			Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	196					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(10)|ovary(1)	17						CTGTTGGGCCAAAAGATCATA	0.383																																																	0													135.0	140.0	138.0					12																	102471235		2203	4300	6503	SO:0001589	frameshift_variant	0			AF514994	CCDS9089.1	12q23.2	2014-08-12			ENSG00000075188	ENSG00000075188		"""WD repeat domain containing"""	29929	protein-coding gene	gene with protein product		609264				12196509	Standard	NM_024057		Approved	MGC5585, FLJ22618	uc001tjc.3	Q8NFH4	OTTHUMG00000170478	ENST00000552283.1:c.587delT	12.37:g.102471235delA	ENSP00000448054:p.Leu196fs		Q9H644	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L196fs	ENST00000552283.1	37	c.587	CCDS9089.1	12																																																																																			NUP37	-	superfamily_WD40_repeat_dom	ENSG00000075188		0.383	NUP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP37	HGNC	protein_coding	OTTHUMT00000409330.1		0.00	43	0	A	NM_024057		102471235	-1	tier1		no_errors	ENST00000251074	ensembl	human	known	74_37	frame_shift_del	5.88	32	2	DEL	0.054	-
NXPH2	11249	genome.wustl.edu	37	2	139428724	139428724	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:139428724C>T	ENST00000272641.3	-	2	669	c.563G>A	c.(562-564)cGc>cAc	p.R188H		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	188	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.R188H(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		ATACTCAATGCGACAATTGAA	0.478																																																	1	Substitution - Missense(1)	large_intestine(1)											59.0	58.0	59.0					2																	139428724		1880	4096	5976	SO:0001583	missense	0			AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.563G>A	2.37:g.139428724C>T	ENSP00000272641:p.Arg188His		B7WP24|Q494R1|Q75QC3	Missense_Mutation	SNP	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.R188H	ENST00000272641.3	37	c.563	CCDS46421.1	2	.	.	.	.	.	.	.	.	.	.	C	14.49	2.549860	0.45383	.	.	ENSG00000144227	ENST00000272641	.	.	.	5.66	4.78	0.61160	.	0.048936	0.85682	N	0.000000	T	0.60457	0.2270	M	0.64170	1.965	0.58432	D	0.999991	B	0.28801	0.223	B	0.32149	0.141	T	0.57985	-0.7716	8	.	.	.	-8.6021	13.9695	0.64230	0.0:0.9264:0.0:0.0736	.	188	O95156	NXPH2_HUMAN	H	188	.	.	R	-	2	0	NXPH2	139145194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.903000	0.63272	1.507000	0.48752	0.655000	0.94253	CGC	NXPH2	-	pfam_NXPH/NXPE,pirsf_Neurexophilin	ENSG00000144227		0.478	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH2	HGNC	protein_coding	OTTHUMT00000331901.1		0.00	40	0	C			139428724	-1			no_errors	ENST00000272641	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
OPCML	4978	genome.wustl.edu	37	11	132290100	132290100	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:132290100A>G	ENST00000331898.7	-	7	1603	c.1025T>C	c.(1024-1026)tTc>tCc	p.F342S	OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000374778.4_Missense_Mutation_p.F301S|OPCML_ENST00000524381.1_Missense_Mutation_p.F335S|OPCML_ENST00000541867.1_Missense_Mutation_p.F351S	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	342					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		AAACTTGATGAAGAAGTGGGC	0.512																																																	0													106.0	96.0	99.0					11																	132290100		2201	4297	6498	SO:0001583	missense	0			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.1025T>C	11.37:g.132290100A>G	ENSP00000330862:p.Phe342Ser		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F351S	ENST00000331898.7	37	c.1052	CCDS8492.1	11	.	.	.	.	.	.	.	.	.	.	A	15.02	2.709623	0.48517	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.63096	0.35;0.32;0.5;-0.02	5.04	5.04	0.67666	.	0.236441	0.35585	N	0.003104	T	0.46405	0.1391	N	0.14661	0.345	0.35554	D	0.804169	B;B;B;B	0.26002	0.015;0.139;0.087;0.139	B;B;B;B	0.24701	0.027;0.034;0.035;0.055	T	0.58707	-0.7589	10	0.87932	D	0	-9.0433	13.3194	0.60424	1.0:0.0:0.0:0.0	.	351;335;341;342	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	S	342;335;301;309;351	ENSP00000330862:F342S;ENSP00000434750:F335S;ENSP00000363910:F301S;ENSP00000445496:F351S	ENSP00000330862:F342S	F	-	2	0	OPCML	131795310	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.552000	0.67281	2.025000	0.59659	0.460000	0.39030	TTC	OPCML	-	NULL	ENSG00000183715		0.512	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	-	0.00	27	0	A	NM_001012393		132290100	-1	tier1	-	no_errors	ENST00000541867	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	G
OPRL1	4987	genome.wustl.edu	37	20	62729951	62729951	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr20:62729951C>T	ENST00000349451.3	+	6	1324	c.912C>T	c.(910-912)tgC>tgT	p.C304C	OPRL1_ENST00000336866.2_Silent_p.C304C|OPRL1_ENST00000355631.4_Silent_p.C304C	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	304					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					TGCGCTTCTGCACGGCCCTGG	0.622																																																	0													93.0	78.0	83.0					20																	62729951		2203	4297	6500	SO:0001819	synonymous_variant	0				CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.912C>T	20.37:g.62729951C>T			Q8TD34|Q8WYH9|Q9H4K4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_X_opioid_rcpt,prints_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Somatstn_rcpt,prints_Neuropept_B/W_rcpt,prints_NPY_rcpt	p.C304	ENST00000349451.3	37	c.912	CCDS13556.1	20																																																																																			OPRL1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Opioid_rcpt	ENSG00000125510		0.622	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OPRL1	HGNC	protein_coding	OTTHUMT00000080295.1		0.00	49	0	C	NM_182647		62729951	+1			no_errors	ENST00000336866	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
OR2A12	346525	genome.wustl.edu	37	7	143793132	143793132	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr7:143793132G>A	ENST00000408949.2	+	1	992	c.932G>A	c.(931-933)tGa>tAa	p.*311*		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					AGATCAATGTGAAGAATCATT	0.428																																																	0													105.0	101.0	103.0					7																	143793132		1850	4093	5943	SO:0001819	synonymous_variant	0				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.932G>A	7.37:g.143793132G>A			Q6IF43	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.*311	ENST00000408949.2	37	c.932	CCDS43670.1	7																																																																																			OR2A12	-	NULL	ENSG00000221858		0.428	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A12	HGNC	protein_coding	OTTHUMT00000349969.1	-	0.00	42	0	G			143793132	+1	tier1	-	no_errors	ENST00000408949	ensembl	human	known	74_37	silent	25.81	23	8	SNP	0.071	A
OR2L2	26246	genome.wustl.edu	37	1	248201860	248201860	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:248201860G>A	ENST00000366479.2	+	1	387	c.291G>A	c.(289-291)ggG>ggA	p.G97G	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ctggatgtgggattcAGAGTT	0.428																																																	0													144.0	137.0	139.0					1																	248201860		2203	4300	6503	SO:0001819	synonymous_variant	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.291G>A	1.37:g.248201860G>A			Q2M3T5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G97	ENST00000366479.2	37	c.291	CCDS31103.1	1																																																																																			OR2L2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000203663		0.428	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	-	0.00	129	0	G	NM_001004686		248201860	+1	tier1	-	no_errors	ENST00000366479	ensembl	human	known	74_37	silent	22.48	99	29	SNP	0.000	A
OR4X2	119764	genome.wustl.edu	37	11	48266938	48266938	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:48266938T>G	ENST00000302329.3	+	1	331	c.283T>G	c.(283-285)Ttc>Gtc	p.F95V		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						ACAGCTTTTCTTCTTGCACTT	0.517																																																	0													122.0	116.0	118.0					11																	48266938		2201	4298	6499	SO:0001583	missense	0			AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.283T>G	11.37:g.48266938T>G	ENSP00000307751:p.Phe95Val		B2RNK3|Q6IF73|Q96R63	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F95V	ENST00000302329.3	37	c.283	CCDS31486.1	11	.	.	.	.	.	.	.	.	.	.	T	4.840	0.156215	0.09236	.	.	ENSG00000172208	ENST00000302329	T	0.00500	6.96	5.37	4.23	0.50019	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000030	T	0.00784	0.0026	L	0.42008	1.315	0.28285	N	0.923803	D	0.69078	0.997	P	0.62813	0.907	T	0.49735	-0.8908	10	0.09338	T	0.73	.	9.8965	0.41322	0.1529:0.0:0.0:0.8471	.	95	Q8NGF9	OR4X2_HUMAN	V	95	ENSP00000307751:F95V	ENSP00000307751:F95V	F	+	1	0	OR4X2	48223514	0.000000	0.05858	0.537000	0.28052	0.132000	0.20833	-0.688000	0.05150	0.848000	0.35191	0.528000	0.53228	TTC	OR4X2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000172208		0.517	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X2	HGNC	protein_coding	OTTHUMT00000383376.2	-	0.00	83	0	T	NM_001004727		48266938	+1	tier1	-	no_errors	ENST00000302329	ensembl	human	known	74_37	missense	21.82	86	24	SNP	0.894	G
OR5AC2	81050	genome.wustl.edu	37	3	97806700	97806701	+	Frame_Shift_Ins	INS	-	-	A	rs11369970	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:97806700_97806701insA	ENST00000358642.2	+	1	684_685	c.684_685insA	c.(685-687)aaafs	p.K229fs		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	229					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						TTGATATTCTGAAAAAAAAGTC	0.371														159	0.0317492	0.112	0.0144	5008	,	,		21923	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001589	frameshift_variant	0			AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.692dupA	3.37:g.97806708_97806708dupA	ENSP00000351466:p.Lys229fs			Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S231fs	ENST00000358642.2	37	c.684_685	CCDS33796.1	3																																																																																			OR5AC2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196578		0.371	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AC2	HGNC	protein_coding	OTTHUMT00000359116.1		0.00	25	0	-			97806701	+1	tier1		no_errors	ENST00000358642	ensembl	human	known	74_37	frame_shift_ins	6.67	28	2	INS	0.016:0.046	A
OR8G5	219865	genome.wustl.edu	37	11	124135398	124135398	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:124135398A>G	ENST00000524943.2	+	1	676	c.676A>G	c.(676-678)Agt>Ggt	p.S226G	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		CTCCTGTTCTAGTACTTACAT	0.368																																					Ovarian(169;523 1969 8640 31295 51256)												0													178.0	177.0	177.0					11																	124135398		1949	4164	6113	SO:0001583	missense	0			BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.676A>G	11.37:g.124135398A>G	ENSP00000477014:p.Ser226Gly		B2RND3|Q6IEU6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S226G	ENST00000524943.2	37	c.676		11																																																																																			OR8G5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000255298		0.368	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	OR8G5	HGNC	protein_coding	OTTHUMT00000387283.2	-	0.00	118	0	A	NM_001005198		124135398	+1	tier1	-	no_errors	ENST00000524943	ensembl	human	known	74_37	missense	6.62	127	9	SNP	0.004	G
OSBPL6	114880	genome.wustl.edu	37	2	179197705	179197705	+	Missense_Mutation	SNP	A	A	G	rs372381868		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:179197705A>G	ENST00000190611.4	+	8	970	c.594A>G	c.(592-594)atA>atG	p.I198M	OSBPL6_ENST00000315022.2_Missense_Mutation_p.I177M|OSBPL6_ENST00000357080.4_Missense_Mutation_p.I198M|OSBPL6_ENST00000392505.2_Missense_Mutation_p.I198M|OSBPL6_ENST00000359685.3_Missense_Mutation_p.I198M|OSBPL6_ENST00000409631.1_Missense_Mutation_p.I198M|OSBPL6_ENST00000409045.3_Missense_Mutation_p.I198M	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	198					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			GTTTTCACATATTTCCTTCAA	0.423																																																	0								A	MET/ILE,MET/ILE,MET/ILE,MET/ILE,MET/ILE	0,4406		0,0,2203	123.0	109.0	114.0		531,594,594,594,594	3.0	1.0	2		114	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	OSBPL6	NM_145739.2,NM_032523.3,NM_001201482.1,NM_001201481.1,NM_001201480.1	10,10,10,10,10	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	177/939,198/935,198/899,198/904,198/960	179197705	1,13005	2203	4300	6503	SO:0001583	missense	0			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.594A>G	2.37:g.179197705A>G	ENSP00000190611:p.Ile198Met		B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	pfam_Oxysterol-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.I177M	ENST00000190611.4	37	c.531	CCDS2277.1	2	.	.	.	.	.	.	.	.	.	.	A	13.31	2.198639	0.38806	0.0	1.16E-4	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.12361	2.71;2.72;2.69;2.7;2.72;2.72;2.71	5.57	2.99	0.34606	.	0.138754	0.64402	D	0.000003	T	0.04588	0.0125	N	0.02011	-0.69	0.38005	D	0.934358	B;B;B;B;B;B	0.23128	0.006;0.08;0.002;0.045;0.008;0.053	B;B;B;B;B;B	0.20767	0.015;0.031;0.006;0.028;0.008;0.013	T	0.33854	-0.9852	10	0.33141	T	0.24	-17.1364	7.0537	0.25087	0.6433:0.2854:0.0714:0.0	.	198;177;198;198;198;198	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	M	198;198;198;198;198;198;177	ENSP00000376293:I198M;ENSP00000352713:I198M;ENSP00000349591:I198M;ENSP00000387248:I198M;ENSP00000190611:I198M;ENSP00000386885:I198M;ENSP00000318723:I177M	ENSP00000190611:I198M	I	+	3	3	OSBPL6	178905951	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.680000	0.25306	1.022000	0.39626	0.533000	0.62120	ATA	OSBPL6	-	NULL	ENSG00000079156		0.423	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSBPL6	HGNC	protein_coding	OTTHUMT00000334393.2	-	0.00	62	0	A	NM_032523		179197705	+1	tier1	-	no_errors	ENST00000315022	ensembl	human	known	74_37	missense	22.64	41	12	SNP	1.000	G
PAK3	5063	genome.wustl.edu	37	X	110389749	110389749	+	Splice_Site	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrX:110389749C>T	ENST00000372010.1	+	7	719	c.277C>T	c.(277-279)Cca>Tca	p.P93S	PAK3_ENST00000372007.5_Intron|PAK3_ENST00000360648.4_Splice_Site_p.P114S|PAK3_ENST00000446737.1_Intron|PAK3_ENST00000262836.4_Splice_Site_p.P93S|PAK3_ENST00000518291.1_Splice_Site_p.P114S|PAK3_ENST00000425146.1_Intron|PAK3_ENST00000417227.1_Intron|PAK3_ENST00000519681.1_Intron			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	93	Autoregulatory region. {ECO:0000250}.|GTPase-binding. {ECO:0000250}.|Linker.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						TCCATTACAGCCAGATCTCTA	0.463										TSP Lung(19;0.15)																																							0													32.0	26.0	28.0					X																	110389749		1564	3564	5128	SO:0001630	splice_region_variant	0			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.277-1C>T	X.37:g.110389749C>T			A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.P114S	ENST00000372010.1	37	c.340	CCDS48153.1	X	.	.	.	.	.	.	.	.	.	.	C	2.984	-0.209606	0.06140	.	.	ENSG00000077264	ENST00000372010;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000262836	T;T;T;T	0.70399	-0.47;-0.48;-0.48;-0.47	5.35	5.35	0.76521	PAK-box/P21-Rho-binding (2);	0.239719	0.27155	N	0.020661	T	0.70228	0.3200	N	0.08118	0	0.41142	D	0.985962	D;D	0.59357	0.981;0.985	D;D	0.71414	0.954;0.973	T	0.71490	-0.4577	9	.	.	.	.	18.7283	0.91724	0.0:1.0:0.0:0.0	.	114;93	O75914-3;O75914	.;PAK3_HUMAN	S	93;114;114;114;93	ENSP00000361080:P93S;ENSP00000428921:P114S;ENSP00000353864:P114S;ENSP00000262836:P93S	.	P	+	1	0	PAK3	110276405	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.876000	0.63079	2.562000	0.86427	0.600000	0.82982	CCA	PAK3	-	NULL	ENSG00000077264		0.463	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAK3	HGNC	protein_coding	OTTHUMT00000057918.1		0.00	13	0	C	NM_002578	Missense_Mutation	110389749	+1			no_errors	ENST00000360648	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	T
PARK2	5071	genome.wustl.edu	37	6	161771153	161771153	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr6:161771153C>T	ENST00000366898.1	-	12	1478	c.1376G>A	c.(1375-1377)gGg>gAg	p.G459E	PARK2_ENST00000366896.1_Missense_Mutation_p.G310E|PARK2_ENST00000366897.1_Missense_Mutation_p.G431E|PARK2_ENST00000366894.1_Missense_Mutation_p.G268E|PARK2_ENST00000338468.3_Missense_Mutation_p.G268E	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	459					adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		CCAGTGGTCCCCCATGCAGAC	0.612																																																	0													45.0	39.0	41.0					6																	161771153		2203	4300	6503	SO:0001583	missense	0				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.1376G>A	6.37:g.161771153C>T	ENSP00000355865:p.Gly459Glu		A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Znf_C6HC,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,smart_Znf_C6HC,pirsf_Parkin,pfscan_Ubiquitin_supergroup,prints_Parkin,prints_Ubiquitin	p.G459E	ENST00000366898.1	37	c.1376	CCDS5281.1	6	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619230	0.87460	.	.	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366896;ENST00000366894;ENST00000338468	D;D;D;D;D	0.92965	-2.82;-2.93;-3.14;-2.52;-2.52	5.27	4.37	0.52481	.	0.000000	0.85682	D	0.000000	D	0.92485	0.7614	L	0.49126	1.545	0.80722	D	1	D;D;D	0.76494	0.999;0.988;0.993	D;P;P	0.75020	0.985;0.896;0.896	D	0.92801	0.6256	10	0.54805	T	0.06	.	12.8544	0.57876	0.0:0.8356:0.1644:0.0	.	310;431;459	Q5VVX3;Q5VVX4;O60260	.;.;PRKN2_HUMAN	E	459;431;310;268;268	ENSP00000355865:G459E;ENSP00000355863:G431E;ENSP00000355862:G310E;ENSP00000355860:G268E;ENSP00000343589:G268E	ENSP00000343589:G268E	G	-	2	0	PARK2	161691143	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	5.476000	0.66793	1.163000	0.42636	0.563000	0.77884	GGG	PARK2	-	pirsf_Parkin,prints_Parkin	ENSG00000185345		0.612	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PARK2	HGNC	protein_coding	OTTHUMT00000042995.1	-	0.00	115	0	C			161771153	-1	tier1	-	no_errors	ENST00000366898	ensembl	human	known	74_37	missense	24.30	81	26	SNP	1.000	T
