#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA10	10349	genome.wustl.edu	37	17	67183913	67183913	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:67183913T>C	ENST00000269081.4	-	20	3148	c.2239A>G	c.(2239-2241)Agt>Ggt	p.S747G	ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	747					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					GCTGCACTACTGACAGCCTTT	0.418																																																	0													169.0	157.0	161.0					17																	67183913		2203	4300	6503	SO:0001583	missense	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.2239A>G	17.37:g.67183913T>C	ENSP00000269081:p.Ser747Gly		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S747G	ENST00000269081.4	37	c.2239	CCDS11684.1	17	.	.	.	.	.	.	.	.	.	.	T	5.540	0.284613	0.10513	.	.	ENSG00000154263	ENST00000269081	T	0.77229	-1.08	2.76	-0.859	0.10685	.	.	.	.	.	T	0.64494	0.2603	L	0.37561	1.115	0.09310	N	1	B;B	0.14805	0.011;0.011	B;B	0.17979	0.02;0.012	T	0.46652	-0.9176	9	0.25106	T	0.35	.	8.1257	0.30997	0.0:0.4069:0.0:0.5931	.	747;747	E5RFN6;Q8WWZ4	.;ABCAA_HUMAN	G	747	ENSP00000269081:S747G	ENSP00000269081:S747G	S	-	1	0	ABCA10	64695508	0.060000	0.20803	0.000000	0.03702	0.156000	0.22039	1.471000	0.35365	-0.504000	0.06577	0.338000	0.21704	AGT	ABCA10	-	NULL	ENSG00000154263		0.418	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	-	0.00	95	0	T	NM_080282		67183913	-1	tier1	-	no_errors	ENST00000269081	ensembl	human	known	74_37	missense	35.19	70	38	SNP	0.000	C
ABCG4	64137	genome.wustl.edu	37	11	119027325	119027325	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:119027325C>A	ENST00000449422.2	+	8	1050	c.862C>A	c.(862-864)Ctg>Atg	p.L288M	ABCG4_ENST00000307417.3_Missense_Mutation_p.L288M|ABCG4_ENST00000531739.1_Missense_Mutation_p.L288M	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	288	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGTCACCAACCTGATCCCCTA	0.582																																																	0													148.0	141.0	143.0					11																	119027325		2200	4295	6495	SO:0001583	missense	0			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.862C>A	11.37:g.119027325C>A	ENSP00000406874:p.Leu288Met		A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L288M	ENST00000449422.2	37	c.862	CCDS8415.1	11	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054523	0.75960	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.35789	1.29;1.29;1.29	5.74	3.85	0.44370	ABC transporter-like (1);	0.123850	0.56097	D	0.000027	T	0.49081	0.1536	L	0.41961	1.31	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.41910	-0.9482	10	0.52906	T	0.07	-13.3703	11.0937	0.48132	0.1289:0.8042:0.0:0.0669	.	288	Q9H172	ABCG4_HUMAN	M	288	ENSP00000304111:L288M;ENSP00000406874:L288M;ENSP00000434318:L288M	ENSP00000304111:L288M	L	+	1	2	ABCG4	118532535	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.778000	0.68940	0.743000	0.32719	0.655000	0.94253	CTG	ABCG4	-	pfscan_ABC_transporter-like	ENSG00000172350		0.582	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ABCG4	HGNC	protein_coding	OTTHUMT00000388215.1	-	0.00	29	0	C	NM_022169		119027325	+1	tier1	-	no_errors	ENST00000307417	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	A
ACSF3	197322	genome.wustl.edu	37	16	89167129	89167129	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:89167129T>C	ENST00000317447.4	+	3	417	c.40T>C	c.(40-42)Tgc>Cgc	p.C14R	ACSF3_ENST00000378345.4_Intron|ACSF3_ENST00000406948.3_Missense_Mutation_p.C14R	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	14					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		GCGCCTGGGCTGCGCCTTGGC	0.672																																																	0													15.0	17.0	16.0					16																	89167129		2173	4235	6408	SO:0001583	missense	0			AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.40T>C	16.37:g.89167129T>C	ENSP00000320646:p.Cys14Arg		A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.C14R	ENST00000317447.4	37	c.40	CCDS10974.1	16	.	.	.	.	.	.	.	.	.	.	T	7.037	0.561745	0.13498	.	.	ENSG00000176715	ENST00000317447;ENST00000537290;ENST00000406948	T;T;T	0.53640	1.04;0.61;1.04	5.02	2.67	0.31697	.	2.666840	0.00851	N	0.001834	T	0.38558	0.1045	L	0.36672	1.1	0.09310	N	1	B	0.23854	0.092	B	0.19148	0.024	T	0.14839	-1.0458	10	0.20519	T	0.43	0.0	6.2401	0.20785	0.0:0.3261:0.0:0.6739	.	14	Q4G176	ACSF3_HUMAN	R	14	ENSP00000320646:C14R;ENSP00000440734:C14R;ENSP00000384627:C14R	ENSP00000320646:C14R	C	+	1	0	ACSF3	87694630	0.000000	0.05858	0.001000	0.08648	0.084000	0.17831	0.071000	0.14594	0.760000	0.33108	0.528000	0.53228	TGC	ACSF3	-	NULL	ENSG00000176715		0.672	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF3	HGNC	protein_coding	OTTHUMT00000269919.1		0.00	13	0	T	NM_174917		89167129	+1			no_errors	ENST00000317447	ensembl	human	known	74_37	missense	33.33	10	5	SNP	0.000	C
ACTN4	81	genome.wustl.edu	37	19	39212306	39212306	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:39212306G>A	ENST00000252699.2	+	12	1496	c.1420G>A	c.(1420-1422)Gcc>Acc	p.A474T	ACTN4_ENST00000390009.3_Missense_Mutation_p.A255T|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	474					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGAGCAGATCGCCGCCATTGC	0.637																																					Colon(168;199 1940 10254 46213 46384)												0													95.0	73.0	81.0					19																	39212306		2203	4300	6503	SO:0001583	missense	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1420G>A	19.37:g.39212306G>A	ENSP00000252699:p.Ala474Thr		A4K467|D6PXK4|O76048	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A474T	ENST00000252699.2	37	c.1420	CCDS12518.1	19	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516716	0.85495	.	.	ENSG00000130402	ENST00000252699;ENST00000445727;ENST00000390009	T;T	0.47528	0.84;0.84	4.21	4.21	0.49690	.	0.000000	0.64402	D	0.000001	T	0.56366	0.1980	M	0.78223	2.4	0.80722	D	1	B;P	0.46784	0.054;0.884	B;P	0.46275	0.107;0.51	T	0.64330	-0.6433	10	0.51188	T	0.08	.	15.8417	0.78852	0.0:0.0:1.0:0.0	.	474;474	E7EV83;O43707	.;ACTN4_HUMAN	T	474;474;255	ENSP00000252699:A474T;ENSP00000439497:A255T	ENSP00000252699:A474T	A	+	1	0	ACTN4	43904146	1.000000	0.71417	0.101000	0.21167	0.796000	0.44982	9.657000	0.98554	2.340000	0.79590	0.462000	0.41574	GCC	ACTN4	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000130402		0.637	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1		0.00	43	0	G			39212306	+1			no_errors	ENST00000252699	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.998	A
ADAMTS19	171019	genome.wustl.edu	37	5	128956349	128956349	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:128956349C>T	ENST00000274487.4	+	9	1644	c.1499C>T	c.(1498-1500)gCt>gTt	p.A500V	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	500	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CCATCGTGTGCTGATGGTCTT	0.353																																																	0													154.0	139.0	144.0					5																	128956349		2203	4300	6503	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1499C>T	5.37:g.128956349C>T	ENSP00000274487:p.Ala500Val			Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.A500V	ENST00000274487.4	37	c.1499	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846334	0.91277	.	.	ENSG00000145808	ENST00000274487	D	0.87256	-2.23	4.51	4.51	0.55191	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.073245	0.53938	D	0.000048	D	0.89280	0.6670	L	0.40543	1.245	0.53688	D	0.999979	D	0.59767	0.986	P	0.60117	0.869	D	0.87679	0.2546	9	.	.	.	.	18.5315	0.90993	0.0:1.0:0.0:0.0	.	500	Q8TE59	ATS19_HUMAN	V	500	ENSP00000274487:A500V	.	A	+	2	0	ADAMTS19	128984248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.935000	0.63498	2.783000	0.95769	0.655000	0.94253	GCT	ADAMTS19	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000145808		0.353	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	-	0.00	89	0	C	NM_133638		128956349	+1	tier1	-	no_errors	ENST00000274487	ensembl	human	known	74_37	missense	23.68	58	18	SNP	1.000	T
AFF1	4299	genome.wustl.edu	37	4	88048211	88048211	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:88048211G>T	ENST00000307808.6	+	14	3244	c.2824G>T	c.(2824-2826)Gtg>Ttg	p.V942L	AFF1_ENST00000395146.4_Missense_Mutation_p.V949L|AFF1_ENST00000544085.1_Missense_Mutation_p.V580L	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	942					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		TCCTTTTCCAGTGCCTTCTTT	0.368																																																	0													135.0	140.0	138.0					4																	88048211		2203	4300	6503	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.2824G>T	4.37:g.88048211G>T	ENSP00000305689:p.Val942Leu		B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.V949L	ENST00000307808.6	37	c.2845	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512641	0.44660	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000544085	T;T;T	0.63744	-0.06;-0.06;-0.06	5.4	5.4	0.78164	.	0.000000	0.56097	D	0.000036	T	0.74665	0.3746	L	0.58428	1.81	0.48632	D	0.999686	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.67933	-0.5542	10	0.10902	T	0.67	-19.3858	18.8	0.92013	0.0:0.0:1.0:0.0	.	949;942;942	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	L	949;942;580	ENSP00000378578:V949L;ENSP00000305689:V942L;ENSP00000440843:V580L	ENSP00000305689:V942L	V	+	1	0	AFF1	88267235	1.000000	0.71417	1.000000	0.80357	0.140000	0.21249	5.132000	0.64758	2.527000	0.85204	0.563000	0.77884	GTG	AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.368	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	-	0.00	61	0	G	NM_005935		88048211	+1	tier1	-	no_errors	ENST00000395146	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
AGAP1	116987	genome.wustl.edu	37	2	236761397	236761397	+	Intron	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:236761397G>A	ENST00000304032.8	+	10	1630				AGAP1_ENST00000409457.1_Missense_Mutation_p.R373H|AGAP1_ENST00000409538.1_Intron|AGAP1_ENST00000336665.5_Intron|AGAP1_ENST00000428334.2_Intron	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1						protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						GCCCGTGCCCGTCAGTCCTCC	0.592																																																	0																																										SO:0001627	intron_variant	0			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1051-30592G>A	2.37:g.236761397G>A			B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	pfam_MIRO-like,pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.R373H	ENST00000304032.8	37	c.1118	CCDS33408.1	2	.	.	.	.	.	.	.	.	.	.	G	9.795	1.178888	0.21787	.	.	ENSG00000157985	ENST00000409457	D	0.87334	-2.24	5.44	-2.76	0.05896	.	.	.	.	.	D	0.87881	0.6289	.	.	.	0.30987	N	0.721819	.	.	.	.	.	.	D	0.85814	0.1381	6	0.87932	D	0	.	12.2748	0.54728	0.6233:0.0:0.3767:0.0	.	.	.	.	H	373	ENSP00000387174:R373H	ENSP00000387174:R373H	R	+	2	0	AGAP1	236426136	0.041000	0.20044	0.048000	0.18961	0.840000	0.47671	0.056000	0.14256	-0.344000	0.08338	-0.794000	0.03295	CGT	AGAP1	-	NULL	ENSG00000157985		0.592	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	HGNC	protein_coding	OTTHUMT00000257076.2	-	0.00	41	0	G	NM_014914		236761397	+1	tier1	-	no_errors	ENST00000409457	ensembl	human	novel	74_37	missense	37.21	27	16	SNP	0.022	A
AGL	178	genome.wustl.edu	37	1	100340249	100340249	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:100340249G>T	ENST00000294724.4	+	8	1443	c.965G>T	c.(964-966)aGg>aTg	p.R322M	AGL_ENST00000370161.2_Missense_Mutation_p.R306M|AGL_ENST00000361915.3_Missense_Mutation_p.R322M|AGL_ENST00000361522.4_Missense_Mutation_p.R305M|AGL_ENST00000477753.1_3'UTR|AGL_ENST00000361302.3_Missense_Mutation_p.R306M|AGL_ENST00000370165.3_Missense_Mutation_p.R322M|AGL_ENST00000370163.3_Missense_Mutation_p.R322M	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	322					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TTAGAAAATAGGCGAGTAACC	0.333																																																	0													82.0	73.0	76.0					1																	100340249		2203	4300	6503	SO:0001583	missense	0			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.965G>T	1.37:g.100340249G>T	ENSP00000294724:p.Arg322Met		A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	pfam_AGL/Gdb1,superfamily_6-hairpin_glycosidase-like,superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	p.R322M	ENST00000294724.4	37	c.965	CCDS759.1	1	.	.	.	.	.	.	.	.	.	.	G	9.082	0.999505	0.19121	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.04	4.12	0.48240	Glycoside hydrolase, superfamily (1);	0.227401	0.45126	D	0.000390	T	0.64713	0.2623	L	0.47716	1.5	0.29746	N	0.836695	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.11329	0.006;0.006;0.002	T	0.55166	-0.8183	10	0.30078	T	0.28	.	7.9666	0.30102	0.0817:0.0:0.7603:0.158	.	305;306;322	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	M	322;322;322;322;306;306;305	ENSP00000355106:R322M;ENSP00000359184:R322M;ENSP00000359182:R322M;ENSP00000294724:R322M;ENSP00000354971:R306M;ENSP00000359180:R306M;ENSP00000354635:R305M	ENSP00000294724:R322M	R	+	2	0	AGL	100112837	0.859000	0.29813	0.580000	0.28601	0.397000	0.30659	1.812000	0.38952	1.254000	0.44035	-0.225000	0.12378	AGG	AGL	-	superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	ENSG00000162688		0.333	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGL	HGNC	protein_coding	OTTHUMT00000029778.1	-	0.00	61	0	G	NM_000028		100340249	+1	tier1	-	no_errors	ENST00000294724	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.764	T
AKIRIN2	55122	genome.wustl.edu	37	6	88391386	88391386	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:88391386A>C	ENST00000257787.5	-	2	855	c.331T>G	c.(331-333)Tct>Gct	p.S111A		NM_018064.3	NP_060534.1	Q53H80	AKIR2_HUMAN	akirin 2	111					embryo development (GO:0009790)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to lipopolysaccharide (GO:0032496)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)			large_intestine(4)	4						TGTGCATCAGAAGTACAACAC	0.363																																																	0													177.0	143.0	154.0					6																	88391386		2203	4300	6503	SO:0001583	missense	0			BC000764	CCDS5013.1	6q15	2009-04-17	2008-06-23	2008-06-23	ENSG00000135334	ENSG00000135334			21407	protein-coding gene	gene with protein product		615165	"""chromosome 6 open reading frame 166"""	C6orf166			Standard	NM_018064		Approved	FLJ10342, dJ486L4.2	uc003pmk.3	Q53H80	OTTHUMG00000015180	ENST00000257787.5:c.331T>G	6.37:g.88391386A>C	ENSP00000257787:p.Ser111Ala		Q9BQB1	Missense_Mutation	SNP	NULL	p.S111A	ENST00000257787.5	37	c.331	CCDS5013.1	6	.	.	.	.	.	.	.	.	.	.	A	16.08	3.020199	0.54576	.	.	ENSG00000135334	ENST00000257787	T	0.49720	0.77	5.93	4.7	0.59300	.	0.351568	0.33127	N	0.005260	T	0.25680	0.0625	L	0.49126	1.545	0.35331	D	0.785605	B	0.14438	0.01	B	0.13407	0.009	T	0.22103	-1.0226	10	0.52906	T	0.07	-11.1906	9.2104	0.37316	0.6852:0.0:0.0:0.3148	.	111	Q53H80	AKIR2_HUMAN	A	111	ENSP00000257787:S111A	ENSP00000257787:S111A	S	-	1	0	AKIRIN2	88448105	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.300000	0.65721	2.263000	0.75096	0.533000	0.62120	TCT	AKIRIN2	-	NULL	ENSG00000135334		0.363	AKIRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKIRIN2	HGNC	protein_coding	OTTHUMT00000041455.1	-	0.00	96	0	A	NM_018064		88391386	-1	tier1	-	no_errors	ENST00000257787	ensembl	human	known	74_37	missense	27.10	78	29	SNP	1.000	C
AKT3	10000	genome.wustl.edu	37	1	243809220	243809220	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:243809220G>A	ENST00000366539.1	-	5	604	c.404C>T	c.(403-405)gCc>gTc	p.A135V	AKT3_ENST00000366540.1_Missense_Mutation_p.A135V|AKT3_ENST00000336199.5_Missense_Mutation_p.A135V|AKT3_ENST00000263826.5_Missense_Mutation_p.A135V			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	135					mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			GGTTGTAGAGGCATCCATCTC	0.388																																																	0													193.0	188.0	190.0					1																	243809220		2203	4300	6503	SO:0001583	missense	0			AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.404C>T	1.37:g.243809220G>A	ENSP00000355497:p.Ala135Val		Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom	p.A135V	ENST00000366539.1	37	c.404	CCDS31077.1	1	.	.	.	.	.	.	.	.	.	.	G	4.851	0.158198	0.09236	.	.	ENSG00000117020	ENST00000336199;ENST00000366540;ENST00000366539;ENST00000263826;ENST00000552631	T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;2.43	5.09	5.09	0.68999	.	0.188551	0.46442	D	0.000284	T	0.17874	0.0429	N	0.08118	0	0.37759	D	0.92625	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.14671	-1.0464	10	0.11182	T	0.66	.	11.9419	0.52905	0.0796:0.0:0.9204:0.0	.	135;135	Q9Y243;Q9Y243-2	AKT3_HUMAN;.	V	135	ENSP00000336943:A135V;ENSP00000355498:A135V;ENSP00000355497:A135V;ENSP00000263826:A135V;ENSP00000447820:A135V	ENSP00000263826:A135V	A	-	2	0	AKT3	241875843	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	3.320000	0.51991	2.361000	0.80049	0.591000	0.81541	GCC	AKT3	-	NULL	ENSG00000117020		0.388	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT3	HGNC	protein_coding	OTTHUMT00000096479.1	-	0.00	56	0	G	NM_181690		243809220	-1	tier1	-	no_errors	ENST00000263826	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	A
ALDH18A1	5832	genome.wustl.edu	37	10	97386519	97386519	+	Missense_Mutation	SNP	G	G	T	rs11541778		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:97386519G>T	ENST00000371224.2	-	10	1230	c.1093C>A	c.(1093-1095)Cag>Aag	p.Q365K	ALDH18A1_ENST00000371221.3_Missense_Mutation_p.Q363K	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	365	Gamma-glutamyl phosphate reductase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		TCTCCCTGCTGCTCAACAGTA	0.448																																																	0													136.0	107.0	117.0					10																	97386519		2203	4300	6503	SO:0001583	missense	0			X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.1093C>A	10.37:g.97386519G>T	ENSP00000360268:p.Gln365Lys		B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Missense_Mutation	SNP	pfam_Asp/Glu/Uridylate_kinase,pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,superfamily_Asp/Glu/Uridylate_kinase,pirsf_P5_carboxy_syn,prints_Glu/AcGlu_kinase,tigrfam_P5_carboxy_syn,tigrfam_G-glutamylP_reductase	p.Q365K	ENST00000371224.2	37	c.1093	CCDS7443.1	10	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288902	0.59976	.	.	ENSG00000059573	ENST00000371224;ENST00000371221	T;T	0.71817	-0.6;-0.6	5.96	5.96	0.96718	Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.047918	0.85682	D	0.000000	T	0.68072	0.2961	L	0.41632	1.29	0.80722	D	1	B;B	0.18310	0.027;0.021	B;B	0.31290	0.127;0.077	T	0.61893	-0.6969	10	0.41790	T	0.15	-17.1899	17.9158	0.88950	0.0:0.0:1.0:0.0	.	365;363	P54886;P54886-2	P5CS_HUMAN;.	K	365;363	ENSP00000360268:Q365K;ENSP00000360265:Q363K	ENSP00000360265:Q363K	Q	-	1	0	ALDH18A1	97376509	1.000000	0.71417	0.999000	0.59377	0.781000	0.44180	8.968000	0.93407	2.832000	0.97577	0.655000	0.94253	CAG	ALDH18A1	-	superfamily_Ald_DH/histidinol_DH,pirsf_P5_carboxy_syn,tigrfam_P5_carboxy_syn	ENSG00000059573		0.448	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALDH18A1	HGNC	protein_coding	OTTHUMT00000049552.1	-	0.00	88	0	G	NM_002860		97386519	-1	tier1	-	no_errors	ENST00000371224	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
ALK	238	genome.wustl.edu	37	2	29519902	29519902	+	Missense_Mutation	SNP	G	G	T	rs200364883		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:29519902G>T	ENST00000389048.3	-	9	2575	c.1669C>A	c.(1669-1671)Cgt>Agt	p.R557S	ALK_ENST00000498037.1_5'UTR|ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	557	MAM 2. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R557C(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	AAGACTCCACGAATGAGCCAG	0.527			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	1	Substitution - Missense(1)	NS(1)											115.0	93.0	100.0					2																	29519902		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1669C>A	2.37:g.29519902G>T	ENSP00000373700:p.Arg557Ser		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R557S	ENST00000389048.3	37	c.1669	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	G	15.15	2.749196	0.49257	.	.	ENSG00000171094	ENST00000389048	T	0.01854	4.6	5.2	4.31	0.51392	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	0.449337	0.18745	U	0.132341	T	0.01940	0.0061	N	0.19112	0.55	0.80722	D	1	B	0.28400	0.21	B	0.25405	0.06	T	0.60762	-0.7199	9	.	.	.	.	12.1402	0.53994	0.0:0.0:0.8283:0.1717	.	557	Q9UM73	ALK_HUMAN	S	557	ENSP00000373700:R557S	.	R	-	1	0	ALK	29373406	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.973000	0.70456	1.167000	0.42706	0.563000	0.77884	CGT	ALK	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,pfscan_MAM_dom	ENSG00000171094		0.527	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1		0.00	17	0	G	NM_004304		29519902	-1			no_errors	ENST00000389048	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
ALPK3	57538	genome.wustl.edu	37	15	85406844	85406844	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr15:85406844C>T	ENST00000258888.5	+	11	5245	c.5078C>T	c.(5077-5079)gCc>gTc	p.A1693V		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1693	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GAAGCCCGGGCCGCGCCTGGC	0.547																																																	0													57.0	49.0	52.0					15																	85406844		2203	4299	6502	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.5078C>T	15.37:g.85406844C>T	ENSP00000258888:p.Ala1693Val		Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.A1693V	ENST00000258888.5	37	c.5078	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079302	0.36662	.	.	ENSG00000136383	ENST00000258888	T	0.13196	2.61	5.8	5.8	0.92144	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.067050	0.64402	D	0.000011	T	0.10165	0.0249	N	0.20530	0.585	0.35018	D	0.757576	P	0.39443	0.674	B	0.37047	0.24	T	0.27640	-1.0068	10	0.14656	T	0.56	-16.2706	17.5569	0.87894	0.0:1.0:0.0:0.0	.	1693	Q96L96	ALPK3_HUMAN	V	1693	ENSP00000258888:A1693V	ENSP00000258888:A1693V	A	+	2	0	ALPK3	83207848	0.986000	0.35501	0.958000	0.39756	0.009000	0.06853	2.555000	0.45854	2.735000	0.93741	0.655000	0.94253	GCC	ALPK3	-	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	ENSG00000136383		0.547	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	-	0.00	36	0	C	NM_020778		85406844	+1	tier1	-	no_errors	ENST00000258888	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.979	T
ANKS1B	56899	genome.wustl.edu	37	12	99201655	99201655	+	Intron	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:99201655T>C	ENST00000547776.2	-	20	3066				ANKS1B_ENST00000341752.7_Intron|ANKS1B_ENST00000550693.2_Silent_p.G201G|ANKS1B_ENST00000332712.7_Silent_p.G201G|ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000333732.7_Silent_p.G41G|ANKS1B_ENST00000549493.2_Silent_p.G261G|ANKS1B_ENST00000549558.2_Intron|ANKS1B_ENST00000547446.1_Intron|ANKS1B_ENST00000546568.1_Intron|ANKS1B_ENST00000549025.2_Silent_p.G109G|ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000546960.1_Intron	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B							cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		AGAAAGGAAATCCTGCGTTCT	0.393																																																	0													135.0	124.0	128.0					12																	99201655		1906	4121	6027	SO:0001627	intron_variant	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.3067-6752A>G	12.37:g.99201655T>C			A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Silent	SNP	pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,pfam_PTB,superfamily_SAM/pointed,smart_SAM,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_SAM	p.G261	ENST00000547776.2	37	c.783	CCDS55872.1	12																																																																																			ANKS1B	-	NULL	ENSG00000185046		0.393	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	-	0.00	74	0	T	NM_020140		99201655	-1	tier1	-	no_errors	ENST00000549493	ensembl	human	known	74_37	silent	18.18	53	12	SNP	1.000	C
LINC00671	388387	genome.wustl.edu	37	17	41024518	41024518	+	lincRNA	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:41024518G>A	ENST00000301683.3	-	0	3916									long intergenic non-protein coding RNA 671																		CAGGTGACCCGGAAGCTGCTG	0.637																																																	0																																												0			AK055784, BC122868, DC361857		17q21.31	2012-10-12			ENSG00000213373	ENSG00000213373		"""Long non-coding RNAs"""	44339	non-coding RNA	RNA, long non-coding							Standard	NR_027254		Approved		uc010whe.1		OTTHUMG00000132654		17.37:g.41024518G>A				RNA	SNP	-	NULL	ENST00000301683.3	37	NULL		17																																																																																			AOC4P	-	-	ENSG00000260105		0.637	LINC00671-001	KNOWN	basic	lincRNA	AOC4P	HGNC	lincRNA	OTTHUMT00000255905.2	-	0.00	66	0	G	NR_027254		41024518	+1	tier1	-	no_errors	ENST00000563852	ensembl	human	known	74_37	rna	42.11	32	24	SNP	0.963	A
APOBEC3B	9582	genome.wustl.edu	37	22	39388094	39388094	+	Silent	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr22:39388094C>A	ENST00000333467.3	+	7	1119	c.1074C>A	c.(1072-1074)ccC>ccA	p.P358P	APOBEC3B_ENST00000402182.3_Silent_p.P358P|APOBEC3B-AS1_ENST00000513758.2_RNA|APOBEC3B_ENST00000407298.3_Silent_p.P333P	NM_001270411.1|NM_004900.4	NP_001257340.1|NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B	358					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|negative regulation of transposition (GO:0010529)	nucleus (GO:0005634)	deoxycytidine deaminase activity (GO:0047844)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	13	Melanoma(58;0.04)					CCTTCCAGCCCTGGGATGGAC	0.612																																																	0													96.0	76.0	82.0					22																	39388094		2198	4282	6480	SO:0001819	synonymous_variant	0			AK024854	CCDS13982.1, CCDS58807.1	22q13.1-q13.2	2008-05-15			ENSG00000179750	ENSG00000179750		"""Apolipoprotein B mRNA editing enzymes"""	17352	protein-coding gene	gene with protein product	"""phorbolin 3"""	607110				11863358, 10469298	Standard	NM_004900		Approved	PHRBNL, FLJ21201	uc003awo.2	Q9UH17	OTTHUMG00000151085	ENST00000333467.3:c.1074C>A	22.37:g.39388094C>A			B0QYD2|O95618|Q20WL1|Q5IFJ4|Q7Z2N3|Q7Z6D6|Q9UE74	Silent	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.P358	ENST00000333467.3	37	c.1074	CCDS13982.1	22																																																																																			APOBEC3B	-	pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	ENSG00000179750		0.612	APOBEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3B	HGNC	protein_coding	OTTHUMT00000321233.1	-	0.00	49	0	C	NM_004900		39388094	+1	tier1	-	no_errors	ENST00000333467	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.265	A
ARHGAP36	158763	genome.wustl.edu	37	X	130217914	130217914	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrX:130217914C>G	ENST00000276211.5	+	4	871	c.526C>G	c.(526-528)Ccc>Gcc	p.P176A	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.P40A|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.P164A	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	176	Arg-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GCCCACCTTGCCCCGGGAGTT	0.642																																																	0													31.0	31.0	31.0					X																	130217914		2203	4300	6503	SO:0001583	missense	0				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.526C>G	X.37:g.130217914C>G	ENSP00000276211:p.Pro176Ala		B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P176A	ENST00000276211.5	37	c.526	CCDS14628.1	X	.	.	.	.	.	.	.	.	.	.	C	10.86	1.471017	0.26423	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432;ENST00000370921	T;T;T;T	0.10668	2.85;2.85;2.87;2.92	4.24	3.37	0.38596	.	0.000000	0.48286	D	0.000187	T	0.15132	0.0365	N	0.17082	0.46	0.24809	N	0.992652	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.996;0.991	T	0.04065	-1.0980	10	0.44086	T	0.13	.	8.3677	0.32397	0.2336:0.7664:0.0:0.0	.	145;164;176	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	A	176;164;128;145;40	ENSP00000276211:P176A;ENSP00000359960:P164A;ENSP00000408515:P145A;ENSP00000359959:P40A	ENSP00000276211:P176A	P	+	1	0	ARHGAP36	130045595	1.000000	0.71417	0.776000	0.31678	0.067000	0.16453	2.954000	0.49113	1.116000	0.41820	-0.224000	0.12420	CCC	ARHGAP36	-	NULL	ENSG00000147256		0.642	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP36	HGNC	protein_coding	OTTHUMT00000355073.1	-	0.00	61	0	C	NM_144967		130217914	+1	tier1	-	no_errors	ENST00000276211	ensembl	human	known	74_37	missense	73.47	13	36	SNP	0.704	G