PAXIP1	22976	genome.wustl.edu	37	7	154760285	154760285	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr7:154760285C>G	ENST00000404141.1	-	7	1780	c.1626G>C	c.(1624-1626)caG>caC	p.Q542H	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.Q542H			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	542	Gln-rich.			Missing (in Ref. 4; AAB91434). {ECO:0000305}.	adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)		p.Q508H(1)		NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		gctgctgctgctggtgcatgc	0.627																																																	1	Substitution - Missense(1)	large_intestine(1)											13.0	13.0	13.0					7																	154760285		1934	3626	5560	SO:0001583	missense	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1626G>C	7.37:g.154760285C>G	ENSP00000384048:p.Gln542His		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q542H	ENST00000404141.1	37	c.1626	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548436	0.27652	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000323199	T;T	0.48201	0.82;0.82	4.96	-3.3	0.05003	.	0.298320	0.23000	N	0.053095	T	0.26593	0.0650	N	0.19112	0.55	0.25352	N	0.988853	B;B;B;B	0.14012	0.001;0.009;0.002;0.001	B;B;B;B	0.12156	0.003;0.007;0.007;0.003	T	0.11991	-1.0565	10	0.45353	T	0.12	-3.9012	9.2332	0.37450	0.0:0.4209:0.4486:0.1305	.	495;451;508;542	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	H	542;542;495	ENSP00000384048:Q542H;ENSP00000380376:Q542H	ENSP00000319149:Q495H	Q	-	3	2	PAXIP1	154391218	0.712000	0.27916	0.413000	0.26509	0.911000	0.54048	0.051000	0.14141	-0.530000	0.06349	-0.357000	0.07601	CAG	PAXIP1	-	NULL	ENSG00000157212		0.627	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	57	0	C	NM_007349		154760285	-1			no_errors	ENST00000397192	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.930	G
PBOV1	59351	genome.wustl.edu	37	6	138539138	138539138	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr6:138539138G>T	ENST00000527246.2	-	1	489	c.395C>A	c.(394-396)cCa>cAa	p.P132Q	KIAA1244_ENST00000251691.4_Intron	NM_021635.2	NP_067648.1	Q9GZY1	PBOV1_HUMAN	prostate and breast cancer overexpressed 1	132						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)	1	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00055)|GBM - Glioblastoma multiforme(68;0.000674)		TATGATCTGTGGATGTATAGT	0.393																																																	0													101.0	103.0	102.0					6																	138539138		2203	4300	6503	SO:0001583	missense	0			AF189269	CCDS5190.1	6q23.3	2012-02-09			ENSG00000254440	ENSG00000254440			21079	protein-coding gene	gene with protein product		605669				12553037, 11156405	Standard	NM_021635		Approved	UC28, UROC28	uc003qhv.3	Q9GZY1	OTTHUMG00000167040	ENST00000527246.2:c.395C>A	6.37:g.138539138G>T	ENSP00000432353:p.Pro132Gln			Missense_Mutation	SNP	NULL	p.P132Q	ENST00000527246.2	37	c.395	CCDS5190.1	6	.	.	.	.	.	.	.	.	.	.	G	4.932	0.173091	0.09391	.	.	ENSG00000254440	ENST00000527246	T	0.57752	0.38	3.53	-3.64	0.04515	.	.	.	.	.	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	P	0.40332	0.713	B	0.37304	0.246	T	0.13176	-1.0519	9	0.87932	D	0	.	3.2463	0.06798	0.3257:0.0:0.2161:0.4582	.	132	Q9GZY1	PBOV1_HUMAN	Q	132	ENSP00000432353:P132Q	ENSP00000432353:P132Q	P	-	2	0	PBOV1	138580831	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.986000	0.03747	-0.902000	0.03886	0.655000	0.94253	CCA	PBOV1	-	NULL	ENSG00000254440		0.393	PBOV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBOV1	HGNC	protein_coding	OTTHUMT00000392617.1	-	0.00	76	0	G	NM_021635		138539138	-1	tier1	-	no_errors	ENST00000527246	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.000	T
PCDHA1	56147	genome.wustl.edu	37	5	140167909	140167909	+	Silent	SNP	G	G	A	rs562110007		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:140167909G>A	ENST00000504120.2	+	1	2034	c.2034G>A	c.(2032-2034)gcG>gcA	p.A678A	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Silent_p.A678A	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	678	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A678A(2)		breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCAAAGGCGTCTTCGCGGG	0.662													.|||	1	0.000199681	0.0	0.0	5008	,	,		16213	0.0		0.001	False		,,,				2504	0.0																2	Substitution - coding silent(2)	prostate(2)											42.0	47.0	45.0					5																	140167909		2201	4300	6501	SO:0001819	synonymous_variant	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2034G>A	5.37:g.140167909G>A			O75288|Q9NRT7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A678	ENST00000504120.2	37	c.2034	CCDS54913.1	5																																																																																			PCDHA1	-	pfscan_Cadherin	ENSG00000204970		0.662	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	-	0.00	89	0	G	NM_018900		140167909	+1	tier1	-	no_errors	ENST00000504120	ensembl	human	known	74_37	silent	5.49	86	5	SNP	0.000	A
PCDHB1	29930	genome.wustl.edu	37	5	140431920	140431920	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:140431920C>T	ENST00000306549.3	+	1	942	c.865C>T	c.(865-867)Ctc>Ttc	p.L289F		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	289	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAAGCAATTCTCAAGACGTT	0.473																																																	0													68.0	69.0	68.0					5																	140431920		2203	4300	6503	SO:0001583	missense	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.865C>T	5.37:g.140431920C>T	ENSP00000307234:p.Leu289Phe		Q2M257	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L289F	ENST00000306549.3	37	c.865	CCDS4243.1	5	.	.	.	.	.	.	.	.	.	.	C	7.173	0.588029	0.13812	.	.	ENSG00000171815	ENST00000306549	T	0.51817	0.69	6.17	1.97	0.26223	Cadherin (4);Cadherin-like (1);	0.204216	0.25186	N	0.032490	T	0.34716	0.0907	L	0.41710	1.295	0.09310	N	1	P	0.45634	0.863	B	0.43990	0.438	T	0.09465	-1.0673	10	0.24483	T	0.36	.	4.8782	0.13667	0.3266:0.38:0.2299:0.0635	.	289	Q9Y5F3	PCDB1_HUMAN	F	289	ENSP00000307234:L289F	ENSP00000307234:L289F	L	+	1	0	PCDHB1	140412104	0.000000	0.05858	0.643000	0.29450	0.708000	0.40852	-0.342000	0.07801	0.904000	0.36572	0.655000	0.94253	CTC	PCDHB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000171815		0.473	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	-	0.00	72	0	C	NM_013340		140431920	+1	tier1	-	no_errors	ENST00000306549	ensembl	human	known	74_37	missense	15.38	44	8	SNP	0.000	T
PCDHGA3	56112	genome.wustl.edu	37	5	140724088	140724088	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:140724088G>T	ENST00000253812.6	+	1	488	c.488G>T	c.(487-489)gGc>gTc	p.G163V	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGATGTAGGCATTAACTCC	0.463																																																	0													84.0	82.0	82.0					5																	140724088		1937	4132	6069	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.488G>T	5.37:g.140724088G>T	ENSP00000253812:p.Gly163Val		Q9Y5D4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G163V	ENST00000253812.6	37	c.488	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	20.8	4.054644	0.75960	.	.	ENSG00000254245	ENST00000253812	T	0.28454	1.61	5.65	5.65	0.86999	Cadherin (3);Cadherin-like (1);	0.000000	0.33572	U	0.004772	T	0.74876	0.3774	H	0.99325	4.515	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74674	0.983;0.984	D	0.85654	0.1284	10	0.87932	D	0	.	19.7068	0.96076	0.0:0.0:1.0:0.0	.	163;163	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	V	163	ENSP00000253812:G163V	ENSP00000253812:G163V	G	+	2	0	PCDHGA3	140704272	1.000000	0.71417	0.980000	0.43619	0.924000	0.55760	7.830000	0.86741	2.824000	0.97209	0.655000	0.94253	GGC	PCDHGA3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254245		0.463	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	-	0.00	44	0	G	NM_018916		140724088	+1	tier1	-	no_errors	ENST00000253812	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
PCDH1	5097	genome.wustl.edu	37	5	141244537	141244537	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:141244537C>A	ENST00000394536.3	-	3	1498	c.1359G>T	c.(1357-1359)aaG>aaT	p.K453N	PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000456271.1_Missense_Mutation_p.K441N|PCDH1_ENST00000287008.3_Missense_Mutation_p.K453N|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000536585.1_Missense_Mutation_p.K431N	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	453	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		AATACTTCTTCTTGCTGTCAC	0.557																																					Ovarian(132;1609 1739 4190 14731 45037)												0													182.0	171.0	174.0					5																	141244537		2203	4300	6503	SO:0001583	missense	0			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1359G>T	5.37:g.141244537C>A	ENSP00000378043:p.Lys453Asn		Q8IUP2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K453N	ENST00000394536.3	37	c.1359	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	c	14.29	2.492526	0.44352	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.37915	1.17;4.66;4.66;4.66;4.66	5.88	4.99	0.66335	Cadherin (4);Cadherin-like (1);	0.000000	0.53938	D	0.000048	T	0.50051	0.1593	L	0.42581	1.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.45116	-0.9283	10	0.41790	T	0.15	.	12.0419	0.53458	0.0:0.9132:0.0:0.0868	.	453;453	Q08174;Q08174-2	PCDH1_HUMAN;.	N	453;453;441;464;431	ENSP00000287008:K453N;ENSP00000378043:K453N;ENSP00000403497:K441N;ENSP00000350122:K464N;ENSP00000438825:K431N	ENSP00000287008:K453N	K	-	3	2	PCDH1	141224721	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.880000	0.39628	1.443000	0.47586	0.645000	0.84053	AAG	PCDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000156453		0.557	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	-	0.00	14	0	C	NM_032420		141244537	-1	tier1	-	no_errors	ENST00000287008	ensembl	human	known	74_37	missense	40.00	9	6	SNP	1.000	A
PGBD4	161779	genome.wustl.edu	37	15	34396468	34396468	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr15:34396468A>G	ENST00000397766.2	+	1	2195	c.1736A>G	c.(1735-1737)tAc>tGc	p.Y579C	EMC7_ENST00000532113.1_5'Flank|EMC7_ENST00000256545.4_5'Flank	NM_152595.4	NP_689808.2	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	579										breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)|prostate(1)	16		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		TTTGAAATTTACCACACGAAA	0.393																																																	0													107.0	92.0	97.0					15																	34396468		2201	4298	6499	SO:0001583	missense	0			AK057200	CCDS10033.1	15q13.1	2002-10-25			ENSG00000182405	ENSG00000182405			19401	protein-coding gene	gene with protein product							Standard	NM_152595		Approved	FLJ32638, FLJ37497	uc001zho.3	Q96DM1	OTTHUMG00000129370	ENST00000397766.2:c.1736A>G	15.37:g.34396468A>G	ENSP00000380872:p.Tyr579Cys		A1L487|A8K0C6|Q8N9E8	Missense_Mutation	SNP	NULL	p.Y579C	ENST00000397766.2	37	c.1736	CCDS10033.1	15	.	.	.	.	.	.	.	.	.	.	a	13.53	2.264757	0.40095	.	.	ENSG00000182405	ENST00000397766	T	0.27557	1.66	1.16	-2.1	0.07210	.	0.883647	0.08904	U	0.876810	T	0.35970	0.0950	M	0.64170	1.965	0.23473	N	0.99761	D	0.63046	0.992	P	0.54460	0.753	T	0.22836	-1.0205	10	0.52906	T	0.07	.	2.1287	0.03745	0.5485:0.0:0.1978:0.2537	.	579	Q96DM1	PGBD4_HUMAN	C	579	ENSP00000380872:Y579C	ENSP00000380872:Y579C	Y	+	2	0	PGBD4	32183760	0.972000	0.33761	0.023000	0.16930	0.362000	0.29581	-0.023000	0.12456	-0.625000	0.05604	0.255000	0.18592	TAC	PGBD4	-	NULL	ENSG00000182405		0.393	PGBD4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PGBD4	HGNC	protein_coding	OTTHUMT00000251522.1		0.00	36	0	A			34396468	+1			no_errors	ENST00000397766	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.753	G
PHLDA2	7262	genome.wustl.edu	37	11	2950495	2950495	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:2950495C>A	ENST00000314222.4	-	1	190	c.100G>T	c.(100-102)Gac>Tac	p.D34Y		NM_003311.3	NP_003302.1	Q53GA4	PHLA2_HUMAN	pleckstrin homology-like domain, family A, member 2	34	PH.				apoptotic process (GO:0006915)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|regulation of gene expression (GO:0010468)|regulation of glycogen metabolic process (GO:0070873)	cytoplasm (GO:0005737)|membrane (GO:0016020)				central_nervous_system(1)	1		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTCAGGCGGTCGGAGGTGAGC	0.662																																																	0													20.0	22.0	21.0					11																	2950495		2196	4297	6493	SO:0001583	missense	0			AF035444	CCDS7741.1	11p15.4	2013-01-10	2003-09-26	2003-10-01	ENSG00000181649	ENSG00000181649		"""Pleckstrin homology (PH) domain containing"""	12385	protein-coding gene	gene with protein product		602131	"""tumor suppressing subtransferable candidate 3"""	TSSC3		9328465, 9403053	Standard	NM_003311		Approved	IPL, BWR1C, HLDA2	uc001lxa.1	Q53GA4	OTTHUMG00000010926	ENST00000314222.4:c.100G>T	11.37:g.2950495C>A	ENSP00000319231:p.Asp34Tyr		O00496	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology	p.D34Y	ENST00000314222.4	37	c.100	CCDS7741.1	11	.	.	.	.	.	.	.	.	.	.	C	28.2	4.903455	0.92035	.	.	ENSG00000181649	ENST00000314222	T	0.52526	0.66	3.51	3.51	0.40186	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	U	0.000000	T	0.67646	0.2915	M	0.74258	2.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.74405	-0.3676	10	0.87932	D	0	-26.7573	15.3955	0.74790	0.0:1.0:0.0:0.0	.	34	Q53GA4	PHLA2_HUMAN	Y	34	ENSP00000319231:D34Y	ENSP00000319231:D34Y	D	-	1	0	PHLDA2	2907071	1.000000	0.71417	0.981000	0.43875	0.934000	0.57294	6.786000	0.75094	1.660000	0.50760	0.313000	0.20887	GAC	PHLDA2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology	ENSG00000181649		0.662	PHLDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDA2	HGNC	protein_coding	OTTHUMT00000030116.1	-	0.00	27	0	C	NM_003311		2950495	-1	tier1	-	no_errors	ENST00000314222	ensembl	human	known	74_37	missense	41.67	7	5	SNP	1.000	A
PITPNM2	57605	genome.wustl.edu	37	12	123470823	123470823	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:123470823C>T	ENST00000542749.1	-	24	3864	c.3801G>A	c.(3799-3801)acG>acA	p.T1267T	PITPNM2_ENST00000320201.4_Silent_p.T1267T|PITPNM2_ENST00000392428.1_Silent_p.T988T|PITPNM2_ENST00000280562.5_Silent_p.T1261T			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1267					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TGCGGGTGGCCGTGTTGCGAG	0.706																																																	0													8.0	9.0	9.0					12																	123470823		2141	4194	6335	SO:0001819	synonymous_variant	0			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3801G>A	12.37:g.123470823C>T			Q9P271	Silent	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.T1267	ENST00000542749.1	37	c.3801	CCDS9242.1	12																																																																																			PITPNM2	-	NULL	ENSG00000090975		0.706	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	HGNC	protein_coding	OTTHUMT00000401342.1	-	0.00	14	0	C	NM_020845		123470823	-1	tier1	-	no_errors	ENST00000320201	ensembl	human	known	74_37	silent	40.00	6	4	SNP	0.539	T
PLCB3	5331	genome.wustl.edu	37	11	64032910	64032910	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:64032910C>T	ENST00000540288.1	+	25	3074	c.2971C>T	c.(2971-2973)Cgc>Tgc	p.R991C	PLCB3_ENST00000279230.6_Missense_Mutation_p.R991C|PLCB3_ENST00000325234.5_Missense_Mutation_p.R924C	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	991					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						CCTCACCCGCCGCCTGCTGGA	0.677																																																	0													20.0	21.0	21.0					11																	64032910		2183	4263	6446	SO:0001583	missense	0			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2971C>T	11.37:g.64032910C>T	ENSP00000443631:p.Arg991Cys		A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,pfam_PLC-beta_CS,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.R991C	ENST00000540288.1	37	c.2971	CCDS8064.1	11	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961551	0.74016	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.47177	0.85;0.85;0.85	5.2	4.22	0.49857	.	0.367126	0.27019	N	0.021334	T	0.38639	0.1048	N	0.08118	0	0.23232	N	0.998072	D;D	0.71674	0.998;0.998	P;P	0.55260	0.701;0.772	T	0.21690	-1.0238	10	0.66056	D	0.02	.	10.2017	0.43087	0.1982:0.8018:0.0:0.0	.	924;991	G5E960;Q01970	.;PLCB3_HUMAN	C	991;991;924	ENSP00000279230:R991C;ENSP00000443631:R991C;ENSP00000324660:R924C	ENSP00000279230:R991C	R	+	1	0	PLCB3	63789486	1.000000	0.71417	0.402000	0.26371	0.206000	0.24218	1.244000	0.32778	2.445000	0.82738	0.561000	0.74099	CGC	PLCB3	-	pirsf_PLC-beta	ENSG00000149782		0.677	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	PLCB3	HGNC	protein_coding	OTTHUMT00000396405.1	-	0.00	95	0	C			64032910	+1	tier1	-	no_errors	ENST00000279230	ensembl	human	known	74_37	missense	14.29	54	9	SNP	0.268	T
PLLP	51090	genome.wustl.edu	37	16	57295866	57295866	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:57295866G>T	ENST00000219207.5	-	2	398	c.252C>A	c.(250-252)ttC>ttA	p.F84L	PLLP_ENST00000569059.1_Intron	NM_015993.2	NP_057077.1	Q9Y342	PLLP_HUMAN	plasmolipin	84	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				ion transport (GO:0006811)|myelination (GO:0042552)|response to wounding (GO:0009611)	compact myelin (GO:0043218)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)				endometrium(1)|prostate(1)	2						GGTAGAGGTTGAAGAGGACGA	0.567																																																	0													165.0	123.0	137.0					16																	57295866		2198	4300	6498	SO:0001583	missense	0			AF137386	CCDS10777.1	16q13	2010-06-24	2010-06-24	2005-03-21	ENSG00000102934	ENSG00000102934			18553	protein-coding gene	gene with protein product	"""plasma membrane proteolipid"""	600340	"""transmembrane 4 superfamily member 11 (plasmolipin)"", ""plasma membrane proteolipid (plasmolipin)"""	TM4SF11		11707781	Standard	NM_015993		Approved	PMLP	uc002elg.2	Q9Y342	OTTHUMG00000133465	ENST00000219207.5:c.252C>A	16.37:g.57295866G>T	ENSP00000219207:p.Phe84Leu		B2R9T6	Missense_Mutation	SNP	pfam_Marvel,prints_MAL	p.F84L	ENST00000219207.5	37	c.252	CCDS10777.1	16	.	.	.	.	.	.	.	.	.	.	G	6.797	0.516044	0.12944	.	.	ENSG00000102934	ENST00000219207	T	0.16743	2.32	5.62	1.52	0.23074	Marvel (1);MARVEL-like domain (1);	0.047210	0.85682	D	0.000000	T	0.10981	0.0268	L	0.37850	1.14	0.80722	D	1	P	0.43431	0.807	B	0.41946	0.371	T	0.18587	-1.0332	10	0.02654	T	1	-5.0403	9.3092	0.37893	0.4258:0.0:0.5742:0.0	.	84	Q9Y342	PLLP_HUMAN	L	84	ENSP00000219207:F84L	ENSP00000219207:F84L	F	-	3	2	PLLP	55853367	0.958000	0.32768	0.144000	0.22314	0.110000	0.19582	1.488000	0.35551	0.066000	0.16515	0.561000	0.74099	TTC	PLLP	-	pfam_Marvel	ENSG00000102934		0.567	PLLP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLLP	HGNC	protein_coding	OTTHUMT00000257341.2	-	0.00	97	0	G			57295866	-1	tier1	-	no_errors	ENST00000219207	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.549	T
POM121L9P	29774	genome.wustl.edu	37	22	24657714	24657714	+	RNA	SNP	C	C	G	rs80002636		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr22:24657714C>G	ENST00000414583.2	+	0	2131					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		AGCAGCTGCTCATGGGCAGAG	0.637																																																	0																																												0			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24657714C>G				RNA	SNP	-	NULL	ENST00000414583.2	37	NULL		22																																																																																			POM121L9P	-	-	ENSG00000128262		0.637	POM121L9P-001	KNOWN	basic	processed_transcript	POM121L9P	HGNC	pseudogene	OTTHUMT00000319991.1	-	0.00	37	0	C	NM_014549		24657714	+1	tier1	rs80002636	no_errors	ENST00000414583	ensembl	human	known	74_37	rna	14.29	18	3	SNP	0.000	G
POU4F1	5457	genome.wustl.edu	37	13	79176484	79176486	+	In_Frame_Del	DEL	TGG	TGG	-	rs371388366		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	TGG	TGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr13:79176484_79176486delTGG	ENST00000377208.5	-	2	535_537	c.324_326delCCA	c.(322-327)caccag>cag	p.H108del	RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606124.1_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	108	Poly-His.				axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.H108delH(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TTCGAGCGCCtggtggtggtggt	0.729																																					Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)												1	Deletion - In frame(1)	central_nervous_system(1)																																								SO:0001651	inframe_deletion	0			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.324_326delCCA	13.37:g.79176493_79176495delTGG	ENSP00000366413:p.His108del		Q14986|Q15318|Q5T227	In_Frame_Del	DEL	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.H108in_frame_del	ENST00000377208.5	37	c.326_324	CCDS31996.1	13																																																																																			POU4F1	-	NULL	ENSG00000152192		0.729	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F1	HGNC	protein_coding	OTTHUMT00000045360.3		0.00	13	0	TGG			79176486	-1	tier1		no_errors	ENST00000377208	ensembl	human	known	74_37	in_frame_del	21.43	11	3	DEL	1.000:1.000:1.000	-
PRIM1	5557	genome.wustl.edu	37	12	57127970	57127970	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:57127970G>A	ENST00000338193.6	-	12	1240	c.1204C>T	c.(1204-1206)Ctg>Ttg	p.L402L		NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	402					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						GATTTATCCAGATTTTCAAGA	0.323																																																	0													83.0	83.0	83.0					12																	57127970		1810	4067	5877	SO:0001819	synonymous_variant	0			BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.1204C>T	12.37:g.57127970G>A				Silent	SNP	pfam_DNA_primase_S,tigrfam_DNA_primase_ssu_euk/arc	p.L402	ENST00000338193.6	37	c.1204	CCDS44926.1	12																																																																																			PRIM1	-	NULL	ENSG00000198056		0.323	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIM1	HGNC	protein_coding	OTTHUMT00000406956.1	-	0.00	62	0	G	NM_000946		57127970	-1	tier1	-	no_errors	ENST00000338193	ensembl	human	known	74_37	silent	17.39	37	8	SNP	0.989	A
PROSER1	80209	genome.wustl.edu	37	13	39608335	39608336	+	Splice_Site	INS	-	-	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr13:39608335_39608336insA	ENST00000352251.3	-	2	879		c.e2-2		PROSER1_ENST00000350125.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1									p.?(1)									CAAAACAGCCTAAAAAAAAAAA	0.327																																																	1	Unknown(1)	ovary(1)																																								SO:0001630	splice_region_variant	0			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.46-2->T	13.37:g.39608346_39608346dupA			A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Splice_Site	INS	-	e2-2	ENST00000352251.3	37	c.46-3_46-2	CCDS9368.2	13																																																																																			PROSER1	-	-	ENSG00000120685		0.327	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5		0.00	29	0	-	NM_025138	Intron	39608336	-1	tier1		no_errors	ENST00000352251	ensembl	human	known	74_37	splice_site_ins	10.34	26	3	INS	1.000:0.899	A
PROX1	5629	genome.wustl.edu	37	1	214171008	214171008	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:214171008G>A	ENST00000366958.4	+	2	1738	c.1130G>A	c.(1129-1131)cGc>cAc	p.R377H	PROX1_ENST00000435016.1_Missense_Mutation_p.R377H|PROX1_ENST00000498508.2_Missense_Mutation_p.R377H|PROX1_ENST00000261454.4_Missense_Mutation_p.R377H	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	377					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AAGCCCTCCCGCCAGGTTCCT	0.547																																																	0													99.0	99.0	99.0					1																	214171008		2203	4300	6503	SO:0001583	missense	0			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1130G>A	1.37:g.214171008G>A	ENSP00000355925:p.Arg377His		A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	pfam_Homeo_prospero_dom,superfamily_Homeodomain-like	p.R377H	ENST00000366958.4	37	c.1130	CCDS31021.1	1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711771	0.68730	.	.	ENSG00000117707	ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.47177	0.86;0.85;0.86;0.86	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.63212	0.2492	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	P	0.58577	0.841	T	0.60120	-0.7325	10	0.36615	T	0.2	-3.8807	19.3843	0.94550	0.0:0.0:1.0:0.0	.	377	Q92786	PROX1_HUMAN	H	377	ENSP00000420283:R377H;ENSP00000355925:R377H;ENSP00000400694:R377H;ENSP00000261454:R377H	ENSP00000261454:R377H	R	+	2	0	PROX1	212237631	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.912000	0.87465	2.574000	0.86865	0.563000	0.77884	CGC	PROX1	-	pfam_Homeo_prospero_dom	ENSG00000117707		0.547	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROX1	HGNC	protein_coding	OTTHUMT00000089727.6	-	0.00	53	0	G	NM_002763		214171008	+1	tier1	-	no_errors	ENST00000261454	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	A
PSMD9	5715	genome.wustl.edu	37	12	122337551	122337551	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:122337551G>T	ENST00000541212.1	+	3	379	c.253G>T	c.(253-255)Gat>Tat	p.D85Y	PSMD9_ENST00000340175.5_Missense_Mutation_p.D85Y|PSMD9_ENST00000261817.2_Missense_Mutation_p.D85Y|RP11-87C12.2_ENST00000546333.1_Intron|PSMD9_ENST00000542602.1_Intron			O00233	PSMD9_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 9	85					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion (GO:0046676)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome regulatory particle (GO:0005838)	bHLH transcription factor binding (GO:0043425)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(1)|lung(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000117)|Epithelial(86;0.000415)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CCTGCAGAATGATCACAAGGC	0.552																																																	0													36.0	32.0	33.0					12																	122337551		2200	4298	6498	SO:0001583	missense	0			AB003177	CCDS9225.1, CCDS58284.1	12q24.31-q24.32	2008-05-22			ENSG00000110801	ENSG00000110801		"""Proteasome (prosome, macropain) subunits"""	9567	protein-coding gene	gene with protein product		603146				9653651	Standard	NM_002813		Approved	p27, Rpn4	uc001ubl.4	O00233	OTTHUMG00000168945	ENST00000541212.1:c.253G>T	12.37:g.122337551G>T	ENSP00000440485:p.Asp85Tyr		B2RD35|G3V1Q6|Q9BQ42	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ	p.D85Y	ENST00000541212.1	37	c.253	CCDS9225.1	12	.	.	.	.	.	.	.	.	.	.	G	27.4	4.832501	0.91036	.	.	ENSG00000110801	ENST00000541212;ENST00000340175;ENST00000261817;ENST00000538613	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.62539	0.2436	H	0.95151	3.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.73842	-0.3855	10	0.87932	D	0	-30.5929	20.0139	0.97470	0.0:0.0:1.0:0.0	.	85;85	F8W7V8;O00233	.;PSMD9_HUMAN	Y	85	ENSP00000440485:D85Y;ENSP00000340847:D85Y;ENSP00000261817:D85Y;ENSP00000443081:D85Y	ENSP00000261817:D85Y	D	+	1	0	PSMD9	120821934	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.024000	0.93689	2.724000	0.93272	0.563000	0.77884	GAT	PSMD9	-	NULL	ENSG00000110801		0.552	PSMD9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMD9	HGNC	protein_coding	OTTHUMT00000401686.1		0.00	39	0	G	NM_002813		122337551	+1			no_errors	ENST00000541212	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
PTPRD	5789	genome.wustl.edu	37	9	8486299	8486299	+	Missense_Mutation	SNP	G	G	C	rs142009246	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr9:8486299G>C	ENST00000381196.4	-	25	3061	c.2518C>G	c.(2518-2520)Ctt>Gtt	p.L840V	PTPRD_ENST00000360074.4_Missense_Mutation_p.L827V|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000540109.1_Missense_Mutation_p.L840V|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000358503.5_Missense_Mutation_p.L818V|PTPRD_ENST00000356435.5_Missense_Mutation_p.L840V|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000486161.1_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	840	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CACTGAATAAGAGCAGTATTC	0.488										TSP Lung(15;0.13)																																							0													75.0	73.0	74.0					9																	8486299		2203	4300	6503	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2518C>G	9.37:g.8486299G>C	ENSP00000370593:p.Leu840Val		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.L840V	ENST00000381196.4	37	c.2518	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663882	0.47572	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49	5.93	5.93	0.95920	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71728	0.3374	M	0.61703	1.905	0.80722	D	1	B;D;B	0.76494	0.292;0.999;0.195	B;D;B	0.80764	0.101;0.994;0.192	T	0.67681	-0.5608	9	.	.	.	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	827;840;840	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	V	840;840;827;818;840	ENSP00000370593:L840V;ENSP00000348812:L840V;ENSP00000353187:L827V;ENSP00000351293:L818V;ENSP00000438164:L840V	.	L	-	1	0	PTPRD	8476299	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.297000	0.72757	2.826000	0.97356	0.655000	0.94253	CTT	PTPRD	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000153707		0.488	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	58	0	G			8486299	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	11.90	37	5	SNP	1.000	C
PTPRN	5798	genome.wustl.edu	37	2	220173953	220173953	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:220173953G>A	ENST00000295718.2	-	1	342	c.102C>T	c.(100-102)gcC>gcT	p.A34A	PTPRN_ENST00000409251.3_Silent_p.A34A|PTPRN_ENST00000423636.2_5'Flank	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	34					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GGGCACTAACGGCGCTGCAGC	0.736																																																	0													3.0	4.0	4.0					2																	220173953		1931	3897	5828	SO:0001819	synonymous_variant	0				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.102C>T	2.37:g.220173953G>A			B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A34	ENST00000295718.2	37	c.102	CCDS2440.1	2																																																																																			PTPRN	-	NULL	ENSG00000054356		0.736	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRN	HGNC	protein_coding	OTTHUMT00000256819.2	-	0.00	58	0	G			220173953	-1	tier1	-	no_errors	ENST00000295718	ensembl	human	known	74_37	silent	23.73	45	14	SNP	1.000	A
RAB27B	5874	genome.wustl.edu	37	18	52546673	52546673	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr18:52546673C>T	ENST00000262094.5	+	3	748	c.227C>T	c.(226-228)gCg>gTg	p.A76V	RAB27B_ENST00000586594.1_3'UTR|RP11-99A1.2_ENST00000590604.1_lincRNA	NM_004163.4	NP_004154.2	O00194	RB27B_HUMAN	RAB27B, member RAS oncogene family	76					multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|multivesicular body membrane (GO:0032585)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein domain specific binding (GO:0019904)			large_intestine(3)|lung(3)|skin(1)	7				Colorectal(16;0.0273)|READ - Rectum adenocarcinoma(59;0.219)		TGGGACACTGCGGGACAAGAG	0.358																																																	0													178.0	154.0	162.0					18																	52546673		2203	4300	6503	SO:0001583	missense	0			U57093	CCDS11958.1	18q21.2	2006-12-18			ENSG00000041353	ENSG00000041353		"""RAB, member RAS oncogene"""	9767	protein-coding gene	gene with protein product		603869				9066979	Standard	NM_004163		Approved		uc002lfr.3	O00194	OTTHUMG00000132710	ENST00000262094.5:c.227C>T	18.37:g.52546673C>T	ENSP00000262094:p.Ala76Val		B2RAB0|Q9BZB6	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Ras,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A76V	ENST00000262094.5	37	c.227	CCDS11958.1	18	.	.	.	.	.	.	.	.	.	.	C	34	5.359060	0.95854	.	.	ENSG00000041353	ENST00000262094	D	0.88818	-2.43	6.17	6.17	0.99709	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.96288	0.8789	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96419	0.9310	10	0.87932	D	0	-4.7839	19.6509	0.95805	0.0:1.0:0.0:0.0	.	76	O00194	RB27B_HUMAN	V	76	ENSP00000262094:A76V	ENSP00000262094:A76V	A	+	2	0	RAB27B	50697671	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.657000	0.83745	2.941000	0.99782	0.655000	0.94253	GCG	RAB27B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Ras,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000041353		0.358	RAB27B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB27B	HGNC	protein_coding	OTTHUMT00000256008.3	-	0.00	60	0	C	NM_004163		52546673	+1	tier1	-	no_errors	ENST00000262094	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
RAMP2	10266	genome.wustl.edu	37	17	40914461	40914461	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:40914461C>T	ENST00000253796.5	+	3	320	c.252C>T	c.(250-252)tgC>tgT	p.C84C	RAMP2-AS1_ENST00000592670.1_lincRNA|RAMP2_ENST00000589683.1_Silent_p.C9C|RAMP2_ENST00000588576.1_Intron|RAMP2_ENST00000587142.1_Silent_p.C89C	NM_005854.2	NP_005845.2	O60895	RAMP2_HUMAN	receptor (G protein-coupled) activity modifying protein 2	84					adherens junction assembly (GO:0034333)|angiogenesis (GO:0001525)|basement membrane assembly (GO:0070831)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to hormone stimulus (GO:0032870)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|heart development (GO:0007507)|intracellular protein transport (GO:0006886)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of vascular permeability (GO:0043116)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of gene expression (GO:0010628)|positive regulation of vasculogenesis (GO:2001214)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|sprouting angiogenesis (GO:0002040)|tight junction assembly (GO:0070830)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)			endometrium(2)|lung(1)|stomach(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0741)	Pramlintide(DB01278)	AGGATTGGTGCGACTGGGCCA	0.532																																																	0													119.0	110.0	113.0					17																	40914461		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ001015	CCDS11437.1	17q12-q21.1	2012-08-17	2006-11-21		ENSG00000131477	ENSG00000131477		"""Receptor (G protein-coupled) activity modifying proteins"""	9844	protein-coding gene	gene with protein product		605154	"""receptor activity modifying protein 2"", ""receptor (calcitonin) activity modifying protein 2"""				Standard	NM_005854		Approved		uc002ibg.3	O60895		ENST00000253796.5:c.252C>T	17.37:g.40914461C>T			A7L9S6|K7EMD3|Q8N1F2	Silent	SNP	pfam_RAMP	p.C84	ENST00000253796.5	37	c.252	CCDS11437.1	17																																																																																			RAMP2	-	pfam_RAMP	ENSG00000131477		0.532	RAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAMP2	HGNC	protein_coding	OTTHUMT00000452380.1		0.00	54	0	C	NM_005854		40914461	+1			no_errors	ENST00000253796	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.855	T
RAPSN	5913	genome.wustl.edu	37	11	47460234	47460234	+	Intron	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:47460234C>T	ENST00000298854.2	-	7	1380				RAPSN_ENST00000352508.3_Intron|RNU6-1302P_ENST00000516518.1_RNA|RAPSN_ENST00000528356.1_Intron|RAPSN_ENST00000529341.1_Silent_p.G346G|RAPSN_ENST00000524487.1_Intron	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse						positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						CCCTAGAGTGCCCCGAAGAGA	0.582																																																	0													9.0	9.0	9.0					11																	47460234		2110	4075	6185	SO:0001627	intron_variant	0				CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.1166+48G>A	11.37:g.47460234C>T			Q8TDF3|Q9BTD9	Silent	SNP	pfam_Rapsyn_myristoylation/link_N,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Postsynaptic	p.G346	ENST00000298854.2	37	c.1038	CCDS7936.1	11																																																																																			RAPSN	-	NULL	ENSG00000165917		0.582	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPSN	HGNC	protein_coding	OTTHUMT00000391726.1	-	0.00	131	0	C			47460234	-1	tier1	-	no_errors	ENST00000529341	ensembl	human	novel	74_37	silent	13.60	108	17	SNP	0.043	T