ARHGDIA	396	genome.wustl.edu	37	17	79826408	79826408	+	3'UTR	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:79826408G>T	ENST00000269321.7	-	0	1094				ARHGDIA_ENST00000541078.2_3'UTR|ARHGDIA_ENST00000400721.4_3'UTR|RP11-498C9.3_ENST00000576021.1_RNA|ARHGDIA_ENST00000582520.1_Intron|RP11-498C9.3_ENST00000576554.1_RNA|ARHGDIA_ENST00000580685.1_3'UTR|ARHGDIA_ENST00000584461.1_Missense_Mutation_p.S185R	NM_001185078.1|NM_004309.4	NP_001172007.1|NP_004300.1	P52565	GDIR1_HUMAN	Rho GDP dissociation inhibitor (GDI) alpha						cellular component movement (GO:0006928)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of axonogenesis (GO:0050772)|regulation of axonogenesis (GO:0050770)|regulation of protein localization (GO:0032880)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			endometrium(1)|lung(1)|prostate(1)	3	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CTGGAGAATGGCTGCTCCGCT	0.706																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC028333	CCDS11788.1, CCDS58609.1	17q25.3	2005-12-20				ENSG00000141522			678	protein-coding gene	gene with protein product		601925		GDIA1		9186513	Standard	NM_001185077		Approved	RHOGDI	uc002kbq.3	P52565		ENST00000269321.7:c.*344C>A	17.37:g.79826408G>T			A8MXW0|B2R5X1|B4DDD3|B4DUV9|Q6IBM5	Missense_Mutation	SNP	pfam_Rho_GDI,superfamily_Ig_E-set,prints_Rho_GDI	p.S185R	ENST00000269321.7	37	c.555	CCDS11788.1	17																																																																																			ARHGDIA	-	NULL	ENSG00000141522		0.706	ARHGDIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGDIA	HGNC	protein_coding	OTTHUMT00000441679.2	-	0.00	23	0	G	NM_004309		79826408	-1	tier1	-	no_errors	ENST00000584461	ensembl	human	putative	74_37	missense	11.76	30	4	SNP	0.000	T
ARID5B	84159	genome.wustl.edu	37	10	63852412	63852412	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:63852412G>T	ENST00000279873.7	+	10	3600	c.3190G>T	c.(3190-3192)Ggc>Tgc	p.G1064C	ARID5B_ENST00000309334.5_Missense_Mutation_p.G821C	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1064					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					GCATTCCGGGGGCGGATCAGA	0.612																																																	0													71.0	69.0	70.0					10																	63852412		2203	4300	6503	SO:0001583	missense	0			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.3190G>T	10.37:g.63852412G>T	ENSP00000279873:p.Gly1064Cys		B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.G1064C	ENST00000279873.7	37	c.3190	CCDS31208.1	10	.	.	.	.	.	.	.	.	.	.	G	3.586	-0.084663	0.07097	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.47869	0.84;0.83	5.72	2.02	0.26589	.	0.660669	0.17454	N	0.173679	T	0.30854	0.0778	N	0.22421	0.69	0.09310	N	0.999999	P	0.45348	0.856	B	0.39419	0.299	T	0.11941	-1.0567	10	0.62326	D	0.03	-0.122	9.0744	0.36513	0.4416:0.0:0.5584:0.0	.	1064	Q14865	ARI5B_HUMAN	C	1064;821	ENSP00000279873:G1064C;ENSP00000308862:G821C	ENSP00000279873:G1064C	G	+	1	0	ARID5B	63522418	0.995000	0.38212	0.022000	0.16811	0.051000	0.14879	1.390000	0.34464	0.589000	0.29677	-0.136000	0.14681	GGC	ARID5B	-	NULL	ENSG00000150347		0.612	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID5B	HGNC	protein_coding	OTTHUMT00000048233.1	-	0.00	27	0	G	XM_084482		63852412	+1	tier1	-	no_errors	ENST00000279873	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.309	T
ASMT	438	genome.wustl.edu	37	X	1755228	1755228	+	Intron	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrX:1755228G>T	ENST00000381229.4	+	7	739				ASMT_ENST00000381241.3_Intron|ASMT_ENST00000381233.3_Intron|ASMT_ENST00000509780.1_3'UTR			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase						cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	GGAAGACCTGGGAAAGGCGTG	0.532																																																	0																																										SO:0001627	intron_variant	0			M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.704-103G>T	X.37:g.1755228G>T			B2RC33|Q16598|Q5JQ72|Q5JQ73	RNA	SNP	-	NULL	ENST00000381229.4	37	NULL		X																																																																																			ASMT	-	-	ENSG00000196433		0.532	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	HGNC	protein_coding	OTTHUMT00000055612.1	-	0.00	79	0	G	NM_004043		1755228	+1	tier1	-	no_errors	ENST00000509780	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.004	T
ATAD2	29028	genome.wustl.edu	37	8	124359623	124359623	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr8:124359623A>G	ENST00000287394.5	-	16	2028	c.1921T>C	c.(1921-1923)Tca>Cca	p.S641P	ATAD2_ENST00000521903.1_5'UTR|MIR548AA1_ENST00000384971.2_RNA	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	641					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GCACATATTGATTTAATATCT	0.408																																																	0													57.0	54.0	55.0					8																	124359623		2203	4298	6501	SO:0001583	missense	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1921T>C	8.37:g.124359623A>G	ENSP00000287394:p.Ser641Pro		Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.S641P	ENST00000287394.5	37	c.1921	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	A	20.3	3.966486	0.74131	.	.	ENSG00000156802	ENST00000287394	D	0.95103	-3.61	4.96	4.96	0.65561	.	0.068205	0.64402	D	0.000012	D	0.97071	0.9043	M	0.89904	3.07	0.80722	D	1	D	0.69078	0.997	P	0.61201	0.885	D	0.97623	1.0137	10	0.87932	D	0	-11.2002	12.1028	0.53794	0.8569:0.1431:0.0:0.0	.	641	Q6PL18	ATAD2_HUMAN	P	641	ENSP00000287394:S641P	ENSP00000287394:S641P	S	-	1	0	ATAD2	124428804	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.668000	0.61568	1.977000	0.57605	0.482000	0.46254	TCA	ATAD2	-	superfamily_P-loop_NTPase	ENSG00000156802		0.408	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	-	0.00	28	0	A	NM_014109		124359623	-1	tier1	-	no_errors	ENST00000287394	ensembl	human	known	74_37	missense	58.62	12	17	SNP	1.000	G
ATP13A1	57130	genome.wustl.edu	37	19	19768201	19768201	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:19768201G>A	ENST00000357324.6	-	4	720	c.694C>T	c.(694-696)Cct>Tct	p.P232S	ATP13A1_ENST00000496082.1_5'Flank|ATP13A1_ENST00000291503.5_Missense_Mutation_p.P114S	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	232						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GAGAAGTCAGGCACCACCATC	0.592																																					Esophageal Squamous(142;920 1789 9047 14684 24777)												0													53.0	46.0	48.0					19																	19768201		2197	4289	6486	SO:0001583	missense	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.694C>T	19.37:g.19768201G>A	ENSP00000349877:p.Pro232Ser		B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.P232S	ENST00000357324.6	37	c.694	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406173	0.83230	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.88586	-2.4;-2.4	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.95182	0.8438	M	0.91459	3.21	0.80722	D	1	D;D	0.61697	0.99;0.985	P;D	0.65874	0.878;0.939	D	0.96209	0.9151	10	0.87932	D	0	-15.4288	15.5416	0.76052	0.0:0.0:1.0:0.0	.	232;114	Q9HD20;Q9HD20-2	AT131_HUMAN;.	S	114;232	ENSP00000291503:P114S;ENSP00000349877:P232S	ENSP00000291503:P114S	P	-	1	0	ATP13A1	19629201	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.086000	0.94088	2.278000	0.76064	0.467000	0.42956	CCT	ATP13A1	-	tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000105726		0.592	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	-	0.00	75	0	G	NM_020410		19768201	-1	tier1	-	no_errors	ENST00000357324	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	A
ATP9B	374868	genome.wustl.edu	37	18	76856506	76856506	+	Silent	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr18:76856506G>A	ENST00000426216.2	+	2	167	c.150G>A	c.(148-150)ttG>ttA	p.L50L	ATP9B_ENST00000458297.2_5'UTR|ATP9B_ENST00000586722.1_Silent_p.L50L|ATP9B_ENST00000307671.7_Silent_p.L50L|ATP9B_ENST00000591464.1_3'UTR	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	50					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CTGCGCATTTGGATGAAATGC	0.443																																																	0													178.0	155.0	163.0					18																	76856506		2203	4300	6503	SO:0001819	synonymous_variant	0			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.150G>A	18.37:g.76856506G>A			O60872|Q08AD8|Q08AD9	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L50	ENST00000426216.2	37	c.150	CCDS12014.1	18																																																																																			ATP9B	-	NULL	ENSG00000166377		0.443	ATP9B-001	KNOWN	basic|CCDS	protein_coding	ATP9B	HGNC	protein_coding	OTTHUMT00000256402.3	-	0.00	112	0	G	NM_198531		76856506	+1	tier1	-	no_errors	ENST00000426216	ensembl	human	known	74_37	silent	14.04	153	25	SNP	1.000	A
C10orf107	219621	genome.wustl.edu	37	10	63450334	63450334	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:63450334G>T	ENST00000330194.2	+	4	548	c.243G>T	c.(241-243)gaG>gaT	p.E81D		NM_173554.2	NP_775825.1	Q8IVU9	CJ107_HUMAN	chromosome 10 open reading frame 107	81										breast(1)|kidney(1)|lung(4)|prostate(1)|skin(1)	8	Prostate(12;0.016)					AGCTATACGAGTTTATGTTCT	0.318																																																	0													133.0	132.0	132.0					10																	63450334		2203	4299	6502	SO:0001583	missense	0			BC041932	CCDS7262.1	10q21.3	2012-06-01			ENSG00000183346	ENSG00000183346			28678	protein-coding gene	gene with protein product						12477932	Standard	NM_173554		Approved	bA63A2.1, Em:AC022398.2, MGC44593	uc010qik.2	Q8IVU9	OTTHUMG00000018295	ENST00000330194.2:c.243G>T	10.37:g.63450334G>T	ENSP00000328698:p.Glu81Asp		Q5T1B8	Missense_Mutation	SNP	NULL	p.E81D	ENST00000330194.2	37	c.243	CCDS7262.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.18|19.18	3.776752|3.776752	0.70107|0.70107	.|.	.|.	ENSG00000183346|ENSG00000183346	ENST00000330194|ENST00000389639	.|.	.|.	.|.	5.48|5.48	3.23|3.23	0.37069|0.37069	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.57257|0.57257	0.2041|0.2041	M|M	0.80183|0.80183	2.485|2.485	0.30493|0.30493	N|N	0.771152|0.771152	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.59778|0.59778	-0.7390|-0.7390	9|5	0.66056|.	D|.	0.02|.	-17.5611|-17.5611	7.0234|7.0234	0.24926|0.24926	0.3421:0.0:0.6579:0.0|0.3421:0.0:0.6579:0.0	.|.	81|.	Q8IVU9|.	CJ107_HUMAN|.	D|I	81|70	.|.	ENSP00000328698:E81D|.	E|S	+|+	3|2	2|0	C10orf107|C10orf107	63120340|63120340	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	0.590000|0.590000	0.23954|0.23954	1.443000|1.443000	0.47586|0.47586	0.591000|0.591000	0.81541|0.81541	GAG|AGT	C10orf107	-	NULL	ENSG00000183346		0.318	C10orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf107	HGNC	protein_coding	OTTHUMT00000048228.2	-	0.00	63	0	G	NM_173554		63450334	+1	tier1	-	no_errors	ENST00000330194	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
C18orf63	644041	genome.wustl.edu	37	18	71985143	71985143	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr18:71985143C>T	ENST00000579455.1	+	2	372	c.43C>T	c.(43-45)Cca>Tca	p.P15S		NM_001174123.1	NP_001167594.1	Q68DL7	CR063_HUMAN	chromosome 18 open reading frame 63	15										breast(1)	1						CATCACACTTCCAGATTTAAA	0.368																																																	0																																										SO:0001583	missense	0				CCDS54189.1	18q22.3	2012-10-24			ENSG00000206043	ENSG00000206043			40037	protein-coding gene	gene with protein product							Standard	NM_001174123		Approved	DKFZP781G0119	uc002llj.3	Q68DL7	OTTHUMG00000178987	ENST00000579455.1:c.43C>T	18.37:g.71985143C>T	ENSP00000464330:p.Pro15Ser		A6NME8	Missense_Mutation	SNP	NULL	p.P15S	ENST00000579455.1	37	c.43	CCDS54189.1	18	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305134	0.81247	.	.	ENSG00000206043	ENST00000382675	.	.	.	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000015	T	0.76421	0.3985	M	0.73598	2.24	0.40810	D	0.983411	.	.	.	.	.	.	T	0.79179	-0.1910	7	0.66056	D	0.02	-6.3794	16.5467	0.84448	0.0:1.0:0.0:0.0	.	.	.	.	S	15	.	ENSP00000372122:P15S	P	+	1	0	C18orf63	70136123	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	4.349000	0.59385	2.639000	0.89480	0.655000	0.94253	CCA	C18orf63	-	NULL	ENSG00000206043		0.368	C18orf63-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	C18orf63	HGNC	protein_coding	OTTHUMT00000444246.2	-	0.00	83	0	C	NM_001174123		71985143	+1	tier1	-	no_errors	ENST00000579455	ensembl	human	known	74_37	missense	11.41	163	21	SNP	0.997	T
C1orf137	388667	genome.wustl.edu	37	1	117236755	117236755	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:117236755G>T	ENST00000369482.1	+	1	22	c.4G>T	c.(4-6)Gcg>Tcg	p.A2S		NM_001013643.1	NP_001013665.1	Q5JT78	CA137_HUMAN	chromosome 1 open reading frame 137	2																	CCCAGGAATGGCGTTAAAGAC	0.458																																																	0																																										SO:0001583	missense	0				CCDS60233.1	1p13.1	2013-01-14			ENSG00000203864	ENSG00000203864			32040	protein-coding gene	gene with protein product							Standard	NM_001013643		Approved			Q5JT78	OTTHUMG00000022754	ENST00000369482.1:c.4G>T	1.37:g.117236755G>T	ENSP00000358494:p.Ala2Ser			Missense_Mutation	SNP	NULL	p.A2S	ENST00000369482.1	37	c.4		1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.422182	0.25639	.	.	ENSG00000203864	ENST00000369482	.	.	.	3.93	-0.284	0.12870	.	.	.	.	.	T	0.30572	0.0769	.	.	.	.	.	.	.	.	.	.	.	.	T	0.22138	-1.0225	4	0.87932	D	0	.	6.5055	0.22192	0.4766:0.0:0.5234:0.0	.	.	.	.	S	2	.	ENSP00000358494:A2S	A	+	1	0	C1orf137	117038278	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.321000	0.08018	-0.035000	0.13691	-0.345000	0.07892	GCG	C1orf137	-	NULL	ENSG00000203864		0.458	C1orf137-001	KNOWN	basic|appris_principal	protein_coding	C1orf137	HGNC	protein_coding	OTTHUMT00000059045.1	-	0.00	85	0	G	NM_001013643		117236755	+1	tier1	-	no_errors	ENST00000369482	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.000	T
CFAP61	26074	genome.wustl.edu	37	20	20180414	20180414	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:20180414C>A	ENST00000245957.5	+	17	1876	c.1800C>A	c.(1798-1800)ttC>ttA	p.F600L	C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000389656.3_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		600								p.F600L(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TCTTTCAGTTCCAGAACCCCT	0.473																																																	1	Substitution - Missense(1)	lung(1)											126.0	116.0	119.0					20																	20180414		2203	4300	6503	SO:0001583	missense	0																														ENST00000245957.5:c.1800C>A	20.37:g.20180414C>A	ENSP00000245957:p.Phe600Leu		A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.F600L	ENST00000245957.5	37	c.1800	CCDS33447.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.760|6.760	0.509129|0.509129	0.12883|0.12883	.|.	.|.	ENSG00000089101|ENSG00000089101	ENST00000343997;ENST00000339482;ENST00000389655;ENST00000245957|ENST00000431753	T|.	0.42513|.	0.97|.	5.57|5.57	0.772|0.772	0.18510|0.18510	.|.	0.322809|.	0.30356|.	N|.	0.009806|.	T|T	0.33000|0.33000	0.0848|0.0848	N|N	0.16201|0.16201	0.385|0.385	0.80722|0.80722	D|D	1|1	B;B|.	0.10296|.	0.003;0.001|.	B;B|.	0.11329|.	0.006;0.004|.	T|T	0.03993|0.03993	-1.0986|-1.0986	10|5	0.12430|.	T|.	0.62|.	.|.	6.2025|6.2025	0.20583|0.20583	0.0:0.4765:0.2586:0.2648|0.0:0.4765:0.2586:0.2648	.|.	580;600|.	F8W6K4;Q8NHU2|.	.;CT026_HUMAN|.	L|Y	540;168;580;600|140	ENSP00000245957:F600L|.	ENSP00000245957:F600L|.	F|S	+|+	3|2	2|0	C20orf26|C20orf26	20128414|20128414	0.998000|0.998000	0.40836|0.40836	0.997000|0.997000	0.53966|0.53966	0.993000|0.993000	0.82548|0.82548	0.269000|0.269000	0.18589|0.18589	0.278000|0.278000	0.22164|0.22164	0.563000|0.563000	0.77884|0.77884	TTC|TCC	C20orf26	-	NULL	ENSG00000089101		0.473	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3		0.00	58	0	C			20180414	+1			no_errors	ENST00000245957	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.989	A
C2CD3	26005	genome.wustl.edu	37	11	73744881	73744881	+	Silent	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:73744881T>C	ENST00000334126.7	-	31	6550	c.6324A>G	c.(6322-6324)gaA>gaG	p.E2108E	C2CD3_ENST00000542452.1_5'UTR			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	2108					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					AAGAGGGGCCTTCCCTCTGCA	0.542																																																	0																																										SO:0001819	synonymous_variant	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.6324A>G	11.37:g.73744881T>C			C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.E2108	ENST00000334126.7	37	c.6324		11																																																																																			C2CD3	-	NULL	ENSG00000168014		0.542	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		-	0.00	24	0	T	NM_015531		73744881	-1	tier1	-	no_errors	ENST00000334126	ensembl	human	known	74_37	silent	36.36	7	4	SNP	0.081	C
CARF	79800	genome.wustl.edu	37	2	203807485	203807485	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:203807485G>T	ENST00000402905.3	+	4	422	c.101G>T	c.(100-102)aGg>aTg	p.R34M	CARF_ENST00000444724.1_Missense_Mutation_p.R34M|CARF_ENST00000471271.1_3'UTR|CARF_ENST00000545253.1_Intron|WDR12_ENST00000477723.1_Intron|CARF_ENST00000428585.1_Intron|CARF_ENST00000434998.1_Intron|CARF_ENST00000320443.8_Missense_Mutation_p.R34M|CARF_ENST00000438828.2_Missense_Mutation_p.R34M|CARF_ENST00000414439.1_Intron|CARF_ENST00000545262.1_Intron|CARF_ENST00000456821.2_Missense_Mutation_p.R22M	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	34					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ATGGACTCCAGGGATTCTTCC	0.348																																																	0													60.0	55.0	56.0					2																	203807485		1841	4089	5930	SO:0001583	missense	0			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.101G>T	2.37:g.203807485G>T	ENSP00000384006:p.Arg34Met		B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Splice_Site	SNP	-	e2-1	ENST00000402905.3	37	c.79-1	CCDS42801.1	2	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134598	0.56828	.	.	ENSG00000138380	ENST00000402905;ENST00000414490;ENST00000431787;ENST00000444724;ENST00000414857;ENST00000445120;ENST00000441569;ENST00000432024;ENST00000443740;ENST00000456821;ENST00000320443;ENST00000438828	.	.	.	5.64	3.85	0.44370	.	0.398961	0.26784	N	0.022504	T	0.51058	0.1652	L	0.56769	1.78	0.23473	N	0.9976	P;D;P	0.60575	0.944;0.988;0.904	P;P;P	0.56514	0.724;0.8;0.724	T	0.43310	-0.9399	9	0.62326	D	0.03	0.3049	9.5196	0.39126	0.1639:0.0:0.8361:0.0	.	34;34;34	B4DRP6;Q8N187;F6SXV3	.;AL2S8_HUMAN;.	M	34;34;4;34;34;4;34;34;34;22;34;34	.	ENSP00000316224:R34M	R	+	2	0	ALS2CR8	203515730	1.000000	0.71417	0.369000	0.25952	0.996000	0.88848	1.901000	0.39838	0.750000	0.32877	0.563000	0.77884	AGG	CARF	-	-	ENSG00000138380		0.348	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARF	HGNC	protein_coding	OTTHUMT00000335768.5		0.00	45	0	G	NM_001104586		203807485	+1			no_errors	ENST00000427712	ensembl	human	known	74_37	splice_site	5.36	53	3	SNP	0.954	T
CDC42BPB	9578	genome.wustl.edu	37	14	103450049	103450049	+	Silent	SNP	C	C	T	rs373702358		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr14:103450049C>T	ENST00000361246.2	-	7	1023	c.735G>A	c.(733-735)ccG>ccA	p.P245P		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GCAGGATCTCCGGCGAGATGT	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		18311	0.0		0.0	False		,,,				2504	0.001																0								C		1,4405	2.1+/-5.4	0,1,2202	75.0	70.0	71.0		735	-10.1	0.1	14		71	0,8600		0,0,4300	no	coding-synonymous	CDC42BPB	NM_006035.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		245/1712	103450049	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.735G>A	14.37:g.103450049C>T				Silent	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_CRIB_dom,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.P245	ENST00000361246.2	37	c.735	CCDS9978.1	14																																																																																			CDC42BPB	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000198752		0.557	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1		0.00	13	0	C	NM_006035		103450049	-1			no_errors	ENST00000361246	ensembl	human	known	74_37	silent	30.00	7	3	SNP	0.128	T
CDH26	60437	genome.wustl.edu	37	20	58587688	58587688	+	Intron	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:58587688G>T	ENST00000244047.5	+	15	2483				CDH26_ENST00000350849.6_Missense_Mutation_p.S134I|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000244049.3_Missense_Mutation_p.S93I|CDH26_ENST00000348616.4_Missense_Mutation_p.S801I			Q8IXH8	CAD26_HUMAN	cadherin 26						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			TCTCTGGCCAGCTTGGAACAG	0.522																																																	0													93.0	92.0	92.0					20																	58587688		2203	4300	6503	SO:0001627	intron_variant	0			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2172+5846G>T	20.37:g.58587688G>T			A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S801I	ENST00000244047.5	37	c.2402		20	.	.	.	.	.	.	.	.	.	.	G	8.671	0.902769	0.17760	.	.	ENSG00000124215	ENST00000348616;ENST00000244049;ENST00000350849	T;T;T	0.80653	0.69;-1.4;-1.4	3.57	1.27	0.21489	.	.	.	.	.	T	0.63570	0.2522	.	.	.	0.19300	N	0.999974	B;B;B	0.15930	0.002;0.015;0.001	B;B;B	0.11329	0.005;0.006;0.003	T	0.44726	-0.9309	8	0.15499	T	0.54	.	8.1431	0.31095	0.0:0.0:0.4836:0.5164	.	93;134;801	Q8IXH8-5;Q8IXH8-2;Q8IXH8-4	.;.;.	I	801;93;134	ENSP00000339390:S801I;ENSP00000244049:S93I;ENSP00000310845:S134I	ENSP00000244049:S93I	S	+	2	0	CDH26	58021083	0.007000	0.16637	0.004000	0.12327	0.011000	0.07611	0.433000	0.21477	0.253000	0.21552	-0.535000	0.04281	AGC	CDH26	-	NULL	ENSG00000124215		0.522	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		-	0.00	62	0	G	NM_177980		58587688	+1	tier1	-	no_errors	ENST00000348616	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.005	T
CDH9	1007	genome.wustl.edu	37	5	26988213	26988213	+	Splice_Site	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:26988213C>A	ENST00000231021.4	-	2	400	c.228G>T	c.(226-228)aaG>aaT	p.K76N		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	76	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AAATTCTTACCTTGCCTACAT	0.348																																					Melanoma(8;187 585 15745 40864 52829)												0													62.0	60.0	61.0					5																	26988213		2203	4300	6503	SO:0001630	splice_region_variant	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.228+1G>T	5.37:g.26988213C>A			Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K76N	ENST00000231021.4	37	c.228	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813034	0.70912	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	T;T;T	0.52526	0.66;0.66;1.22	5.64	5.64	0.86602	Cadherin (2);Cadherin-like (1);	0.049791	0.85682	D	0.000000	T	0.76140	0.3946	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.81914	0.995;0.97	T	0.81113	-0.1080	9	.	.	.	.	18.2526	0.90009	0.0:1.0:0.0:0.0	.	76;76	E7EPN0;Q9ULB4	.;CADH9_HUMAN	N	76	ENSP00000231021:K76N;ENSP00000426239:K76N;ENSP00000422538:K76N	.	K	-	3	2	CDH9	27023970	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.447000	0.80620	2.652000	0.90054	0.591000	0.81541	AAG	CDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin	ENSG00000113100		0.348	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	-	0.00	67	0	C	NM_016279	Missense_Mutation	26988213	-1	tier1	-	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	A
CDHR3	222256	genome.wustl.edu	37	7	105653427	105653427	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:105653427G>T	ENST00000317716.9	+	9	1254	c.1174G>T	c.(1174-1176)Ggg>Tgg	p.G392W	CDHR3_ENST00000343407.5_Missense_Mutation_p.G109W|CDHR3_ENST00000541203.1_3'UTR|CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000478080.1_Missense_Mutation_p.G304W|CDHR3_ENST00000542731.1_Missense_Mutation_p.G392W	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	392	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						ATCTGGAGTGGGGAGCGGCAG	0.478																																																	0													153.0	149.0	150.0					7																	105653427		1944	4165	6109	SO:0001583	missense	0			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.1174G>T	7.37:g.105653427G>T	ENSP00000325954:p.Gly392Trp		Q8TCI7	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G392W	ENST00000317716.9	37	c.1174	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118464	0.56505	.	.	ENSG00000128536	ENST00000542731;ENST00000343407;ENST00000317716;ENST00000478080;ENST00000466045	T;T;T;T;T	0.64260	0.21;0.21;0.21;-0.09;-0.09	5.23	4.34	0.51931	Cadherin (3);Cadherin-like (1);	0.081350	0.51477	D	0.000093	T	0.76990	0.4065	M	0.75264	2.295	0.41665	D	0.989201	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.993;0.998;0.998	T	0.79761	-0.1667	10	0.72032	D	0.01	-25.0823	12.3871	0.55338	0.0797:0.0:0.9203:0.0	.	109;379;392;304	Q6ZTQ4-2;B3KYA0;Q6ZTQ4;B7Z8X2	.;.;CDHR3_HUMAN;.	W	392;109;392;304;150	ENSP00000439766:G392W;ENSP00000341510:G109W;ENSP00000325954:G392W;ENSP00000417771:G304W;ENSP00000419017:G150W	ENSP00000325954:G392W	G	+	1	0	CDHR3	105440663	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	3.709000	0.54853	2.447000	0.82792	0.484000	0.47621	GGG	CDHR3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000128536		0.478	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2		0.00	38	0	G	NM_152750		105653427	+1			no_errors	ENST00000317716	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	T
CDKN2A	1029	genome.wustl.edu	37	9	21971154	21971155	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	CG	CG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr9:21971154_21971155delCG	ENST00000304494.5	-	2	473_474	c.203_204delCG	c.(202-204)gcgfs	p.A68fs	CDKN2A_ENST00000579755.1_Frame_Shift_Del_p.G83fs|CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.A68fs|CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.A68fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000497750.1_Frame_Shift_Del_p.A17fs|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.A68fs|CDKN2A_ENST00000578845.2_Frame_Shift_Del_p.A17fs|CDKN2A_ENST00000361570.3_Frame_Shift_Del_p.G124fs|CDKN2A_ENST00000479692.2_Frame_Shift_Del_p.A17fs|CDKN2A_ENST00000494262.1_Frame_Shift_Del_p.A17fs|CDKN2A_ENST00000498628.2_Frame_Shift_Del_p.A17fs|CDKN2A_ENST00000530628.2_Frame_Shift_Del_p.G83fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	68			A -> L (in CMM2; requires 2 nucleotide substitutions).|A -> T (in an esophagus tumor).|A -> V. {ECO:0000269|PubMed:8710906}.|Missing (in melanoma; loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.A68V(3)|p.E61fs*49(2)|p.A68A(2)|p.E61fs*50(1)|p.R122fs*49(1)|p.A68E(1)|p.E61_L94del(1)|p.0(1)|p.A68fs*51(1)|p.L64_E69>Q(1)|p.V59fs*45(1)|p.L65fs*38(1)|p.L65fs*77(1)|p.A68fs*3(1)|p.L63fs*75(1)|p.E69fs*51(1)|p.G124fs*51(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		AGTTGGGCTCCGCGCCGTGGAG	0.708		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1380	Whole gene deletion(1316)|Unknown(44)|Deletion - Frameshift(11)|Substitution - Missense(4)|Substitution - coding silent(2)|Deletion - In frame(1)|Insertion - Frameshift(1)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(285)|skin(177)|central_nervous_system(167)|lung(145)|urinary_tract(91)|bone(74)|soft_tissue(58)|oesophagus(55)|pleura(51)|upper_aerodigestive_tract(51)|ovary(37)|kidney(33)|breast(33)|pancreas(32)|biliary_tract(14)|thyroid(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	GRCh37	CM960270|CX984029	CDKN2A	M|X																																				SO:0001589	frameshift_variant	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.203_204delCG	9.37:g.21971156_21971157delCG	ENSP00000307101:p.Ala68fs		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	pfam_Cyclin_kinase-Inhib_2A	p.G124fs	ENST00000304494.5	37	c.370_369	CCDS6510.1	9																																																																																			CDKN2A	-	NULL	ENSG00000147889		0.708	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1		0.00	14	0	CG	NM_000077		21971155	-1	tier1		no_errors	ENST00000361570	ensembl	human	known	74_37	frame_shift_del	28.57	5	2	DEL	0.054:0.999	-
CDRT1	374286	genome.wustl.edu	37	17	15522728	15522728	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:15522728G>T	ENST00000395906.3	-	1	98	c.99C>A	c.(97-99)gtC>gtA	p.V33V	RP11-385D13.1_ENST00000455584.2_Intron	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	33										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		TCCAGGCTAAGACACGCGTCT	0.463																																																	0													274.0	280.0	278.0					17																	15522728		2202	4299	6501	SO:0001819	synonymous_variant	0			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.99C>A	17.37:g.15522728G>T			O43848|O95611	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V33	ENST00000395906.3	37	c.99	CCDS45619.1	17																																																																																			CDRT1	-	NULL	ENSG00000241322		0.463	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	HGNC	protein_coding	OTTHUMT00000448127.1	-	0.00	106	0	G	NM_006382		15522728	-1	tier1	-	no_errors	ENST00000395906	ensembl	human	known	74_37	silent	30.77	89	40	SNP	0.185	T