RCN3	57333	genome.wustl.edu	37	19	50046369	50046369	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:50046369C>T	ENST00000270645.3	+	7	1333	c.886C>T	c.(886-888)Cgg>Tgg	p.R296W		NM_020650.2	NP_065701.2	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	296	EF-hand 6. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		CCAGGATGGGCGGCTGAGCAA	0.597																																																	0													65.0	53.0	57.0					19																	50046369		2203	4300	6503	SO:0001583	missense	0			AY195859	CCDS12771.1	19q13.33	2013-01-10				ENSG00000142552		"""EF-hand domain containing"""	21145	protein-coding gene	gene with protein product							Standard	NM_020650		Approved	RLP49	uc002poj.3	Q96D15		ENST00000270645.3:c.886C>T	19.37:g.50046369C>T	ENSP00000270645:p.Arg296Trp		Q9HBZ8	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.R296W	ENST00000270645.3	37	c.886	CCDS12771.1	19	.	.	.	.	.	.	.	.	.	.	C	13.00	2.107724	0.37242	.	.	ENSG00000142552	ENST00000270645	T	0.79454	-1.27	4.52	3.47	0.39725	EF-hand-like domain (1);	0.073344	0.53938	D	0.000057	T	0.82181	0.4981	M	0.66939	2.045	0.09310	N	1	D	0.69078	0.997	P	0.60473	0.875	T	0.72603	-0.4243	10	0.66056	D	0.02	-17.5681	7.3801	0.26851	0.3379:0.498:0.1641:0.0	.	296	Q96D15	RCN3_HUMAN	W	296	ENSP00000270645:R296W	ENSP00000270645:R296W	R	+	1	2	RCN3	54738181	0.305000	0.24481	0.376000	0.26042	0.253000	0.25986	2.510000	0.45468	1.106000	0.41623	0.555000	0.69702	CGG	RCN3	-	smart_EF_hand_dom	ENSG00000142552		0.597	RCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCN3	HGNC	protein_coding	OTTHUMT00000465261.1	-	0.00	84	0	C	NM_020650		50046369	+1	tier1	-	no_errors	ENST00000270645	ensembl	human	known	74_37	missense	30.91	38	17	SNP	0.006	T
RIMKLB	57494	genome.wustl.edu	37	12	8926293	8926293	+	Silent	SNP	G	G	T	rs201727444		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr12:8926293G>T	ENST00000538135.1	+	6	1899	c.1074G>T	c.(1072-1074)acG>acT	p.T358T	RIMKLB_ENST00000535829.1_Silent_p.T358T|RIMKLB_ENST00000299673.5_Intron|A2ML1-AS1_ENST00000537288.1_RNA|RIMKLB_ENST00000357529.3_Silent_p.T358T			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	358					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CTGAAAGCACGGAGCGAGAGC	0.557																																																	0													97.0	96.0	96.0					12																	8926293		1928	4136	6064	SO:0001819	synonymous_variant	0			AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.1074G>T	12.37:g.8926293G>T			B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Silent	SNP	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	p.T358	ENST00000538135.1	37	c.1074	CCDS41748.1	12																																																																																			RIMKLB	-	NULL	ENSG00000166532		0.557	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMKLB	HGNC	protein_coding	OTTHUMT00000398874.1	-	0.00	32	0	G	NM_020734		8926293	+1	tier1	-	no_errors	ENST00000357529	ensembl	human	known	74_37	silent	11.90	37	5	SNP	0.669	T
ROBO1	6091	genome.wustl.edu	37	3	78676529	78676529	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:78676529G>A	ENST00000464233.1	-	26	3930	c.3817C>T	c.(3817-3819)Ccc>Tcc	p.P1273S	ROBO1_ENST00000495273.1_Missense_Mutation_p.P1228S|ROBO1_ENST00000436010.2_Missense_Mutation_p.P1234S|ROBO1_ENST00000467549.1_Missense_Mutation_p.P1173S	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1273					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGTAACATGGGCTGGAGTTCT	0.542																																																	0													52.0	60.0	58.0					3																	78676529		2164	4270	6434	SO:0001583	missense	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3817C>T	3.37:g.78676529G>A	ENSP00000420321:p.Pro1273Ser		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P1273S	ENST00000464233.1	37	c.3817	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371548	0.82573	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.62105	0.21;0.19;0.19;0.05	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.71426	0.3338	L	0.32530	0.975	0.80722	D	1	D;P;D;P;P	0.89917	1.0;0.604;0.999;0.495;0.928	D;B;D;B;P	0.87578	0.998;0.209;0.942;0.095;0.652	T	0.68394	-0.5420	9	.	.	.	.	19.2858	0.94069	0.0:0.0:1.0:0.0	.	1237;1273;1228;1173;1234	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	S	1234;1228;1273;1228;1173;1277	ENSP00000406043:P1234S;ENSP00000420321:P1273S;ENSP00000420637:P1228S;ENSP00000417992:P1173S	.	P	-	1	0	ROBO1	78759219	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	9.809000	0.99208	2.630000	0.89119	0.561000	0.74099	CCC	ROBO1	-	NULL	ENSG00000169855		0.542	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	-	0.00	46	0	G	NM_002941		78676529	-1	tier1	-	no_errors	ENST00000464233	ensembl	human	known	74_37	missense	12.50	42	6	SNP	1.000	A
RPS2	6187	genome.wustl.edu	37	16	2014594	2014594	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:2014594G>T	ENST00000343262.4	-	2	89	c.33C>A	c.(31-33)ccC>ccA	p.P11P	RNF151_ENST00000569714.1_5'Flank|SNHG9_ENST00000459373.1_lincRNA|SNORA10_ENST00000384084.1_RNA|RPS2_ENST00000529806.1_Silent_p.P11P|RPS2_ENST00000526522.1_Silent_p.P11P|RPS2_ENST00000530225.1_Silent_p.P11P|SNORA64_ENST00000384674.1_RNA|RNF151_ENST00000569210.2_5'Flank|RNF151_ENST00000321392.3_5'Flank	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	11					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CAGGGCCCCCGGGCCCCCCCG	0.721																																																	0													8.0	10.0	10.0					16																	2014594		1456	3293	4749	SO:0001819	synonymous_variant	0			AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.33C>A	16.37:g.2014594G>T			B2R5G0|D3DU82|Q3MIB1	Silent	SNP	pfam_Ribosomal_S5_N,pfam_Ribosomal_S5_C,superfamily_Ribosomal_S5_D2-typ_fold,pfscan_Ribosomal_S5_N,tigrfam_Ribosomal_S5_euk/arc	p.P11	ENST00000343262.4	37	c.33	CCDS10452.1	16																																																																																			RPS2	-	NULL	ENSG00000140988		0.721	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS2	HGNC	protein_coding	OTTHUMT00000250613.2	-	0.00	35	0	G	NM_002952		2014594	-1	tier1	-	no_errors	ENST00000343262	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.951	T
RPTOR	57521	genome.wustl.edu	37	17	78704398	78704398	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:78704398G>T	ENST00000306801.3	+	5	908	c.546G>T	c.(544-546)ctG>ctT	p.L182L	RPTOR_ENST00000570891.1_Silent_p.L182L|RPTOR_ENST00000544334.2_Silent_p.L182L|RPTOR_ENST00000537330.1_5'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	182					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.L182L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						TATATGACCTGCAGACGTGGA	0.532																																																	1	Substitution - coding silent(1)	urinary_tract(1)											150.0	105.0	120.0					17																	78704398		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.546G>T	17.37:g.78704398G>T			B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.L182	ENST00000306801.3	37	c.546	CCDS11773.1	17																																																																																			RPTOR	-	prints_Raptor	ENSG00000141564		0.532	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1		0.00	53	0	G	NM_020761		78704398	+1			no_errors	ENST00000306801	ensembl	human	known	74_37	silent	7.89	35	3	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237801690	237801690	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:237801690A>C	ENST00000366574.2	+	45	7143	c.6826A>C	c.(6826-6828)Agt>Cgt	p.S2276R	RYR2_ENST00000542537.1_Missense_Mutation_p.S2260R|RYR2_ENST00000360064.6_Missense_Mutation_p.S2274R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2276	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGACTGCAAAGTTGCCAGAT	0.418																																																	0													259.0	252.0	254.0					1																	237801690		1920	4135	6055	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6826A>C	1.37:g.237801690A>C	ENSP00000355533:p.Ser2276Arg		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.S2274R	ENST00000366574.2	37	c.6820	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.640740	0.87859	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95690	-3.78;-3.78;-3.78	5.31	5.31	0.75309	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.97161	0.9072	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97802	1.0245	10	0.72032	D	0.01	-11.7159	15.5642	0.76277	1.0:0.0:0.0:0.0	.	2276	Q92736	RYR2_HUMAN	R	2276;2274;2260	ENSP00000355533:S2276R;ENSP00000353174:S2274R;ENSP00000443798:S2260R	ENSP00000353174:S2274R	S	+	1	0	RYR2	235868313	1.000000	0.71417	0.621000	0.29145	0.780000	0.44128	9.287000	0.95975	2.123000	0.65237	0.459000	0.35465	AGT	RYR2	-	pfam_Ca-rel_channel	ENSG00000198626		0.418	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	85	0	A	NM_001035		237801690	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	22.50	62	18	SNP	1.000	C
ZBED9	114821	genome.wustl.edu	37	6	28542713	28542713	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr6:28542713T>G	ENST00000452236.2	-	3	2386	c.1769A>C	c.(1768-1770)gAa>gCa	p.E590A	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						AGGGCTTTTTTCAGCCACCTT	0.363																																																	0													52.0	51.0	51.0					6																	28542713		2203	4300	6503	SO:0001583	missense	0																														ENST00000452236.2:c.1769A>C	6.37:g.28542713T>G	ENSP00000395259:p.Glu590Ala			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.E590A	ENST00000452236.2	37	c.1769	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	T	0.250	-1.007522	0.02112	.	.	ENSG00000232040	ENST00000452236	T	0.01584	4.75	3.41	-4.5	0.03493	.	.	.	.	.	T	0.00271	0.0008	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44360	-0.9333	9	0.35671	T	0.21	.	0.989	0.01452	0.17:0.3316:0.1742:0.3242	.	590	Q6R2W3	SCND3_HUMAN	A	590	ENSP00000395259:E590A	ENSP00000395259:E590A	E	-	2	0	SCAND3	28650692	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.580000	0.02121	-1.070000	0.03149	-0.371000	0.07208	GAA	SCAND3	-	NULL	ENSG00000232040		0.363	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3	-	0.00	45	0	T			28542713	-1	tier1	-	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	32.39	48	23	SNP	0.000	G
SCN3A	6328	genome.wustl.edu	37	2	166019203	166019203	+	Missense_Mutation	SNP	C	C	A	rs370566356		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:166019203C>A	ENST00000360093.3	-	8	1321	c.830G>T	c.(829-831)tGt>tTt	p.C277F	SCN3A_ENST00000283254.7_Missense_Mutation_p.C277F|SCN3A_ENST00000409101.3_Missense_Mutation_p.C277F	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	277					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCACTGCAAACATTTATTCCT	0.433																																																	0													111.0	107.0	109.0					2																	166019203		2203	4300	6503	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.830G>T	2.37:g.166019203C>A	ENSP00000353206:p.Cys277Phe		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.C277F	ENST00000360093.3	37	c.830		2	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105281	0.56291	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14	5.82	5.82	0.92795	Ion transport (1);	0.196957	0.37261	N	0.002175	D	0.99648	0.9870	H	0.99732	4.735	0.80722	D	1	D;P;P;P;D	0.76494	0.997;0.811;0.766;0.875;0.999	D;P;P;P;D	0.83275	0.996;0.786;0.73;0.877;0.996	D	0.97301	0.9931	10	0.87932	D	0	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	277;277;277;277;277	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	F	277	ENSP00000353206:C277F;ENSP00000283254:C277F;ENSP00000386726:C277F;ENSP00000403348:C277F	ENSP00000283254:C277F	C	-	2	0	SCN3A	165727449	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.818000	0.86416	2.752000	0.94435	0.655000	0.94253	TGT	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.433	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	78	0	C	NM_006922		166019203	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	28.81	42	17	SNP	1.000	A
SDPR	8436	genome.wustl.edu	37	2	192711216	192711216	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:192711216G>T	ENST00000304141.4	-	1	765	c.436C>A	c.(436-438)Cac>Aac	p.H146N	AC098617.1_ENST00000424116.2_RNA	NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			AGCTGGGCGTGGTTGTTCTCC	0.587																																																	0													53.0	44.0	47.0					2																	192711216		2203	4300	6503	SO:0001583	missense	0			AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.436C>A	2.37:g.192711216G>T	ENSP00000305675:p.His146Asn			Missense_Mutation	SNP	NULL	p.H146N	ENST00000304141.4	37	c.436	CCDS2313.1	2	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634327	0.87660	.	.	ENSG00000168497	ENST00000304141	T	0.60171	0.21	4.62	4.62	0.57501	.	0.057961	0.64402	D	0.000002	T	0.76421	0.3985	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79631	-0.1723	10	0.72032	D	0.01	-30.4964	18.0107	0.89222	0.0:0.0:1.0:0.0	.	146	O95810	SDPR_HUMAN	N	146	ENSP00000305675:H146N	ENSP00000305675:H146N	H	-	1	0	SDPR	192419461	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.635000	0.61332	2.564000	0.86499	0.484000	0.47621	CAC	SDPR	-	NULL	ENSG00000168497		0.587	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDPR	HGNC	protein_coding	OTTHUMT00000334791.2	-	0.00	32	0	G	NM_004657		192711216	-1	tier1	-	no_errors	ENST00000304141	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
SERPINB10	5273	genome.wustl.edu	37	18	61585277	61585277	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr18:61585277G>A	ENST00000238508.3	+	4	372	c.313G>A	c.(313-315)Gac>Aac	p.D105N		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	105					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				GCCCAACGATGACTACTTACT	0.353																																																	0													96.0	89.0	92.0					18																	61585277		2203	4300	6503	SO:0001583	missense	0			U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.313G>A	18.37:g.61585277G>A	ENSP00000238508:p.Asp105Asn		Q4VAX4|Q4VAX7	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.D105N	ENST00000238508.3	37	c.313	CCDS11990.1	18	.	.	.	.	.	.	.	.	.	.	G	5.384	0.256054	0.10185	.	.	ENSG00000242550	ENST00000238508	D	0.82893	-1.66	5.83	-0.938	0.10412	Serpin domain (3);	0.684781	0.15411	N	0.263742	T	0.55097	0.1899	N	0.02842	-0.48	0.09310	N	1	B	0.27791	0.189	B	0.25614	0.062	T	0.49031	-0.8981	10	0.23302	T	0.38	.	4.9649	0.14085	0.2832:0.0:0.2893:0.4275	.	105	P48595	SPB10_HUMAN	N	105	ENSP00000238508:D105N	ENSP00000238508:D105N	D	+	1	0	SERPINB10	59736257	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.187000	0.09656	-0.057000	0.13199	-0.150000	0.13652	GAC	SERPINB10	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000242550		0.353	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB10	HGNC	protein_coding	OTTHUMT00000134012.3	-	0.00	74	0	G	NM_005024		61585277	+1	tier1	-	no_errors	ENST00000238508	ensembl	human	known	74_37	missense	14.29	66	11	SNP	0.000	A
SFMBT1	51460	genome.wustl.edu	37	3	52977502	52977502	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:52977502C>T	ENST00000394752.3	-	4	613	c.231G>A	c.(229-231)gaG>gaA	p.E77E	SFMBT1_ENST00000394750.1_Silent_p.E77E|SFMBT1_ENST00000296295.6_Silent_p.E77E|SFMBT1_ENST00000358080.2_Silent_p.E77E	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	77					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		GGAGCAACTGCTCACAGGTAG	0.527																																																	0													115.0	89.0	98.0					3																	52977502		2203	4300	6503	SO:0001819	synonymous_variant	0			AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.231G>A	3.37:g.52977502C>T			Q402F7|Q96C73|Q9Y4Q9	Silent	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.E77	ENST00000394752.3	37	c.231	CCDS2867.1	3																																																																																			SFMBT1	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000163935		0.527	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT1	HGNC	protein_coding	OTTHUMT00000353040.3	-	0.00	48	0	C	NM_016329		52977502	-1	tier1	-	no_errors	ENST00000358080	ensembl	human	known	74_37	silent	22.81	44	13	SNP	1.000	T
SIN3A	25942	genome.wustl.edu	37	15	75692464	75692464	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr15:75692464A>C	ENST00000394947.3	-	12	2085	c.1771T>G	c.(1771-1773)Tgg>Ggg	p.W591G	SIN3A_ENST00000360439.4_Missense_Mutation_p.W591G|SIN3A_ENST00000394949.4_Missense_Mutation_p.W591G	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						TCCTCAGACCACGAAGGGAAG	0.398																																																	0													97.0	92.0	93.0					15																	75692464		2197	4294	6491	SO:0001583	missense	0			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.1771T>G	15.37:g.75692464A>C	ENSP00000378402:p.Trp591Gly			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.W591G	ENST00000394947.3	37	c.1771	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	A	26.3	4.725030	0.89298	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.49432	0.78;0.78;0.78	6.08	6.08	0.98989	Histone deacetylase interacting (2);	0.000000	0.85682	D	0.000000	T	0.61073	0.2318	L	0.46947	1.48	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.54669	-0.8259	10	0.20046	T	0.44	-9.6549	15.8323	0.78764	1.0:0.0:0.0:0.0	.	591	Q96ST3	SIN3A_HUMAN	G	591	ENSP00000378402:W591G;ENSP00000378403:W591G;ENSP00000353622:W591G	ENSP00000353622:W591G	W	-	1	0	SIN3A	73479517	1.000000	0.71417	0.951000	0.38953	0.995000	0.86356	9.338000	0.96553	2.333000	0.79357	0.482000	0.46254	TGG	SIN3A	-	pfam_HDAC_interact,smart_HDAC_interact	ENSG00000169375		0.398	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	HGNC	protein_coding	OTTHUMT00000286469.1		0.00	58	0	A	NM_015477		75692464	-1			no_errors	ENST00000360439	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	C
SKIDA1	387640	genome.wustl.edu	37	10	21805228	21805228	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:21805228G>T	ENST00000449193.2	-	4	3776	c.1524C>A	c.(1522-1524)ctC>ctA	p.L508L	SKIDA1_ENST00000444772.3_Silent_p.L429L	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	427						nucleus (GO:0005634)											CACTACTCTTGAGGTCGGGAA	0.637																																																	0													39.0	43.0	42.0					10																	21805228		1938	4152	6090	SO:0001819	synonymous_variant	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1524C>A	10.37:g.21805228G>T			B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.L508	ENST00000449193.2	37	c.1524	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.637	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2		0.00	79	0	G	NM_207371		21805228	-1			no_errors	ENST00000449193	ensembl	human	known	74_37	silent	5.41	70	4	SNP	1.000	T
SLC22A11	55867	genome.wustl.edu	37	11	64329843	64329843	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr11:64329843C>T	ENST00000301891.4	+	4	1131	c.757C>T	c.(757-759)Cgg>Tgg	p.R253W	SLC22A11_ENST00000377585.3_Missense_Mutation_p.R253W|SLC22A11_ENST00000490834.1_3'UTR|SLC22A11_ENST00000377581.3_Missense_Mutation_p.R253W	NM_018484.2	NP_060954.1	Q9NSA0	S22AB_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 11	253					organic anion transport (GO:0015711)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23					Aminohippurate(DB00345)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Estradiol(DB00783)|Furosemide(DB00695)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Novobiocin(DB01051)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Salicylic acid(DB00936)|Tetracycline(DB00759)|Zidovudine(DB00495)	CTTTGCCCTGCGGGACTGGAG	0.632																																																	0													74.0	80.0	78.0					11																	64329843		2201	4297	6498	SO:0001583	missense	0			AB026116	CCDS8074.1	11q13.3	2013-05-22	2008-01-11		ENSG00000168065	ENSG00000168065		"""Solute carriers"""	18120	protein-coding gene	gene with protein product		607097				10660625, 15576633, 17229912	Standard	NM_018484		Approved	OAT4	uc001oai.3	Q9NSA0	OTTHUMG00000045142	ENST00000301891.4:c.757C>T	11.37:g.64329843C>T	ENSP00000301891:p.Arg253Trp		A8K426|Q53GR2|Q6ZP72|Q8NBU4	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R253W	ENST00000301891.4	37	c.757	CCDS8074.1	11	.	.	.	.	.	.	.	.	.	.	.	15.75	2.926597	0.52759	.	.	ENSG00000168065	ENST00000301891;ENST00000377585;ENST00000377581	T;T;T	0.57436	0.4;0.4;0.4	3.58	1.64	0.23874	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	U	0.000001	T	0.72763	0.3501	M	0.94021	3.485	0.29678	N	0.841925	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	T	0.66999	-0.5781	10	0.87932	D	0	.	3.5031	0.07680	0.1954:0.5802:0.0:0.2244	.	253;47;253;253	Q9NSA0-2;Q8NBZ3;A6NCG2;Q9NSA0	.;.;.;S22AB_HUMAN	W	253	ENSP00000301891:R253W;ENSP00000366809:R253W;ENSP00000366804:R253W	ENSP00000301891:R253W	R	+	1	2	SLC22A11	64086419	0.917000	0.31117	0.999000	0.59377	0.734000	0.41952	0.425000	0.21346	0.210000	0.20664	0.555000	0.69702	CGG	SLC22A11	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000168065		0.632	SLC22A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A11	HGNC	protein_coding	OTTHUMT00000104886.4	-	0.00	30	0	C	NM_018484		64329843	+1	tier1	-	no_errors	ENST00000301891	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.998	T
SLC25A18	83733	genome.wustl.edu	37	22	18072879	18072879	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr22:18072879G>A	ENST00000327451.6	+	11	1363	c.825G>A	c.(823-825)gaG>gaA	p.E275E	AC004019.13_ENST00000443935.1_RNA|SLC25A18_ENST00000399813.1_Silent_p.E275E	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	275						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		GGATTCAGGAGGGACCATCTG	0.552																																					Colon(118;1560 1625 18964 29606 50093)												0													85.0	81.0	82.0					22																	18072879		2203	4300	6503	SO:0001819	synonymous_variant	0			AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.825G>A	22.37:g.18072879G>A				Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.E275	ENST00000327451.6	37	c.825	CCDS13744.1	22																																																																																			SLC25A18	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000182902		0.552	SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A18	HGNC	protein_coding	OTTHUMT00000316214.3	-	0.00	58	0	G	NM_031481		18072879	+1	tier1	-	no_errors	ENST00000327451	ensembl	human	known	74_37	silent	26.67	22	8	SNP	1.000	A
SLC3A1	6519	genome.wustl.edu	37	2	44547468	44547468	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:44547468C>T	ENST00000260649.6	+	10	1824	c.1748C>T	c.(1747-1749)aCa>aTa	p.T583I	PREPL_ENST00000409411.1_3'UTR|SLC3A1_ENST00000409380.1_Missense_Mutation_p.T305I|SLC3A1_ENST00000409740.3_Missense_Mutation_p.T214I|PREPL_ENST00000409957.1_3'UTR|PREPL_ENST00000541738.1_3'UTR|PREPL_ENST00000409936.1_3'UTR	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	583					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	GTTGTGTACACAAGAGAGCTG	0.413																																																	0													131.0	113.0	119.0					2																	44547468		2203	4300	6503	SO:0001583	missense	0				CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.1748C>T	2.37:g.44547468C>T	ENSP00000260649:p.Thr583Ile		A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	p.T583I	ENST00000260649.6	37	c.1748	CCDS1819.1	2	.	.	.	.	.	.	.	.	.	.	C	14.50	2.553945	0.45487	.	.	ENSG00000138079	ENST00000260649;ENST00000540334;ENST00000409380;ENST00000409740	D;D;D	0.96232	-3.95;-3.95;-3.95	5.99	4.09	0.47781	.	0.508271	0.22398	N	0.060589	D	0.91019	0.7175	L	0.33485	1.01	0.80722	D	1	B	0.15473	0.013	B	0.10450	0.005	D	0.85316	0.1081	10	0.33141	T	0.24	-5.0688	3.9034	0.09172	0.0:0.5415:0.1851:0.2734	.	583	Q07837	SLC31_HUMAN	I	583;519;305;214	ENSP00000260649:T583I;ENSP00000386709:T305I;ENSP00000386677:T214I	ENSP00000260649:T583I	T	+	2	0	SLC3A1	44400972	0.989000	0.36119	0.989000	0.46669	0.994000	0.84299	2.890000	0.48609	1.529000	0.49120	0.655000	0.94253	ACA	SLC3A1	-	NULL	ENSG00000138079		0.413	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC3A1	HGNC	protein_coding	OTTHUMT00000250676.1	-	0.00	65	0	C	NM_000341		44547468	+1	tier1	-	no_errors	ENST00000260649	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.971	T
SLITRK4	139065	genome.wustl.edu	37	X	142716871	142716871	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrX:142716871G>T	ENST00000381779.4	-	2	2279	c.2054C>A	c.(2053-2055)gCt>gAt	p.A685D	SLITRK4_ENST00000356928.1_Missense_Mutation_p.A685D|SLITRK4_ENST00000338017.4_Missense_Mutation_p.A685D	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	685						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TGGAATGAAAGCTTCTGTGCT	0.463																																																	0													120.0	120.0	120.0					X																	142716871		2203	4300	6503	SO:0001583	missense	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2054C>A	X.37:g.142716871G>T	ENSP00000371198:p.Ala685Asp		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.A685D	ENST00000381779.4	37	c.2054	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335391	0.24253	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.50813	0.73;0.73;0.73	5.36	5.36	0.76844	.	0.149918	0.44688	U	0.000439	T	0.24509	0.0594	N	0.02539	-0.55	0.52501	D	0.999952	B	0.02656	0.0	B	0.06405	0.002	T	0.11203	-1.0597	10	0.18276	T	0.48	-5.633	16.5642	0.84574	0.0:0.0:1.0:0.0	.	685	Q8IW52	SLIK4_HUMAN	D	685	ENSP00000371198:A685D;ENSP00000349400:A685D;ENSP00000336627:A685D	ENSP00000336627:A685D	A	-	2	0	SLITRK4	142544537	1.000000	0.71417	0.985000	0.45067	0.997000	0.91878	6.379000	0.73154	2.224000	0.72417	0.513000	0.50165	GCT	SLITRK4	-	NULL	ENSG00000179542		0.463	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	-	0.00	25	0	G	NM_173078		142716871	-1	tier1	-	no_errors	ENST00000338017	ensembl	human	known	74_37	missense	32.43	25	12	SNP	0.999	T
SLITRK2	84631	genome.wustl.edu	37	X	144905900	144905900	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrX:144905900G>A	ENST00000370490.1	+	1	6212	c.1957G>A	c.(1957-1959)Gtt>Att	p.V653I	SLITRK2_ENST00000428560.2_Missense_Mutation_p.V653I|SLITRK2_ENST00000447897.2_Missense_Mutation_p.V653I|SLITRK2_ENST00000434188.2_Missense_Mutation_p.V653I|SLITRK2_ENST00000413937.2_Missense_Mutation_p.V653I			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	653					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					AGTGCCGAGCGTTCCCAGGAA	0.433																																																	0													100.0	87.0	91.0					X																	144905900		2203	4300	6503	SO:0001583	missense	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1957G>A	X.37:g.144905900G>A	ENSP00000359521:p.Val653Ile		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.V653I	ENST00000370490.1	37	c.1957	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	G	13.53	2.263820	0.39995	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.51071	0.76;0.72;0.72;0.72;0.72;0.72	5.91	5.91	0.95273	.	0.205916	0.40222	N	0.001158	T	0.38639	0.1048	N	0.25647	0.755	0.35724	D	0.817387	B	0.02656	0.0	B	0.04013	0.001	T	0.40346	-0.9568	10	0.51188	T	0.08	-1.5871	16.462	0.84059	0.0:0.0:1.0:0.0	.	653	Q9H156	SLIK2_HUMAN	I	653	ENSP00000334374:V653I;ENSP00000411681:V653I;ENSP00000359521:V653I;ENSP00000397015:V653I;ENSP00000407347:V653I;ENSP00000412010:V653I	ENSP00000334374:V653I	V	+	1	0	SLITRK2	144713592	1.000000	0.71417	0.983000	0.44433	0.954000	0.61252	3.500000	0.53318	2.493000	0.84123	0.600000	0.82982	GTT	SLITRK2	-	NULL	ENSG00000185985		0.433	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	-	0.00	29	0	G	NM_032539		144905900	+1	tier1	-	no_errors	ENST00000370490	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.774	A
SMR3B	10879	genome.wustl.edu	37	4	71255445	71255445	+	Silent	SNP	T	T	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:71255445T>G	ENST00000304915.3	+	3	269	c.120T>G	c.(118-120)ccT>ccG	p.P40P	SMR3B_ENST00000504825.1_Silent_p.P40P	NM_006685.3	NP_006676.1	P02814	SMR3B_HUMAN	submaxillary gland androgen regulated protein 3B	40	Pro-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				large_intestine(2)|lung(3)|skin(2)	7		all_hematologic(202;0.196)				CTCCTCAACCTTTTGGCCCAG	0.537																																																	0													98.0	97.0	97.0					4																	71255445		2203	4300	6503	SO:0001819	synonymous_variant	0			D29833	CCDS3540.1	4q13.3	2008-02-27	2008-02-27	2005-02-07	ENSG00000171201	ENSG00000171201			17326	protein-coding gene	gene with protein product		611593	"""proline rich 3"", ""submaxillary gland androgen regulated protein 3 homolog B (mouse)"""	PROL3		7982889, 479131	Standard	NM_006685		Approved	P-B, PRL3		P02814	OTTHUMG00000129396	ENST00000304915.3:c.120T>G	4.37:g.71255445T>G			B7ZMG7|Q9UBN0|Q9UCT0	Silent	SNP	NULL	p.P40	ENST00000304915.3	37	c.120	CCDS3540.1	4																																																																																			SMR3B	-	NULL	ENSG00000171201		0.537	SMR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMR3B	HGNC	protein_coding	OTTHUMT00000251552.2	-	0.00	120	0	T	NM_006685		71255445	+1	tier1	-	no_errors	ENST00000304915	ensembl	human	known	74_37	silent	44.25	63	50	SNP	0.020	G
TMEM107	84314	genome.wustl.edu	37	17	8076806	8076806	+	IGR	SNP	G	G	C	rs150885627		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:8076806G>C	ENST00000437139.2	-	0	747				TMEM107_ENST00000449985.2_3'UTR|SNORD118_ENST00000363593.1_RNA	NM_183065.2	NP_898888.1	Q6UX40	TM107_HUMAN	transmembrane protein 107						cilium assembly (GO:0042384)|embryonic digit morphogenesis (GO:0042733)|neural tube patterning (GO:0021532)	integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(1)	6						tgcaagtcctgattacgcaga	0.433																																																	0													104.0	90.0	94.0					17																	8076806		876	1991	2867	SO:0001628	intergenic_variant	0			AF311338	CCDS11132.1, CCDS45607.1	17p13.1	2005-12-19				ENSG00000179029			28128	protein-coding gene	gene with protein product						12477932	Standard	NM_032354		Approved	MGC10744	uc002gkh.4	Q6UX40			17.37:g.8076806G>C			A0PJV7|Q6NSE3|Q6ZRX9|Q96T82	RNA	SNP	-	NULL	ENST00000437139.2	37	NULL	CCDS45607.1	17																																																																																			SNORD118	-	-	ENSG00000200463		0.433	TMEM107-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD118	HGNC	protein_coding	OTTHUMT00000388844.1	-	0.00	39	0	G	NM_032354		8076806	-1	tier1	-	no_errors	ENST00000363593	ensembl	human	known	74_37	rna	38.10	13	8	SNP	0.853	C
SNTA1	6640	genome.wustl.edu	37	20	32005706	32005706	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr20:32005706G>T	ENST00000217381.2	-	3	791	c.520C>A	c.(520-522)Ccg>Acg	p.P174T		NM_003098.2	NP_003089.1	Q13424	SNTA1_HUMAN	syntrophin, alpha 1	174	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|neuromuscular junction development (GO:0007528)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of vasoconstriction by circulating norepinephrine (GO:0003117)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular (GO:0005622)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	ATPase binding (GO:0051117)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)			breast(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(1)	13						TTGAAATACGGTGAGACGTCC	0.542																																																	0													86.0	85.0	85.0					20																	32005706		2203	4300	6503	SO:0001583	missense	0			U40571	CCDS13220.1	20q11.2	2014-09-17	2012-06-15		ENSG00000101400	ENSG00000101400			11167	protein-coding gene	gene with protein product	"""pro-TGF-alpha cytoplasmic domain-interacting protein 1"", ""dystrophin-associated protein A1, 59kDa, acidic component"""	601017	"""syntrophin, alpha 1 (dystrophin-associated protein A1, 59kD, acidic component)"""	SNT1		8576247, 8612778	Standard	NM_003098		Approved	TACIP1, LQT12	uc002wzd.1	Q13424	OTTHUMG00000032259	ENST00000217381.2:c.520C>A	20.37:g.32005706G>T	ENSP00000217381:p.Pro174Thr		A8K7H9|B4DX40|E1P5N1|Q16438	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Pleckstrin_homology,smart_PDZ,pfscan_PDZ,pfscan_Pleckstrin_homology	p.P174T	ENST00000217381.2	37	c.520	CCDS13220.1	20	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216343	0.79352	.	.	ENSG00000101400	ENST00000217381	T	0.59772	0.24	5.71	4.76	0.60689	PDZ/DHR/GLGF (1);Pleckstrin homology domain (2);	0.065382	0.64402	D	0.000008	T	0.66906	0.2837	L	0.57130	1.785	0.53005	D	0.999966	D;P	0.54207	0.965;0.613	P;B	0.54965	0.765;0.248	T	0.70828	-0.4766	10	0.72032	D	0.01	-11.7429	14.4074	0.67090	0.0715:0.0:0.9285:0.0	.	174;174	B4DX40;Q13424	.;SNTA1_HUMAN	T	174	ENSP00000217381:P174T	ENSP00000217381:P174T	P	-	1	0	SNTA1	31469367	1.000000	0.71417	0.992000	0.48379	0.959000	0.62525	3.753000	0.55180	1.421000	0.47157	-0.140000	0.14226	CCG	SNTA1	-	superfamily_PDZ,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000101400		0.542	SNTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTA1	HGNC	protein_coding	OTTHUMT00000078704.2		0.00	39	0	G	NM_003098		32005706	-1			no_errors	ENST00000217381	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
SPHKAP	80309	genome.wustl.edu	37	2	228858303	228858303	+	Silent	SNP	G	G	A	rs528902743		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:228858303G>A	ENST00000392056.3	-	9	4714	c.4668C>T	c.(4666-4668)ggC>ggT	p.G1556G	SPHKAP_ENST00000344657.5_Intron	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1556						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GATCCATAATGCCAAGACTGC	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		20045	0.0		0.0	False		,,,				2504	0.001																0													104.0	79.0	87.0					2																	228858303		1568	3582	5150	SO:0001819	synonymous_variant	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4668C>T	2.37:g.228858303G>A			Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	pfam_AKAP_110_C	p.G1556	ENST00000392056.3	37	c.4668	CCDS46537.1	2																																																																																			SPHKAP	-	NULL	ENSG00000153820		0.438	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	-	0.00	60	0	G	NM_030623		228858303	-1	tier1	-	no_errors	ENST00000392056	ensembl	human	known	74_37	silent	9.62	47	5	SNP	1.000	A
SPOCK1	6695	genome.wustl.edu	37	5	136324305	136324305	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:136324305C>T	ENST00000394945.1	-	8	903	c.734G>A	c.(733-735)tGc>tAc	p.C245Y	SPOCK1_ENST00000282223.7_Missense_Mutation_p.C245Y|SPOCK1_ENST00000509978.1_5'UTR	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	245					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGAGTCCTTGCAGATGGGCAG	0.512																																																	0													103.0	86.0	92.0					5																	136324305		2203	4300	6503	SO:0001583	missense	0			AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.734G>A	5.37:g.136324305C>T	ENSP00000378401:p.Cys245Tyr		B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.C245Y	ENST00000394945.1	37	c.734	CCDS4191.1	5	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965279	0.92855	.	.	ENSG00000152377	ENST00000394945;ENST00000282223	T;T	0.51574	0.7;0.7	6.06	6.06	0.98353	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.75057	0.3798	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77800	-0.2452	10	0.87932	D	0	.	19.6164	0.95636	0.0:1.0:0.0:0.0	.	245	Q08629	TICN1_HUMAN	Y	245	ENSP00000378401:C245Y;ENSP00000282223:C245Y	ENSP00000282223:C245Y	C	-	2	0	SPOCK1	136352204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.871000	0.98454	0.655000	0.94253	TGC	SPOCK1	-	pfam_SPARC/Testican_Ca-bd-dom	ENSG00000152377		0.512	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOCK1	HGNC	protein_coding	OTTHUMT00000251222.1	-	0.00	37	0	C	NM_004598		136324305	-1	tier1	-	no_errors	ENST00000282223	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