CHST8	64377	genome.wustl.edu	37	19	34263698	34263698	+	Silent	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:34263698C>T	ENST00000262622.4	+	4	1763	c.1005C>T	c.(1003-1005)tgC>tgT	p.C335C	CHST8_ENST00000438847.3_Silent_p.C335C|CHST8_ENST00000434302.1_Silent_p.C335C	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	335					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					GCCGGCTCTGCAGCCCCTGCC	0.622																																																	0													71.0	55.0	60.0					19																	34263698		2203	4300	6503	SO:0001819	synonymous_variant	0			AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.1005C>T	19.37:g.34263698C>T			Q9H3N2	Silent	SNP	pfam_Sulfotransferase	p.C335	ENST00000262622.4	37	c.1005	CCDS12433.1	19																																																																																			CHST8	-	pfam_Sulfotransferase	ENSG00000124302		0.622	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHST8	HGNC	protein_coding	OTTHUMT00000451453.1	-	0.00	38	0	C	NM_022467		34263698	+1	tier1	-	no_errors	ENST00000262622	ensembl	human	known	74_37	silent	56.36	24	31	SNP	1.000	T
CIZ1	25792	genome.wustl.edu	37	9	130947923	130947923	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr9:130947923G>T	ENST00000393608.1	-	5	693	c.491C>A	c.(490-492)cCt>cAt	p.P164H	CIZ1_ENST00000372954.1_Missense_Mutation_p.P140H|CIZ1_ENST00000541172.1_Missense_Mutation_p.P63H|CIZ1_ENST00000372948.3_Missense_Mutation_p.P164H|CIZ1_ENST00000372938.5_Missense_Mutation_p.P164H|CIZ1_ENST00000538431.1_Missense_Mutation_p.P164H|CIZ1_ENST00000476727.2_5'UTR|CIZ1_ENST00000357558.5_Missense_Mutation_p.P164H|CIZ1_ENST00000277465.4_Missense_Mutation_p.P164H|CIZ1_ENST00000325721.8_Missense_Mutation_p.P140H	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	164					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						GACCCCAACAGGAGGAGGTCC	0.612																																																	0													65.0	65.0	65.0					9																	130947923		2203	4300	6503	SO:0001583	missense	0			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.491C>A	9.37:g.130947923G>T	ENSP00000377232:p.Pro164His		A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,pfscan_Znf_C2H2_matrin	p.P164H	ENST00000393608.1	37	c.491	CCDS6894.1	9	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380938	0.82792	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372941;ENST00000372948;ENST00000372938;ENST00000415526;ENST00000324544;ENST00000420484	D;D;D;D;D;D;D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	5.44	5.44	0.79542	.	0.125535	0.37178	N	0.002210	D	0.88559	0.6469	L	0.34521	1.04	0.38891	D	0.957124	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.998;0.94;0.999;0.973;0.973;0.935;0.999;0.94	D	0.89976	0.4097	10	0.87932	D	0	-14.0367	16.1154	0.81302	0.0:0.0:1.0:0.0	.	164;164;164;164;140;164;140;164	B7Z3U7;B4E0A3;F5H2X7;Q9ULV3-4;Q9ULV3-3;Q9ULV3;Q9ULV3-2;Q5SYW2	.;.;.;.;.;CIZ1_HUMAN;.;.	H	140;164;164;164;140;131;63;164;140;164;164;91;164;164	ENSP00000362045:P140H;ENSP00000377232:P164H;ENSP00000439244:P164H;ENSP00000350169:P164H;ENSP00000320374:P140H;ENSP00000445057:P63H;ENSP00000277465:P164H;ENSP00000362039:P164H;ENSP00000362029:P164H;ENSP00000398011:P91H;ENSP00000321780:P164H;ENSP00000407265:P164H	ENSP00000277465:P164H	P	-	2	0	CIZ1	129987744	1.000000	0.71417	0.981000	0.43875	0.972000	0.66771	5.234000	0.65343	2.832000	0.97577	0.655000	0.94253	CCT	CIZ1	-	NULL	ENSG00000148337		0.612	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1		0.00	102	0	G	NM_012127		130947923	-1			no_errors	ENST00000538431	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.991	T
CLDN6	9074	genome.wustl.edu	37	16	3065855	3065855	+	Silent	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:3065855C>A	ENST00000396925.1	-	3	596	c.168G>T	c.(166-168)gtG>gtT	p.V56V	TNFRSF12A_ENST00000573001.1_5'Flank|CLDN6_ENST00000572154.1_Intron|CLDN6_ENST00000328796.4_Silent_p.V56V			P56747	CLD6_HUMAN	claudin 6	56					calcium-independent cell-cell adhesion (GO:0016338)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	10						CGGTGCTCTGCACCACGCAGG	0.637																																																	0													151.0	115.0	127.0					16																	3065855		2198	4300	6498	SO:0001819	synonymous_variant	0			AJ249735	CCDS10488.1	16p13.3	2008-08-01			ENSG00000184697	ENSG00000184697		"""Claudins"""	2048	protein-coding gene	gene with protein product		615798				9892664, 18234789	Standard	NM_021195		Approved		uc002csu.4	P56747	OTTHUMG00000128999	ENST00000396925.1:c.168G>T	16.37:g.3065855C>A			B3KQP9|D3DUA5	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin6	p.V56	ENST00000396925.1	37	c.168	CCDS10488.1	16																																																																																			CLDN6	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000184697		0.637	CLDN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN6	HGNC	protein_coding	OTTHUMT00000250988.1	-	0.00	44	0	C	NM_021195		3065855	-1	tier1	-	no_errors	ENST00000328796	ensembl	human	known	74_37	silent	8.51	43	4	SNP	1.000	A
CLK3	1198	genome.wustl.edu	37	15	74922200	74922200	+	Silent	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr15:74922200C>T	ENST00000395066.3	+	13	2354	c.1893C>T	c.(1891-1893)caC>caT	p.H631H	CLK3_ENST00000348245.3_3'UTR|CLK3_ENST00000345005.4_Silent_p.H483H|CLK3_ENST00000352989.5_Silent_p.H460H	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	631					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						GGTCCTTCCACACCAGCCGCA	0.657																																					Ovarian(133;694 1754 28950 29027 31859)												0													22.0	19.0	20.0					15																	74922200		2195	4291	6486	SO:0001819	synonymous_variant	0			L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.1893C>T	15.37:g.74922200C>T			D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H631	ENST00000395066.3	37	c.1893	CCDS45304.1	15																																																																																			CLK3	-	NULL	ENSG00000179335		0.657	CLK3-003	KNOWN	basic|CCDS	protein_coding	CLK3	HGNC	protein_coding	OTTHUMT00000390442.3	-	0.00	34	0	C			74922200	+1	tier1	-	no_errors	ENST00000395066	ensembl	human	known	74_37	silent	38.24	21	13	SNP	0.825	T
CNTD1	124817	genome.wustl.edu	37	17	40961790	40961790	+	3'UTR	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:40961790T>C	ENST00000588408.1	+	0	1506				CNTD1_ENST00000588527.1_3'UTR|CNTD1_ENST00000315066.5_3'UTR	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1											central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		AGTTGTTTCATTTTTGTTTAA	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.*237T>C	17.37:g.40961790T>C			Q658Q6|Q8NEP1	RNA	SNP	-	NULL	ENST00000588408.1	37	NULL	CCDS11440.1	17																																																																																			CNTD1	-	-	ENSG00000176563		0.348	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTD1	HGNC	protein_coding	OTTHUMT00000452398.1	-	0.00	9	0	T	NM_173478		40961790	+1	tier1	-	no_errors	ENST00000315066	ensembl	human	known	74_37	rna	75.00	3	9	SNP	0.289	C
COL11A1	1301	genome.wustl.edu	37	1	103364294	103364294	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:103364294G>T	ENST00000370096.3	-	56	4488	c.4176C>A	c.(4174-4176)acC>acA	p.T1392T	COL11A1_ENST00000353414.4_Silent_p.T1353T|COL11A1_ENST00000512756.1_Silent_p.T1276T|COL11A1_ENST00000358392.2_Silent_p.T1404T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1392	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CGACTGGGCCGGTTTTTCCAG	0.468																																																	0													44.0	46.0	46.0					1																	103364294		2203	4300	6503	SO:0001819	synonymous_variant	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4176C>A	1.37:g.103364294G>T			B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.T1404	ENST00000370096.3	37	c.4212	CCDS778.1	1																																																																																			COL11A1	-	NULL	ENSG00000060718		0.468	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	229	0	G	NM_080630		103364294	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	silent	9.28	215	22	SNP	0.985	T
CPSF6	11052	genome.wustl.edu	37	12	69656282	69656282	+	Silent	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:69656282T>C	ENST00000435070.2	+	9	1709	c.1599T>C	c.(1597-1599)gaT>gaC	p.D533D	CPSF6_ENST00000266679.8_Silent_p.D570D|CPSF6_ENST00000551516.1_Missense_Mutation_p.I36T|CPSF6_ENST00000456847.3_Silent_p.D460D	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	533	Arg-rich.|Sufficient for nuclear targeting.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			GGCACCGGGATcgtgaccgag	0.493																																																	0													203.0	146.0	165.0					12																	69656282		2203	4300	6503	SO:0001819	synonymous_variant	0			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1599T>C	12.37:g.69656282T>C			A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	NULL	p.I36T	ENST00000435070.2	37	c.107	CCDS8988.1	12	.	.	.	.	.	.	.	.	.	.	T	10.94	1.491734	0.26774	.	.	ENSG00000111605	ENST00000551516	.	.	.	5.74	-0.151	0.13411	.	.	.	.	.	T	0.35653	0.0939	.	.	.	0.23210	N	0.998116	.	.	.	.	.	.	T	0.33163	-0.9879	4	.	.	.	-13.4528	10.6393	0.45584	0.0:0.3465:0.0:0.6535	.	.	.	.	T	36	.	.	I	+	2	0	CPSF6	67942549	0.997000	0.39634	0.993000	0.49108	0.976000	0.68499	0.346000	0.19997	0.018000	0.15052	0.528000	0.53228	ATC	CPSF6	-	NULL	ENSG00000111605		0.493	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF6	HGNC	protein_coding	OTTHUMT00000403609.1	-	0.00	45	0	T	NM_007007		69656282	+1	tier1	-	no_errors	ENST00000551516	ensembl	human	putative	74_37	missense	15.28	326	59	SNP	0.987	C
CPSF6	11052	genome.wustl.edu	37	12	69656279	69656279	+	Silent	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:69656279G>A	ENST00000435070.2	+	9	1706	c.1596G>A	c.(1594-1596)cgG>cgA	p.R532R	CPSF6_ENST00000266679.8_Silent_p.R569R|CPSF6_ENST00000551516.1_Missense_Mutation_p.G35E|CPSF6_ENST00000456847.3_Silent_p.R459R	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	532	Arg-rich.|Sufficient for nuclear targeting.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			AGAGGCACCGGGATcgtgacc	0.488																																																	0													200.0	145.0	163.0					12																	69656279		2203	4300	6503	SO:0001819	synonymous_variant	0			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1596G>A	12.37:g.69656279G>A			A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	NULL	p.G35E	ENST00000435070.2	37	c.104	CCDS8988.1	12	.	.	.	.	.	.	.	.	.	.	G	11.20	1.568547	0.28003	.	.	ENSG00000111605	ENST00000551516	.	.	.	5.74	1.65	0.23941	.	.	.	.	.	T	0.23289	0.0563	.	.	.	0.25545	N	0.987144	.	.	.	.	.	.	T	0.22347	-1.0219	4	.	.	.	-6.2025	2.7884	0.05380	0.1391:0.1113:0.4077:0.3419	.	.	.	.	E	35	.	.	G	+	2	0	CPSF6	67942546	0.924000	0.31332	0.999000	0.59377	0.980000	0.70556	0.014000	0.13333	0.091000	0.17302	0.650000	0.86243	GGG	CPSF6	-	NULL	ENSG00000111605		0.488	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF6	HGNC	protein_coding	OTTHUMT00000403609.1		0.00	44	0	G	NM_007007		69656279	+1			no_errors	ENST00000551516	ensembl	human	putative	74_37	missense	13.25	333	51	SNP	0.983	A
CPSF6	11052	genome.wustl.edu	37	12	69656306	69656306	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:69656306G>C	ENST00000435070.2	+	9	1733	c.1623G>C	c.(1621-1623)gaG>gaC	p.E541D	CPSF6_ENST00000266679.8_Missense_Mutation_p.E578D|CPSF6_ENST00000551516.1_Missense_Mutation_p.S44T|CPSF6_ENST00000456847.3_Missense_Mutation_p.E468D	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	541	Arg-rich.|Sufficient for nuclear targeting.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			gtgaccgagagcgtgaccgag	0.483																																																	0													215.0	149.0	171.0					12																	69656306		2203	4300	6503	SO:0001583	missense	0			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1623G>C	12.37:g.69656306G>C	ENSP00000391774:p.Glu541Asp		A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E578D	ENST00000435070.2	37	c.1734	CCDS8988.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.115|8.115	0.779585|0.779585	0.16120|0.16120	.|.	.|.	ENSG00000111605|ENSG00000111605	ENST00000435070;ENST00000456847;ENST00000266679|ENST00000551516	T;T;T|.	0.30981|.	1.51;1.51;1.51|.	5.74|5.74	-6.76|-6.76	0.01732|0.01732	.|.	0.043653|.	0.85682|.	D|.	0.000000|.	T|T	0.20941|0.20941	0.0504|0.0504	N|N	0.10809|0.10809	0.05|0.05	0.09310|0.09310	N|N	1|1	B;B;B|.	0.11235|.	0.0;0.004;0.001|.	B;B;B|.	0.11329|.	0.0;0.006;0.002|.	T|T	0.32348|0.32348	-0.9910|-0.9910	9|5	.|.	.|.	.|.	-11.2038|-11.2038	11.9982|11.9982	0.53216|0.53216	0.6417:0.0:0.273:0.0853|0.6417:0.0:0.273:0.0853	.|.	290;578;541|.	B4DSU9;Q16630-2;Q16630|.	.;.;CPSF6_HUMAN|.	D|T	541;468;578|44	ENSP00000391774:E541D;ENSP00000391437:E468D;ENSP00000266679:E578D|.	.|.	E|S	+|+	3|2	2|0	CPSF6|CPSF6	67942573|67942573	0.700000|0.700000	0.27796|0.27796	0.311000|0.311000	0.25182|0.25182	0.936000|0.936000	0.57629|0.57629	-0.158000|-0.158000	0.10070|0.10070	-1.264000|-1.264000	0.02452|0.02452	-1.608000|-1.608000	0.00805|0.00805	GAG|AGC	CPSF6	-	NULL	ENSG00000111605		0.483	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF6	HGNC	protein_coding	OTTHUMT00000403609.1	-	0.00	43	0	G	NM_007007		69656306	+1	tier1	-	no_errors	ENST00000266679	ensembl	human	known	74_37	missense	38.46	216	135	SNP	0.033	C
CPSF6	11052	genome.wustl.edu	37	12	69656321	69656321	+	Silent	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:69656321C>T	ENST00000435070.2	+	9	1748	c.1638C>T	c.(1636-1638)cgC>cgT	p.R546R	CPSF6_ENST00000266679.8_Silent_p.R583R|CPSF6_ENST00000551516.1_Missense_Mutation_p.A49V|CPSF6_ENST00000456847.3_Silent_p.R473R	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	546	Arg-rich.|Sufficient for nuclear targeting.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			accgagagcgCGAATATCGTC	0.473																																																	0													205.0	140.0	162.0					12																	69656321		2203	4300	6503	SO:0001819	synonymous_variant	0			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1638C>T	12.37:g.69656321C>T			A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	NULL	p.A49V	ENST00000435070.2	37	c.146	CCDS8988.1	12	.	.	.	.	.	.	.	.	.	.	C	12.13	1.846804	0.32606	.	.	ENSG00000111605	ENST00000551516	.	.	.	5.75	1.12	0.20585	.	.	.	.	.	T	0.35158	0.0922	.	.	.	0.24121	N	0.995807	.	.	.	.	.	.	T	0.26121	-1.0112	4	.	.	.	-5.3309	9.4649	0.38806	0.5679:0.2684:0.1636:0.0	.	.	.	.	V	49	.	.	A	+	2	0	CPSF6	67942588	0.959000	0.32827	1.000000	0.80357	0.991000	0.79684	0.141000	0.16076	0.283000	0.22279	-0.274000	0.10170	GCG	CPSF6	-	NULL	ENSG00000111605		0.473	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF6	HGNC	protein_coding	OTTHUMT00000403609.1		0.00	37	0	C	NM_007007		69656321	+1			no_errors	ENST00000551516	ensembl	human	putative	74_37	missense	20.25	252	64	SNP	0.995	T
CRNKL1	51340	genome.wustl.edu	37	20	20021343	20021343	+	Missense_Mutation	SNP	G	G	A	rs566498711		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:20021343G>A	ENST00000377340.2	-	11	1806	c.1775C>T	c.(1774-1776)gCc>gTc	p.A592V	CRNKL1_ENST00000377327.4_Missense_Mutation_p.A580V|CRNKL1_ENST00000536226.1_Missense_Mutation_p.A431V|CRNKL1_ENST00000521379.1_5'Flank	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	592	Mediates interaction with HSP90. {ECO:0000250|UniProtKB:P63154}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						TGCTCTTCTGGCTAATGACAG	0.348																																																	0													122.0	121.0	121.0					20																	20021343		2203	4300	6503	SO:0001583	missense	0			AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.1775C>T	20.37:g.20021343G>A	ENSP00000366557:p.Ala592Val		A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	pfam_HAT,pfam_Suf,smart_HAT,pfscan_TPR-contain_dom	p.A592V	ENST00000377340.2	37	c.1775	CCDS33446.1	20	.	.	.	.	.	.	.	.	.	.	G	33	5.240319	0.95240	.	.	ENSG00000101343	ENST00000377327;ENST00000377340;ENST00000536226	T;T;T	0.44881	0.91;0.91;0.91	6.03	6.03	0.97812	Tetratricopeptide-like helical (1);	0.197875	0.53938	N	0.000059	T	0.65450	0.2692	M	0.91406	3.205	0.80722	D	1	P	0.47677	0.899	P	0.49012	0.598	T	0.72221	-0.4356	10	0.62326	D	0.03	-6.7159	20.5568	0.99304	0.0:0.0:1.0:0.0	.	592	Q9BZJ0	CRNL1_HUMAN	V	580;592;431	ENSP00000366544:A580V;ENSP00000366557:A592V;ENSP00000440733:A431V	ENSP00000366544:A580V	A	-	2	0	CRNKL1	19969343	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.869000	0.99810	2.861000	0.98227	0.655000	0.94253	GCC	CRNKL1	-	smart_HAT	ENSG00000101343		0.348	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	HGNC	protein_coding	OTTHUMT00000127787.1	-	0.00	25	0	G			20021343	-1	tier1	-	no_errors	ENST00000377340	ensembl	human	known	74_37	missense	34.09	29	15	SNP	1.000	A
CSRP2	1466	genome.wustl.edu	37	12	77259983	77259983	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:77259983C>T	ENST00000311083.5	-	2	181	c.58G>A	c.(58-60)Gca>Aca	p.A20T	CSRP2_ENST00000547435.1_Missense_Mutation_p.A20T|CSRP2_ENST00000546966.1_Missense_Mutation_p.A20T|CSRP2_ENST00000552330.1_Missense_Mutation_p.A20T	NM_001321.1	NP_001312.1	Q16527	CSRP2_HUMAN	cysteine and glycine-rich protein 2	20	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)	8						ACCTCTTCTGCGTGGTACACG	0.522																																																	0													122.0	90.0	100.0					12																	77259983		2203	4300	6503	SO:0001583	missense	0			BC000992	CCDS9015.1	12q21.1	2005-10-30				ENSG00000175183			2470	protein-coding gene	gene with protein product		601871				7499425, 9286703	Standard	XM_006719258		Approved	SmLIM, CRP2, LMO5	uc001syl.1	Q16527		ENST00000311083.5:c.58G>A	12.37:g.77259983C>T	ENSP00000310901:p.Ala20Thr		Q93030	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A20T	ENST00000311083.5	37	c.58	CCDS9015.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.724913	0.96847	.	.	ENSG00000175183	ENST00000311083;ENST00000552330;ENST00000546966;ENST00000547435	D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09	5.12	5.12	0.69794	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.95430	0.8516	M	0.67700	2.07	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	D	0.95146	0.8268	10	0.51188	T	0.08	.	18.9377	0.92592	0.0:1.0:0.0:0.0	.	20	Q16527	CSRP2_HUMAN	T	20	ENSP00000310901:A20T;ENSP00000449824:A20T;ENSP00000450056:A20T;ENSP00000450143:A20T	ENSP00000310901:A20T	A	-	1	0	CSRP2	75784114	1.000000	0.71417	0.945000	0.38365	0.949000	0.60115	7.709000	0.84645	2.546000	0.85860	0.650000	0.86243	GCA	CSRP2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000175183		0.522	CSRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRP2	HGNC	protein_coding	OTTHUMT00000406572.1		0.00	20	0	C	NM_001321		77259983	-1			no_errors	ENST00000311083	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
DCT	1638	genome.wustl.edu	37	13	95131328	95131328	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr13:95131328C>T	ENST00000377028.5	-	1	595	c.182G>A	c.(181-183)tGc>tAc	p.C61Y	DCT_ENST00000446125.1_Missense_Mutation_p.C61Y	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	61					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CACCTCTGTGCACTGCCCCCG	0.607																																																	0													71.0	62.0	65.0					13																	95131328		2203	4300	6503	SO:0001583	missense	0			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.182G>A	13.37:g.95131328C>T	ENSP00000366227:p.Cys61Tyr		Q09GT4	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.C61Y	ENST00000377028.5	37	c.182	CCDS9470.1	13	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117179	0.77323	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.84516	-1.86;-1.86	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.94810	0.8324	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.96128	0.9090	10	0.87932	D	0	-19.2918	18.78	0.91928	0.0:1.0:0.0:0.0	.	61;61	Q09GT4;P40126	.;TYRP2_HUMAN	Y	61	ENSP00000366227:C61Y;ENSP00000392762:C61Y	ENSP00000366227:C61Y	C	-	2	0	DCT	93929329	1.000000	0.71417	0.974000	0.42286	0.663000	0.39108	7.298000	0.78815	2.425000	0.82216	0.650000	0.86243	TGC	DCT	-	NULL	ENSG00000080166		0.607	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	HGNC	protein_coding	OTTHUMT00000045461.3	-	0.00	34	0	C			95131328	-1	tier1	-	no_errors	ENST00000446125	ensembl	human	known	74_37	missense	26.00	37	13	SNP	0.999	T
DEF6	50619	genome.wustl.edu	37	6	35280402	35280402	+	Splice_Site	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:35280402G>T	ENST00000316637.5	+	5	665		c.e5-1		DEF6_ENST00000542066.1_Intron	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)							cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						CCGGCTGGCAGGGCTACCTGT	0.617																																																	0													34.0	36.0	35.0					6																	35280402		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.661-1G>T	6.37:g.35280402G>T			Q86VF4	Splice_Site	SNP	-	e5-1	ENST00000316637.5	37	c.661-1	CCDS4802.1	6	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402934	0.62288	.	.	ENSG00000023892	ENST00000316637	.	.	.	5.25	3.48	0.39840	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9018	0.52688	0.1418:0.0:0.8582:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DEF6	35388380	1.000000	0.71417	0.998000	0.56505	0.872000	0.50106	7.835000	0.86780	0.721000	0.32231	0.655000	0.94253	.	DEF6	-	-	ENSG00000023892		0.617	DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEF6	HGNC	protein_coding	OTTHUMT00000040276.1		0.00	70	0	G	NM_022047	Intron	35280402	+1			no_errors	ENST00000316637	ensembl	human	known	74_37	splice_site	5.63	67	4	SNP	1.000	T
DMWD	1762	genome.wustl.edu	37	19	46294166	46294166	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:46294166C>A	ENST00000270223.6	-	2	666	c.621G>T	c.(619-621)gaG>gaT	p.E207D	DMWD_ENST00000377735.3_Missense_Mutation_p.E207D|DMWD_ENST00000601370.1_5'UTR	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	207										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		CAATCACCTCCTCATTGAACA	0.562																																																	0													108.0	100.0	103.0					19																	46294166		2203	4300	6503	SO:0001583	missense	0			L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.621G>T	19.37:g.46294166C>A	ENSP00000270223:p.Glu207Asp			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E207D	ENST00000270223.6	37	c.621	CCDS33054.1	19	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529509	0.64860	.	.	ENSG00000185800	ENST00000377735;ENST00000270223	T;T	0.44881	0.91;0.91	3.69	1.09	0.20402	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.071606	0.53938	D	0.000058	T	0.51805	0.1696	L	0.60455	1.87	0.48341	D	0.999634	D;D	0.61697	0.99;0.984	D;D	0.73380	0.98;0.956	T	0.45071	-0.9286	10	0.46703	T	0.11	-21.3756	5.8254	0.18550	0.0:0.5119:0.0:0.4881	.	207;207	G5E9A7;Q09019	.;DMWD_HUMAN	D	207	ENSP00000366964:E207D;ENSP00000270223:E207D	ENSP00000270223:E207D	E	-	3	2	DMWD	50986006	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.713000	0.25794	0.277000	0.22141	0.561000	0.74099	GAG	DMWD	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000185800		0.562	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DMWD	HGNC	protein_coding	OTTHUMT00000402063.1	-	0.00	35	0	C	NM_004943		46294166	-1	tier1	-	no_errors	ENST00000270223	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
DNAH14	127602	genome.wustl.edu	37	1	225586937	225586937	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:225586937G>T	ENST00000445597.2	+	61	10490	c.10490G>T	c.(10489-10491)cGg>cTg	p.R3497L	DNAH14_ENST00000439375.2_Missense_Mutation_p.R4505L|DNAH14_ENST00000430092.1_Missense_Mutation_p.R4505L			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3497					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ATCACAATGCGGGTTGCATTG	0.348																																																	0													92.0	80.0	83.0					1																	225586937		692	1591	2283	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.10490G>T	1.37:g.225586937G>T	ENSP00000409472:p.Arg3497Leu		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.R4505L	ENST00000445597.2	37	c.13514		1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.447524	0.43429	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.08193	3.12;3.12;3.12	5.02	1.61	0.23674	.	.	.	.	.	T	0.05914	0.0154	L	0.27053	0.805	0.80722	D	1	P	0.41748	0.761	B	0.38378	0.272	T	0.39663	-0.9603	9	0.87932	D	0	.	7.3507	0.26689	0.3538:0.0:0.6462:0.0	.	4505	Q0VDD8-4	.	L	3497;4505;4505	ENSP00000409472:R3497L;ENSP00000414402:R4505L;ENSP00000392061:R4505L	ENSP00000414402:R4505L	R	+	2	0	DNAH14	223653560	1.000000	0.71417	0.999000	0.59377	0.928000	0.56348	2.281000	0.43452	0.050000	0.15949	-0.373000	0.07131	CGG	DNAH14	-	pfam_Dynein_heavy_dom	ENSG00000185842		0.348	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	52	0	G	XM_059166		225586937	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	6.58	71	5	SNP	1.000	T
DNAH2	146754	genome.wustl.edu	37	17	7661923	7661923	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:7661923G>T	ENST00000572933.1	+	14	3622	c.2162G>T	c.(2161-2163)gGg>gTg	p.G721V	DNAH2_ENST00000389173.2_Missense_Mutation_p.G721V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	721	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCCTTGAAGGGGGCCAGTGCC	0.537																																																	0													72.0	70.0	71.0					17																	7661923		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.2162G>T	17.37:g.7661923G>T	ENSP00000458355:p.Gly721Val		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G721V	ENST00000572933.1	37	c.2162	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518837	0.64634	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.25579	1.79	5.91	5.91	0.95273	.	0.125717	0.52532	D	0.000078	T	0.53818	0.1820	M	0.75447	2.3	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.50224	-0.8853	10	0.52906	T	0.07	.	19.0726	0.93145	0.0:0.0:1.0:0.0	.	721	Q9P225	DYH2_HUMAN	V	721	ENSP00000373825:G721V	ENSP00000353818:G721V	G	+	2	0	DNAH2	7602648	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.733000	0.74796	2.809000	0.96659	0.555000	0.69702	GGG	DNAH2	-	NULL	ENSG00000183914		0.537	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	-	0.00	22	0	G	NM_020877		7661923	+1	tier1	-	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	39.39	20	13	SNP	1.000	T
DNAH2	146754	genome.wustl.edu	37	17	7696048	7696048	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:7696048G>A	ENST00000572933.1	+	47	8679	c.7219G>A	c.(7219-7221)Gcc>Acc	p.A2407T	DNAH2_ENST00000389173.2_Missense_Mutation_p.A2407T			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2407	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CAGCTTGGTGGCCAACCAGAA	0.617																																																	0													73.0	63.0	66.0					17																	7696048		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.7219G>A	17.37:g.7696048G>A	ENSP00000458355:p.Ala2407Thr		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A2407T	ENST00000572933.1	37	c.7219	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600420	0.28534	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.22945	1.93	5.47	0.546	0.17196	.	0.539436	0.19197	N	0.120291	T	0.14527	0.0351	L	0.31120	0.905	0.33393	D	0.576382	B	0.06786	0.001	B	0.15870	0.014	T	0.26430	-1.0103	10	0.13470	T	0.59	.	8.2505	0.31715	0.0824:0.0:0.4103:0.5073	.	2407	Q9P225	DYH2_HUMAN	T	2407	ENSP00000373825:A2407T	ENSP00000353818:A2407T	A	+	1	0	DNAH2	7636773	0.244000	0.23889	0.930000	0.37139	0.850000	0.48378	0.384000	0.20668	0.593000	0.29745	0.643000	0.83706	GCC	DNAH2	-	superfamily_P-loop_NTPase	ENSG00000183914		0.617	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1		0.00	18	0	G	NM_020877		7696048	+1			no_errors	ENST00000389173	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.128	A
DNAH5	1767	genome.wustl.edu	37	5	13793634	13793634	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:13793634G>T	ENST00000265104.4	-	49	8318	c.8214C>A	c.(8212-8214)gaC>gaA	p.D2738E		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2738	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D2738E(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CAAAGATCTTGTCCACAGAAG	0.478									Kartagener syndrome																																								1	Substitution - Missense(1)	lung(1)											108.0	112.0	111.0					5																	13793634		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8214C>A	5.37:g.13793634G>T	ENSP00000265104:p.Asp2738Glu		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D2738E	ENST00000265104.4	37	c.8214	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226298	0.79576	.	.	ENSG00000039139	ENST00000265104	T	0.34859	1.34	5.88	5.88	0.94601	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.63426	0.2510	M	0.77103	2.36	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	T	0.63699	-0.6578	10	0.59425	D	0.04	.	20.2366	0.98359	0.0:0.0:1.0:0.0	.	2738	Q8TE73	DYH5_HUMAN	E	2738	ENSP00000265104:D2738E	ENSP00000265104:D2738E	D	-	3	2	DNAH5	13846634	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	2.648000	0.46647	2.792000	0.96026	0.557000	0.71058	GAC	DNAH5	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000039139		0.478	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2		0.00	35	0	G	NM_001369		13793634	-1			no_errors	ENST00000265104	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
DNM1P46	196968	genome.wustl.edu	37	15	100341320	100341320	+	RNA	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr15:100341320C>T	ENST00000341853.1	-	0	326					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										TTCCATTTGCCGCTCCAGCTG	0.582																																																	0													45.0	41.0	42.0					15																	100341320		1544	3554	5098			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100341320C>T			Q3ZCN3	RNA	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.582	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	-	0.00	157	0	C	NR_003260		100341320	-1	tier1	-	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	14.84	131	23	SNP	1.000	T
DOCK2	1794	genome.wustl.edu	37	5	169508923	169508923	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:169508923C>A	ENST00000256935.8	+	51	5445	c.5365C>A	c.(5365-5367)Caa>Aaa	p.Q1789K	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.Q1281K|DOCK2_ENST00000540750.1_Missense_Mutation_p.Q850K	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1789					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GACCTTCCTCCAACTCTCAGA	0.557																																																	0													110.0	102.0	105.0					5																	169508923		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5365C>A	5.37:g.169508923C>A	ENSP00000256935:p.Gln1789Lys		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.Q1789K	ENST00000256935.8	37	c.5365	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	C	10.31	1.314412	0.23908	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.07327	3.85;3.49;3.2	4.84	2.85	0.33270	.	0.808908	0.11154	N	0.593786	T	0.03783	0.0107	N	0.08118	0	0.18873	N	0.999985	B;B;B	0.12013	0.001;0.005;0.002	B;B;B	0.09377	0.002;0.004;0.003	T	0.39683	-0.9602	10	0.05959	T	0.93	.	9.0584	0.36419	0.1658:0.6735:0.1608:0.0	.	1281;345;1789	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	K	1789;1281;850	ENSP00000256935:Q1789K;ENSP00000429283:Q1281K;ENSP00000438827:Q850K	ENSP00000256935:Q1789K	Q	+	1	0	DOCK2	169441501	0.000000	0.05858	0.759000	0.31340	0.990000	0.78478	-0.011000	0.12721	1.098000	0.41479	0.655000	0.94253	CAA	DOCK2	-	NULL	ENSG00000134516		0.557	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2		0.00	42	0	C	NM_004946		169508923	+1			no_errors	ENST00000256935	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.567	A
DTD1	92675	genome.wustl.edu	37	20	18576693	18576693	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:18576693G>T	ENST00000377452.3	+	3	358	c.178G>T	c.(178-180)Ggg>Tgg	p.G60W	DTD1_ENST00000494921.1_3'UTR	NM_080820.4	NP_543010.3	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	60					D-amino acid catabolic process (GO:0019478)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			large_intestine(4)|lung(1)|ovary(2)	7						GGATGAGAGTGGGAAGCACTG	0.493																																																	0													148.0	124.0	132.0					20																	18576693		2203	4300	6503	SO:0001583	missense	0			AF332356	CCDS13138.1	20p11.23	2012-09-25	2012-09-25	2007-02-23	ENSG00000125821	ENSG00000125821			16219	protein-coding gene	gene with protein product		610996	"""chromosome 20 open reading frame 88"", ""D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)"""	C20orf88, HARS2			Standard	NM_080820		Approved	DUEB, MGC119131, MGC41905, bA379J5.3, bA555E18.1, pqn-68	uc002wrf.4	Q8TEA8	OTTHUMG00000031980	ENST00000377452.3:c.178G>T	20.37:g.18576693G>T	ENSP00000366672:p.Gly60Trp		A8K5X5|D3DW37|Q496D1|Q5W184|Q8WXU8|Q9BW67|Q9H464|Q9H474	Missense_Mutation	SNP	pfam_DTyrtRNA_deacyls,superfamily_DTD-like_dom,tigrfam_DTyrtRNA_deacyls	p.G60W	ENST00000377452.3	37	c.178	CCDS13138.1	20	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754182	0.89843	.	.	ENSG00000125821	ENST00000377452	.	.	.	5.83	5.83	0.93111	D-Tyr tRNAtyr deacylase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.91623	0.7353	H	0.99299	4.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94700	0.7882	9	0.87932	D	0	-11.5435	19.0992	0.93266	0.0:0.0:1.0:0.0	.	60	Q8TEA8	DTD1_HUMAN	W	60	.	ENSP00000366672:G60W	G	+	1	0	DTD1	18524693	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.986000	0.88173	2.741000	0.93983	0.655000	0.94253	GGG	DTD1	-	pfam_DTyrtRNA_deacyls,superfamily_DTD-like_dom,tigrfam_DTyrtRNA_deacyls	ENSG00000125821		0.493	DTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTD1	HGNC	protein_coding	OTTHUMT00000078189.3	-	0.00	51	0	G	NM_080820		18576693	+1	tier1	-	no_errors	ENST00000377452	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
DZIP3	9666	genome.wustl.edu	37	3	108363103	108363103	+	Missense_Mutation	SNP	T	T	C	rs201610955		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:108363103T>C	ENST00000361582.3	+	14	1464	c.1234T>C	c.(1234-1236)Ttt>Ctt	p.F412L	DZIP3_ENST00000463306.1_Missense_Mutation_p.F412L	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	412					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						TCGACAAATATTTGATGAGGC	0.333																																																	0													77.0	80.0	79.0					3																	108363103		2203	4300	6503	SO:0001583	missense	0			AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1234T>C	3.37:g.108363103T>C	ENSP00000355028:p.Phe412Leu		B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.F412L	ENST00000361582.3	37	c.1234	CCDS2952.1	3	.	.	.	.	.	.	.	.	.	.	T	14.46	2.542317	0.45280	.	.	ENSG00000198919	ENST00000361582;ENST00000479138;ENST00000463306	T;T;T	0.43688	0.94;0.94;0.94	4.95	3.71	0.42584	.	0.258207	0.28135	N	0.016463	T	0.35158	0.0922	N	0.19112	0.55	0.30468	N	0.773625	D;P	0.56287	0.975;0.787	P;B	0.53102	0.718;0.351	T	0.19192	-1.0313	10	0.41790	T	0.15	-16.6286	7.5091	0.27562	0.1911:0.0:0.0:0.8089	.	412;412	C9J9M8;Q86Y13	.;DZIP3_HUMAN	L	412	ENSP00000355028:F412L;ENSP00000418115:F412L;ENSP00000419981:F412L	ENSP00000355028:F412L	F	+	1	0	DZIP3	109845793	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.953000	0.40352	2.199000	0.70637	0.533000	0.62120	TTT	DZIP3	-	NULL	ENSG00000198919		0.333	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP3	HGNC	protein_coding	OTTHUMT00000353968.1	-	0.00	36	0	T	NM_014648		108363103	+1	tier1	-	no_errors	ENST00000361582	ensembl	human	known	74_37	missense	15.52	98	18	SNP	1.000	C
ECSIT	51295	genome.wustl.edu	37	19	11617015	11617015	+	Missense_Mutation	SNP	T	T	A	rs561466699		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:11617015T>A	ENST00000270517.7	-	8	1415	c.1280A>T	c.(1279-1281)cAg>cTg	p.Q427L	CTC-398G3.6_ENST00000585656.1_5'Flank|ECSIT_ENST00000252440.7_3'UTR|ECSIT_ENST00000417981.2_Missense_Mutation_p.Q213L|ZNF653_ENST00000293771.5_5'Flank|ZNF653_ENST00000593191.1_5'Flank|ECSIT_ENST00000591352.1_5'Flank|ECSIT_ENST00000588998.1_3'UTR|ECSIT_ENST00000591104.1_3'UTR	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	427					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						CTGGCCCTGCTGCTGTCGCTG	0.662																																																	0													55.0	56.0	56.0					19																	11617015		2152	4207	6359	SO:0001583	missense	0			BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.1280A>T	19.37:g.11617015T>A	ENSP00000270517:p.Gln427Leu		E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	pfam_ECSIT	p.Q427L	ENST00000270517.7	37	c.1280	CCDS12262.1	19	.	.	.	.	.	.	.	.	.	.	T	14.41	2.525658	0.44969	.	.	ENSG00000130159	ENST00000270517;ENST00000417981	T;T	0.34472	1.36;1.37	5.6	0.946	0.19549	.	0.493997	0.19588	N	0.110695	T	0.25158	0.0611	L	0.51422	1.61	0.30513	N	0.769259	B;B	0.29646	0.253;0.164	B;B	0.25291	0.059;0.027	T	0.13072	-1.0523	10	0.33940	T	0.23	-26.0387	4.2775	0.10816	0.1387:0.2437:0.0:0.6176	.	213;427	E9PAN9;Q9BQ95	.;ECSIT_HUMAN	L	427;213	ENSP00000270517:Q427L;ENSP00000412712:Q213L	ENSP00000270517:Q427L	Q	-	2	0	ECSIT	11478015	0.979000	0.34478	0.729000	0.30791	0.837000	0.47467	0.263000	0.18478	0.044000	0.15775	-0.386000	0.06593	CAG	ECSIT	-	NULL	ENSG00000130159		0.662	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECSIT	HGNC	protein_coding	OTTHUMT00000442603.2	-	0.00	47	0	T	NM_016581		11617015	-1	tier1	-	no_errors	ENST00000270517	ensembl	human	known	74_37	missense	22.92	37	11	SNP	0.007	A
EFCAB10	100130771	genome.wustl.edu	37	7	105209877	105209877	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:105209877A>G	ENST00000480514.1	-	2	284	c.248T>C	c.(247-249)aTa>aCa	p.I83T	EFCAB10_ENST00000485614.1_Missense_Mutation_p.I83T|RP11-251G23.5_ENST00000609827.1_RNA|EFCAB10_ENST00000460135.1_Intron|EFCAB10_ENST00000490493.1_5'UTR|EFCAB10_ENST00000486180.1_Missense_Mutation_p.I83T			A6NFE3	EFC10_HUMAN	EF-hand calcium binding domain 10	83	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)										CACAAATGATATGGTGCCTCT	0.383																																																	0																																										SO:0001583	missense	0			BC105284		7q22.2	2013-01-29			ENSG00000185055	ENSG00000185055		"""EF-hand domain containing"""	34531	protein-coding gene	gene with protein product							Standard	NR_027068		Approved		uc003vdc.4	A6NFE3	OTTHUMG00000157397	ENST00000480514.1:c.248T>C	7.37:g.105209877A>G	ENSP00000418678:p.Ile83Thr			Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b,pfscan_EF_hand_dom	p.I83T	ENST00000480514.1	37	c.248		7	.	.	.	.	.	.	.	.	.	.	A	18.32	3.598488	0.66332	.	.	ENSG00000185055	ENST00000480514;ENST00000485614;ENST00000486180	.	.	.	5.95	4.77	0.60923	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	.	.	.	0.80722	D	1	D	0.56521	0.976	P	0.52424	0.698	T	0.69939	-0.5009	8	0.87932	D	0	-35.3787	12.0293	0.53390	0.9314:0.0:0.0686:0.0	.	83	A6NFE3	EFC10_HUMAN	T	83	.	ENSP00000418678:I83T	I	-	2	0	EFCAB10	104997113	1.000000	0.71417	0.966000	0.40874	0.792000	0.44763	4.683000	0.61679	1.032000	0.39892	0.528000	0.53228	ATA	EFCAB10	-	pfscan_EF_hand_dom	ENSG00000185055		0.383	EFCAB10-001	KNOWN	basic|appris_candidate	protein_coding	EFCAB10	HGNC	protein_coding	OTTHUMT00000348673.1	-	0.00	69	0	A			105209877	-1	tier1	-	no_errors	ENST00000480514	ensembl	human	known	74_37	missense	37.33	47	28	SNP	0.829	G
EML3	256364	genome.wustl.edu	37	11	62371469	62371469	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:62371469T>C	ENST00000394773.2	-	18	2423	c.2116A>G	c.(2116-2118)Atc>Gtc	p.I706V	EML3_ENST00000278845.4_Missense_Mutation_p.I707V|EML3_ENST00000438258.1_5'Flank|EML3_ENST00000529309.1_Missense_Mutation_p.I706V|EML3_ENST00000531557.1_Missense_Mutation_p.I489V|MTA2_ENST00000278823.2_5'Flank|MTA2_ENST00000527204.1_5'Flank|EML3_ENST00000494176.2_Missense_Mutation_p.I678V|RP11-831H9.3_ENST00000532626.1_RNA	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	706						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						ACACTATAGATGTAGATCACG	0.532																																																	0													111.0	95.0	100.0					11																	62371469		2202	4299	6501	SO:0001583	missense	0			AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.2116A>G	11.37:g.62371469T>C	ENSP00000378254:p.Ile706Val		Q6ZQW7|Q8NA55	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I706V	ENST00000394773.2	37	c.2116	CCDS8023.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.72|14.72	2.619622|2.619622	0.46736|0.46736	.|.	.|.	ENSG00000149499|ENSG00000149499	ENST00000394776|ENST00000394773;ENST00000278845;ENST00000531557;ENST00000494176;ENST00000529309	.|T;T;T;T;T	.|0.60040	.|1.13;1.13;0.22;1.66;1.66	5.5|5.5	5.5|5.5	0.81552|0.81552	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.049163	.|0.85682	.|N	.|0.000000	T|T	0.65502|0.65502	0.2697|0.2697	L|L	0.35723|0.35723	1.085|1.085	0.45272|0.45272	D|D	0.998273|0.998273	.|P;P;B;D;P	.|0.53151	.|0.843;0.87;0.148;0.958;0.607	.|P;P;B;D;B	.|0.70716	.|0.628;0.673;0.085;0.97;0.224	T|T	0.62756|0.62756	-0.6787|-0.6787	5|10	.|0.31617	.|T	.|0.26	-22.4873|-22.4873	13.5629|13.5629	0.61799|0.61799	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|706;706;489;707;678	.|Q32P44-2;Q32P44;G3V195;B7WPE2;G3V1D0	.|.;EMAL3_HUMAN;.;.;.	R|V	700|706;707;489;678;706	.|ENSP00000378254:I706V;ENSP00000278845:I707V;ENSP00000433417:I489V;ENSP00000435064:I678V;ENSP00000434513:I706V	.|ENSP00000278845:I707V	H|I	-|-	2|1	0|0	EML3|EML3	62128045|62128045	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.969000|1.969000	0.40510|0.40510	2.097000|2.097000	0.63578|0.63578	0.454000|0.454000	0.30748|0.30748	CAT|ATC	EML3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000149499		0.532	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	EML3	HGNC	protein_coding	OTTHUMT00000313432.1	-	0.00	29	0	T	NM_153265		62371469	-1	tier1	-	no_errors	ENST00000529309	ensembl	human	known	74_37	missense	25.00	27	9	SNP	1.000	C
ENO4	387712	genome.wustl.edu	37	10	118616072	118616072	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:118616072G>A	ENST00000341276.5	+	4	422	c.367G>A	c.(367-369)Gcg>Acg	p.A123T	ENO4_ENST00000409522.1_Intron|ENO4_ENST00000369207.2_5'Flank	NM_001242699.1	NP_001229628.1	A6NNW6	ENO4_HUMAN	enolase family member 4	123					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						GCTGGCCAAGGCGGAGGAGGC	0.557																																																	0																																										SO:0001583	missense	0				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000341276.5:c.367G>A	10.37:g.118616072G>A	ENSP00000345555:p.Ala123Thr		B8ZZN9	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N	p.A123T	ENST00000341276.5	37	c.367		10	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864114	0.32884	.	.	ENSG00000188316	ENST00000341276	T	0.29397	1.57	5.87	4.01	0.46588	.	0.322809	0.29376	N	0.012336	T	0.32315	0.0825	L	0.43701	1.375	0.09310	N	1	.	.	.	.	.	.	T	0.15150	-1.0447	8	0.51188	T	0.08	-4.8853	9.8245	0.40903	0.1601:0.0:0.8399:0.0	.	.	.	.	T	123	ENSP00000345555:A123T	ENSP00000345555:A123T	A	+	1	0	ENO4	118606062	0.109000	0.22037	0.003000	0.11579	0.009000	0.06853	2.810000	0.47979	1.636000	0.50526	-0.136000	0.14681	GCG	ENO4	-	pfam_Enolase_N	ENSG00000188316		0.557	ENO4-201	KNOWN	basic|appris_principal	protein_coding	ENO4	HGNC	protein_coding		-	0.00	29	0	G	NM_001242699		118616072	+1	tier1	-	no_errors	ENST00000341276	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.005	A
RP11-764K9.1	0	genome.wustl.edu	37	9	68400525	68400525	+	lincRNA	SNP	C	C	A	rs79614538	byFrequency	TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr9:68400525C>A	ENST00000417843.2	-	0	1294																											cactttgagacaaattaagga	0.478																																																	0																																												0																															9.37:g.68400525C>A				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.478	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	21	0	C			68400525	-1	tier1	rs79614538	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	25.00	15	5	SNP	0.106	A
RP11-782C8.2	0	genome.wustl.edu	37	1	143194276	143194276	+	lincRNA	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:143194276G>A	ENST00000412204.2	-	0	2353				RP11-782C8.1_ENST00000438000.1_lincRNA																							AGAGTGCTGAGAAAATATTTC	0.363																																																	0																																												0																															1.37:g.143194276G>A				RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.363	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	77	0	G			143194276	-1	tier1	-	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	34.12	56	29	SNP	0.017	A
C11orf97	643037	genome.wustl.edu	37	11	94265160	94265160	+	lincRNA	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:94265160G>T	ENST00000542198.1	+	0	423																											TTTAAGATGTGTGCAAAAAAA	0.308																																																	0																																												0																															11.37:g.94265160G>T				RNA	SNP	-	NULL	ENST00000542198.1	37	NULL		11																																																																																			RP11-867G2.2	-	-	ENSG00000257057		0.308	RP11-867G2.2-001	KNOWN	basic	lincRNA	ENSG00000257057	Clone_based_vega_gene	lincRNA	OTTHUMT00000396326.1	-	0.00	98	0	G			94265160	+1	tier1	-	no_errors	ENST00000542198	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.000	T
FRG2DP	146481	genome.wustl.edu	37	16	34712278	34712278	+	RNA	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:34712278C>A	ENST00000569028.2	-	0	1076																											AAGGGATGGGCTTCTCTATCC	0.547																																																	0																																												0																															16.37:g.34712278C>A				RNA	SNP	-	NULL	ENST00000569028.2	37	NULL		16																																																																																			RP11-80F22.9	-	-	ENSG00000261711		0.547	RP11-80F22.9-002	KNOWN	basic	processed_transcript	ENSG00000261711	Clone_based_vega_gene	pseudogene	OTTHUMT00000431372.2	-	0.00	45	0	C			34712278	-1	tier1	-	no_errors	ENST00000569028	ensembl	human	known	74_37	rna	20.00	32	8	SNP	0.035	A
EIF4A2	1974	genome.wustl.edu	37	3	186501283	186501283	+	5'Flank	SNP	C	C	T	rs539682485		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:186501283C>T	ENST00000323963.5	+	0	0				EIF4A2_ENST00000356531.5_5'Flank|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000440191.2_5'Flank|RP11-573D15.9_ENST00000577781.1_RNA|SNORA63_ENST00000363548.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TTGTAGCTGACCGAAGCACGG	0.498			T	BCL6	NHL								C|||	1	0.000199681	0.0008	0.0	5008	,	,		14181	0.0		0.0	False		,,,				2504	0.0							Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	0																																										SO:0001631	upstream_gene_variant	0			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564		3.37:g.186501283C>T	Exception_encountered		D3DNU9|Q53XJ6|Q96B90|Q96EA8	RNA	SNP	-	NULL	ENST00000323963.5	37	NULL	CCDS3282.1	3																																																																																			RP11-573D15.9	-	-	ENSG00000263826		0.498	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263826	Clone_based_vega_gene	protein_coding	OTTHUMT00000344609.1	-	0.00	90	0	C	NM_001967		186501283	-1	tier1	-	no_errors	ENST00000577781	ensembl	human	known	74_37	rna	5.70	215	13	SNP	0.000	T
WASH6P	653440	genome.wustl.edu	37	X	155253101	155253101	+	RNA	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrX:155253101G>A	ENST00000461007.1	+	0	2017				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GCAGGACGACGGCAGCAGCAG	0.652																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155253101G>A			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X	.	.	.	.	.	.	.	.	.	.	N	0.015	-1.570279	0.00895	.	.	ENSG00000182484	ENST00000359512;ENST00000285718	.	.	.	0.321	0.321	0.15883	.	2.547610	0.01423	N	0.014457	T	0.09642	0.0237	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20638	-1.0269	5	0.02654	T	1	-0.4711	.	.	.	.	.	.	.	S	353;322	.	ENSP00000285718:G322S	G	+	1	0	WASH6P	154906295	0.002000	0.14202	0.002000	0.10522	0.242000	0.25591	-0.197000	0.09518	-1.576000	0.01652	-2.074000	0.00383	GGC	AJ271736.10	-	-	ENSG00000270726		0.652	WASH6P-016	KNOWN	basic	processed_transcript	ENSG00000270726	Clone_based_vega_gene	pseudogene	OTTHUMT00000058840.1		0.00	91	0	G	NG_008380		155253101	+1			no_errors	ENST00000285718	ensembl	human	known	74_37	rna	5.49	86	5	SNP	0.004	A
LRIF1	55791	genome.wustl.edu	37	1	111506159	111506159	+	Intron	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:111506159C>T	ENST00000369763.4	-	1	459				LRIF1_ENST00000485275.2_Intron|RP11-96K19.5_ENST00000609118.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						CTCAACTACACAGCGTCCGGA	0.622											OREG0013667	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.68+83G>A	1.37:g.111506159C>T		1435	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	RNA	SNP	-	NULL	ENST00000369763.4	37	NULL	CCDS30800.1	1																																																																																			RP11-96K19.5	-	-	ENSG00000273010		0.622	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000273010	Clone_based_vega_gene	protein_coding	OTTHUMT00000032932.2	-	0.00	87	0	C	NM_018372		111506159	+1	tier1	-	no_errors	ENST00000609118	ensembl	human	known	74_37	rna	23.88	51	16	SNP	0.000	T
ENTPD5	957	genome.wustl.edu	37	14	74485982	74485982	+	5'UTR	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr14:74485982C>A	ENST00000334696.6	-	0	53				CCDC176_ENST00000394009.3_5'Flank|ENTPD5_ENST00000554664.1_5'UTR|ENTPD5_ENST00000556242.1_5'UTR	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5						'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		cgcggcagcccgccgccctcg	0.821																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.-267G>T	14.37:g.74485982C>A			A1L4C5|Q96RX0	RNA	SNP	-	NULL	ENST00000334696.6	37	NULL	CCDS9825.1	14																																																																																			ENTPD5	-	-	ENSG00000187097		0.821	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD5	HGNC	protein_coding	OTTHUMT00000412637.1	-	0.00	10	0	C	NM_001249		74485982	-1	tier1	-	no_errors	ENST00000554664	ensembl	human	known	74_37	rna	46.15	6	6	SNP	0.899	A
EPHB1	2047	genome.wustl.edu	37	3	134696812	134696812	+	Intron	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:134696812C>A	ENST00000398015.3	+	3	1175				EPHB1_ENST00000488154.1_Intron	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CCACAGTGTCCAGGCCTTTTT	0.542																																																	0																																										SO:0001627	intron_variant	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.805+25918C>A	3.37:g.134696812C>A			A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	p.S270	ENST00000398015.3	37	c.810	CCDS46921.1	3																																																																																			EPHB1	-	NULL	ENSG00000154928		0.542	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	-	0.00	55	0	C	NM_004441		134696812	+1	tier1	-	no_errors	ENST00000482618	ensembl	human	known	74_37	silent	7.20	116	9	SNP	0.000	A
ETAA1	54465	genome.wustl.edu	37	2	67626404	67626404	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:67626404delG	ENST00000272342.5	+	2	457	c.327delG	c.(325-327)cagfs	p.Q109fs		NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	109						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TTTGGGATCAGAATTCTCCAT	0.333																																																	0													67.0	64.0	65.0					2																	67626404		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.327delG	2.37:g.67626404delG	ENSP00000272342:p.Gln109fs		Q05BT7|Q53SC4	Frame_Shift_Del	DEL	NULL	p.N110fs	ENST00000272342.5	37	c.327	CCDS1882.1	2																																																																																			ETAA1	-	NULL	ENSG00000143971		0.333	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	HGNC	protein_coding	OTTHUMT00000251735.1		0.00	120	0	G	NM_019002		67626404	+1	tier1		no_errors	ENST00000272342	ensembl	human	known	74_37	frame_shift_del	31.84	122	57	DEL	0.368	-
FAM135B	51059	genome.wustl.edu	37	8	139180271	139180271	+	Silent	SNP	C	C	A	rs201150785		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr8:139180271C>A	ENST00000395297.1	-	12	1295	c.1125G>T	c.(1123-1125)ctG>ctT	p.L375L		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	375										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TATCCAGGGACAGCTGGCTGT	0.607										HNSCC(54;0.14)																																							0													97.0	104.0	102.0					8																	139180271		2112	4225	6337	SO:0001819	synonymous_variant	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1125G>T	8.37:g.139180271C>A			B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.L375	ENST00000395297.1	37	c.1125	CCDS6375.2	8																																																																																			FAM135B	-	NULL	ENSG00000147724		0.607	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	-	0.00	30	0	C	NM_015912		139180271	-1	tier1	-	no_errors	ENST00000395297	ensembl	human	known	74_37	silent	14.81	23	4	SNP	0.999	A
FAM182A	284800	genome.wustl.edu	37	20	26061818	26061818	+	RNA	SNP	G	G	C	rs112101451		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:26061818G>C	ENST00000376398.2	+	0	838					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GATTTCTCCTGCTTAGAAATG	0.463																																																	0													12.0	11.0	11.0					20																	26061818		692	1579	2271			0			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061818G>C			A2RRD0|Q8N947	RNA	SNP	-	NULL	ENST00000376398.2	37	NULL		20	.	.	.	.	.	.	.	.	.	.	N	7.694	0.691703	0.15039	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.47322	0.1439	.	.	.	0.30118	N	0.805912	.	.	.	.	.	.	T	0.53092	-0.8487	4	0.87932	D	0	.	.	.	.	.	.	.	.	S	57	.	ENSP00000246000:C57S	C	+	2	0	FAM182A	26009818	1.000000	0.71417	0.427000	0.26684	0.468000	0.32798	0.774000	0.26675	0.451000	0.26802	0.123000	0.15791	TGC	FAM182A	-	-	ENSG00000125804		0.463	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	HGNC	processed_transcript	OTTHUMT00000078473.2	-	0.00	74	0	G			26061818	+1	tier1	rs112101451	no_errors	ENST00000376398	ensembl	human	known	74_37	rna	10.17	52	6	SNP	0.580	C
FANCM	57697	genome.wustl.edu	37	14	45606438	45606438	+	Silent	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr14:45606438T>C	ENST00000267430.5	+	2	760	c.675T>C	c.(673-675)taT>taC	p.Y225Y	FKBP3_ENST00000396062.3_5'Flank|FKBP3_ENST00000216330.3_5'Flank|FANCM_ENST00000556036.1_Silent_p.Y225Y|FANCM_ENST00000542564.2_Silent_p.Y225Y	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	225	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ACTATGCTTATTGCCAGGTAA	0.348								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													59.0	57.0	58.0					14																	45606438		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.675T>C	14.37:g.45606438T>C			B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Y225	ENST00000267430.5	37	c.675	CCDS32070.1	14																																																																																			FANCM	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000187790		0.348	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	-	0.00	62	0	T	XM_048128		45606438	+1	tier1	-	no_errors	ENST00000267430	ensembl	human	known	74_37	silent	74.58	15	44	SNP	1.000	C
FAT1	2195	genome.wustl.edu	37	4	187541543	187541545	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	ACA	ACA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:187541543_187541545delACA	ENST00000441802.2	-	10	6404_6406	c.6195_6197delTGT	c.(6193-6198)gttgtc>gtc	p.2065_2066VV>V		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2065	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GACCTTCACGACAACGTGGGCCA	0.517										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0																																										SO:0001651	inframe_deletion	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6195_6197delTGT	4.37:g.187541543_187541545delACA	ENSP00000406229:p.Val2067del			In_Frame_Del	DEL	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.V2067in_frame_del	ENST00000441802.2	37	c.6197_6195	CCDS47177.1	4																																																																																			FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.517	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3		0.00	38	0	ACA	NM_005245		187541545	-1	tier1		no_errors	ENST00000441802	ensembl	human	known	74_37	in_frame_del	37.14	22	13	DEL	0.354:0.256:0.073	-