SRRM2	23524	genome.wustl.edu	37	16	2816651	2816651	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr16:2816651G>A	ENST00000301740.8	+	11	6671	c.6122G>A	c.(6121-6123)cGt>cAt	p.R2041H		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2041	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCACGCAAACGTTCTCGAAGT	0.597																																																	0													73.0	64.0	67.0					16																	2816651		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6122G>A	16.37:g.2816651G>A	ENSP00000301740:p.Arg2041His		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R2041H	ENST00000301740.8	37	c.6122	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	12.99	2.103458	0.37145	.	.	ENSG00000167978	ENST00000301740;ENST00000544933	T	0.24538	1.85	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000006	T	0.29684	0.0741	N	0.08118	0	0.36688	D	0.879449	D	0.76494	0.999	P	0.62435	0.902	T	0.44283	-0.9338	10	0.59425	D	0.04	-7.6696	16.7947	0.85598	0.0:0.0:1.0:0.0	.	2041	Q9UQ35	SRRM2_HUMAN	H	2041;1293	ENSP00000301740:R2041H	ENSP00000301740:R2041H	R	+	2	0	SRRM2	2756652	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	4.489000	0.60309	2.572000	0.86782	0.650000	0.86243	CGT	SRRM2	-	NULL	ENSG00000167978		0.597	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	-	0.00	27	0	G			2816651	+1	tier1	-	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.993	A
SRRM5	100170229	genome.wustl.edu	37	19	44117575	44117575	+	Silent	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:44117575G>A	ENST00000607544.1	+	3	1624	c.1302G>A	c.(1300-1302)gcG>gcA	p.A434A	SRRM5_ENST00000526798.1_Silent_p.A449A|SRRM5_ENST00000417606.1_Silent_p.A434A|ZNF428_ENST00000300811.3_Intron			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	434	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						CCAACAAGGCGAGAGATTGCA	0.532																																																	0													53.0	65.0	61.0					19																	44117575		692	1591	2283	SO:0001819	synonymous_variant	0			AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1302G>A	19.37:g.44117575G>A			B4DNF0	Silent	SNP	NULL	p.A449	ENST00000607544.1	37	c.1347	CCDS46095.1	19																																																																																			SRRM5	-	NULL	ENSG00000226763		0.532	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	SRRM5	HGNC	protein_coding	OTTHUMT00000384398.2		0.00	82	0	G	NM_001145641		44117575	+1			no_errors	ENST00000526798	ensembl	human	known	74_37	silent	5.77	49	3	SNP	0.000	A
SULT1C3	442038	genome.wustl.edu	37	2	108872060	108872060	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:108872060C>G	ENST00000329106.2	+	4	432	c.432C>G	c.(430-432)tgC>tgG	p.C144W	SULT1C3_ENST00000376700.1_Missense_Mutation_p.C144W	NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	144					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						CCAAGGATTGCCTGGTGTCCT	0.428																																																	0													125.0	121.0	122.0					2																	108872060		2203	4300	6503	SO:0001583	missense	0			BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.432C>G	2.37:g.108872060C>G	ENSP00000333310:p.Cys144Trp		Q6IMI5	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.C144W	ENST00000329106.2	37	c.432	CCDS33267.1	2	.	.	.	.	.	.	.	.	.	.	C	14.17	2.455093	0.43634	.	.	ENSG00000196228	ENST00000329106;ENST00000376700	D;D	0.82344	-1.6;-1.6	3.58	-2.06	0.07298	Sulfotransferase domain (1);	0.308775	0.28376	N	0.015580	D	0.89708	0.6793	M	0.90705	3.14	0.32002	N	0.60322	D	0.69078	0.997	D	0.68353	0.957	D	0.87908	0.2695	10	0.87932	D	0	.	8.9775	0.35944	0.0:0.4068:0.0:0.5932	.	144	Q6IMI6	ST1C3_HUMAN	W	144	ENSP00000333310:C144W;ENSP00000365890:C144W	ENSP00000333310:C144W	C	+	3	2	SULT1C3	108238492	0.000000	0.05858	0.001000	0.08648	0.235000	0.25334	-0.210000	0.09345	-0.660000	0.05352	0.650000	0.86243	TGC	SULT1C3	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000196228		0.428	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULT1C3	HGNC	protein_coding	OTTHUMT00000330255.1	-	0.00	52	0	C	NM_001008743		108872060	+1	tier1	-	no_errors	ENST00000329106	ensembl	human	known	74_37	missense	23.81	48	15	SNP	0.403	G
SUMO1	7341	genome.wustl.edu	37	2	203096349	203096349	+	Intron	DEL	A	A	-			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:203096349delA	ENST00000392246.2	-	1	169				SUMO1_ENST00000392245.1_Intron|SUMO1_ENST00000409368.1_Intron|SUMO1_ENST00000409205.1_Intron|SUMO1_ENST00000409181.1_Intron|SUMO1_ENST00000392244.3_Intron|SUMO1_ENST00000409498.2_Intron|SUMO1_ENST00000409712.1_Intron	NM_003352.4	NP_003343.1	P63165	SUMO1_HUMAN	small ubiquitin-like modifier 1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|DNA repair (GO:0006281)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of DNA binding (GO:0043392)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|PML body organization (GO:0030578)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein complex assembly (GO:0031334)|post-translational protein modification (GO:0043687)|protein localization to nuclear pore (GO:0090204)|protein sumoylation (GO:0016925)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein localization (GO:0032880)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)										actccgtctcaaaaaaaaaaG	0.517																																																	0																																										SO:0001627	intron_variant	0			U38784	CCDS2352.1, CCDS46493.1	2q33	2013-06-05	2013-06-05	2004-05-19	ENSG00000116030	ENSG00000116030			12502	protein-coding gene	gene with protein product		601912	"""ubiquitin-like 1 (sentrin)"", ""SMT3 suppressor of mif two 3 homolog 1 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)"""	UBL1		8812453, 8906799	Standard	NM_003352		Approved	PIC1, GMP1, SMT3C, SUMO-1, SMT3H3, OFC10	uc002uyz.1	P63165	OTTHUMG00000132839	ENST00000392246.2:c.12+6813T>-	2.37:g.203096349delA			A8MUS8|B2R4I5|P55856|Q6FGG0|Q6NZ62|Q93068	Frame_Shift_Del	DEL	NULL	p.L40fs	ENST00000392246.2	37	c.119	CCDS2352.1	2																																																																																			SUMO1	-	NULL	ENSG00000116030		0.517	SUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMO1	HGNC	protein_coding	OTTHUMT00000256312.2		0.00	26	0	A	NM_003352		203096349	-1	tier1		no_errors	ENST00000409627	ensembl	human	known	74_37	frame_shift_del	18.18	9	2	DEL	0.011	-
SYNJ2	8871	genome.wustl.edu	37	6	158505053	158505053	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr6:158505053G>T	ENST00000355585.4	+	22	3130	c.3055G>T	c.(3055-3057)Gaa>Taa	p.E1019*	SYNJ2_ENST00000367121.3_Nonsense_Mutation_p.E1019*|SYNJ2_ENST00000367112.1_Nonsense_Mutation_p.E104*|SYNJ2_ENST00000367122.2_Nonsense_Mutation_p.E1019*	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	1019					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TGAAGACGATGAAGACTACTT	0.527																																																	0													237.0	255.0	249.0					6																	158505053		2203	4300	6503	SO:0001587	stop_gained	0			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.3055G>T	6.37:g.158505053G>T	ENSP00000347792:p.Glu1019*		Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Nonsense_Mutation	SNP	pfam_Syja_N,pfam_DUF1866,pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.E1019*	ENST00000355585.4	37	c.3055	CCDS5254.1	6	.	.	.	.	.	.	.	.	.	.	G	38	7.219427	0.98143	.	.	ENSG00000078269	ENST00000367122;ENST00000367121;ENST00000355585;ENST00000367112	.	.	.	5.08	5.08	0.68730	.	0.105878	0.41605	D	0.000856	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	15.202	0.73147	0.0:0.0:1.0:0.0	.	.	.	.	X	1019;1019;1019;104	.	ENSP00000347792:E1019X	E	+	1	0	SYNJ2	158425041	0.998000	0.40836	0.101000	0.21167	0.214000	0.24535	5.004000	0.63966	1.922000	0.55676	0.482000	0.46254	GAA	SYNJ2	-	NULL	ENSG00000078269		0.527	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2	HGNC	protein_coding	OTTHUMT00000042858.2	-	0.00	69	0	G			158505053	+1	tier1	-	no_errors	ENST00000355585	ensembl	human	known	74_37	nonsense	28.57	45	18	SNP	0.422	T
TECRL	253017	genome.wustl.edu	37	4	65175643	65175643	+	Silent	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:65175643A>C	ENST00000381210.3	-	6	668	c.558T>G	c.(556-558)gcT>gcG	p.A186A	TECRL_ENST00000507440.1_Silent_p.A186A|TECRL_ENST00000513125.1_5'UTR	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	186					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						GACAGAAGCAAGCCAAGCTGG	0.323																																																	0													72.0	77.0	75.0					4																	65175643		2203	4299	6502	SO:0001819	synonymous_variant	0			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.558T>G	4.37:g.65175643A>C				Silent	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.A186	ENST00000381210.3	37	c.558	CCDS33990.1	4																																																																																			TECRL	-	NULL	ENSG00000205678		0.323	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECRL	HGNC	protein_coding	OTTHUMT00000361705.4	-	0.00	56	0	A	NM_001010874		65175643	-1	tier1	-	no_errors	ENST00000381210	ensembl	human	known	74_37	silent	30.77	36	16	SNP	1.000	C
TGIF2LX	90316	genome.wustl.edu	37	X	89177239	89177239	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chrX:89177239A>C	ENST00000561129.2	+	1	285	c.155A>C	c.(154-156)aAg>aCg	p.K52T	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.K52T			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	52					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						CACAAGAAGAAGCGCAAGGGA	0.512																																																	0													27.0	28.0	27.0					X																	89177239		2201	4278	6479	SO:0001583	missense	0			AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.155A>C	X.37:g.89177239A>C	ENSP00000453704:p.Lys52Thr		Q5JRM9|Q8TD48	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.K52T	ENST00000561129.2	37	c.155	CCDS14459.1	X	.	.	.	.	.	.	.	.	.	.	A	11.85	1.763126	0.31228	.	.	ENSG00000153779	ENST00000283891	D	0.86097	-2.07	2.34	-0.415	0.12355	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.533374	0.14108	N	0.340886	D	0.86871	0.6037	M	0.65975	2.015	0.09310	N	1	D	0.76494	0.999	D	0.64144	0.922	T	0.75320	-0.3359	9	.	.	.	0.3189	2.6454	0.04983	0.6158:0.0:0.1539:0.2303	.	52	Q8IUE1	TF2LX_HUMAN	T	52	ENSP00000355119:K52T	.	K	+	2	0	TGIF2LX	89063895	0.565000	0.26610	0.000000	0.03702	0.003000	0.03518	0.929000	0.28844	-0.167000	0.10871	-0.438000	0.05819	AAG	TGIF2LX	-	pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000153779		0.512	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TGIF2LX	HGNC	protein_coding	OTTHUMT00000417911.2	-	0.00	41	0	A	NM_138960		89177239	+1	tier1	-	no_errors	ENST00000283891	ensembl	human	known	74_37	missense	62.96	10	17	SNP	0.001	C
THNSL2	55258	genome.wustl.edu	37	2	88482532	88482532	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:88482532C>T	ENST00000324166.5	+	6	2708	c.1017C>T	c.(1015-1017)gcC>gcT	p.A339A	THNSL2_ENST00000449349.1_Intron|THNSL2_ENST00000377254.3_Silent_p.A339A|THNSL2_ENST00000343544.4_Silent_p.A339A|THNSL2_ENST00000496844.1_3'UTR|THNSL2_ENST00000358591.2_Silent_p.A339A|THNSL2_ENST00000402102.1_Silent_p.A339A	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	339					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						TGACAAGAGCCCTCATGGAGC	0.527																																																	0													83.0	76.0	79.0					2																	88482532		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.1017C>T	2.37:g.88482532C>T			B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Silent	SNP	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	p.A339	ENST00000324166.5	37	c.1017	CCDS2002.2	2																																																																																			THNSL2	-	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	ENSG00000144115		0.527	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	HGNC	protein_coding	OTTHUMT00000252662.1	-	0.00	58	0	C	NM_018271		88482532	+1	tier1	-	no_errors	ENST00000324166	ensembl	human	known	74_37	silent	14.81	46	8	SNP	0.121	T
THAP4	51078	genome.wustl.edu	37	2	242545863	242545863	+	Silent	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr2:242545863C>T	ENST00000407315.1	-	3	1697	c.1266G>A	c.(1264-1266)gtG>gtA	p.V422V	THAP4_ENST00000402545.1_Silent_p.V10V|THAP4_ENST00000402136.1_Silent_p.V10V	NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	422							DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V422V(1)		kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		ACAGTGGCTCCACCACTGGGT	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											30.0	26.0	27.0					2																	242545863		2203	4295	6498	SO:0001819	synonymous_variant	0			AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.1266G>A	2.37:g.242545863C>T			Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Silent	SNP	pfam_DUF1794,pfam_Znf_C2CH,superfamily_Calycin-like,smart_Znf_C2CH,pfscan_Znf_C2CH	p.V422	ENST00000407315.1	37	c.1266	CCDS2551.1	2																																																																																			THAP4	-	pfam_DUF1794,superfamily_Calycin-like	ENSG00000176946		0.587	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP4	HGNC	protein_coding	OTTHUMT00000257267.3		0.00	31	0	C	NM_015963		242545863	-1			no_errors	ENST00000407315	ensembl	human	known	74_37	silent	6.82	41	3	SNP	0.978	T
TMC6	11322	genome.wustl.edu	37	17	76120749	76120749	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:76120749G>T	ENST00000590602.1	-	8	906	c.747C>A	c.(745-747)ttC>ttA	p.F249L	TMC6_ENST00000392467.3_Missense_Mutation_p.F249L|TMC6_ENST00000589553.1_Missense_Mutation_p.F22L|TMC6_ENST00000592076.1_5'Flank|TMC6_ENST00000322933.4_5'UTR|TMC6_ENST00000322914.3_Missense_Mutation_p.F249L|TMC6_ENST00000591436.1_5'Flank|TMC6_ENST00000306591.7_Missense_Mutation_p.F249L			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	249					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TGAGAAAGAGGAAGTAGGAGA	0.672																																																	0													20.0	18.0	19.0					17																	76120749		2177	4245	6422	SO:0001583	missense	0			AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.747C>A	17.37:g.76120749G>T	ENSP00000465261:p.Phe249Leu		O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	pfam_TMC	p.F249L	ENST00000590602.1	37	c.747	CCDS32748.1	17	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535903	0.85812	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000306591	D;D;D	0.83992	-1.79;-1.79;-1.79	3.28	3.28	0.37604	.	0.137634	0.49305	D	0.000154	D	0.91095	0.7197	M	0.91406	3.205	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.994;0.999;0.999;0.995	D	0.91033	0.4865	10	0.72032	D	0.01	-30.4903	7.6768	0.28490	0.1241:0.0:0.8758:0.0	.	86;249;22;249	B4E003;Q7Z403-2;Q7Z403-4;Q7Z403	.;.;.;TMC6_HUMAN	L	249	ENSP00000313408:F249L;ENSP00000376260:F249L;ENSP00000306405:F249L	ENSP00000306405:F249L	F	-	3	2	TMC6	73632344	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.453000	0.60061	1.661000	0.50771	0.462000	0.41574	TTC	TMC6	-	NULL	ENSG00000141524		0.672	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMC6	HGNC	protein_coding	OTTHUMT00000437146.1	-	0.00	47	0	G			76120749	-1	tier1	-	no_errors	ENST00000322914	ensembl	human	known	74_37	missense	40.00	27	18	SNP	1.000	T
TNFAIP8L2	79626	genome.wustl.edu	37	1	151131355	151131355	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:151131355A>T	ENST00000368910.3	+	2	308	c.182A>T	c.(181-183)aAg>aTg	p.K61M		NM_024575.4	NP_078851.2	Q6P589	TP8L2_HUMAN	tumor necrosis factor, alpha-induced protein 8-like 2	61					innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)				lung(1)|skin(2)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CGCGTGATCAAGGACCTGATC	0.592																																																	0													51.0	49.0	50.0					1																	151131355		2203	4300	6503	SO:0001583	missense	0			BC063014	CCDS985.1	1q21.2	2008-02-05			ENSG00000163154	ENSG00000163154			26277	protein-coding gene	gene with protein product		612112					Standard	NM_024575		Approved	FLJ23467	uc001ewx.2	Q6P589	OTTHUMG00000012259	ENST00000368910.3:c.182A>T	1.37:g.151131355A>T	ENSP00000357906:p.Lys61Met		Q6I9Y0|Q9H2H7|Q9H5G2	Missense_Mutation	SNP	pfam_DUF758	p.K61M	ENST00000368910.3	37	c.182	CCDS985.1	1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.682344	0.88542	.	.	ENSG00000163154	ENST00000368910	T	0.49432	0.78	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.66489	0.2794	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.73685	-0.3905	10	0.87932	D	0	-4.1057	14.9096	0.70746	1.0:0.0:0.0:0.0	.	61	Q6P589	TP8L2_HUMAN	M	61	ENSP00000357906:K61M	ENSP00000357906:K61M	K	+	2	0	TNFAIP8L2	149397979	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.339000	0.96797	2.159000	0.67721	0.533000	0.62120	AAG	TNFAIP8L2	-	pfam_DUF758	ENSG00000163154		0.592	TNFAIP8L2-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	TNFAIP8L2	HGNC	protein_coding	OTTHUMT00000034069.2	-	0.00	35	0	A	NM_024575		151131355	+1	tier1	-	no_errors	ENST00000368910	ensembl	human	known	74_37	missense	43.40	30	23	SNP	1.000	T
TOPBP1	11073	genome.wustl.edu	37	3	133329972	133329972	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:133329972T>C	ENST00000260810.5	-	25	4180	c.4049A>G	c.(4048-4050)gAa>gGa	p.E1350G		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1350	BRCT 7. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						ACTTCCCCATTCATAGTCTTC	0.443								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)												0													136.0	126.0	129.0					3																	133329972		1865	4106	5971	SO:0001583	missense	0			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.4049A>G	3.37:g.133329972T>C	ENSP00000260810:p.Glu1350Gly		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.E1350G	ENST00000260810.5	37	c.4049	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	T	24.4	4.531977	0.85812	.	.	ENSG00000163781	ENST00000260810	T	0.60672	0.17	5.39	5.39	0.77823	BRCT (2);	0.000000	0.85682	D	0.000000	T	0.81517	0.4839	M	0.92169	3.28	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86424	0.1756	10	0.87932	D	0	.	15.4073	0.74890	0.0:0.0:0.0:1.0	.	1350	Q92547	TOPB1_HUMAN	G	1350	ENSP00000260810:E1350G	ENSP00000260810:E1350G	E	-	2	0	TOPBP1	134812662	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	6.825000	0.75293	2.043000	0.60533	0.482000	0.46254	GAA	TOPBP1	-	superfamily_BRCT_dom,pfscan_BRCT_dom	ENSG00000163781		0.443	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	-	0.00	44	0	T	NM_007027		133329972	-1	tier1	-	no_errors	ENST00000260810	ensembl	human	known	74_37	missense	11.29	55	7	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	35	0	C	NM_000546		7578406	-1	tier1	rs28934578	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	38.46	16	10	SNP	1.000	T
TPM3	7170	genome.wustl.edu	37	1	154144685	154144685	+	Intron	SNP	T	T	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:154144685T>A	ENST00000368530.2	-	5	759				TPM3_ENST00000323144.7_Intron|TPM3_ENST00000469717.1_5'UTR|TPM3_ENST00000271850.7_Intron|TPM3_ENST00000302206.5_Intron|TPM3_ENST00000341372.3_Intron|TPM3_ENST00000328159.4_Intron|TPM3_ENST00000368531.2_Intron|TPM3_ENST00000368533.3_Intron|TPM3_ENST00000341485.5_Intron|TPM3_ENST00000330188.9_Intron	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					AAAAAAAAAATTCAAAAAATG	0.428			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""																																			Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	0																																										SO:0001627	intron_variant	0			BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.566+698A>T	1.37:g.154144685T>A			D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	RNA	SNP	-	NULL	ENST00000368530.2	37	NULL	CCDS41403.1	1																																																																																			TPM3	-	-	ENSG00000143549		0.428	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM3	HGNC	protein_coding	OTTHUMT00000087271.2	-	0.00	49	0	T	NM_152263		154144685	-1	tier1	-	no_errors	ENST00000469717	ensembl	human	known	74_37	rna	17.54	46	10	SNP	0.000	A
TRIM65	201292	genome.wustl.edu	37	17	73887368	73887369	+	In_Frame_Ins	INS	-	-	GGC	rs368015889		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:73887368_73887369insGGC	ENST00000269383.3	-	6	1110_1111	c.1045_1046insGCC	c.(1045-1047)cag>cGCCag	p.348_349insR		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	348	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGCTGGTCCTGGCGCGACAGA	0.619																																																	0																																										SO:0001652	inframe_insertion	0			BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.1043_1045dupGCC	17.37:g.73887369_73887371dupGGC	ENSP00000269383:p.Arg348_Arg348dup		Q4G0F0|Q6DKJ6|Q9BRP6	In_Frame_Ins	INS	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.349in_frame_insR	ENST00000269383.3	37	c.1046_1045	CCDS11732.1	17																																																																																			TRIM65	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000141569		0.619	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM65	HGNC	protein_coding	OTTHUMT00000255170.2		0.00	73	0	-	NM_173547		73887369	-1	tier1		no_errors	ENST00000269383	ensembl	human	known	74_37	in_frame_ins	10.00	45	5	INS	0.279:0.224	GGC
TRIM9	114088	genome.wustl.edu	37	14	51448791	51448791	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr14:51448791G>A	ENST00000298355.3	-	8	2755	c.1634C>T	c.(1633-1635)gCg>gTg	p.A545V	TRIM9_ENST00000557456.1_5'Flank|TRIM9_ENST00000338969.5_Missense_Mutation_p.A626V	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	545	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A626V(1)|p.A545V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					GTCCGAGTGCGCCGAGCCAGG	0.527																																																	2	Substitution - Missense(2)	large_intestine(2)											72.0	60.0	64.0					14																	51448791		2203	4300	6503	SO:0001583	missense	0			AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1634C>T	14.37:g.51448791G>A	ENSP00000298355:p.Ala545Val		D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.A626V	ENST00000298355.3	37	c.1877	CCDS9703.1	14	.	.	.	.	.	.	.	.	.	.	G	17.79	3.474882	0.63737	.	.	ENSG00000100505	ENST00000298355;ENST00000338969	T;T	0.76448	-1.02;-0.75	6.08	6.08	0.98989	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.044027	0.85682	D	0.000000	D	0.89887	0.6845	M	0.86573	2.825	0.80722	D	1	D;D	0.76494	0.999;0.971	D;P	0.68765	0.96;0.508	D	0.90354	0.4368	10	0.72032	D	0.01	.	19.6603	0.95864	0.0:0.0:1.0:0.0	.	626;545	Q9C026-4;Q9C026	.;TRIM9_HUMAN	V	545;626	ENSP00000298355:A545V;ENSP00000342970:A626V	ENSP00000298355:A545V	A	-	2	0	TRIM9	50518541	1.000000	0.71417	0.097000	0.21041	0.001000	0.01503	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	GCG	TRIM9	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000100505		0.527	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	HGNC	protein_coding	OTTHUMT00000276874.1	-	0.00	47	0	G	NM_015163		51448791	-1	tier1	-	no_errors	ENST00000338969	ensembl	human	known	74_37	missense	17.65	42	9	SNP	0.999	A
TTBK1	84630	genome.wustl.edu	37	6	43214429	43214429	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr6:43214429G>A	ENST00000259750.4	+	2	114	c.31G>A	c.(31-33)Gaa>Aaa	p.E11K	TTBK1_ENST00000304139.5_5'Flank	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	11					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CCTTAAGGACGAAACCAACAT	0.667																																																	0													36.0	33.0	34.0					6																	43214429		2203	4300	6503	SO:0001583	missense	0			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.31G>A	6.37:g.43214429G>A	ENSP00000259750:p.Glu11Lys		A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E11K	ENST00000259750.4	37	c.31	CCDS34455.1	6	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675026	0.88445	.	.	ENSG00000146216	ENST00000259750	T	0.52295	0.67	4.77	3.9	0.45041	.	0.162071	0.40908	D	0.000990	T	0.15392	0.0371	N	0.19112	0.55	0.80722	D	1	P	0.35011	0.48	B	0.24006	0.05	T	0.07558	-1.0766	10	0.59425	D	0.04	.	11.8577	0.52449	0.0869:0.0:0.9131:0.0	.	11	Q5TCY1	TTBK1_HUMAN	K	11	ENSP00000259750:E11K	ENSP00000259750:E11K	E	+	1	0	TTBK1	43322407	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.889000	0.63171	1.000000	0.39049	-0.136000	0.14681	GAA	TTBK1	-	NULL	ENSG00000146216		0.667	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK1	HGNC	protein_coding	OTTHUMT00000040584.3	-	0.00	147	0	G			43214429	+1	tier1	-	no_errors	ENST00000259750	ensembl	human	known	74_37	missense	19.59	78	19	SNP	1.000	A
TULP4	56995	genome.wustl.edu	37	6	158900956	158900956	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr6:158900956G>T	ENST00000367097.3	+	7	2557	c.1200G>T	c.(1198-1200)ctG>ctT	p.L400L	TULP4_ENST00000367094.2_Silent_p.L400L	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	400	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R403fs*91(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AGCTGACTCTGCCCCCCCGCC	0.642																																																	1	Insertion - Frameshift(1)	large_intestine(1)											75.0	72.0	73.0					6																	158900956		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.1200G>T	6.37:g.158900956G>T			Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Silent	SNP	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L400	ENST00000367097.3	37	c.1200	CCDS34561.1	6																																																																																			TULP4	-	pfam_SOCS_C,superfamily_Tumour_necrosis_fac-like_dom,smart_SOCS_C,pfscan_SOCS_C	ENSG00000130338		0.642	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1		0.00	44	0	G	NM_020245		158900956	+1			no_errors	ENST00000367097	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	T
UBE2D1	7321	genome.wustl.edu	37	10	60124623	60124623	+	Silent	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:60124623G>T	ENST00000373910.4	+	5	518	c.291G>T	c.(289-291)ctG>ctT	p.L97L		NM_001204880.1|NM_003338.4	NP_001191809.1|NP_003329.1	P51668	UB2D1_HUMAN	ubiquitin-conjugating enzyme E2D 1	97					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|BMP signaling pathway (GO:0030509)|cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|prostate(1)|skin(2)	10						CACCAGCTCTGACTGTATCAA	0.333																																																	0													149.0	138.0	142.0					10																	60124623		2203	4300	6503	SO:0001819	synonymous_variant	0			BC015997	CCDS7252.1, CCDS73139.1	10q21.1	2011-05-19	2011-05-19		ENSG00000072401	ENSG00000072401		"""Ubiquitin-conjugating enzymes E2"""	12474	protein-coding gene	gene with protein product		602961	"""stimulator of Fe transport"", ""ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)"""	SFT		10072594, 8530467	Standard	NM_003338		Approved	UbcH5A, UBCH5, UBC4/5, E2(17)KB1	uc001jke.2	P51668	OTTHUMG00000018269	ENST00000373910.4:c.291G>T	10.37:g.60124623G>T			A6NLF6|A8K786	Silent	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.L97	ENST00000373910.4	37	c.291	CCDS7252.1	10																																																																																			UBE2D1	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000072401		0.333	UBE2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2D1	HGNC	protein_coding	OTTHUMT00000048143.2	-	0.00	65	0	G	NM_003338		60124623	+1	tier1	-	no_errors	ENST00000373910	ensembl	human	known	74_37	silent	5.88	80	5	SNP	1.000	T
ULK4	54986	genome.wustl.edu	37	3	41795927	41795927	+	Silent	SNP	T	T	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr3:41795927T>C	ENST00000301831.4	-	22	2709	c.2247A>G	c.(2245-2247)agA>agG	p.R749R		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	749					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AGGCTTTTGCTCTAATGCATG	0.363																																																	0													97.0	94.0	95.0					3																	41795927		1830	4088	5918	SO:0001819	synonymous_variant	0			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2247A>G	3.37:g.41795927T>C			A6NF15|Q8IW79|Q9NWV6|Q9UF96	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R749	ENST00000301831.4	37	c.2247	CCDS43071.1	3																																																																																			ULK4	-	superfamily_ARM-type_fold	ENSG00000168038		0.363	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	-	0.00	61	0	T	XM_929989		41795927	-1	tier1	-	no_errors	ENST00000301831	ensembl	human	known	74_37	silent	24.39	31	10	SNP	1.000	C
VIPR2	7434	genome.wustl.edu	37	7	158910034	158910034	+	Intron	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr7:158910034G>T	ENST00000262178.2	-	3	337				VIPR2_ENST00000421760.2_Missense_Mutation_p.T72N|VIPR2_ENST00000402066.1_Intron	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2						activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CAATGGGTAGGTATGTGGGTC	0.438																																					Pancreas(154;1876 1931 2329 17914 20079)												0																																										SO:0001627	intron_variant	0			CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.152-7424C>A	7.37:g.158910034G>T			Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Missense_Mutation	SNP	prints_GPCR_2_VIP_rcpt_2	p.T72N	ENST00000262178.2	37	c.215	CCDS5950.1	7	.	.	.	.	.	.	.	.	.	.	G	2.694	-0.272530	0.05716	.	.	ENSG00000106018	ENST00000421760	T	0.51325	0.71	1.36	1.36	0.22044	.	.	.	.	.	T	0.35970	0.0950	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24799	-1.0150	5	.	.	.	.	6.2916	0.21063	0.0:0.0:1.0:0.0	.	.	.	.	N	72	ENSP00000402690:T72N	.	T	-	2	0	VIPR2	158602795	0.004000	0.15560	0.001000	0.08648	0.008000	0.06430	1.384000	0.34396	1.084000	0.41184	0.454000	0.30748	ACC	VIPR2	-	NULL	ENSG00000106018		0.438	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPR2	HGNC	protein_coding	OTTHUMT00000322675.1	-	0.00	72	0	G	NM_003382		158910034	-1	tier1	-	no_errors	ENST00000421760	ensembl	human	putative	74_37	missense	10.53	34	4	SNP	0.002	T
VPS13B	157680	genome.wustl.edu	37	8	100865817	100865817	+	Silent	SNP	G	G	A	rs151315104		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:100865817G>A	ENST00000358544.2	+	56	10386	c.10275G>A	c.(10273-10275)ccG>ccA	p.P3425P	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.P3400P	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3425					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GTGTGGCCCCGGGAGCTGGTC	0.542																																					Colon(161;2205 2542 7338 31318)												0								A	,	0,4406		0,0,2203	67.0	63.0	64.0		10275,10200	-10.9	0.0	8	dbSNP_134	64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	VPS13B	NM_017890.3,NM_152564.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	3425/4023,3400/3998	100865817	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10275G>A	8.37:g.100865817G>A			C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	pfam_Autophagy-rel_C	p.P3425	ENST00000358544.2	37	c.10275	CCDS6280.1	8																																																																																			VPS13B	-	NULL	ENSG00000132549		0.542	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	-	0.00	48	0	G	NM_184042		100865817	+1	tier1	rs151315104	no_errors	ENST00000358544	ensembl	human	known	74_37	silent	26.47	25	9	SNP	0.000	A
WDFY4	57705	genome.wustl.edu	37	10	49984875	49984875	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr10:49984875G>T	ENST00000325239.5	+	15	2971	c.2944G>T	c.(2944-2946)Gcc>Tcc	p.A982S	WDFY4_ENST00000413659.2_Missense_Mutation_p.A982S	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	982						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGTCACACAGGCCCCGCAGCC	0.637																																																	0													20.0	19.0	20.0					10																	49984875		692	1590	2282	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2944G>T	10.37:g.49984875G>T	ENSP00000320563:p.Ala982Ser		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A982S	ENST00000325239.5	37	c.2944	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.404|0.404	-0.916857|-0.916857	0.02415|0.02415	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659|ENST00000312002	T;T|.	0.55052|.	0.54;1.53|.	4.54|4.54	2.64|2.64	0.31445|0.31445	.|.	.|.	.|.	.|.	.|.	T|T	0.36082|0.36082	0.0954|0.0954	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	B|.	0.10296|.	0.003|.	B|.	0.04013|.	0.001|.	T|T	0.25882|0.25882	-1.0119|-1.0119	8|5	.|.	.|.	.|.	.|.	3.9472|3.9472	0.09353|0.09353	0.0925:0.1602:0.5824:0.1649|0.0925:0.1602:0.5824:0.1649	.|.	982|.	Q6ZS81|.	WDFY4_HUMAN|.	S|V	991;982;982;982|72	ENSP00000320563:A982S;ENSP00000403789:A982S|.	.|.	A|G	+|+	1|2	0|0	WDFY4|WDFY4	49654881|49654881	0.001000|0.001000	0.12720|0.12720	0.024000|0.024000	0.17045|0.17045	0.079000|0.079000	0.17450|0.17450	-0.026000|-0.026000	0.12392|0.12392	0.592000|0.592000	0.29728|0.29728	0.655000|0.655000	0.94253|0.94253	GCC|GGC	WDFY4	-	NULL	ENSG00000128815		0.637	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	34	0	G	XM_033379		49984875	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.006	T
WDR16	146845	genome.wustl.edu	37	17	9490147	9490147	+	Missense_Mutation	SNP	G	G	A	rs372458377		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr17:9490147G>A	ENST00000352665.5	+	3	472	c.403G>A	c.(403-405)Gga>Aga	p.G135R	WDR16_ENST00000396219.3_Missense_Mutation_p.G67R|WDR16_ENST00000299764.5_Missense_Mutation_p.G145R|WDR16_ENST00000576499.1_3'UTR	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						CCCAGATGACGGAAGGTAATG	0.378																																																	0								G	ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	69.0	66.0	67.0		199,403	5.7	1.0	17		67	0,8600		0,0,4300	no	missense,missense	WDR16	NM_001080556.1,NM_145054.4	125,125	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	67/553,135/621	9490147	1,13005	2203	4300	6503	SO:0001583	missense	0			AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.403G>A	17.37:g.9490147G>A	ENSP00000339449:p.Gly135Arg			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G145R	ENST00000352665.5	37	c.433	CCDS11149.2	17	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779634	0.90195	2.27E-4	0.0	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;T;T	0.63744	-0.06;-0.06;-0.06	5.69	5.69	0.88448	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.091794	0.85682	D	0.000000	T	0.74374	0.3708	L	0.47190	1.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.78314	0.973;0.991;0.846	T	0.71227	-0.4655	10	0.37606	T	0.19	-16.2541	18.5891	0.91202	0.0:0.0:1.0:0.0	.	145;67;135	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	R	135;67;145	ENSP00000339449:G135R;ENSP00000379521:G67R;ENSP00000299764:G145R	ENSP00000299764:G145R	G	+	1	0	WDR16	9430872	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.268000	0.95675	2.690000	0.91761	0.455000	0.32223	GGA	WDR16	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000166596		0.378	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR16	HGNC	protein_coding	OTTHUMT00000316569.2		0.00	50	0	G	NM_145054		9490147	+1			no_errors	ENST00000299764	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	A
WDR5	11091	genome.wustl.edu	37	9	137013436	137013436	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr9:137013436G>T	ENST00000358625.3	+	8	726	c.555G>T	c.(553-555)ttG>ttT	p.L185F	WDR5_ENST00000425041.1_Missense_Mutation_p.L185F	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5	185					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)		p.L185F(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		ATGGATCCTTGATAGTTTCAA	0.408																																																	1	Substitution - Missense(1)	lung(1)											214.0	199.0	204.0					9																	137013436		2203	4300	6503	SO:0001583	missense	0			AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.555G>T	9.37:g.137013436G>T	ENSP00000351446:p.Leu185Phe		Q91VA5|Q9NWX7|Q9UGP9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L185F	ENST00000358625.3	37	c.555	CCDS6981.1	9	.	.	.	.	.	.	.	.	.	.	G	18.29	3.591359	0.66219	.	.	ENSG00000196363	ENST00000358625;ENST00000425041	T;T	0.61274	0.12;0.12	3.54	3.54	0.40534	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000016	T	0.64271	0.2583	L	0.41632	1.29	0.80722	D	1	D	0.67145	0.996	D	0.73380	0.98	T	0.64964	-0.6283	10	0.52906	T	0.07	.	10.3276	0.43803	0.0:0.2014:0.7986:0.0	.	185	P61964	WDR5_HUMAN	F	185	ENSP00000351446:L185F;ENSP00000401889:L185F	ENSP00000351446:L185F	L	+	3	2	WDR5	136003257	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.868000	0.56055	1.712000	0.51347	0.543000	0.68304	TTG	WDR5	-	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196363		0.408	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR5	HGNC	protein_coding	OTTHUMT00000254621.1		0.00	75	0	G	NM_052821		137013436	+1			no_errors	ENST00000358625	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