FAT2	2196	genome.wustl.edu	37	5	150946899	150946899	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:150946899G>T	ENST00000261800.5	-	1	1606	c.1594C>A	c.(1594-1596)Cgg>Agg	p.R532R		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	532	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R532W(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCTCTTACCCGGAAGGTATAA	0.463																																																	1	Substitution - Missense(1)	lung(1)											58.0	66.0	63.0					5																	150946899		2203	4300	6503	SO:0001819	synonymous_variant	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1594C>A	5.37:g.150946899G>T			O75091|Q9NSR7	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R532	ENST00000261800.5	37	c.1594	CCDS4317.1	5																																																																																			FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.463	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1		0.00	62	0	G	NM_001447		150946899	-1			no_errors	ENST00000261800	ensembl	human	known	74_37	silent	5.26	54	3	SNP	1.000	T
FAT3	120114	genome.wustl.edu	37	11	92086682	92086682	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:92086682C>G	ENST00000298047.6	+	1	1421	c.1404C>G	c.(1402-1404)caC>caG	p.H468Q	FAT3_ENST00000541502.1_Missense_Mutation_p.H468Q|FAT3_ENST00000409404.2_Missense_Mutation_p.H468Q|FAT3_ENST00000525166.1_Missense_Mutation_p.H318Q			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	468	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAAATGACCACACCCCAGAAT	0.413										TCGA Ovarian(4;0.039)																																							0													74.0	73.0	73.0					11																	92086682		1961	4162	6123	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1404C>G	11.37:g.92086682C>G	ENSP00000298047:p.His468Gln		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.H468Q	ENST00000298047.6	37	c.1404		11	.	.	.	.	.	.	.	.	.	.	C	6.876	0.531113	0.13127	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	5.93	1.98	0.26296	.	.	.	.	.	T	0.68659	0.3025	M	0.87827	2.91	0.31560	N	0.657612	D	0.53312	0.959	P	0.51777	0.679	T	0.72513	-0.4270	9	0.72032	D	0.01	.	8.9898	0.36017	0.0:0.6495:0.0:0.3505	.	468	Q8TDW7-3	.	Q	468;468;468;318	ENSP00000298047:H468Q;ENSP00000387040:H468Q;ENSP00000443786:H468Q;ENSP00000432586:H318Q	ENSP00000298047:H468Q	H	+	3	2	FAT3	91726330	0.745000	0.28261	1.000000	0.80357	0.219000	0.24729	0.114000	0.15520	0.409000	0.25649	0.655000	0.94253	CAC	FAT3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.413	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	46	0	C	NM_001008781		92086682	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	G
FBRS	64319	genome.wustl.edu	37	16	30680881	30680881	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:30680881T>C	ENST00000287468.5	+	12	1561	c.1298T>C	c.(1297-1299)cTt>cCt	p.L433P	FBRS_ENST00000568722.1_Missense_Mutation_p.L345P|FBRS_ENST00000395073.2_Intron|FBRS_ENST00000356166.6_Missense_Mutation_p.L953P	NM_001105079.1	NP_001098549.1	Q9HAH7	FBRS_HUMAN	fibrosin	433										ovary(1)	1			Colorectal(24;0.103)			CCGGGAGCCCTTTTGGGGGCA	0.716																																																	0													58.0	71.0	67.0					16																	30680881		1960	4131	6091	SO:0001583	missense	0			AK021680		16p11.2	2008-02-05	2007-04-18	2007-04-18	ENSG00000156860	ENSG00000156860			20442	protein-coding gene	gene with protein product		608601	"""fibrosin 1"""	FBS1		7892239, 9809749	Standard	NM_001105079		Approved	FBS, FLJ11618	uc002dzd.4	Q9HAH7	OTTHUMG00000132390	ENST00000287468.5:c.1298T>C	16.37:g.30680881T>C	ENSP00000287468:p.Leu433Pro		B4DP86|Q96CI9|Q9H9X4	Missense_Mutation	SNP	prints_AUTS2	p.L953P	ENST00000287468.5	37	c.2858		16	.	.	.	.	.	.	.	.	.	.	T	13.03	2.114425	0.37339	.	.	ENSG00000156860	ENST00000356166;ENST00000287468	T	0.36520	1.25	5.09	5.09	0.68999	.	0.097704	0.38111	N	0.001809	T	0.45518	0.1346	L	0.29908	0.895	0.58432	D	0.999998	D	0.71674	0.998	D	0.66351	0.943	T	0.36986	-0.9725	10	0.44086	T	0.13	-5.4678	13.9913	0.64369	0.0:0.0:0.0:1.0	.	433	Q9HAH7	FBRS_HUMAN	P	953;433	ENSP00000348489:L953P	ENSP00000287468:L433P	L	+	2	0	FBRS	30588382	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.334000	0.52097	2.146000	0.66826	0.459000	0.35465	CTT	FBRS	-	NULL	ENSG00000156860		0.716	FBRS-201	KNOWN	basic|appris_principal	protein_coding	FBRS	HGNC	protein_coding			0.00	33	0	T	NM_022452		30680881	+1			no_errors	ENST00000356166	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	C
FBXO34	55030	genome.wustl.edu	37	14	55818691	55818691	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr14:55818691C>T	ENST00000313833.4	+	2	1828	c.1583C>T	c.(1582-1584)gCt>gTt	p.A528V	FBXO34_ENST00000440021.1_Missense_Mutation_p.A528V	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	528										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						AGTGGGTCTGCTGAGCCATTT	0.507																																																	0													128.0	125.0	126.0					14																	55818691		2203	4300	6503	SO:0001583	missense	0			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1583C>T	14.37:g.55818691C>T	ENSP00000313159:p.Ala528Val		Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	superfamily_F-box_dom,pfscan_F-box_dom	p.A528V	ENST00000313833.4	37	c.1583	CCDS32086.1	14	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.446670	0.01089	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.16743	2.32;2.32	5.23	-0.545	0.11843	.	0.829943	0.10255	N	0.696735	T	0.07007	0.0178	N	0.03115	-0.41	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.42032	-0.9475	10	0.15066	T	0.55	-5.0122	11.2729	0.49150	0.0:0.6326:0.0:0.3673	.	528	Q9NWN3	FBX34_HUMAN	V	528	ENSP00000313159:A528V;ENSP00000394117:A528V	ENSP00000313159:A528V	A	+	2	0	FBXO34	54888444	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.038000	0.12144	0.007000	0.14760	0.655000	0.94253	GCT	FBXO34	-	NULL	ENSG00000178974		0.507	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO34	HGNC	protein_coding	OTTHUMT00000411322.1	-	0.00	58	0	C			55818691	+1	tier1	-	no_errors	ENST00000313833	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.000	T
FLOT2	2319	genome.wustl.edu	37	17	27211278	27211278	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:27211278C>T	ENST00000394908.4	-	3	291	c.187G>A	c.(187-189)Gag>Aag	p.E63K	FLOT2_ENST00000585169.1_Intron|FLOT2_ENST00000394906.2_Missense_Mutation_p.E118K|FLOT2_ENST00000577789.1_Intron	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2	63					cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GCTACCCCCTCGGCCGTCTCT	0.612																																																	0													65.0	73.0	71.0					17																	27211278		2074	4201	6275	SO:0001583	missense	0			M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.187G>A	17.37:g.27211278C>T	ENSP00000378368:p.Glu63Lys			Missense_Mutation	SNP	pfam_Band_7,smart_Band_7	p.E63K	ENST00000394908.4	37	c.187	CCDS11245.2	17	.	.	.	.	.	.	.	.	.	.	C	19.39	3.817746	0.71028	.	.	ENSG00000132589	ENST00000394906;ENST00000394908	D;D	0.95205	-3.64;-3.64	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.89726	0.6798	N	0.20483	0.58	0.80722	D	1	B	0.18968	0.032	B	0.23018	0.043	D	0.85562	0.1228	10	0.25106	T	0.35	-25.7445	17.4593	0.87616	0.0:1.0:0.0:0.0	.	63	Q14254	FLOT2_HUMAN	K	118;63	ENSP00000378366:E118K;ENSP00000378368:E63K	ENSP00000378366:E118K	E	-	1	0	FLOT2	24235404	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.353000	0.79882	0.563000	0.77884	GAG	FLOT2	-	pfam_Band_7	ENSG00000132589		0.612	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	FLOT2	HGNC	protein_coding	OTTHUMT00000255935.3	-	0.00	47	0	C	NM_004475		27211278	-1	tier1	-	no_errors	ENST00000394908	ensembl	human	known	74_37	missense	17.50	33	7	SNP	1.000	T
FMO1	2326	genome.wustl.edu	37	1	171239716	171239716	+	Intron	SNP	A	A	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:171239716A>G	ENST00000354841.4	+	2	452				FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Intron|FMO1_ENST00000367750.3_Intron	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1						NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GCAATTACAGAGTGGTATTCA	0.299																																																	0																																										SO:0001627	intron_variant	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.321+2846A>G	1.37:g.171239716A>G			A8K248|B7Z3P4|Q5QPT2|Q9UJC2	RNA	SNP	-	NULL	ENST00000354841.4	37	NULL	CCDS1294.1	1																																																																																			FMO1	-	-	ENSG00000010932		0.299	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	-	0.00	123	0	A	NM_002021		171239716	+1	tier1	-	no_errors	ENST00000469112	ensembl	human	known	74_37	rna	45.77	77	65	SNP	1.000	G
FMN2	56776	genome.wustl.edu	37	1	240555817	240555817	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:240555817T>C	ENST00000319653.9	+	15	5095	c.4865T>C	c.(4864-4866)aTt>aCt	p.I1622T	FMN2_ENST00000545751.1_Missense_Mutation_p.I218T	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1622	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCAGCCAAAATTGACCAAGAG	0.333																																																	0													116.0	124.0	122.0					1																	240555817		2203	4300	6503	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4865T>C	1.37:g.240555817T>C	ENSP00000318884:p.Ile1622Thr		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.I1622T	ENST00000319653.9	37	c.4865	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	T	3.682	-0.065423	0.07273	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355;ENST00000406993	T;T	0.15487	2.42;2.42	5.47	4.35	0.52113	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.103901	0.39687	N	0.001291	T	0.10294	0.0252	N	0.21240	0.645	0.80722	D	1	B;B;B;B	0.17852	0.003;0.0;0.003;0.024	B;B;B;B	0.13407	0.003;0.001;0.003;0.009	T	0.16571	-1.0398	10	0.15499	T	0.54	.	8.8374	0.35119	0.0:0.0853:0.0:0.9147	.	218;237;251;1622	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	T	1622;218;249;98	ENSP00000318884:I1622T;ENSP00000437918:I218T	ENSP00000318884:I1622T	I	+	2	0	FMN2	238622440	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	4.411000	0.59781	0.922000	0.37019	0.528000	0.53228	ATT	FMN2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000155816		0.333	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	68	0	T	XM_371352		240555817	+1	tier1	-	no_errors	ENST00000319653	ensembl	human	known	74_37	missense	39.74	47	31	SNP	1.000	C
FOXA3	3171	genome.wustl.edu	37	19	46375506	46375506	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:46375506G>T	ENST00000302177.2	+	2	440	c.243G>T	c.(241-243)ctG>ctT	p.L81L		NM_004497.2	NP_004488.2	P55318	FOXA3_HUMAN	forkhead box A3	81					cell differentiation (GO:0030154)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|chromatin modification (GO:0016568)|endocrine pancreas development (GO:0031018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	13		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		TCCCAGGCCTGGGTGTCAGCG	0.736																																																	0													18.0	22.0	21.0					19																	46375506		2199	4293	6492	SO:0001819	synonymous_variant	0			L12141	CCDS12677.1	19q13.32	2014-09-11		2002-09-20	ENSG00000170608	ENSG00000170608		"""Forkhead boxes"""	5023	protein-coding gene	gene with protein product		602295	"""hepatocyte nuclear factor 3, gamma"""	HNF3G		9119385	Standard	NM_004497		Approved		uc002pdr.3	P55318	OTTHUMG00000182484	ENST00000302177.2:c.243G>T	19.37:g.46375506G>T			A9LYI5|Q53F16|Q9UMW9	Silent	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L81	ENST00000302177.2	37	c.243	CCDS12677.1	19																																																																																			FOXA3	-	pfam_Fork-head_N	ENSG00000170608		0.736	FOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA3	HGNC	protein_coding	OTTHUMT00000461682.1	-	0.00	82	0	G			46375506	+1	tier1	-	no_errors	ENST00000302177	ensembl	human	known	74_37	silent	5.32	89	5	SNP	0.974	T
FOXRED1	55572	genome.wustl.edu	37	11	126145250	126145250	+	Silent	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:126145250C>A	ENST00000263578.5	+	6	734	c.660C>A	c.(658-660)ccC>ccA	p.P220P	FOXRED1_ENST00000534011.1_3'UTR|FOXRED1_ENST00000532125.1_Silent_p.P206P|FOXRED1_ENST00000442061.2_Silent_p.P50P	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1	220						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		GGTTTGACCCCTGGTGTCTGC	0.527																																																	0													107.0	99.0	102.0					11																	126145250		2201	4298	6499	SO:0001819	synonymous_variant	0				CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.660C>A	11.37:g.126145250C>A			B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Silent	SNP	pfam_FAD-dep_OxRdtase	p.P220	ENST00000263578.5	37	c.660	CCDS8471.1	11																																																																																			FOXRED1	-	pfam_FAD-dep_OxRdtase	ENSG00000110074		0.527	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXRED1	HGNC	protein_coding	OTTHUMT00000386434.1	-	0.00	56	0	C	NM_017547		126145250	+1	tier1	-	no_errors	ENST00000263578	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.990	A
FOXRED2	80020	genome.wustl.edu	37	22	36902124	36902124	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr22:36902124G>T	ENST00000397224.4	-	2	439	c.346C>A	c.(346-348)Cgt>Agt	p.R116S	FOXRED2_ENST00000397223.4_Missense_Mutation_p.R116S|FOXRED2_ENST00000216187.6_Missense_Mutation_p.R116S	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	116					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AAGTAGGCACGCGAGTAGTGT	0.642																																																	0													132.0	110.0	117.0					22																	36902124		2203	4300	6503	SO:0001583	missense	0			BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.346C>A	22.37:g.36902124G>T	ENSP00000380401:p.Arg116Ser		B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.R116S	ENST00000397224.4	37	c.346	CCDS13929.1	22	.	.	.	.	.	.	.	.	.	.	G	9.793	1.178325	0.21787	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000397223	T;T;T	0.21031	2.03;2.03;2.03	5.12	-7.57	0.01318	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	1.204930	0.05879	N	0.626185	T	0.16854	0.0405	L	0.60012	1.86	0.09310	N	1	B	0.15141	0.012	B	0.17979	0.02	T	0.40942	-0.9536	10	0.10377	T	0.69	-0.1412	10.2985	0.43637	0.0:0.2701:0.2992:0.4307	.	116	Q8IWF2	FXRD2_HUMAN	S	116	ENSP00000380401:R116S;ENSP00000216187:R116S;ENSP00000380400:R116S	ENSP00000216187:R116S	R	-	1	0	FOXRED2	35232070	0.000000	0.05858	0.000000	0.03702	0.736000	0.42039	-0.382000	0.07408	-0.820000	0.04318	0.561000	0.74099	CGT	FOXRED2	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000100350		0.642	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXRED2	HGNC	protein_coding	OTTHUMT00000104098.2	-	0.00	35	0	G	NM_024955		36902124	-1	tier1	-	no_errors	ENST00000216187	ensembl	human	known	74_37	missense	23.81	32	10	SNP	0.009	T
FRS3	10817	genome.wustl.edu	37	6	41738548	41738548	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:41738548G>A	ENST00000373018.3	-	7	1539	c.1288C>T	c.(1288-1290)Cct>Tct	p.P430S	FRS3_ENST00000259748.2_Missense_Mutation_p.P430S	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	430					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GGCCCCTTAGGGCGGTCTCCA	0.637																																																	0													25.0	32.0	30.0					6																	41738548		2201	4297	6498	SO:0001583	missense	0			AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.1288C>T	6.37:g.41738548G>A	ENSP00000362109:p.Pro430Ser		Q5T3D5	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.P430S	ENST00000373018.3	37	c.1288	CCDS4860.1	6	.	.	.	.	.	.	.	.	.	.	G	8.070	0.770047	0.15983	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	T;T	0.20738	2.05;2.05	5.76	2.88	0.33553	.	1.150150	0.06088	N	0.663249	T	0.04407	0.0121	N	0.16233	0.39	0.33490	D	0.58854	P	0.49090	0.919	B	0.37550	0.253	T	0.36040	-0.9764	10	0.23302	T	0.38	-18.6196	9.3478	0.38120	0.0749:0.3288:0.5963:0.0	.	430	O43559	FRS3_HUMAN	S	430	ENSP00000362109:P430S;ENSP00000259748:P430S	ENSP00000259748:P430S	P	-	1	0	FRS3	41846526	0.043000	0.20138	0.970000	0.41538	0.992000	0.81027	0.271000	0.18626	0.274000	0.22072	0.655000	0.94253	CCT	FRS3	-	NULL	ENSG00000137218		0.637	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRS3	HGNC	protein_coding	OTTHUMT00000040532.2	-	0.00	99	0	G	NM_006653		41738548	-1	tier1	-	no_errors	ENST00000259748	ensembl	human	known	74_37	missense	5.18	183	10	SNP	0.991	A
FUK	197258	genome.wustl.edu	37	16	70502787	70502787	+	Silent	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:70502787C>T	ENST00000288078.6	+	9	931	c.699C>T	c.(697-699)gcC>gcT	p.A233A	FUK_ENST00000571514.1_5'UTR|FUK_ENST00000378912.2_Silent_p.A265A	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	233						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				TGGAGACTGCCGAGCGCCTCC	0.652																																																	0													94.0	98.0	97.0					16																	70502787		1987	4155	6142	SO:0001819	synonymous_variant	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.699C>T	16.37:g.70502787C>T			Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.A265	ENST00000288078.6	37	c.795	CCDS10891.2	16																																																																																			FUK	-	pfam_Fucokinase	ENSG00000157353		0.652	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	-	0.00	76	0	C	NM_145059		70502787	+1	tier1	-	no_errors	ENST00000378912	ensembl	human	known	74_37	silent	16.18	57	11	SNP	0.937	T
GABRA2	2555	genome.wustl.edu	37	4	46252490	46252490	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:46252490G>T	ENST00000510861.1	-	10	1364	c.1191C>A	c.(1189-1191)aaC>aaA	p.N397K	GABRA2_ENST00000540012.1_Missense_Mutation_p.N402K|GABRA2_ENST00000381620.4_Missense_Mutation_p.N397K|GABRA2_ENST00000356504.1_Missense_Mutation_p.N397K|GABRA2_ENST00000507069.1_Missense_Mutation_p.N457K|GABRA2_ENST00000514090.1_Missense_Mutation_p.N397K			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	397					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTGGCTTCTTGTTGGGTTCTG	0.428																																																	0													198.0	200.0	200.0					4																	46252490		2203	4299	6502	SO:0001583	missense	0				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1191C>A	4.37:g.46252490G>T	ENSP00000421828:p.Asn397Lys		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa2_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.N402K	ENST00000510861.1	37	c.1206	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	G	5.915	0.352942	0.11182	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	5.96	4.25	0.50352	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.272290	0.47455	D	0.000240	T	0.70211	0.3198	N	0.14661	0.345	0.46849	D	0.999225	B;B	0.28350	0.208;0.004	B;B	0.30251	0.113;0.015	T	0.62756	-0.6787	10	0.05959	T	0.93	.	11.8856	0.52600	0.14:0.0:0.86:0.0	.	402;397	B7Z1H8;P47869	.;GBRA2_HUMAN	K	397;397;397;397;402;457	ENSP00000421828:N397K;ENSP00000421300:N397K;ENSP00000371033:N397K;ENSP00000348897:N397K;ENSP00000444409:N402K;ENSP00000427603:N457K	ENSP00000348897:N397K	N	-	3	2	GABRA2	45947247	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.114000	0.31196	0.864000	0.35578	0.655000	0.94253	AAC	GABRA2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABBAa2_rcpt,tigrfam_Neur_channel	ENSG00000151834		0.428	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	HGNC	protein_coding	OTTHUMT00000360848.2	-	0.00	85	0	G			46252490	-1	tier1	-	no_errors	ENST00000540012	ensembl	human	known	74_37	missense	16.18	57	11	SNP	1.000	T
GABRB1	2560	genome.wustl.edu	37	4	47163459	47163459	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:47163459C>A	ENST00000295454.3	+	4	726	c.434C>A	c.(433-435)cCt>cAt	p.P145H	GABRB1_ENST00000538619.1_Missense_Mutation_p.P75H	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	145					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CGACTGCATCCTGATGGAACA	0.398																																																	0													145.0	133.0	137.0					4																	47163459		2203	4300	6503	SO:0001583	missense	0				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.434C>A	4.37:g.47163459C>A	ENSP00000295454:p.Pro145His		B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.P145H	ENST00000295454.3	37	c.434	CCDS3474.1	4	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848803	0.71603	.	.	ENSG00000163288	ENST00000513567;ENST00000295454;ENST00000538619	T;T;T	0.77877	-1.13;-1.13;-1.13	4.8	3.96	0.45880	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.64402	D	0.000002	D	0.82944	0.5147	L	0.56340	1.77	0.52099	D	0.99994	P;D	0.57571	0.95;0.98	P;P	0.61592	0.712;0.891	T	0.82657	-0.0349	10	0.41790	T	0.15	-6.372	14.4273	0.67225	0.0:0.852:0.148:0.0	.	75;145	F5GXV5;P18505	.;GBRB1_HUMAN	H	112;145;75	ENSP00000426753:P112H;ENSP00000295454:P145H;ENSP00000440330:P75H	ENSP00000295454:P145H	P	+	2	0	GABRB1	46858216	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	7.647000	0.83462	1.221000	0.43506	0.555000	0.69702	CCT	GABRB1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000163288		0.398	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	HGNC	protein_coding	OTTHUMT00000216896.1	-	0.00	64	0	C			47163459	+1	tier1	-	no_errors	ENST00000295454	ensembl	human	known	74_37	missense	10.20	44	5	SNP	1.000	A
GAMT	2593	genome.wustl.edu	37	19	1398805	1398805	+	Intron	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:1398805G>A	ENST00000252288.2	-	5	637				GAMT_ENST00000447102.3_Missense_Mutation_p.P227L|AC005329.7_ENST00000501448.1_RNA	NM_000156.5	NP_000147.1	Q14353	GAMT_HUMAN	guanidinoacetate N-methyltransferase						cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|organ morphogenesis (GO:0009887)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	guanidinoacetate N-methyltransferase activity (GO:0030731)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|upper_aerodigestive_tract(1)	6		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Lung NSC(49;0.000195)|Breast(49;0.000231)|all_lung(49;0.000247)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Creatine(DB00148)|Guanidine(DB00536)	GCCCACCCAGGGGGTCAGGAA	0.597																																					Colon(167;1531 1939 13427 28842 31956)												0													21.0	24.0	23.0					19																	1398805		1327	2306	3633	SO:0001627	intron_variant	0			Z49878	CCDS12064.1, CCDS45897.1	19p13.3	2008-02-05							4136	protein-coding gene	gene with protein product		601240				9570966, 8547310	Standard	NM_000156		Approved	PIG2, TP53I2	uc002lsk.4	Q14353		ENST00000252288.2:c.570+109C>T	19.37:g.1398805G>A			A8K0A0|Q53Y34|Q8WVJ1	Missense_Mutation	SNP	NULL	p.P227L	ENST00000252288.2	37	c.680	CCDS12064.1	19	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507319	0.64410	.	.	ENSG00000130005	ENST00000447102	D	0.94828	-3.53	3.0	-1.2	0.09554	.	.	.	.	.	D	0.88100	0.6346	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.76038	-0.3105	8	0.41790	T	0.15	.	5.0998	0.14753	0.136:0.4125:0.4515:0.0	.	227	A8K0A0	.	L	227	ENSP00000403536:P227L	ENSP00000403536:P227L	P	-	2	0	GAMT	1349805	0.000000	0.05858	0.000000	0.03702	0.694000	0.40290	-0.248000	0.08854	-0.242000	0.09667	0.313000	0.20887	CCC	GAMT	-	NULL	ENSG00000130005		0.597	GAMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAMT	HGNC	protein_coding	OTTHUMT00000449739.1	-	0.00	50	0	G	NM_138924		1398805	-1	tier1	-	no_errors	ENST00000447102	ensembl	human	known	74_37	missense	50.00	25	25	SNP	0.000	A
GFM2	84340	genome.wustl.edu	37	5	74021855	74021855	+	Missense_Mutation	SNP	T	T	A	rs145997856		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:74021855T>A	ENST00000296805.3	-	18	2280	c.1823A>T	c.(1822-1824)gAg>gTg	p.E608V	GFM2_ENST00000345239.2_Missense_Mutation_p.E561V|RNU6-658P_ENST00000384606.1_RNA|GFM2_ENST00000509430.1_Missense_Mutation_p.E608V|GFM2_ENST00000515125.1_5'UTR	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		ATACTCAAACTCAATCACAGG	0.418																																																	0													124.0	127.0	126.0					5																	74021855		2203	4300	6503	SO:0001583	missense	0			AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.1823A>T	5.37:g.74021855T>A	ENSP00000296805:p.Glu608Val			Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_EFG_V,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_EFG_III-V,superfamily_Ribosomal_S5_D2-typ_fold,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.E608V	ENST00000296805.3	37	c.1823	CCDS4023.1	5	.	.	.	.	.	.	.	.	.	.	-	0.827	-0.746541	0.03065	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000509430	T;T;T	0.45276	0.9;0.9;0.9	.	.	.	Ribosomal protein S5 domain 2-type fold (1);Translation elongation factor EFG/EF2, domain IV (2);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.349225	0.33309	N	0.005048	T	0.23688	0.0573	N	0.14661	0.345	0.09310	N	1	B;.;B	0.31752	0.0;.;0.338	B;.;B	0.36030	0.009;.;0.216	T	0.16512	-1.0400	8	0.87932	D	0	.	.	.	.	.	608;561;608	Q969S9-3;Q969S9-2;Q969S9	.;.;RRF2M_HUMAN	V	608;561;608	ENSP00000296805:E608V;ENSP00000296804:E561V;ENSP00000427004:E608V	ENSP00000296805:E608V	E	-	2	0	GFM2	74057611	0.640000	0.27243	0.005000	0.12908	0.054000	0.15201	0.784000	0.26816	0.000000	0.14550	0.000000	0.15137	GAG	GFM2	-	pfam_Transl_elong_EFG/EF2_IV,superfamily_Ribosomal_S5_D2-typ_fold,smart_Transl_elong_EFG/EF2_IV	ENSG00000164347		0.418	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM2	HGNC	protein_coding	OTTHUMT00000219860.2		0.00	19	0	T	NM_032380		74021855	-1			no_errors	ENST00000296805	ensembl	human	known	74_37	missense	28.57	15	6	SNP	0.021	A
GPR110	266977	genome.wustl.edu	37	6	46977523	46977523	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:46977523G>T	ENST00000371253.2	-	11	1863	c.1648C>A	c.(1648-1650)Cac>Aac	p.H550N	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Missense_Mutation_p.H353N	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	550	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						TTCACTAGGTGGCAgcctgca	0.443																																																	0													110.0	94.0	99.0					6																	46977523		2203	4300	6503	SO:0001583	missense	0			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.1648C>A	6.37:g.46977523G>T	ENSP00000360299:p.His550Asn		Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.H550N	ENST00000371253.2	37	c.1648	CCDS34471.1	6	.	.	.	.	.	.	.	.	.	.	G	9.912	1.209856	0.22289	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	T;T	0.68181	-0.31;-0.31	5.84	3.1	0.35709	GPS domain (3);	0.646279	0.15170	N	0.276725	T	0.36413	0.0966	L	0.42686	1.345	0.25111	N	0.990713	B	0.22480	0.07	B	0.22880	0.042	T	0.32534	-0.9903	10	0.51188	T	0.08	-0.7386	7.6547	0.28369	0.2025:0.1186:0.6789:0.0	.	550	Q5T601	GP110_HUMAN	N	550;550;353	ENSP00000360299:H550N;ENSP00000283297:H353N	ENSP00000283297:H353N	H	-	1	0	GPR110	47085482	0.009000	0.17119	0.925000	0.36789	0.382000	0.30200	0.098000	0.15189	0.382000	0.24878	0.555000	0.69702	CAC	GPR110	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom	ENSG00000153292		0.443	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	HGNC	protein_coding	OTTHUMT00000040810.2		0.00	54	0	G	NM_153840		46977523	-1			no_errors	ENST00000371253	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.927	T
GRID2IP	392862	genome.wustl.edu	37	7	6550248	6550248	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:6550248G>T	ENST00000457091.2	-	10	1644	c.1645C>A	c.(1645-1647)Ccc>Acc	p.P549T	GRID2IP_ENST00000435185.1_Missense_Mutation_p.P365T|GRID2IP_ENST00000452113.1_Missense_Mutation_p.P358T	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	549					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						ACCATCTTGGGGTTGGGGGTC	0.667																																																	0													74.0	80.0	78.0					7																	6550248		692	1591	2283	SO:0001583	missense	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.1645C>A	7.37:g.6550248G>T	ENSP00000397351:p.Pro549Thr			Missense_Mutation	SNP	pfam_FH2_Formin,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_FH2_Formin,pfscan_PDZ	p.P549T	ENST00000457091.2	37	c.1645	CCDS47537.1	7	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882090	0.72294	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.39056	1.1;1.1;1.1	4.87	4.87	0.63330	.	0.292311	0.27437	U	0.019370	T	0.59101	0.2169	L	0.51422	1.61	0.47037	D	0.999295	D	0.89917	1.0	D	0.80764	0.994	T	0.61729	-0.7003	10	0.72032	D	0.01	.	15.8949	0.79326	0.0:0.0:1.0:0.0	.	549	A4D2P6	GRD2I_HUMAN	T	358;365;549	ENSP00000397887:P358T;ENSP00000408364:P365T;ENSP00000397351:P549T	ENSP00000408364:P365T	P	-	1	0	GRID2IP	6516773	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.002000	0.63952	2.418000	0.82041	0.462000	0.41574	CCC	GRID2IP	-	NULL	ENSG00000215045		0.667	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1	-	0.00	70	0	G	XM_294249		6550248	-1	tier1	-	no_errors	ENST00000457091	ensembl	human	putative	74_37	missense	5.41	70	4	SNP	1.000	T
GRXCR2	643226	genome.wustl.edu	37	5	145252492	145252492	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:145252492C>A	ENST00000377976.1	-	1	39	c.40G>T	c.(40-42)Ggc>Tgc	p.G14C		NM_001080516.1	NP_001073985.1	A6NFK2	GRCR2_HUMAN	glutaredoxin, cysteine rich 2	14						cell projection (GO:0042995)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CGGGGTTTGCCATCACTCTTC	0.507																																																	0													108.0	106.0	107.0					5																	145252492		2203	4300	6503	SO:0001583	missense	0				CCDS34263.1	5q32	2014-03-14			ENSG00000204928	ENSG00000204928			33862	protein-coding gene	gene with protein product		615762				24619944	Standard	NM_001080516		Approved	DFNB101	uc003lns.1	A6NFK2	OTTHUMG00000163417	ENST00000377976.1:c.40G>T	5.37:g.145252492C>A	ENSP00000367214:p.Gly14Cys			Missense_Mutation	SNP	NULL	p.G14C	ENST00000377976.1	37	c.40	CCDS34263.1	5	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525704	0.27299	.	.	ENSG00000204928	ENST00000377976	T	0.56103	0.48	5.73	-1.38	0.09027	.	0.568373	0.20717	N	0.086981	T	0.47710	0.1460	L	0.43152	1.355	0.09310	N	1	P	0.43885	0.82	P	0.46479	0.518	T	0.50381	-0.8835	10	0.56958	D	0.05	-12.8412	12.2074	0.54361	0.0:0.6156:0.0:0.3844	.	14	A6NFK2	GRCR2_HUMAN	C	14	ENSP00000367214:G14C	ENSP00000367214:G14C	G	-	1	0	GRXCR2	145232685	0.006000	0.16342	0.536000	0.28039	0.159000	0.22180	0.011000	0.13264	-0.254000	0.09500	0.655000	0.94253	GGC	GRXCR2	-	NULL	ENSG00000204928		0.507	GRXCR2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	GRXCR2	HGNC	protein_coding	OTTHUMT00000373289.2	-	0.00	52	0	C			145252492	-1	tier1	-	no_errors	ENST00000377976	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.094	A
GTF2F1	2962	genome.wustl.edu	37	19	6381602	6381602	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:6381602G>T	ENST00000394456.5	-	8	1325	c.861C>A	c.(859-861)agC>agA	p.S287R	GTF2F1_ENST00000429701.2_Missense_Mutation_p.S202R|PSPN_ENST00000597721.1_5'Flank	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	287	Glu-rich.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						CCTTGGCCTTGCTCTCAGGCT	0.687																																																	0													45.0	46.0	45.0					19																	6381602		2202	4300	6502	SO:0001583	missense	0				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.861C>A	19.37:g.6381602G>T	ENSP00000377969:p.Ser287Arg		B2RCS0|Q9BWN0	Missense_Mutation	SNP	pfam_TFIIF-alpha,superfamily_TFIIF_interaction	p.S287R	ENST00000394456.5	37	c.861	CCDS12165.1	19	.	.	.	.	.	.	.	.	.	.	G	7.517	0.655838	0.14580	.	.	ENSG00000125651	ENST00000394456;ENST00000429701;ENST00000542045	T;T	0.44482	0.92;0.92	4.9	2.53	0.30540	.	0.380245	0.28247	N	0.016043	T	0.22742	0.0549	N	0.08118	0	0.28505	N	0.913818	B;B;B	0.21381	0.055;0.055;0.022	B;B;B	0.31869	0.076;0.137;0.097	T	0.23868	-1.0176	10	0.17832	T	0.49	-34.1039	9.7706	0.40587	0.0:0.3752:0.4926:0.1322	.	202;185;287	E7EUG6;B4DDB5;P35269	.;.;T2FA_HUMAN	R	287;202;347	ENSP00000377969:S287R;ENSP00000392107:S202R	ENSP00000377969:S287R	S	-	3	2	GTF2F1	6332602	0.992000	0.36948	0.991000	0.47740	0.084000	0.17831	0.704000	0.25661	1.140000	0.42260	0.655000	0.94253	AGC	GTF2F1	-	pfam_TFIIF-alpha	ENSG00000125651		0.687	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F1	HGNC	protein_coding	OTTHUMT00000398033.1	-	0.00	38	0	G	NM_002096		6381602	-1	tier1	-	no_errors	ENST00000394456	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.980	T
GUCY1B2	2974	genome.wustl.edu	37	13	51568748	51568748	+	RNA	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr13:51568748G>T	ENST00000493639.2	-	0	2769					NR_003923.2		O75343	GCYB2_HUMAN	guanylate cyclase 1, soluble, beta 2 (pseudogene)						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)										ACTTTTCTTTGCTGCCACAGA	0.398																																																	0																																												0			AF038499		13q14.3	2012-04-19	2012-04-19		ENSG00000123201	ENSG00000123201	4.6.1.2		4686	pseudogene	pseudogene		603695	"""guanylate cyclase 1, soluble, beta 2"""			9889008, 10449911	Standard	NR_003923		Approved	GC-SB2	uc010tgo.2	O75343	OTTHUMG00000016940		13.37:g.51568748G>T			Q9NZ64	RNA	SNP	-	NULL	ENST00000493639.2	37	NULL		13																																																																																			GUCY1B2	-	-	ENSG00000123201		0.398	GUCY1B2-001	KNOWN	basic	processed_transcript	GUCY1B2	HGNC	pseudogene	OTTHUMT00000045014.3	-	0.00	51	0	G			51568748	-1	tier1	-	no_errors	ENST00000493639	ensembl	human	known	74_37	rna	7.69	48	4	SNP	0.000	T
H3F3B	3021	genome.wustl.edu	37	17	73774216	73774216	+	3'UTR	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:73774216G>A	ENST00000254810.4	-	0	1003				H3F3B_ENST00000593254.1_5'UTR	NM_005324.3	NP_005315.1	P84243	H33_HUMAN	H3 histone, family 3B (H3.3B)						blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			large_intestine(1)|lung(4)|ovary(2)|skin(1)	8	all_cancers(13;1.5e-07)		all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTTTTTTAAAGGAAACTGTAA	0.303																																																	0																																										SO:0001624	3_prime_UTR_variant	0			Z48950	CCDS11729.1	17q25.1	2011-06-01			ENSG00000132475	ENSG00000132475		"""Histones / Replication-independent"""	4765	protein-coding gene	gene with protein product		601058				8586426	Standard	NM_005324		Approved	H3.3B	uc002jpl.3	P84243		ENST00000254810.4:c.*460C>T	17.37:g.73774216G>A			P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	RNA	SNP	-	NULL	ENST00000254810.4	37	NULL	CCDS11729.1	17																																																																																			H3F3B	-	-	ENSG00000132475		0.303	H3F3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H3F3B	HGNC	protein_coding	OTTHUMT00000448499.1	-	0.00	85	0	G	NM_005324		73774216	-1	tier1	-	no_errors	ENST00000593254	ensembl	human	known	74_37	rna	5.56	117	7	SNP	1.000	A
HBE1	3046	genome.wustl.edu	37	11	5290883	5290883	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:5290883G>T	ENST00000380237.1	-	4	460	c.116C>A	c.(115-117)aCc>aAc	p.T39N	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000292896.2_Missense_Mutation_p.T39N			P02100	HBE_HUMAN	hemoglobin, epsilon 1	39					blood coagulation (GO:0007596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein heterooligomerization (GO:0051291)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|skin(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAATCTCTGGGTCCAGGGGTA	0.463																																																	0													64.0	65.0	64.0					11																	5290883		2201	4297	6498	SO:0001583	missense	0			BC015537	CCDS7756.1	11p15.5	2012-10-02			ENSG00000213931	ENSG00000213931			4830	protein-coding gene	gene with protein product		142100				2649166	Standard	NM_005330		Approved	HBE	uc001mal.1	P02100	OTTHUMG00000066675	ENST00000380237.1:c.116C>A	11.37:g.5290883G>T	ENSP00000369586:p.Thr39Asn		Q6FH44	Missense_Mutation	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b,prints_Myoglobin	p.T39N	ENST00000380237.1	37	c.116	CCDS7756.1	11	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970192	0.92855	.	.	ENSG00000213931	ENST00000380237;ENST00000292896;ENST00000396895	D;D;D	0.89875	-2.58;-2.58;-2.58	6.02	6.02	0.97574	Globin-like (1);Globin, structural domain (1);	0.000000	0.85682	U	0.000000	D	0.96747	0.8938	H	0.98005	4.125	0.80722	D	1	P	0.44690	0.841	P	0.60117	0.869	D	0.97297	0.9928	10	0.87932	D	0	-29.9875	19.1686	0.93567	0.0:0.0:1.0:0.0	.	39	P02100	HBE_HUMAN	N	39	ENSP00000369586:T39N;ENSP00000292896:T39N;ENSP00000380104:T39N	ENSP00000292896:T39N	T	-	2	0	HBE1	5247459	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.440000	0.97547	2.875000	0.98604	0.644000	0.83932	ACC	HBE1	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b	ENSG00000213931		0.463	HBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBE1	HGNC	protein_coding	OTTHUMT00000142973.2	-	0.00	60	0	G	NM_005330		5290883	-1	tier1	-	no_errors	ENST00000292896	ensembl	human	known	74_37	missense	48.78	21	20	SNP	1.000	T
HDAC1	3065	genome.wustl.edu	37	1	32768245	32768245	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:32768245G>T	ENST00000373548.3	+	2	157	c.73G>T	c.(73-75)Gga>Tga	p.G25*	HDAC1_ENST00000373541.2_5'UTR	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	25	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	TTACTATTATGGACAAGGCCA	0.438																																																	0													123.0	108.0	113.0					1																	32768245		2203	4300	6503	SO:0001587	stop_gained	0			D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.73G>T	1.37:g.32768245G>T	ENSP00000362649:p.Gly25*		Q92534	Nonsense_Mutation	SNP	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.G25*	ENST00000373548.3	37	c.73	CCDS360.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.170177	0.97343	.	.	ENSG00000116478	ENST00000373548;ENST00000428704	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.8068	19.275	0.94027	0.0:0.0:1.0:0.0	.	.	.	.	X	25	.	ENSP00000362649:G25X	G	+	1	0	HDAC1	32540832	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.140000	0.94607	2.738000	0.93877	0.650000	0.86243	GGA	HDAC1	-	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1	ENSG00000116478		0.438	HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC1	HGNC	protein_coding	OTTHUMT00000019815.3	-	0.00	45	0	G	NM_004964		32768245	+1	tier1	-	no_errors	ENST00000373548	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	T
HERC2	8924	genome.wustl.edu	37	15	28357144	28357144	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr15:28357144G>T	ENST00000261609.7	-	93	14378	c.14270C>A	c.(14269-14271)cCt>cAt	p.P4757H		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTAGGACTCAGGGAGGAAGTG	0.483																																																	0													93.0	78.0	83.0					15																	28357144		2203	4300	6503	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.14270C>A	15.37:g.28357144G>T	ENSP00000261609:p.Pro4757His			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.P4757H	ENST00000261609.7	37	c.14270	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560508	0.86335	.	.	ENSG00000128731	ENST00000261609	D	0.84146	-1.81	5.99	5.99	0.97316	HECT (4);	0.000000	0.85682	D	0.000000	D	0.96216	0.8766	H	0.98754	4.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97240	0.9890	10	0.87932	D	0	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	4757;446	O95714;Q8ND39	HERC2_HUMAN;.	H	4757	ENSP00000261609:P4757H	ENSP00000261609:P4757H	P	-	2	0	HERC2	26030739	1.000000	0.71417	0.772000	0.31596	0.609000	0.37215	9.833000	0.99426	2.840000	0.97914	0.655000	0.94253	CCT	HERC2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000128731		0.483	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	85	0	G	NM_004667		28357144	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	5.56	85	5	SNP	1.000	T
HIST1H2AH	85235	genome.wustl.edu	37	6	27114921	27114921	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:27114921G>T	ENST00000377459.1	+	1	61	c.14G>T	c.(13-15)gGc>gTc	p.G5V	HIST1H2BK_ENST00000356950.1_5'Flank|HIST1H2BK_ENST00000396891.4_5'Flank|MIR3143_ENST00000584253.1_RNA	NM_080596.1	NP_542163.1	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	5						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|prostate(1)|skin(1)	12						TCTGGACGTGGCAAGCAAGGC	0.557																																																	0													67.0	74.0	72.0					6																	27114921		2203	4300	6503	SO:0001583	missense	0			AY131988	CCDS4622.1	6p22.1	2011-01-27	2006-10-11			ENSG00000274997		"""Histones / Replication-dependent"""	13671	protein-coding gene	gene with protein product		615013	"""histone 1, H2ah"""			12408966	Standard	NM_080596		Approved	H2AFALii, dJ86C11.1, H2A/S	uc003niz.4	Q96KK5		ENST00000377459.1:c.14G>T	6.37:g.27114921G>T	ENSP00000366679:p.Gly5Val			Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.G5V	ENST00000377459.1	37	c.14	CCDS4622.1	6	.	.	.	.	.	.	.	.	.	.	G	8.575	0.880995	0.17467	.	.	ENSG00000184825	ENST00000377459	D	0.85629	-2.01	3.95	3.95	0.45737	Histone-fold (2);Histone H2A (1);	0.000000	0.41712	D	0.000824	D	0.91168	0.7218	M	0.90483	3.12	0.80722	D	1	D	0.63046	0.992	P	0.60886	0.88	D	0.92943	0.6374	10	0.87932	D	0	.	14.3093	0.66405	0.0:0.0:1.0:0.0	.	5	Q96KK5	H2A1H_HUMAN	V	5	ENSP00000366679:G5V	ENSP00000366679:G5V	G	+	2	0	HIST1H2AH	27222900	1.000000	0.71417	0.208000	0.23602	0.014000	0.08584	8.519000	0.90563	2.142000	0.66516	0.655000	0.94253	GGC	HIST1H2AH	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000184825		0.557	HIST1H2AH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AH	HGNC	protein_coding	OTTHUMT00000040136.1	-	0.00	76	0	G	NM_080596		27114921	+1	tier1	-	no_errors	ENST00000377459	ensembl	human	known	74_37	missense	61.97	27	44	SNP	0.994	T
HLA-DMB	3109	genome.wustl.edu	37	6	32906598	32906598	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:32906598C>A	ENST00000418107.2	-	2	462	c.200G>T	c.(199-201)gGg>gTg	p.G67V	HLA-DMB_ENST00000416244.2_Missense_Mutation_p.G67V|XXbac-BPG181M17.5_ENST00000429234.1_Missense_Mutation_p.G99V|AL645941.1_ENST00000390777.1_RNA	NM_002118.4	NP_002109.2	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	67	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)			breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						ATTCAGCACCCCAAATTCGCA	0.517																																																	0													117.0	119.0	118.0					6																	32906598		1511	2709	4220	SO:0001583	missense	0				CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000418107.2:c.200G>T	6.37:g.32906598C>A	ENSP00000398890:p.Gly67Val		O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_MHC_II_b_N,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.G67V	ENST00000418107.2	37	c.200	CCDS4760.1	6	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181616	0.57800	.	.	ENSG00000242574;ENSG00000242574;ENSG00000242574;ENSG00000248993	ENST00000446948;ENST00000418107;ENST00000416244;ENST00000429234	T;T;T	0.39229	1.09;1.09;1.09	5.07	5.07	0.68467	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (2);MHC classes I/II-like antigen recognition protein (1);	0.237339	0.29178	N	0.012901	T	0.56202	0.1969	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	T	0.56402	-0.7985	9	.	.	.	.	13.823	0.63333	0.0:1.0:0.0:0.0	.	67;67;76	E9PD01;P28068;Q59F83	.;DMB_HUMAN;.	V	67;67;67;99	ENSP00000398890:G67V;ENSP00000391010:G67V;ENSP00000412457:G99V	.	G	-	2	0	XXbac-BPG181M17.5;HLA-DMB	33014576	0.986000	0.35501	0.967000	0.41034	0.365000	0.29674	3.499000	0.53310	2.631000	0.89168	0.637000	0.83480	GGG	HLA-DMB	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000242574		0.517	HLA-DMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMB	HGNC	protein_coding	OTTHUMT00000076340.2	-	0.00	68	0	C	NM_002118		32906598	-1	tier1	-	no_errors	ENST00000418107	ensembl	human	known	74_37	missense	8.47	54	5	SNP	0.978	A
HMGCR	3156	genome.wustl.edu	37	5	74639790	74639790	+	Splice_Site	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:74639790G>C	ENST00000287936.4	+	3	433		c.e3+1		HMGCR_ENST00000343975.5_Splice_Site|HMGCR_ENST00000511206.1_Splice_Site	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase						aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	TATATTTTGGGTAATAGTTTT	0.303																																																	0													64.0	65.0	64.0					5																	74639790		2202	4295	6497	SO:0001630	splice_region_variant	0				CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.277+1G>C	5.37:g.74639790G>C			B7Z3Y9|Q8N190	Splice_Site	SNP	-	e2+1	ENST00000287936.4	37	c.277+1	CCDS4027.1	5	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535032	0.85812	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975;ENST00000507942	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5562	0.91085	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HMGCR	74675546	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.837000	0.99465	2.388000	0.81334	0.591000	0.81541	.	HMGCR	-	-	ENSG00000113161		0.303	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCR	HGNC	protein_coding	OTTHUMT00000219877.2	-	0.00	112	0	G		Intron	74639790	+1	tier1	-	no_errors	ENST00000287936	ensembl	human	known	74_37	splice_site	24.24	75	24	SNP	1.000	C
HNF4G	3174	genome.wustl.edu	37	8	76472647	76472647	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr8:76472647G>A	ENST00000354370.1	+	10	1321	c.1051G>A	c.(1051-1053)Gga>Aga	p.G351R	HNF4G_ENST00000396423.2_Missense_Mutation_p.G388R			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	351					endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			CCCATTAACTGGACAAACTAT	0.388																																																	0													112.0	105.0	107.0					8																	76472647		2203	4300	6503	SO:0001583	missense	0				CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.1051G>A	8.37:g.76472647G>A	ENSP00000346339:p.Gly351Arg		Q7Z2V9|Q9UH81|Q9UIS6	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.G388R	ENST00000354370.1	37	c.1162		8	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617882	0.46736	.	.	ENSG00000164749	ENST00000354370;ENST00000396423	T;T	0.69926	-0.44;-0.44	4.86	4.86	0.63082	.	0.207319	0.50627	D	0.000104	T	0.72542	0.3473	M	0.66939	2.045	0.45676	D	0.998596	P;P	0.48640	0.913;0.913	P;P	0.48030	0.459;0.564	T	0.75935	-0.3142	10	0.54805	T	0.06	.	18.5513	0.91066	0.0:0.0:1.0:0.0	.	388;351	F1D8Q4;Q14541	.;HNF4G_HUMAN	R	351;388	ENSP00000346339:G351R;ENSP00000379701:G388R	ENSP00000346339:G351R	G	+	1	0	HNF4G	76635202	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	4.899000	0.63245	2.683000	0.91414	0.655000	0.94253	GGA	HNF4G	-	NULL	ENSG00000164749		0.388	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	HNF4G	HGNC	protein_coding	OTTHUMT00000313914.2	-	0.00	49	0	G	NM_004133		76472647	+1	tier1	-	no_errors	ENST00000396423	ensembl	human	known	74_37	missense	33.33	26	13	SNP	1.000	A
HPSE2	60495	genome.wustl.edu	37	10	100242539	100242539	+	Splice_Site	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:100242539G>T	ENST00000370552.3	-	11	1526	c.1467C>A	c.(1465-1467)aaC>aaA	p.N489K	HPSE2_ENST00000370549.1_Splice_Site_p.N431K|HPSE2_ENST00000370546.1_Splice_Site_p.N489K|HPSE2_ENST00000404542.1_Splice_Site_p.N377K	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	489					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CGTAGTTGTGGCTGAGATCCA	0.403																																																	0													79.0	71.0	73.0					10																	100242539		2203	4300	6503	SO:0001630	splice_region_variant	0			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1467-1C>A	10.37:g.100242539G>T			Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.N489K	ENST00000370552.3	37	c.1467	CCDS7477.1	10	.	.	.	.	.	.	.	.	.	.	G	16.58	3.164279	0.57476	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.45668	0.89;0.9;1.5;0.91	5.34	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.54902	0.1887	L	0.59436	1.845	0.58432	D	0.999999	D;P;B;B	0.67145	0.996;0.51;0.421;0.141	D;B;B;B	0.75484	0.986;0.154;0.254;0.091	T	0.51068	-0.8752	10	0.23891	T	0.37	.	9.542	0.39257	0.2185:0.0:0.7815:0.0	.	377;489;431;489	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	K	489;431;489;377	ENSP00000359583:N489K;ENSP00000359580:N431K;ENSP00000359577:N489K;ENSP00000384384:N377K	ENSP00000359577:N489K	N	-	3	2	HPSE2	100232529	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.290000	0.51755	1.407000	0.46875	0.655000	0.94253	AAC	HPSE2	-	NULL	ENSG00000172987		0.403	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	HGNC	protein_coding	OTTHUMT00000049789.1	-	0.00	71	0	G	NM_021828	Missense_Mutation	100242539	-1	tier1	-	no_errors	ENST00000370552	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
IKZF2	22807	genome.wustl.edu	37	2	213872143	213872143	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:213872143T>C	ENST00000434687.1	-	9	1831	c.1522A>G	c.(1522-1524)Agc>Ggc	p.S508G	IKZF2_ENST00000374319.4_Missense_Mutation_p.S482G|IKZF2_ENST00000457361.1_Missense_Mutation_p.S508G|IKZF2_ENST00000451136.2_Missense_Mutation_p.S436G|IKZF2_ENST00000374327.4_Missense_Mutation_p.S363G|IKZF2_ENST00000413091.3_3'UTR|IKZF2_ENST00000421754.2_Missense_Mutation_p.S434G|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000342002.2_Missense_Mutation_p.S514G			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	508					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		CGGTCCTGGCTTCTGTAGCCA	0.498																																																	0													121.0	111.0	114.0					2																	213872143		2203	4300	6503	SO:0001583	missense	0			AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1522A>G	2.37:g.213872143T>C	ENSP00000412869:p.Ser508Gly		Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S508G	ENST00000434687.1	37	c.1522	CCDS2395.1	2	.	.	.	.	.	.	.	.	.	.	T	18.45	3.626468	0.66901	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327;ENST00000542010	T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.67	5.67	0.87782	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.67097	0.2857	M	0.81112	2.525	0.80722	D	1	P;P;D;D;P;D	0.71674	0.802;0.587;0.989;0.998;0.512;0.996	B;B;P;D;B;D	0.75484	0.266;0.266;0.712;0.953;0.195;0.986	T	0.72194	-0.4364	10	0.87932	D	0	-8.3851	15.915	0.79508	0.0:0.0:0.0:1.0	.	436;434;363;482;508;286	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7;Q96LD7	.;.;.;.;IKZF2_HUMAN;.	G	508;514;508;482;436;434;363;212	ENSP00000410447:S508G;ENSP00000342876:S514G;ENSP00000412869:S508G;ENSP00000363439:S482G;ENSP00000395203:S436G;ENSP00000399574:S434G;ENSP00000363447:S363G	ENSP00000342876:S514G	S	-	1	0	IKZF2	213580388	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.977000	0.88081	2.158000	0.67659	0.533000	0.62120	AGC	IKZF2	-	smart_Znf_C2H2-like	ENSG00000030419		0.498	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF2	HGNC	protein_coding	OTTHUMT00000256593.3	-	0.00	86	0	T	NM_016260		213872143	-1	tier1	-	no_errors	ENST00000434687	ensembl	human	known	74_37	missense	26.25	59	21	SNP	1.000	C
IMPA1	3612	genome.wustl.edu	37	8	82593782	82593782	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr8:82593782C>A	ENST00000256108.5	-	2	479	c.14G>T	c.(13-15)tGg>tTg	p.W5L	IMPA1_ENST00000311489.4_Missense_Mutation_p.W5L|IMPA1_ENST00000523710.1_5'UTR|IMPA1_ENST00000449740.2_Missense_Mutation_p.W64L	NM_005536.3	NP_005527.1	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1	5					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|inositol monophosphate phosphatase activity (GO:0052834)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|stomach(1)	18					Lithium(DB01356)	GCATTCCTGCCAAGGATCAGC	0.333																																																	0													93.0	87.0	89.0					8																	82593782		2203	4300	6503	SO:0001583	missense	0				CCDS6231.1, CCDS47883.1, CCDS47884.1	8q21.1-q21.3	2008-01-28			ENSG00000133731	ENSG00000133731	3.1.3.25		6050	protein-coding gene	gene with protein product		602064		IMPA		1377913	Standard	NM_005536		Approved		uc011lfq.1	P29218	OTTHUMG00000164682	ENST00000256108.5:c.14G>T	8.37:g.82593782C>A	ENSP00000256108:p.Trp5Leu		B2R733|B4DLN3|B7Z6Q4|J3KQT7|Q9UK71	Missense_Mutation	SNP	pfam_Inositol_monophosphatase,prints_Inositol_monoPase_Li-sen,prints_Inositol_monophosphatase	p.W64L	ENST00000256108.5	37	c.191	CCDS6231.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.79|18.79	3.698473|3.698473	0.68386|0.68386	.|.	.|.	ENSG00000133731|ENSG00000133731	ENST00000523942|ENST00000256108;ENST00000311489;ENST00000449740;ENST00000521360;ENST00000522997;ENST00000518202	.|T;T;T;T;T;T	.|0.35236	.|1.32;1.33;1.32;1.33;1.33;1.33	4.04|4.04	4.04|4.04	0.47022|0.47022	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.35480|0.35480	0.0933|0.0933	N|N	0.11255|0.11255	0.115|0.115	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	T|T	0.08411|0.08411	-1.0723|-1.0723	5|10	.|0.02654	.|T	.|1	6.0654|6.0654	16.1484|16.1484	0.81586|0.81586	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|5;64;5	.|B4DLN3;B7Z6Q4;P29218	.|.;.;IMPA1_HUMAN	F|L	29|5;5;64;5;64;5	.|ENSP00000256108:W5L;ENSP00000311803:W5L;ENSP00000408526:W64L;ENSP00000430283:W5L;ENSP00000430081:W64L;ENSP00000429516:W5L	.|ENSP00000256108:W5L	L|W	-|-	3|2	2|0	IMPA1|IMPA1	82756337|82756337	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	6.973000|6.973000	0.76116|0.76116	1.943000|1.943000	0.56356|0.56356	0.442000|0.442000	0.29010|0.29010	TTG|TGG	IMPA1	-	NULL	ENSG00000133731		0.333	IMPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPA1	HGNC	protein_coding	OTTHUMT00000379723.1	-	0.00	52	0	C			82593782	-1	tier1	-	no_errors	ENST00000449740	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
ISL1	3670	genome.wustl.edu	37	5	50689371	50689371	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:50689371G>T	ENST00000230658.7	+	6	1562	c.977G>T	c.(976-978)aGt>aTt	p.S326I	ISL1_ENST00000511384.1_Missense_Mutation_p.S303I	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	326	Gln-rich.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				TCCACTGGCAGTGAAGTAGCA	0.398																																																	0													106.0	104.0	104.0					5																	50689371		1882	4098	5980	SO:0001583	missense	0			BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.977G>T	5.37:g.50689371G>T	ENSP00000230658:p.Ser326Ile		P20663|P47894	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.S326I	ENST00000230658.7	37	c.977	CCDS43314.1	5	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818267	0.71028	.	.	ENSG00000016082	ENST00000230658;ENST00000511384	D;D	0.86230	-2.09;-2.02	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.93478	0.7919	M	0.76574	2.34	0.80722	D	1	D	0.71674	0.998	D	0.71656	0.974	D	0.93254	0.6637	10	0.66056	D	0.02	.	20.2009	0.98259	0.0:0.0:1.0:0.0	.	326	P61371	ISL1_HUMAN	I	326;303	ENSP00000230658:S326I;ENSP00000422676:S303I	ENSP00000230658:S326I	S	+	2	0	ISL1	50725128	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.796000	0.99103	2.767000	0.95098	0.591000	0.81541	AGT	ISL1	-	NULL	ENSG00000016082		0.398	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISL1	HGNC	protein_coding	OTTHUMT00000368413.3	-	0.00	57	0	G	NM_002202		50689371	+1	tier1	-	no_errors	ENST00000230658	ensembl	human	known	74_37	missense	36.54	33	19	SNP	1.000	T
JAKMIP1	152789	genome.wustl.edu	37	4	6086661	6086661	+	Missense_Mutation	SNP	C	C	T	rs371853673		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:6086661C>T	ENST00000282924.5	-	5	1351	c.866G>A	c.(865-867)cGa>cAa	p.R289Q	JAKMIP1_ENST00000409831.1_Missense_Mutation_p.R289Q|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.R124Q|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.R124Q|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.R289Q|JAKMIP1_ENST00000457227.2_5'UTR	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	289	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)	p.R289Q(2)		NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TAGTTGAAATCGCCTCACATC	0.383																																																	2	Substitution - Missense(2)	large_intestine(2)						C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	207.0	196.0	200.0		866,866	4.8	1.0	4		200	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	JAKMIP1	NM_001099433.1,NM_144720.3	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	289/832,289/627	6086661	1,13005	2203	4300	6503	SO:0001583	missense	0			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.866G>A	4.37:g.6086661C>T	ENSP00000282924:p.Arg289Gln		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	NULL	p.R289Q	ENST00000282924.5	37	c.866	CCDS3385.1	4	.	.	.	.	.	.	.	.	.	.	C	32	5.169452	0.94768	0.0	1.16E-4	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.41400	1.41;1.14;1.41;1.41;1.0	4.79	4.79	0.61399	.	0.117591	0.37669	N	0.001986	T	0.65186	0.2667	M	0.77313	2.365	0.45946	D	0.998774	D;D;D;D;D	0.71674	0.998;0.974;0.998;0.998;0.974	D;P;D;D;P	0.75484	0.986;0.455;0.986;0.986;0.455	T	0.70630	-0.4819	10	0.87932	D	0	.	15.0225	0.71640	0.0:1.0:0.0:0.0	.	124;289;124;289;289	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	Q	289;124;289;289;181;289;289;124	ENSP00000386711:R289Q;ENSP00000387042:R124Q;ENSP00000282924:R289Q;ENSP00000386925:R289Q;ENSP00000386745:R124Q	ENSP00000282924:R289Q	R	-	2	0	JAKMIP1	6137562	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.396000	0.79891	2.203000	0.70933	0.591000	0.81541	CGA	JAKMIP1	-	NULL	ENSG00000152969		0.383	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP1	HGNC	protein_coding	OTTHUMT00000246816.2		0.00	15	0	C	NM_144720		6086661	-1			no_errors	ENST00000409021	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	T