WFDC9	259240	genome.wustl.edu	37	20	44238766	44238766	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr20:44238766G>T	ENST00000326000.1	-	3	272	c.55C>A	c.(55-57)Ctg>Atg	p.L19M		NM_147198.3	NP_671731.1	Q8NEX5	WFDC9_HUMAN	WAP four-disulfide core domain 9	19						extracellular region (GO:0005576)				breast(1)|large_intestine(1)|liver(1)|lung(1)|prostate(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				AGCACAGGCAGAAGCATCACA	0.512																																																	0													129.0	112.0	118.0					20																	44238766		2203	4300	6503	SO:0001583	missense	0			AL031671	CCDS13362.1	20q13.12	2013-01-21			ENSG00000180205	ENSG00000180205		"""WAP four-disulfide core domain containing"""	20380	protein-coding gene	gene with protein product						12206714	Standard	NM_147198		Approved	WAP9, dJ688G8.2	uc002xoy.3	Q8NEX5	OTTHUMG00000046332	ENST00000326000.1:c.55C>A	20.37:g.44238766G>T	ENSP00000320532:p.Leu19Met		Q3MIX6|Q5TGZ8	Missense_Mutation	SNP	NULL	p.L19M	ENST00000326000.1	37	c.55	CCDS13362.1	20	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973490	0.53720	.	.	ENSG00000180205	ENST00000326000	T	0.37411	1.2	3.99	3.99	0.46301	.	0.306751	0.18071	N	0.152603	T	0.55641	0.1933	.	.	.	0.09310	N	0.999999	D	0.89917	1.0	D	0.79108	0.992	T	0.42120	-0.9470	9	0.56958	D	0.05	.	11.9472	0.52934	0.0:0.0:1.0:0.0	.	19	Q8NEX5	WFDC9_HUMAN	M	19	ENSP00000320532:L19M	ENSP00000320532:L19M	L	-	1	2	WFDC9	43672180	0.003000	0.15002	0.186000	0.23195	0.057000	0.15508	0.952000	0.29149	2.526000	0.85167	0.650000	0.86243	CTG	WFDC9	-	NULL	ENSG00000180205		0.512	WFDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC9	HGNC	protein_coding	OTTHUMT00000106945.1	-	0.00	49	0	G			44238766	-1	tier1	-	no_errors	ENST00000326000	ensembl	human	known	74_37	missense	15.04	96	17	SNP	0.231	T
WWP1	11059	genome.wustl.edu	37	8	87424100	87424100	+	Nonsense_Mutation	SNP	C	C	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:87424100C>G	ENST00000517970.1	+	9	1365	c.1058C>G	c.(1057-1059)tCa>tGa	p.S353*	WWP1_ENST00000349423.2_Nonsense_Mutation_p.S135*|WWP1_ENST00000341922.2_Nonsense_Mutation_p.S223*|WWP1_ENST00000265428.4_Nonsense_Mutation_p.S353*	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	353	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						ACCTTGCCATCAGGGTATGTT	0.403																																																	0													47.0	45.0	46.0					8																	87424100		2203	4299	6502	SO:0001587	stop_gained	0			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.1058C>G	8.37:g.87424100C>G	ENSP00000427793:p.Ser353*		O00307|Q5YLC1|Q96BP4	Nonsense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.S353*	ENST00000517970.1	37	c.1058	CCDS6242.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.305592	0.95601	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	.	.	.	6.07	5.2	0.72013	.	0.202992	0.42294	D	0.000730	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	13.7332	0.62802	0.0:0.9292:0.0:0.0708	.	.	.	.	X	353;353;223;135	.	ENSP00000265428:S353X	S	+	2	0	WWP1	87493216	0.996000	0.38824	0.855000	0.33649	0.881000	0.50899	4.770000	0.62309	1.587000	0.49959	-0.145000	0.13849	TCA	WWP1	-	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	ENSG00000123124		0.403	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP1	HGNC	protein_coding	OTTHUMT00000374755.1		0.00	12	0	C	NM_007013		87424100	+1			no_errors	ENST00000265428	ensembl	human	known	74_37	nonsense	16.67	10	2	SNP	0.992	G
ZDHHC11	79844	genome.wustl.edu	37	5	712139	712139	+	Intron	SNP	T	T	A	rs111351502	byFrequency	TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr5:712139T>A	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000508859.2_3'UTR|ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GCAGCCCATCTTCCTGGAGAT	0.562													t|||	2442	0.48762	0.5522	0.4683	5008	,	,		24038	0.5248		0.4911	False		,,,				2504	0.3722																0																																										SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-1140A>T	5.37:g.712139T>A			Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-	ENSG00000206077		0.562	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		-	0.00	21	0	T	NM_024786		712139	-1	tier1	rs111351502	no_errors	ENST00000522356	ensembl	human	known	74_37	rna	19.05	17	4	SNP	0.000	A
ZDHHC8P1	150244	genome.wustl.edu	37	22	23742518	23742518	+	RNA	SNP	G	G	A			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr22:23742518G>A	ENST00000255890.4	-	0	691									zinc finger, DHHC-type containing 8 pseudogene 1																		TGCTACGGTGGGGCATGGGAG	0.647																																																	0													33.0	34.0	34.0					22																	23742518		692	1591	2283			0					22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23742518G>A				RNA	SNP	-	NULL	ENST00000255890.4	37	NULL		22																																																																																			ZDHHC8P1	-	-	ENSG00000133519		0.647	ZDHHC8P1-001	KNOWN	basic	processed_transcript	ZDHHC8P1	HGNC	pseudogene	OTTHUMT00000319397.1	-	0.00	23	0	G	NR_003950		23742518	-1	tier1	-	no_errors	ENST00000255890	ensembl	human	known	74_37	rna	48.39	16	15	SNP	0.994	A
ZFHX4	79776	genome.wustl.edu	37	8	77767606	77767606	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr8:77767606G>T	ENST00000521891.2	+	10	8897	c.8449G>T	c.(8449-8451)Gac>Tac	p.D2817Y	ZFHX4_ENST00000518282.1_Missense_Mutation_p.D2791Y|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D2772Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D2772Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2772					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CACCACCGGAGACGAGGGAAA	0.468										HNSCC(33;0.089)																																							0													51.0	52.0	51.0					8																	77767606		1959	4154	6113	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8449G>T	8.37:g.77767606G>T	ENSP00000430497:p.Asp2817Tyr		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.D2817Y	ENST00000521891.2	37	c.8449	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480011	0.26598	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.61158	0.13;0.19;0.16;0.15	4.98	4.98	0.66077	.	0.000000	0.45867	U	0.000325	T	0.73148	0.3550	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.75682	-0.3233	10	0.87932	D	0	.	18.4359	0.90646	0.0:0.0:1.0:0.0	.	2772;2772;2817	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Y	2817;2801;2772;2772;2791	ENSP00000430497:D2817Y;ENSP00000399605:D2772Y;ENSP00000050961:D2772Y;ENSP00000430848:D2791Y	ENSP00000050961:D2772Y	D	+	1	0	ZFHX4	77930161	1.000000	0.71417	0.112000	0.21494	0.218000	0.24690	9.657000	0.98554	2.588000	0.87417	0.561000	0.74099	GAC	ZFHX4	-	NULL	ENSG00000091656		0.468	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	42	0	G	NM_024721		77767606	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
ZMYM4	9202	genome.wustl.edu	37	1	35852871	35852871	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:35852871G>T	ENST00000314607.6	+	12	2184	c.2104G>T	c.(2104-2106)Gac>Tac	p.D702Y	ZMYM4_ENST00000373297.2_Missense_Mutation_p.D613Y	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	702					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGAACTTCTTGACTATAAGGT	0.373																																																	0													50.0	43.0	45.0					1																	35852871		2203	4300	6503	SO:0001583	missense	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2104G>T	1.37:g.35852871G>T	ENSP00000322915:p.Asp702Tyr		A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH_dom	p.D702Y	ENST00000314607.6	37	c.2104	CCDS389.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.88|18.88	3.718206|3.718206	0.68844|0.68844	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	T;T|.	0.24723|.	1.84;1.88|.	5.66|5.66	5.66|5.66	0.87406|0.87406	TRASH (1);Zinc finger, MYM-type (1);|.	0.111255|.	0.64402|.	D|.	0.000013|.	T|.	0.70159|.	0.3192|.	L|L	0.48642|0.48642	1.525|1.525	0.49915|0.49915	D|D	0.999836|0.999836	D|.	0.58620|.	0.983|.	D|.	0.65684|.	0.937|.	T|.	0.65203|.	-0.6225|.	10|.	0.48119|.	T|.	0.1|.	-11.9003|-11.9003	19.7395|19.7395	0.96220|0.96220	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	702|.	Q5VZL5|.	ZMYM4_HUMAN|.	Y|L	702;613|361	ENSP00000322915:D702Y;ENSP00000362394:D613Y|.	ENSP00000322915:D702Y|.	D|X	+|+	1|2	0|2	ZMYM4|ZMYM4	35625458|35625458	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	4.572000|4.572000	0.60886|0.60886	2.669000|2.669000	0.90835|0.90835	0.655000|0.655000	0.94253|0.94253	GAC|TGA	ZMYM4	-	pfam_Znf_MYM,smart_TRASH_dom	ENSG00000146463		0.373	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3		0.00	26	0	G	NM_005095		35852871	+1			no_errors	ENST00000314607	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
ZNF271	10778	genome.wustl.edu	37	18	32888585	32888585	+	RNA	SNP	G	G	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr18:32888585G>T	ENST00000399070.3	+	0	2979					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(9)	12						GAGATCTAATGCAGAACTTAT	0.313																																																	0																																												0			X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32888585G>T			B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	RNA	SNP	-	NULL	ENST00000399070.3	37	NULL		18																																																																																			ZNF271	-	-	ENSG00000257267		0.313	ZNF271-002	KNOWN	basic	processed_transcript	ZNF271	HGNC	pseudogene	OTTHUMT00000255767.2	-	0.00	65	0	G	NR_024565		32888585	+1	tier1	-	no_errors	ENST00000399070	ensembl	human	known	74_37	rna	6.90	54	4	SNP	0.007	T
ZNF586	54807	genome.wustl.edu	37	19	58301711	58301711	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:58301711C>T	ENST00000598183.1	+	2	282	c.106C>T	c.(106-108)Cag>Tag	p.Q36*	ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_Nonsense_Mutation_p.Q36*			Q9NXT0	ZN586_HUMAN	zinc finger protein 586	36	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TAATGAGGCTCAGGGATGCCT	0.458																																																	0													386.0	339.0	353.0					19																	58301711		876	1991	2867	SO:0001587	stop_gained	0			AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000598183.1:c.106C>T	19.37:g.58301711C>T	ENSP00000471663:p.Gln36*		A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Nonsense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.Q36*	ENST00000598183.1	37	c.106		19	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482571	0.44147	.	.	ENSG00000083828	ENST00000430084;ENST00000308137	.	.	.	3.1	1.97	0.26223	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.8065	0.29206	0.0:0.7398:0.2602:0.0	.	.	.	.	X	36	.	ENSP00000308355:Q36X	Q	+	1	0	ZNF586	62993523	0.013000	0.17824	0.002000	0.10522	0.478000	0.33099	1.280000	0.33202	0.590000	0.29694	0.306000	0.20318	CAG	ZNF586	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000083828		0.458	ZNF586-005	PUTATIVE	basic	protein_coding	ZNF586	HGNC	protein_coding	OTTHUMT00000466824.1	-	0.00	164	0	C	NM_017652		58301711	+1	tier1	-	no_errors	ENST00000598885	ensembl	human	putative	74_37	nonsense	33.06	81	40	SNP	0.004	T
ZNF544	27300	genome.wustl.edu	37	19	58772267	58772267	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:58772267G>C	ENST00000596652.1	+	6	529	c.295G>C	c.(295-297)Gct>Cct	p.A99P	ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000415203.2_Missense_Mutation_p.A71P|ZNF544_ENST00000594384.1_3'UTR|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000600044.1_Missense_Mutation_p.A71P|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000600220.1_Missense_Mutation_p.A71P|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000599953.1_5'UTR|ZNF544_ENST00000269829.4_Missense_Mutation_p.A99P|ZNF544_ENST00000596825.1_3'UTR			Q6NX49	ZN544_HUMAN	zinc finger protein 544	99					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		AAAAGATCGAGCTAGGGAAGA	0.468																																																	0													61.0	59.0	59.0					19																	58772267		2203	4300	6503	SO:0001583	missense	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.295G>C	19.37:g.58772267G>C	ENSP00000469635:p.Ala99Pro		A8K6J1|Q9UEX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A99P	ENST00000596652.1	37	c.295	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560300	0.27827	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	T;T	0.08008	3.25;3.14	2.95	-4.95	0.03048	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B;B;B	0.24963	0.061;0.061;0.115	B;B;B	0.20767	0.017;0.017;0.031	T	0.42832	-0.9428	9	0.32370	T	0.25	.	0.8974	0.01266	0.2424:0.3335:0.2542:0.1699	.	71;71;99	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	P	99;71	ENSP00000269829:A99P;ENSP00000394341:A71P	ENSP00000269829:A99P	A	+	1	0	ZNF544	63464079	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.355000	0.20163	-0.588000	0.05882	-0.793000	0.03317	GCT	ZNF544	-	NULL	ENSG00000198131		0.468	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	-	0.00	64	0	G	NM_014480		58772267	+1	tier1	-	no_errors	ENST00000269829	ensembl	human	known	74_37	missense	20.59	27	7	SNP	0.000	C
ZNF595	152687	genome.wustl.edu	37	4	60257	60257	+	Silent	SNP	A	A	G			TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr4:60257A>G	ENST00000526473.2	+	4	413	c.240A>G	c.(238-240)caA>caG	p.Q80Q	ZNF595_ENST00000509152.2_Intron|ZNF595_ENST00000339368.6_Intron			Q8IYB9	ZN595_HUMAN	zinc finger protein 595	366					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GTGATCTCCAAGTTTACAAGG	0.363																																																	0																																										SO:0001819	synonymous_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000526473.2:c.240A>G	4.37:g.60257A>G				Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.Q80	ENST00000526473.2	37	c.240		4																																																																																			ZNF595	-	NULL	ENSG00000197701		0.363	ZNF595-201	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF595	HGNC	protein_coding		-	0.00	63	0	A	NM_182524		60257	+1	tier1	-	no_errors	ENST00000526473	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.000	G
ZNF695	57116	genome.wustl.edu	37	1	247151543	247151543	+	Missense_Mutation	SNP	G	G	A	rs575633182		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr1:247151543G>A	ENST00000339986.7	-	4	421	c.274C>T	c.(274-276)Ctt>Ttt	p.L92F	ZNF695_ENST00000498046.2_5'UTR|ZNF695_ENST00000487338.2_Missense_Mutation_p.L92F	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	92					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TCTTCAGTAAGATAAGAAGAC	0.323													G|||	1	0.000199681	0.0	0.0	5008	,	,		19556	0.0		0.001	False		,,,				2504	0.0																0													58.0	55.0	56.0					1																	247151543		1816	4083	5899	SO:0001583	missense	0				CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.274C>T	1.37:g.247151543G>A	ENSP00000341236:p.Leu92Phe		Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L92F	ENST00000339986.7	37	c.274	CCDS44344.1	1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.705377	0.00719	.	.	ENSG00000197472	ENST00000487338;ENST00000391780;ENST00000339986	T;T	0.06142	5.84;3.34	0.459	-0.655	0.11439	.	.	.	.	.	T	0.01254	0.0041	N	0.00504	-1.425	0.09310	N	1	B;B;P	0.36616	0.004;0.002;0.561	B;B;B	0.35470	0.002;0.001;0.203	T	0.30765	-0.9967	9	0.02654	T	1	.	3.7314	0.08495	0.6475:0.0:0.3525:0.0	.	92;80;92	Q8IW36;F2Z2N8;Q8IW36-1	ZN695_HUMAN;.;.	F	92	ENSP00000429736:L92F;ENSP00000341236:L92F	ENSP00000428213:L80F	L	-	1	0	ZNF695	245218166	0.013000	0.17824	0.001000	0.08648	0.580000	0.36256	0.141000	0.16076	-0.384000	0.07845	0.195000	0.17529	CTT	ZNF695	-	NULL	ENSG00000197472		0.323	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF695	HGNC	protein_coding	OTTHUMT00000097823.5		0.00	38	0	G	NM_020394		247151543	-1			no_errors	ENST00000339986	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.005	A
ZNF699	374879	genome.wustl.edu	37	19	9406531	9406531	+	Missense_Mutation	SNP	G	G	T	rs371499745		TCGA-R6-A8W5-01B-11D-A37C-09	TCGA-R6-A8W5-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c89f2492-fb5e-4695-8b16-0d83398c99ed	bb7f548e-c22d-4847-ba3e-bd88958ff2cb	g.chr19:9406531G>T	ENST00000591998.1	-	6	1777	c.1549C>A	c.(1549-1551)Cac>Aac	p.H517N	CTC-325H20.4_ENST00000591336.1_RNA|ZNF699_ENST00000308650.3_Missense_Mutation_p.H517N			Q32M78	ZN699_HUMAN	zinc finger protein 699	517					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACTGTAAGGTGGGAGGAACTA	0.438																																																	0													92.0	98.0	96.0					19																	9406531		2203	4296	6499	SO:0001583	missense	0			BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.1549C>A	19.37:g.9406531G>T	ENSP00000467723:p.His517Asn		Q8N9A1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H517N	ENST00000591998.1	37	c.1549	CCDS42495.1	19	.	.	.	.	.	.	.	.	.	.	G	0.538	-0.854844	0.02630	.	.	ENSG00000196110	ENST00000308650	T	0.13196	2.61	3.13	-2.24	0.06909	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.193628	0.25759	N	0.028483	T	0.04003	0.0112	N	0.05534	-0.03	0.09310	N	1	B	0.12630	0.006	B	0.14578	0.011	T	0.35176	-0.9799	10	0.13470	T	0.59	.	2.0834	0.03640	0.1118:0.1614:0.2369:0.49	.	517	Q32M78	ZN699_HUMAN	N	517	ENSP00000311596:H517N	ENSP00000311596:H517N	H	-	1	0	ZNF699	9267531	0.000000	0.05858	0.007000	0.13788	0.991000	0.79684	-3.029000	0.00638	-0.299000	0.08909	0.555000	0.69702	CAC	ZNF699	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196110		0.438	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF699	HGNC	protein_coding	OTTHUMT00000449010.1		0.00	77	0	G	NM_198535		9406531	-1			no_errors	ENST00000308650	ensembl	human	known	74_37	missense	7.14	65	5	SNP	0.000	T