KNDC1	85442	genome.wustl.edu	37	10	135011900	135011900	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:135011900C>A	ENST00000304613.3	+	13	1987	c.1966C>A	c.(1966-1968)Cag>Aag	p.Q656K	KNDC1_ENST00000368572.2_Missense_Mutation_p.Q656K|KNDC1_ENST00000368571.2_Missense_Mutation_p.Q591K			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	656					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CGTGCCCGGCCAGCACCCCTG	0.697																																																	0													19.0	18.0	18.0					10																	135011900		2184	4291	6475	SO:0001583	missense	0			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1966C>A	10.37:g.135011900C>A	ENSP00000304437:p.Gln656Lys		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.Q656K	ENST00000304613.3	37	c.1966	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	C	10.57	1.388191	0.25118	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.12465	2.68;2.68;2.68	3.91	0.125	0.14718	.	0.935464	0.08904	N	0.876816	T	0.10165	0.0249	L	0.50333	1.59	0.09310	N	1	B;B;B	0.24823	0.112;0.003;0.005	B;B;B	0.23574	0.047;0.005;0.002	T	0.42531	-0.9446	10	0.02654	T	1	-0.0291	6.2055	0.20600	0.3817:0.3161:0.3022:0.0	.	656;591;656	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	K	656;656;591	ENSP00000304437:Q656K;ENSP00000357561:Q656K;ENSP00000357560:Q591K	ENSP00000304437:Q656K	Q	+	1	0	KNDC1	134861890	0.003000	0.15002	0.000000	0.03702	0.005000	0.04900	1.263000	0.33004	0.168000	0.19655	0.313000	0.20887	CAG	KNDC1	-	NULL	ENSG00000171798		0.697	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	-	0.00	61	0	C	NM_152643		135011900	+1	tier1	-	no_errors	ENST00000368572	ensembl	human	known	74_37	missense	27.91	31	12	SNP	0.000	A
KRT12	3859	genome.wustl.edu	37	17	39022479	39022479	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:39022479G>A	ENST00000251643.4	-	2	601	c.578C>T	c.(577-579)gCc>gTc	p.A193V	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	193	Coil 1B.|Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	TCCAATGCTGGCTGAAATGAT	0.418																																																	0													78.0	67.0	70.0					17																	39022479		2203	4300	6503	SO:0001583	missense	0				CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.578C>T	17.37:g.39022479G>A	ENSP00000251643:p.Ala193Val		B2R9E0	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.A193V	ENST00000251643.4	37	c.578	CCDS11378.1	17	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471945	0.63737	.	.	ENSG00000187242	ENST00000251643	D	0.88896	-2.44	6.07	4.09	0.47781	Filament (1);	0.000000	0.49916	D	0.000139	D	0.87951	0.6307	M	0.73753	2.245	0.44492	D	0.997433	P	0.47604	0.898	B	0.42138	0.377	D	0.88308	0.2954	10	0.56958	D	0.05	.	11.1568	0.48493	0.0656:0.0:0.8049:0.1295	.	193	Q99456	K1C12_HUMAN	V	193	ENSP00000251643:A193V	ENSP00000251643:A193V	A	-	2	0	KRT12	36276005	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	3.364000	0.52328	1.574000	0.49760	0.655000	0.94253	GCC	KRT12	-	pfam_IF	ENSG00000187242		0.418	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT12	HGNC	protein_coding	OTTHUMT00000257214.2	-	0.00	38	0	G	NM_000223		39022479	-1	tier1	-	no_errors	ENST00000251643	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
LCE2B	26239	genome.wustl.edu	37	1	152659480	152659480	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:152659480G>C	ENST00000368780.3	+	2	215	c.161G>C	c.(160-162)gGc>gCc	p.G54A	LCE2B_ENST00000417924.2_Missense_Mutation_p.G54A	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	54	Cys-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCTCTGGGGGCTGCTGTGGT	0.647																																																	0													114.0	128.0	124.0					1																	152659480		2203	4300	6503	SO:0001583	missense	0			BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.161G>C	1.37:g.152659480G>C	ENSP00000357769:p.Gly54Ala		Q5TA80	Missense_Mutation	SNP	NULL	p.G54A	ENST00000368780.3	37	c.161	CCDS1020.1	1	.	.	.	.	.	.	.	.	.	.	G	0.384	-0.926921	0.02377	.	.	ENSG00000159455	ENST00000417924;ENST00000368780	T;T	0.03801	3.8;3.8	2.49	0.351	0.16042	.	.	.	.	.	T	0.02193	0.0068	M	0.77313	2.365	0.20926	N	0.99983	B	0.21309	0.054	B	0.15484	0.013	T	0.40232	-0.9574	9	0.87932	D	0	.	3.3983	0.07313	0.1735:0.2711:0.5554:0.0	.	54	O14633	LCE2B_HUMAN	A	54	ENSP00000414043:G54A;ENSP00000357769:G54A	ENSP00000357769:G54A	G	+	2	0	LCE2B	150926104	0.961000	0.32948	0.352000	0.25734	0.019000	0.09904	1.611000	0.36879	-0.163000	0.10946	0.313000	0.20887	GGC	LCE2B	-	NULL	ENSG00000159455		0.647	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2B	HGNC	protein_coding	OTTHUMT00000034524.1	-	0.00	111	0	G	NM_014357		152659480	+1	tier1	-	no_errors	ENST00000368780	ensembl	human	known	74_37	missense	33.33	92	46	SNP	0.912	C
LEKR1	389170	genome.wustl.edu	37	3	156570780	156570780	+	Intron	SNP	T	T	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:156570780T>G	ENST00000470811.1	+	3	377				LEKR1_ENST00000489350.1_Intron|LEKR1_ENST00000491763.1_Intron|LEKR1_ENST00000477399.1_Intron|LEKR1_ENST00000356539.4_Intron|LEKR1_ENST00000498839.1_Missense_Mutation_p.M91R|LEKR1_ENST00000483177.1_Intron			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1											breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AGGTTGAGTATGTTTTTCTTT	0.303																																																	0													73.0	58.0	63.0					3																	156570780		692	1589	2281	SO:0001627	intron_variant	0			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.-959+9T>G	3.37:g.156570780T>G				Missense_Mutation	SNP	NULL	p.M91R	ENST00000470811.1	37	c.272		3	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.616842	0.00828	.	.	ENSG00000197980	ENST00000498839	.	.	.	5.38	4.2	0.49525	.	.	.	.	.	T	0.37972	0.1023	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20207	-1.0282	4	.	.	.	.	9.8387	0.40985	0.0:0.1728:0.0:0.8271	.	.	.	.	R	91	.	.	M	+	2	0	RP11-6F2.7	158053474	0.885000	0.30320	0.089000	0.20774	0.143000	0.21401	2.779000	0.47734	2.032000	0.59987	0.477000	0.44152	ATG	LEKR1	-	NULL	ENSG00000197980		0.303	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	LEKR1	HGNC	protein_coding	OTTHUMT00000351625.3	-	0.00	53	0	T	NM_001004316		156570780	+1	tier1	-	no_errors	ENST00000498839	ensembl	human	putative	74_37	missense	9.29	127	13	SNP	0.003	G
LMAN2	10960	genome.wustl.edu	37	5	176765576	176765576	+	Missense_Mutation	SNP	C	C	T	rs376459001		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:176765576C>T	ENST00000303127.7	-	3	550	c.346G>A	c.(346-348)Gtc>Atc	p.V116I	LMAN2_ENST00000506310.1_5'UTR|LMAN2_ENST00000515209.1_Missense_Mutation_p.V116I|RN7SL562P_ENST00000582768.1_RNA	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	116	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGAAGTGGACGTGCATTTCC	0.617																																																	0								C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	267.0	216.0	233.0		346	3.2	0.3	5		233	0,8600		0,0,4300	no	missense	LMAN2	NM_006816.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	116/357	176765576	1,13005	2203	4300	6503	SO:0001583	missense	0			U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.346G>A	5.37:g.176765576C>T	ENSP00000303366:p.Val116Ile		Q53HH1	Missense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf	p.V116I	ENST00000303127.7	37	c.346	CCDS4417.1	5	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703622	0.68501	2.27E-4	0.0	ENSG00000169223	ENST00000303127;ENST00000539488;ENST00000515209;ENST00000514458;ENST00000502560;ENST00000513877	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.03	3.21	0.36854	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.059239	0.64402	N	0.000003	T	0.63070	0.2480	M	0.67700	2.07	0.80722	D	1	B;B	0.26363	0.088;0.147	B;B	0.38327	0.129;0.271	T	0.59413	-0.7459	10	0.37606	T	0.19	-6.0838	9.7014	0.40189	0.1409:0.7849:0.0:0.0742	.	116;116	Q12907;D6RBV2	LMAN2_HUMAN;.	I	116;45;116;116;116;45	ENSP00000303366:V116I;ENSP00000423998:V116I;ENSP00000424132:V116I;ENSP00000425229:V116I;ENSP00000427377:V45I	ENSP00000303366:V116I	V	-	1	0	LMAN2	176698182	1.000000	0.71417	0.274000	0.24659	0.787000	0.44495	4.745000	0.62125	0.799000	0.34018	0.591000	0.81541	GTC	LMAN2	-	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf	ENSG00000169223		0.617	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMAN2	HGNC	protein_coding	OTTHUMT00000253434.1	-	0.00	34	0	C	NM_006816		176765576	-1	tier1	-	no_errors	ENST00000303127	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.994	T
CADM3	57863	genome.wustl.edu	37	1	159166613	159166613	+	Intron	DEL	T	T	-	rs533935187		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:159166613delT	ENST00000368125.4	+	7	939				CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Intron	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CTCCCAGTTATTTTTTTTTTT	0.527											OREG0013913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.783-68T>-	1.37:g.159166613delT		1799	Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	DEL	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			CTA-134P22.2	-	-	ENSG00000225670		0.527	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1		0.00	13	0	T	NM_021189		159166613	-1	tier1		no_errors	ENST00000415675	ensembl	human	known	74_37	rna	13.64	19	3	DEL	0.000	-
TTN	7273	genome.wustl.edu	37	2	179641846	179641846	+	Intron	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:179641846T>C	ENST00000591111.1	-	27	5039				TTN-AS1_ENST00000610005.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000360870.5_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTGTATAATGAGCTTAGCT	0.378																																																	0													99.0	104.0	102.0					2																	179641846		2203	4300	6503	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4814+29A>G	2.37:g.179641846T>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			RP11-88L24.4	-	-	ENSG00000266413		0.378	TTN-019	PUTATIVE	basic	protein_coding	LOC101927055	Clone_based_vega_gene	protein_coding	OTTHUMT00000460310.1	-	0.00	84	0	T	NM_133378		179641846	+1	tier1	-	no_errors	ENST00000582038	ensembl	human	known	74_37	rna	17.70	93	20	SNP	0.000	C
LOC202181	202181	genome.wustl.edu	37	5	177099140	177099140	+	RNA	SNP	T	T	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:177099140T>A	ENST00000515045.1	-	0	70					NR_026921.1																						GATCACGATGTAATCCTCCAT	0.756																																																	0																																												0																															5.37:g.177099140T>A				RNA	SNP	-	NULL	ENST00000515045.1	37	NULL		5																																																																																			RP11-1277A3.2	-	-	ENSG00000246596		0.756	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	LOC202181	Clone_based_vega_gene	pseudogene	OTTHUMT00000373167.1		0.00	15	0	T			177099140	-1			no_errors	ENST00000515045	ensembl	human	known	74_37	rna	8.00	23	2	SNP	0.986	A
LOC400743	400743	genome.wustl.edu	37	1	17521055	17521056	+	lincRNA	DEL	CT	CT	-	rs188318003		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:17521055_17521056delCT	ENST00000412427.1	+	0	1619_1620																											ctttcctgggctctctctctct	0.465																																																	0																																												0																															1.37:g.17521065_17521066delCT				RNA	DEL	-	NULL	ENST00000412427.1	37	NULL		1																																																																																			RP11-380J14.1	-	-	ENSG00000204362		0.465	RP11-380J14.1-001	KNOWN	basic	lincRNA	LOC400743	Clone_based_vega_gene	lincRNA	OTTHUMT00000006615.1		0.00	51	0	CT			17521056	+1	tier1		no_errors	ENST00000412427	ensembl	human	known	74_37	rna	9.38	29	3	DEL	0.001:0.001	-
LPIN1	23175	genome.wustl.edu	37	2	11927288	11927288	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:11927288G>T	ENST00000256720.2	+	10	1623	c.1530G>T	c.(1528-1530)ggG>ggT	p.G510G	LPIN1_ENST00000404113.2_5'UTR|LPIN1_ENST00000449576.2_Silent_p.G595G|LPIN1_ENST00000396099.1_Silent_p.G552G|LPIN1_ENST00000425416.2_Silent_p.G516G|LPIN1_ENST00000396097.1_Silent_p.G240G	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	510					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TAAAGATTGGGAGTAAGTAAG	0.403																																																	0													121.0	103.0	109.0					2																	11927288		2203	4300	6503	SO:0001819	synonymous_variant	0			D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.1530G>T	2.37:g.11927288G>T			A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Silent	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,superfamily_WD40_repeat_dom,smart_LNS2	p.G595	ENST00000256720.2	37	c.1785	CCDS1682.1	2																																																																																			LPIN1	-	NULL	ENSG00000134324		0.403	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN1	HGNC	protein_coding	OTTHUMT00000239296.3		0.00	57	0	G	NM_145693		11927288	+1			no_errors	ENST00000449576	ensembl	human	known	74_37	silent	10.42	43	5	SNP	0.152	T
LOC645166	645166	genome.wustl.edu	37	2	91824833	91824833	+	RNA	SNP	G	G	C	rs202218362		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:91824833G>C	ENST00000609777.1	-	0	199																											GGTTTCATATGTGGAGTGTGA	0.448																																																	0																																												0																															2.37:g.91824833G>C				RNA	SNP	-	NULL	ENST00000609777.1	37	NULL		2																																																																																			AC027612.6	-	-	ENSG00000143429		0.448	AC027612.6-002	KNOWN	basic	processed_transcript	LOC654342	Clone_based_vega_gene	pseudogene	OTTHUMT00000471986.1	-	0.00	24	0	G			91824833	-1	tier1	rs202218362	no_errors	ENST00000608018	ensembl	human	known	74_37	rna	37.50	10	6	SNP	0.001	C
LRRC4B	94030	genome.wustl.edu	37	19	51020952	51020952	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:51020952T>C	ENST00000599957.1	-	3	2215	c.2018A>G	c.(2017-2019)cAc>cGc	p.H673R	LRRC4B_ENST00000389201.3_Missense_Mutation_p.H673R			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	673					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GCTGCTGTAGTGCGCCTTGAA	0.687																																																	0													29.0	34.0	33.0					19																	51020952		1980	4143	6123	SO:0001583	missense	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.2018A>G	19.37:g.51020952T>C	ENSP00000471502:p.His673Arg		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.H673R	ENST00000599957.1	37	c.2018	CCDS42595.1	19	.	.	.	.	.	.	.	.	.	.	T	5.691	0.311980	0.10789	.	.	ENSG00000131409	ENST00000389201	T	0.34275	1.37	2.62	2.62	0.31277	.	0.084489	0.44902	U	0.000412	T	0.31702	0.0805	L	0.59436	1.845	0.42157	D	0.99158	B	0.15141	0.012	B	0.12156	0.007	T	0.18493	-1.0335	10	0.44086	T	0.13	.	8.7271	0.34476	0.0:0.0:0.0:1.0	.	673	Q9NT99	LRC4B_HUMAN	R	673	ENSP00000373853:H673R	ENSP00000373853:H673R	H	-	2	0	LRRC4B	55712764	0.996000	0.38824	1.000000	0.80357	0.957000	0.61999	1.056000	0.30480	1.207000	0.43291	0.379000	0.24179	CAC	LRRC4B	-	NULL	ENSG00000131409		0.687	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1	-	0.00	65	0	T	NM_001080457		51020952	-1	tier1	-	no_errors	ENST00000389201	ensembl	human	known	74_37	missense	29.23	46	19	SNP	1.000	C
MAGEC1	9947	genome.wustl.edu	37	X	140994088	140994088	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrX:140994088C>A	ENST00000285879.4	+	4	1184	c.898C>A	c.(898-900)Cag>Aag	p.Q300K	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	300										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GGGTTTTCCCCAGTCTCCTCT	0.488										HNSCC(15;0.026)																																							0													125.0	117.0	120.0					X																	140994088		2199	4293	6492	SO:0001583	missense	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.898C>A	X.37:g.140994088C>A	ENSP00000285879:p.Gln300Lys		A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.Q300K	ENST00000285879.4	37	c.898	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	c	1.012	-0.687548	0.03328	.	.	ENSG00000155495	ENST00000285879;ENST00000370511;ENST00000370510	T;T	0.18657	3.91;2.2	.	.	.	.	.	.	.	.	T	0.09113	0.0225	N	0.08118	0	0.18873	N	0.999982	B	0.10296	0.003	B	0.04013	0.001	T	0.29518	-1.0009	8	0.87932	D	0	.	2.6709	0.05067	0.0:0.517:0.0:0.483	.	300	O60732	MAGC1_HUMAN	K	300;102;101	ENSP00000285879:Q300K;ENSP00000359542:Q102K	ENSP00000285879:Q300K	Q	+	1	0	MAGEC1	140821754	0.837000	0.29446	0.124000	0.21820	0.125000	0.20455	0.147000	0.16202	0.148000	0.19059	0.150000	0.16122	CAG	MAGEC1	-	NULL	ENSG00000155495		0.488	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	-	0.00	119	0	C	NM_005462		140994088	+1	tier1	-	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	55.64	59	74	SNP	0.265	A
MANEAL	149175	genome.wustl.edu	37	1	38261479	38261479	+	Silent	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:38261479G>A	ENST00000373045.6	+	2	1002	c.621G>A	c.(619-621)gtG>gtA	p.V207V	MANEAL_ENST00000397631.3_Silent_p.V207V|MANEAL_ENST00000525897.1_Silent_p.V13V|MANEAL_ENST00000329006.5_Missense_Mutation_p.C11Y	NM_001113482.1	NP_001106954.1	Q5VSG8	MANEL_HUMAN	mannosidase, endo-alpha-like	207						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|liver(1)|lung(1)|prostate(3)	7	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ATGACCTGGTGCCCGCCATTC	0.597																																																	0													102.0	95.0	98.0					1																	38261479		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055996	CCDS426.1, CCDS44110.1, CCDS44111.1	1p34.3	2008-02-05			ENSG00000185090	ENSG00000185090			26452	protein-coding gene	gene with protein product							Standard	NM_152496		Approved	FLJ31434	uc001cby.2	Q5VSG8	OTTHUMG00000004317	ENST00000373045.6:c.621G>A	1.37:g.38261479G>A			Q6DD86|Q6P497|Q8N5P8|Q96G55|Q96N42	Missense_Mutation	SNP	NULL	p.C11Y	ENST00000373045.6	37	c.32	CCDS44110.1	1	.	.	.	.	.	.	.	.	.	.	G	8.485	0.860658	0.17178	.	.	ENSG00000185090	ENST00000329006	.	.	.	5.84	-4.35	0.03656	.	.	.	.	.	T	0.10766	0.0263	.	.	.	0.21861	N	0.999509	B	0.02656	0.0	B	0.01281	0.0	T	0.34551	-0.9824	7	0.02654	T	1	-19.0616	4.2252	0.10577	0.5181:0.0988:0.2832:0.0999	.	11	Q5VSG8-2	.	Y	11	.	ENSP00000328770:C11Y	C	+	2	0	MANEAL	38034066	0.876000	0.30132	0.983000	0.44433	0.962000	0.63368	-0.062000	0.11674	-0.411000	0.07530	-0.794000	0.03295	TGC	MANEAL	-	NULL	ENSG00000185090		0.597	MANEAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEAL	HGNC	protein_coding	OTTHUMT00000012469.2		0.00	66	0	G	NM_152496		38261479	+1			no_errors	ENST00000329006	ensembl	human	known	74_37	missense	6.74	77	6	SNP	0.337	A
MAP3K19	80122	genome.wustl.edu	37	2	135722473	135722473	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:135722473G>A	ENST00000375845.3	-	10	3964	c.3934C>T	c.(3934-3936)Cga>Tga	p.R1312*	MAP3K19_ENST00000392918.3_Nonsense_Mutation_p.R446*|MAP3K19_ENST00000375844.3_Nonsense_Mutation_p.R494*|MAP3K19_ENST00000392917.3_Nonsense_Mutation_p.R444*|MAP3K19_ENST00000358371.4_Nonsense_Mutation_p.R1199*	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1312	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										GCAGAAGGTCGCTCATGCTGG	0.448																																																	0													60.0	53.0	56.0					2																	135722473		2203	4300	6503	SO:0001587	stop_gained	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3934C>T	2.37:g.135722473G>A	ENSP00000365005:p.Arg1312*		B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R1312*	ENST00000375845.3	37	c.3934	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560048	0.86335	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917	.	.	.	5.82	1.74	0.24563	.	0.000000	0.39146	N	0.001451	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6453	0.62277	0.0:0.0:0.4502:0.5498	.	.	.	.	X	1312;1199;494;446;444	.	ENSP00000351140:R1199X	R	-	1	2	YSK4	135438943	0.820000	0.29190	0.995000	0.50966	0.995000	0.86356	1.548000	0.36201	0.034000	0.15491	0.561000	0.74099	CGA	MAP3K19	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000176601		0.448	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K19	HGNC	protein_coding	OTTHUMT00000158244.1	-	0.00	42	0	G	NM_025052		135722473	-1	tier1	-	no_errors	ENST00000375845	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	0.996	A
MAPK1IP1L	93487	genome.wustl.edu	37	14	55518518	55518518	+	5'UTR	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr14:55518518C>T	ENST00000395468.4	+	0	170				MAPK1IP1L_ENST00000554364.1_3'UTR	NM_144578.3	NP_653179.1	Q8NDC0	MISSL_HUMAN	mitogen-activated protein kinase 1 interacting protein 1-like											endometrium(2)|large_intestine(1)|lung(3)	6						TCGGATATTGCCGGGTGAGGC	0.687																																																	0													109.0	110.0	110.0					14																	55518518		876	1991	2867	SO:0001623	5_prime_UTR_variant	0			AK025580	CCDS32085.1	14q22.1	2008-01-30	2008-01-30	2008-01-16		ENSG00000168175			19840	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 32"", ""mitogen activated protein kinase 1 interacting protein 1-like"""	C14orf32		12011110	Standard	NM_144578		Approved		uc001xbq.1	Q8NDC0		ENST00000395468.4:c.-8C>T	14.37:g.55518518C>T			B2RDD8|Q96BG5	RNA	SNP	-	NULL	ENST00000395468.4	37	NULL	CCDS32085.1	14																																																																																			MAPK1IP1L	-	-	ENSG00000168175		0.687	MAPK1IP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK1IP1L	HGNC	protein_coding	OTTHUMT00000411302.2	-	0.00	54	0	C	NM_144578		55518518	+1	tier1	-	no_errors	ENST00000554364	ensembl	human	putative	74_37	rna	6.56	57	4	SNP	0.992	T
MDN1	23195	genome.wustl.edu	37	6	90499981	90499981	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:90499981C>A	ENST00000369393.3	-	6	1110	c.995G>T	c.(994-996)gGa>gTa	p.G332V	MDN1_ENST00000428876.1_Missense_Mutation_p.G332V			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	332					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTTGCCACATCCTATTGGTCC	0.463																																																	0													179.0	188.0	185.0					6																	90499981		2203	4300	6503	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.995G>T	6.37:g.90499981C>A	ENSP00000358400:p.Gly332Val		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.G332V	ENST00000369393.3	37	c.995	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534282	0.64972	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	D;D;D	0.96885	-4.16;-4.16;-4.16	4.91	4.91	0.64330	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	D	0.99013	0.9663	H	0.98276	4.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99433	1.0936	10	0.87932	D	0	.	18.1265	0.89587	0.0:1.0:0.0:0.0	.	332;332	Q6ZVV6;Q9NU22	.;MDN1_HUMAN	V	332	ENSP00000358400:G332V;ENSP00000413970:G332V;ENSP00000409664:G332V	ENSP00000358400:G332V	G	-	2	0	MDN1	90556702	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.818000	0.86416	2.288000	0.76882	0.655000	0.94253	GGA	MDN1	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_Midasin	ENSG00000112159		0.463	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	65	0	C			90499981	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
MED13L	23389	genome.wustl.edu	37	12	116422129	116422129	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:116422129C>A	ENST00000281928.3	-	20	4593	c.4387G>T	c.(4387-4389)Ggg>Tgg	p.G1463W		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1463						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CGCATGATCCCGTCACGTAGC	0.483																																																	0													137.0	95.0	110.0					12																	116422129		2203	4300	6503	SO:0001583	missense	0			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.4387G>T	12.37:g.116422129C>A	ENSP00000281928:p.Gly1463Trp		A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.G1463W	ENST00000281928.3	37	c.4387	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325919	0.60743	.	.	ENSG00000123066	ENST00000281928	T	0.72615	-0.67	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.87200	0.6118	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.89341	0.3654	10	0.87932	D	0	.	19.2439	0.93895	0.0:1.0:0.0:0.0	.	1463	Q71F56	MD13L_HUMAN	W	1463	ENSP00000281928:G1463W	ENSP00000281928:G1463W	G	-	1	0	MED13L	114906512	1.000000	0.71417	0.942000	0.38095	0.956000	0.61745	7.484000	0.81180	2.538000	0.85594	0.655000	0.94253	GGG	MED13L	-	NULL	ENSG00000123066		0.483	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3		0.00	30	0	C			116422129	-1			no_errors	ENST00000281928	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.998	A
MEOX2	4223	genome.wustl.edu	37	7	15725803	15725803	+	Silent	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:15725803G>A	ENST00000262041.5	-	1	634	c.225C>T	c.(223-225)caC>caT	p.H75H	AC005550.4_ENST00000442176.1_lincRNA|AC005550.5_ENST00000438923.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	75	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtgatggtggtggtggtggt	0.602																																					Esophageal Squamous(140;197 1769 16409 18257 29929)												0													21.0	22.0	22.0					7																	15725803		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.225C>T	7.37:g.15725803G>A			B2R8I7|O75263|Q9UPL6	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.H75	ENST00000262041.5	37	c.225	CCDS34605.1	7																																																																																			MEOX2	-	NULL	ENSG00000106511		0.602	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX2	HGNC	protein_coding	OTTHUMT00000326058.2		0.00	59	0	G	NM_005924		15725803	-1			no_errors	ENST00000262041	ensembl	human	known	74_37	silent	5.26	54	3	SNP	1.000	A
SLC9A3R1	9368	genome.wustl.edu	37	17	72744762	72744762	+	5'Flank	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:72744762C>T	ENST00000262613.5	+	0	0				MIR3615_ENST00000581999.1_RNA|MIR3615_ENST00000585285.1_RNA	NM_004252.4	NP_004243.1	O14745	NHRF1_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1						actin cytoskeleton organization (GO:0030036)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|bile acid secretion (GO:0032782)|cellular phosphate ion homeostasis (GO:0030643)|cellular protein localization (GO:0034613)|glutathione transport (GO:0034635)|microvillus assembly (GO:0030033)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of sodium:proton antiporter activity (GO:0032416)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein complex assembly (GO:0006461)|regulation of excretion (GO:0044062)|regulation of protein kinase activity (GO:0045859)|regulation of sodium:proton antiporter activity (GO:0032415)|renal absorption (GO:0070293)|renal phosphate ion absorption (GO:0097291)|renal sodium ion transport (GO:0003096)|Wnt signaling pathway (GO:0016055)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|membrane raft (GO:0045121)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle (GO:0031982)	beta-2 adrenergic receptor binding (GO:0031698)|beta-catenin binding (GO:0008013)|chloride channel regulator activity (GO:0017081)|growth factor receptor binding (GO:0070851)|PDZ domain binding (GO:0030165)|phosphatase binding (GO:0019902)|protein self-association (GO:0043621)|receptor binding (GO:0005102)			large_intestine(4)	4						GACTCTGGGACGCTCAGACGC	0.761																																																	0																																										SO:0001631	upstream_gene_variant	0			AF015926	CCDS11705.1	17q25.1	2014-09-04	2012-03-22		ENSG00000109062	ENSG00000109062			11075	protein-coding gene	gene with protein product		604990	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1"""			9314537, 9430655	Standard	NM_004252		Approved	NHERF, EBP50	uc002jlo.4	O14745	OTTHUMG00000178863		17.37:g.72744762C>T	Exception_encountered		B3KY21|O43552|Q86WQ5	RNA	SNP	-	NULL	ENST00000262613.5	37	NULL	CCDS11705.1	17																																																																																			MIR3615	-	-	ENSG00000264624		0.761	SLC9A3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3615	HGNC	protein_coding	OTTHUMT00000443671.1	-	0.00	15	0	C			72744762	+1	tier1	-	no_errors	ENST00000581999	ensembl	human	known	74_37	rna	21.05	15	4	SNP	0.073	T
MITF	4286	genome.wustl.edu	37	3	69987140	69987140	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:69987140G>T	ENST00000448226.2	+	3	649	c.522G>T	c.(520-522)ggG>ggT	p.G174G	MITF_ENST00000394355.2_Silent_p.G149G|MITF_ENST00000328528.6_Silent_p.G173G|MITF_ENST00000352241.4_Silent_p.G174G|MITF_ENST00000531774.1_Intron|MITF_ENST00000314589.5_Silent_p.G158G|MITF_ENST00000314557.6_Silent_p.G67G|MITF_ENST00000472437.1_Silent_p.G122G|MITF_ENST00000394348.1_3'UTR|MITF_ENST00000394351.3_Silent_p.G67G			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	174					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CGGTGCCGGGGAGCAGCGCAC	0.498			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)			Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	0													90.0	79.0	83.0					3																	69987140		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.522G>T	3.37:g.69987140G>T			B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G174	ENST00000448226.2	37	c.522		3																																																																																			MITF	-	NULL	ENSG00000187098		0.498	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	MITF	HGNC	protein_coding	OTTHUMT00000313947.1	-	0.00	45	0	G	NM_198159		69987140	+1	tier1	-	no_errors	ENST00000448226	ensembl	human	known	74_37	silent	12.50	28	4	SNP	1.000	T
MLIP	90523	genome.wustl.edu	37	6	54002010	54002010	+	Intron	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:54002010C>A	ENST00000274897.5	+	4	725				MLIP_ENST00000509997.1_Intron|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000502396.1_Silent_p.T381T|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000514921.1_Silent_p.T370T|MLIP_ENST00000358276.5_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein							nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						AACCATTTACCTCCTCTTTCC	0.527																																																	0																																										SO:0001627	intron_variant	0			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.613-11844C>A	6.37:g.54002010C>A			B7Z2N0|D6RE05|Q96H08|Q96NF7	Silent	SNP	NULL	p.T381	ENST00000274897.5	37	c.1143	CCDS4954.1	6																																																																																			MLIP	-	NULL	ENSG00000146147		0.527	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3		0.00	32	0	C	NM_138569		54002010	+1			no_errors	ENST00000502396	ensembl	human	putative	74_37	silent	10.26	35	4	SNP	0.000	A
MMP12	4321	genome.wustl.edu	37	11	102743837	102743837	+	RNA	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:102743837G>T	ENST00000532855.1	-	0	204							P39900	MMP12_HUMAN	matrix metallopeptidase 12 (macrophage elastase)						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|proteolysis (GO:0006508)|wound healing, spreading of epidermal cells (GO:0035313)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	26		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)|Marimastat(DB00786)	ATTTTTCTAAGTATCTCTGGA	0.328																																																	0													27.0	27.0	27.0					11																	102743837		1800	4071	5871			0			L23808	CCDS73375.1	11q22.3	2009-02-26	2005-08-08			ENSG00000262406			7158	protein-coding gene	gene with protein product		601046	"""matrix metalloproteinase 12 (macrophage elastase)"""				Standard	NM_002426		Approved	HME	uc001phk.3	P39900			11.37:g.102743837G>T			B2R9X8|B7ZLF6|Q2M1L9	RNA	SNP	-	NULL	ENST00000532855.1	37	NULL		11																																																																																			MMP12	-	-	ENSG00000110347		0.328	MMP12-001	KNOWN	basic	processed_transcript	MMP12	HGNC	processed_transcript	OTTHUMT00000386646.1	-	0.00	45	0	G	NM_002426		102743837	-1	tier1	-	no_errors	ENST00000326227	ensembl	human	known	74_37	rna	10.00	36	4	SNP	0.998	T
MOSPD3	64598	genome.wustl.edu	37	7	100210514	100210514	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:100210514G>C	ENST00000393950.2	+	1	382	c.100G>C	c.(100-102)Gtc>Ctc	p.V34L	MOSPD3_ENST00000223054.4_Missense_Mutation_p.V34L|MOSPD3_ENST00000379527.2_Missense_Mutation_p.V34L|MOSPD3_ENST00000424091.2_Missense_Mutation_p.V34L	NM_023948.4	NP_076438.1	O75425	MSPD3_HUMAN	motile sperm domain containing 3	34	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.				heart development (GO:0007507)	integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CGTTGTCCCGGTCCTGGTCTT	0.706																																																	0													30.0	35.0	34.0					7																	100210514		2198	4283	6481	SO:0001583	missense	0			BC011653	CCDS5701.1, CCDS47662.1	7q22	2009-11-06			ENSG00000106330	ENSG00000106330			25078	protein-coding gene	gene with protein product		609125				15533722	Standard	XM_005250531		Approved	CDS3, NET30	uc003uvs.3	O75425	OTTHUMG00000159599	ENST00000393950.2:c.100G>C	7.37:g.100210514G>C	ENSP00000377522:p.Val34Leu		A4D2D1|A6NG17|C9JE89|D6W5W1|O75423|O75424	Missense_Mutation	SNP	pfam_MSP_dom,superfamily_PapD-like,pfscan_MSP_dom	p.V34L	ENST00000393950.2	37	c.100	CCDS5701.1	7	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324498	0.81580	.	.	ENSG00000106330	ENST00000223054;ENST00000493970;ENST00000379527;ENST00000393950;ENST00000424091;ENST00000393953	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	3.89	3.89	0.44902	PapD-like (1);	0.000000	0.50627	D	0.000117	T	0.67534	0.2903	M	0.67700	2.07	0.46336	D	0.998996	D;D	0.63046	0.992;0.992	D;D	0.74348	0.983;0.983	T	0.70245	-0.4925	10	0.72032	D	0.01	-15.8464	11.6633	0.51361	0.0:0.0:1.0:0.0	.	34;34	C9JE89;O75425	.;MSPD3_HUMAN	L	34;34;34;34;34;20	ENSP00000223054:V34L;ENSP00000417276:V34L;ENSP00000368842:V34L;ENSP00000377522:V34L;ENSP00000404626:V34L	ENSP00000223054:V34L	V	+	1	0	MOSPD3	100048450	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.040000	0.64191	2.468000	0.83385	0.462000	0.41574	GTC	MOSPD3	-	pfam_MSP_dom,superfamily_PapD-like,pfscan_MSP_dom	ENSG00000106330		0.706	MOSPD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MOSPD3	HGNC	protein_coding	OTTHUMT00000356395.1	-	0.00	65	0	G	NM_023948		100210514	+1	tier1	-	no_errors	ENST00000223054	ensembl	human	known	74_37	missense	16.39	51	10	SNP	1.000	C
MPL	4352	genome.wustl.edu	37	1	43814638	43814638	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:43814638C>G	ENST00000372470.3	+	9	1475	c.1433C>G	c.(1432-1434)tCg>tGg	p.S478W	MPL_ENST00000413998.2_Missense_Mutation_p.S478W	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	478	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	AGCTCGTGGTCGGACCCAACT	0.711			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														NSCLC(52;534 1204 10016 41452 44427)		yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	L	0													11.0	13.0	12.0					1																	43814638		2163	4236	6399	SO:0001583	missense	0			M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.1433C>G	1.37:g.43814638C>G	ENSP00000361548:p.Ser478Trp		Q5JUZ0	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S478W	ENST00000372470.3	37	c.1433	CCDS483.1	1	.	.	.	.	.	.	.	.	.	.	c	17.85	3.491136	0.64074	.	.	ENSG00000117400	ENST00000372468;ENST00000372470;ENST00000413998	D;D	0.95821	-3.82;-3.82	4.43	4.43	0.53597	Fibronectin, type III (2);Long hematopoietin receptor, single chain, conserved site (1);Immunoglobulin-like fold (1);	0.499201	0.19058	N	0.123849	D	0.97701	0.9246	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.948;0.998;0.999	D	0.98406	1.0570	10	0.87932	D	0	-12.9354	14.2655	0.66116	0.0:1.0:0.0:0.0	.	471;478;478	Q308M1;P40238;Q5JUY5	.;TPOR_HUMAN;.	W	478	ENSP00000361548:S478W;ENSP00000414004:S478W	ENSP00000361546:S478W	S	+	2	0	MPL	43587225	0.993000	0.37304	0.894000	0.35097	0.327000	0.28475	3.968000	0.56809	2.008000	0.58898	0.444000	0.29173	TCG	MPL	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000117400		0.711	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPL	HGNC	protein_coding	OTTHUMT00000019522.1	-	0.00	41	0	C	NM_005373		43814638	+1	tier1	-	no_errors	ENST00000372470	ensembl	human	known	74_37	missense	8.16	43	4	SNP	0.977	G
MUC16	94025	genome.wustl.edu	37	19	9076812	9076813	+	In_Frame_Ins	INS	-	-	TGG			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:9076812_9076813insTGG	ENST00000397910.4	-	3	10836_10837	c.10633_10634insCCA	c.(10633-10635)atg>aCCAtg	p.3544_3545insT		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3545	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTGGTTCCCATGGTGGTGATG	0.535																																																	0																																										SO:0001652	inframe_insertion	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10631_10633dupCCA	19.37:g.9076816_9076818dupTGG	ENSP00000381008:p.Thr3544_Thr3544dup		Q6ZQW5|Q96RK2	In_Frame_Ins	INS	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.3545in_frame_insT	ENST00000397910.4	37	c.10634_10633	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.535	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1		0.00	87	0	-	NM_024690		9076813	-1	tier1		no_errors	ENST00000397910	ensembl	human	known	74_37	in_frame_ins	14.29	96	16	INS	0.001:0.000	TGG
MUC4	4585	genome.wustl.edu	37	3	195510099	195510099	+	Silent	SNP	A	A	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:195510099A>T	ENST00000463781.3	-	2	8811	c.8352T>A	c.(8350-8352)ccT>ccA	p.P2784P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.P2784P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACATGAAGAGGGGTGGCGT	0.592																																																	0													45.0	27.0	33.0					3																	195510099		687	1534	2221	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8352T>A	3.37:g.195510099A>T			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P2784	ENST00000463781.3	37	c.8352	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	147	0	A	NM_018406		195510099	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	33.04	75	38	SNP	0.002	T
MYF6	4618	genome.wustl.edu	37	12	81101624	81101624	+	Silent	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:81101624C>A	ENST00000228641.3	+	1	348	c.126C>A	c.(124-126)tcC>tcA	p.S42S		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	42					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						GTACCTTGTCCCCCTGCCAGG	0.602																																																	0													73.0	76.0	75.0					12																	81101624		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.126C>A	12.37:g.81101624C>A			B2R898|Q53X80|Q6FHI9	Silent	SNP	pfam_Basic,pfam_bHLH_dom,superfamily_bHLH_dom,smart_Basic,smart_bHLH_dom,pfscan_bHLH_dom	p.S42	ENST00000228641.3	37	c.126	CCDS9019.1	12																																																																																			MYF6	-	pfam_Basic,smart_Basic	ENSG00000111046		0.602	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	HGNC	protein_coding	OTTHUMT00000407756.1	-	0.00	53	0	C	NM_002469		81101624	+1	tier1	-	no_errors	ENST00000228641	ensembl	human	known	74_37	silent	18.92	29	7	SNP	1.000	A
MYO5C	55930	genome.wustl.edu	37	15	52539674	52539674	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr15:52539674C>T	ENST00000261839.7	-	15	2023	c.1862G>A	c.(1861-1863)cGg>cAg	p.R621Q	MYO5C_ENST00000443683.2_3'UTR	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	621	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		AACTGTGGTCCGGAAATGCTT	0.493																																																	0													146.0	138.0	141.0					15																	52539674		1936	4139	6075	SO:0001583	missense	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.1862G>A	15.37:g.52539674C>T	ENSP00000261839:p.Arg621Gln		Q6P1W8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R621Q	ENST00000261839.7	37	c.1862	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534420	0.85812	.	.	ENSG00000128833	ENST00000261839	T	0.18810	2.19	5.55	5.55	0.83447	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.27731	0.0682	L	0.42686	1.345	0.80722	D	1	P	0.47302	0.893	P	0.46253	0.509	T	0.00403	-1.1761	10	0.35671	T	0.21	.	19.8764	0.96873	0.0:1.0:0.0:0.0	.	621	Q9NQX4	MYO5C_HUMAN	Q	621	ENSP00000261839:R621Q	ENSP00000261839:R621Q	R	-	2	0	MYO5C	50326966	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.968000	0.63728	2.768000	0.95171	0.655000	0.94253	CGG	MYO5C	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000128833		0.493	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1		0.00	42	0	C	NM_018728		52539674	-1			no_errors	ENST00000261839	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	T
NAALADL2	254827	genome.wustl.edu	37	3	175293940	175293940	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:175293940G>C	ENST00000454872.1	+	10	1893	c.1765G>C	c.(1765-1767)Gtg>Ctg	p.V589L	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	589						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		AGTTCCCATCGTGCAGTTTGC	0.393																																																	0													156.0	151.0	153.0					3																	175293940		1884	4119	6003	SO:0001583	missense	0				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1765G>C	3.37:g.175293940G>C	ENSP00000404705:p.Val589Leu		Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	superfamily_TFR-like_dimer_dom	p.V589L	ENST00000454872.1	37	c.1765	CCDS46960.1	3	.	.	.	.	.	.	.	.	.	.	G	8.424	0.847073	0.17034	.	.	ENSG00000177694	ENST00000454872	T	0.36520	1.25	6.08	3.19	0.36642	Peptidase M28 (1);	0.320980	0.29995	N	0.010678	T	0.19127	0.0459	N	0.20401	0.57	0.09310	N	0.999999	B	0.11235	0.004	B	0.17979	0.02	T	0.18808	-1.0325	10	0.11794	T	0.64	-11.549	7.3788	0.26843	0.0723:0.3259:0.4994:0.1024	.	589	Q58DX5	NADL2_HUMAN	L	589	ENSP00000404705:V589L	ENSP00000404705:V589L	V	+	1	0	NAALADL2	176776634	0.206000	0.23470	0.926000	0.36857	0.943000	0.58893	0.463000	0.21972	1.572000	0.49736	0.655000	0.94253	GTG	NAALADL2	-	NULL	ENSG00000177694		0.393	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL2	HGNC	protein_coding	OTTHUMT00000347390.2	-	0.00	86	0	G	NM_207015		175293940	+1	tier1	-	no_errors	ENST00000454872	ensembl	human	known	74_37	missense	5.85	161	10	SNP	0.153	C
NACA	4666	genome.wustl.edu	37	12	57114751	57114752	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:57114751_57114752delAG	ENST00000454682.1	-	3	843_844	c.562_563delCT	c.(562-564)cttfs	p.L188fs	NACA_ENST00000552540.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000550952.1_Frame_Shift_Del_p.L188fs|NACA_ENST00000548563.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000551793.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	188	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						AACTTTATTAAGATTAGTCTTT	0.49			T	BCL6	NHL																																			Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0																																										SO:0001589	frameshift_variant	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.562_563delCT	12.37:g.57114751_57114752delAG	ENSP00000403817:p.Leu188fs			Frame_Shift_Del	DEL	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx_dom	p.L188fs	ENST00000454682.1	37	c.563_562		12																																																																																			NACA	-	NULL	ENSG00000196531		0.490	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding			0.00	34	0	AG	NM_005594		57114752	-1	tier1		no_errors	ENST00000454682	ensembl	human	known	74_37	frame_shift_del	41.86	25	18	DEL	0.006:0.006	-
NARFL	64428	genome.wustl.edu	37	16	781655	781655	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:781655C>T	ENST00000251588.2	-	9	960	c.944G>A	c.(943-945)gGc>gAc	p.G315D	NARFL_ENST00000540986.1_Missense_Mutation_p.G213D|NARFL_ENST00000301694.5_3'UTR|NARFL_ENST00000562862.1_5'UTR|NARFL_ENST00000568545.1_Missense_Mutation_p.G213D	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	315					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				GCCCCCCGAGCCCCCTCCCCG	0.667																																																	0													21.0	20.0	20.0					16																	781655		2159	4246	6405	SO:0001583	missense	0			AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.944G>A	16.37:g.781655C>T	ENSP00000251588:p.Gly315Asp		A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.G315D	ENST00000251588.2	37	c.944	CCDS10425.1	16	.	.	.	.	.	.	.	.	.	.	C	33	5.220800	0.95139	.	.	ENSG00000103245	ENST00000251588;ENST00000540986	T;T	0.43294	0.95;0.95	5.31	5.31	0.75309	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.047033	0.85682	D	0.000000	T	0.70868	0.3273	M	0.90542	3.125	0.80722	D	1	D	0.60575	0.988	D	0.67548	0.952	T	0.77555	-0.2544	10	0.66056	D	0.02	-7.6494	17.9537	0.89062	0.0:1.0:0.0:0.0	.	315	Q9H6Q4	NARFL_HUMAN	D	315;213	ENSP00000251588:G315D;ENSP00000444008:G213D	ENSP00000251588:G315D	G	-	2	0	NARFL	721656	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	5.365000	0.66116	2.474000	0.83562	0.511000	0.50034	GGC	NARFL	-	pfam_Fe_hydrogenase_lsu_C,superfamily_Fe_hydrogenase	ENSG00000103245		0.667	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARFL	HGNC	protein_coding	OTTHUMT00000242855.1		0.00	23	0	C	NM_022493		781655	-1			no_errors	ENST00000251588	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
NAT16	375607	genome.wustl.edu	37	7	100817776	100817776	+	Splice_Site	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:100817776C>G	ENST00000300303.2	-	2	551		c.e2+1		NAT16_ENST00000443096.1_Missense_Mutation_p.V105L|NAT16_ENST00000455377.1_Splice_Site	NM_198571.2	NP_940973.2	Q8N8M0	NAT16_HUMAN	N-acetyltransferase 16 (GCN5-related, putative)								N-acetyltransferase activity (GO:0008080)										CCCGGGCTCACCACGCCTCCG	0.672																																																	0													18.0	17.0	17.0					7																	100817776		2199	4296	6495	SO:0001630	splice_region_variant	0			AK096556	CCDS5713.1	7q22.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000167011	ENSG00000167011			22030	protein-coding gene	gene with protein product		615783	"""chromosome 7 open reading frame 52"""	C7orf52			Standard	NM_198571		Approved	FLJ39237	uc003uxy.2	Q8N8M0	OTTHUMG00000157110	ENST00000300303.2:c.312+1G>C	7.37:g.100817776C>G			B3KRS2|Q8NDR1	Splice_Site	SNP	-	e1+1	ENST00000300303.2	37	c.312+1	CCDS5713.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.77|17.77	3.470464|3.470464	0.63625|0.63625	.|.	.|.	ENSG00000167011|ENSG00000167011	ENST00000300303;ENST00000455377;ENST00000444446|ENST00000443096	.|T	.|0.53640	.|0.61	3.44|3.44	2.5|2.5	0.30297|0.30297	.|.	.|.	.|.	.|.	.|.	.|T	.|0.37839	.|0.1018	.|.	.|.	.|.	0.21147|0.21147	N|N	0.999775|0.999775	.|P	.|0.40107	.|0.703	.|B	.|0.36959	.|0.237	.|T	.|0.16394	.|-1.0404	.|8	.|0.56958	.|D	.|0.05	.|.	10.2852|10.2852	0.43562|0.43562	0.0:0.7958:0.2042:0.0|0.0:0.7958:0.2042:0.0	.|.	.|105	.|B3KRS2	.|.	.|L	-1|105	.|ENSP00000394435:V105L	.|ENSP00000394435:V105L	.|V	-|-	.|1	.|0	C7orf52|C7orf52	100604496|100604496	1.000000|1.000000	0.71417|0.71417	0.412000|0.412000	0.26496|0.26496	0.943000|0.943000	0.58893|0.58893	1.788000|1.788000	0.38714|0.38714	0.735000|0.735000	0.32537|0.32537	0.407000|0.407000	0.27541|0.27541	.|GTG	NAT16	-	-	ENSG00000167011		0.672	NAT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT16	HGNC	protein_coding	OTTHUMT00000347465.1	-	0.00	121	0	C	NM_198571	Intron	100817776	-1	tier1	-	no_errors	ENST00000300303	ensembl	human	known	74_37	splice_site	6.06	124	8	SNP	1.000	G
NCOA5	57727	genome.wustl.edu	37	20	44699150	44699150	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:44699150G>T	ENST00000290231.6	-	3	228	c.64C>A	c.(64-66)Cga>Aga	p.R22R		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	22	Arg/Asp-rich (mixed charge).|Transcription repression.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				CTTGAATCTCGACTGTCTCCA	0.502																																																	0													90.0	88.0	89.0					20																	44699150		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.64C>A	20.37:g.44699150G>T			B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Silent	SNP	superfamily_Anticodon-bd	p.R22	ENST00000290231.6	37	c.64	CCDS13392.1	20																																																																																			NCOA5	-	NULL	ENSG00000124160		0.502	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA5	HGNC	protein_coding	OTTHUMT00000079559.1	-	0.00	25	0	G	NM_020967		44699150	-1	tier1	-	no_errors	ENST00000290231	ensembl	human	known	74_37	silent	32.26	21	10	SNP	0.997	T
NDOR1	27158	genome.wustl.edu	37	9	140110203	140110203	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr9:140110203G>T	ENST00000344894.5	+	11	1464	c.1381G>T	c.(1381-1383)Ggg>Tgg	p.G461W	NDOR1_ENST00000371521.4_Missense_Mutation_p.G461W|NDOR1_ENST00000427047.2_Missense_Mutation_p.G427W|NDOR1_ENST00000458322.2_Missense_Mutation_p.G454W	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GCCTGGCACTGGGGTAGCCCC	0.672																																																	0													35.0	40.0	39.0					9																	140110203		2202	4300	6502	SO:0001583	missense	0			BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.1381G>T	9.37:g.140110203G>T	ENSP00000343344:p.Gly461Trp			Missense_Mutation	SNP	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.G461W	ENST00000344894.5	37	c.1381	CCDS7036.1	9	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115193	0.56505	.	.	ENSG00000188566	ENST00000458322;ENST00000427047;ENST00000371521;ENST00000344894	D;D;D;D	0.98249	-4.82;-4.65;-4.82;-4.82	4.68	3.71	0.42584	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.85682	D	0.000000	D	0.99423	0.9796	H	0.99705	4.715	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97662	1.0161	10	0.87932	D	0	-4.8984	11.9384	0.52886	0.0:0.1771:0.8229:0.0	.	454;427;461;461	D3YTG6;D3YTH9;Q9UHB4-2;Q9UHB4	.;.;.;NDOR1_HUMAN	W	454;427;461;461	ENSP00000389905:G454W;ENSP00000394309:G427W;ENSP00000360576:G461W;ENSP00000343344:G461W	ENSP00000343344:G461W	G	+	1	0	NDOR1	139230024	1.000000	0.71417	0.218000	0.23776	0.403000	0.30841	4.893000	0.63199	2.153000	0.67306	0.561000	0.74099	GGG	NDOR1	-	pfam_OxRdtase_FAD/NAD-bd,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	ENSG00000188566		0.672	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDOR1	HGNC	protein_coding	OTTHUMT00000254704.1	-	0.00	78	0	G	NM_014434		140110203	+1	tier1	-	no_errors	ENST00000371521	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.991	T
NECAB3	63941	genome.wustl.edu	37	20	32245293	32245293	+	3'UTR	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:32245293G>T	ENST00000246190.6	-	0	1588				NECAB3_ENST00000606525.1_5'UTR|RP1-63M2.6_ENST00000607224.1_RNA|NECAB3_ENST00000375238.4_3'UTR	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3						protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						ACCCTCGCTAGGCGGCCAGAT	0.662																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.*342C>A	20.37:g.32245293G>T			A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	RNA	SNP	-	NULL	ENST00000246190.6	37	NULL	CCDS42866.1	20																																																																																			NECAB3	-	-	ENSG00000125967		0.662	NECAB3-010	KNOWN	basic|CCDS	protein_coding	NECAB3	HGNC	protein_coding	OTTHUMT00000078724.2	-	0.00	25	0	G			32245293	-1	tier1	-	no_errors	ENST00000606525	ensembl	human	known	74_37	rna	10.53	34	4	SNP	0.001	T
NEFL	4747	genome.wustl.edu	37	8	24809971	24809971	+	RNA	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr8:24809971C>G	ENST00000221169.5	-	0	2579							P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GTTCAAAGGACTATTTTTCCA	0.318																																																	0																																												0				CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24809971C>G			B9ZVN2|Q16154|Q8IU72	RNA	SNP	-	NULL	ENST00000221169.5	37	NULL		8																																																																																			NEFL	-	-	ENSG00000104725		0.318	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	NEFL	HGNC	processed_transcript	OTTHUMT00000258943.4	-	0.00	95	0	C	NM_006158		24809971	-1	tier1	-	no_errors	ENST00000221169	ensembl	human	known	74_37	rna	25.88	63	22	SNP	0.956	G
NISCH	11188	genome.wustl.edu	37	3	52522221	52522221	+	Missense_Mutation	SNP	G	G	T	rs372469950		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:52522221G>T	ENST00000479054.1	+	17	2785	c.2713G>T	c.(2713-2715)Gcc>Tcc	p.A905S	NISCH_ENST00000345716.4_Missense_Mutation_p.A905S			Q9Y2I1	NISCH_HUMAN	nischarin	905					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	CAAGTCCGCCGCCATCCCCTA	0.657																																																	0													72.0	61.0	64.0					3																	52522221		2203	4300	6503	SO:0001583	missense	0			AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.2713G>T	3.37:g.52522221G>T	ENSP00000418232:p.Ala905Ser		C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	pfam_Phox,pfam_Leu-rich_rpt,superfamily_Phox,smart_Phox,pfscan_Phox	p.A905S	ENST00000479054.1	37	c.2713	CCDS33767.1	3	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972111	0.34754	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000414197	T;T	0.06608	3.28;3.28	4.48	3.6	0.41247	.	0.583926	0.18631	N	0.135599	T	0.03011	0.0089	N	0.08118	0	0.32388	N	0.553686	B	0.31413	0.322	B	0.24701	0.055	T	0.35624	-0.9781	10	0.21014	T	0.42	-20.4192	9.178	0.37123	0.1054:0.0:0.8946:0.0	.	905	Q9Y2I1	NISCH_HUMAN	S	905;905;249	ENSP00000418232:A905S;ENSP00000339958:A905S	ENSP00000339958:A905S	A	+	1	0	NISCH	52497261	1.000000	0.71417	0.971000	0.41717	0.498000	0.33706	4.036000	0.57304	1.194000	0.43101	0.462000	0.41574	GCC	NISCH	-	NULL	ENSG00000010322		0.657	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NISCH	HGNC	protein_coding	OTTHUMT00000351357.1		0.00	24	0	G	NM_007184		52522221	+1			no_errors	ENST00000345716	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.992	T
NOTCH3	4854	genome.wustl.edu	37	19	15291625	15291625	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:15291625C>T	ENST00000263388.2	-	19	3084	c.3009G>A	c.(3007-3009)tgG>tgA	p.W1003*		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1003	EGF-like 26. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGCGGCTGCACCAATCCACCA	0.617																																																	0													29.0	28.0	28.0					19																	15291625		2203	4299	6502	SO:0001587	stop_gained	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3009G>A	19.37:g.15291625C>T	ENSP00000263388:p.Trp1003*		Q9UEB3|Q9UPL3|Q9Y6L8	Nonsense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.W1003*	ENST00000263388.2	37	c.3009	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	C	39	7.849694	0.98525	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	.	.	.	5.13	4.08	0.47627	.	0.000000	0.30383	N	0.009745	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4849	0.67609	0.0:0.8517:0.1483:0.0	.	.	.	.	X	1003;953	.	ENSP00000263388:W1003X	W	-	3	0	NOTCH3	15152625	1.000000	0.71417	0.998000	0.56505	0.098000	0.18820	4.544000	0.60691	1.143000	0.42306	0.563000	0.77884	TGG	NOTCH3	-	pirsf_Notch,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000074181		0.617	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	79	0	C	NM_000435		15291625	-1	tier1	-	no_errors	ENST00000263388	ensembl	human	known	74_37	nonsense	31.75	43	20	SNP	1.000	T
NUP210	23225	genome.wustl.edu	37	3	13378360	13378360	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:13378360G>T	ENST00000254508.5	-	27	3693	c.3611C>A	c.(3610-3612)gCc>gAc	p.A1204D	NUP210_ENST00000485755.1_5'UTR	NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1204					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GCCTGGCACGGCATTGCCAAA	0.617																																																	0													133.0	112.0	119.0					3																	13378360		2203	4300	6503	SO:0001583	missense	0			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3611C>A	3.37:g.13378360G>T	ENSP00000254508:p.Ala1204Asp		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.A1204D	ENST00000254508.5	37	c.3611	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110091	0.56398	.	.	ENSG00000132182	ENST00000254508	T	0.07216	3.21	5.26	4.38	0.52667	.	0.126733	0.52532	D	0.000070	T	0.31231	0.0790	M	0.82630	2.6	0.58432	D	0.999999	D	0.76494	0.999	D	0.67725	0.953	T	0.24764	-1.0151	10	0.72032	D	0.01	-8.3633	16.1465	0.81575	0.0:0.134:0.866:0.0	.	1204	Q8TEM1	PO210_HUMAN	D	1204	ENSP00000254508:A1204D	ENSP00000254508:A1204D	A	-	2	0	NUP210	13353360	1.000000	0.71417	0.951000	0.38953	0.236000	0.25371	5.208000	0.65203	1.341000	0.45600	-0.274000	0.10170	GCC	NUP210	-	NULL	ENSG00000132182		0.617	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	HGNC	protein_coding	OTTHUMT00000340085.1		0.00	71	0	G	NM_024923		13378360	-1			no_errors	ENST00000254508	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.989	T
ODC1	4953	genome.wustl.edu	37	2	10580959	10580959	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:10580959delG	ENST00000234111.4	-	12	1787	c.1277delC	c.(1276-1278)ccafs	p.P427fs	ODC1_ENST00000405333.1_Frame_Shift_Del_p.P427fs	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	427					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	TACTTCGGGTGGGAAGTCGGG	0.507																																																	0													98.0	96.0	97.0					2																	10580959		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.1277delC	2.37:g.10580959delG	ENSP00000234111:p.Pro427fs		Q53TU3|Q6LDS9	Frame_Shift_Del	DEL	pfam_De-COase2_N,pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C,prints_Orn_de-COase,prints_Orn/DAP/Arg_de-COase	p.P426fs	ENST00000234111.4	37	c.1277	CCDS1672.1	2																																																																																			ODC1	-	NULL	ENSG00000115758		0.507	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODC1	HGNC	protein_coding	OTTHUMT00000206896.2		0.00	68	0	G			10580959	-1	tier1		no_errors	ENST00000234111	ensembl	human	known	74_37	frame_shift_del	12.07	51	7	DEL	0.229	-
OGT	8473	genome.wustl.edu	37	X	70775170	70775170	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrX:70775170G>T	ENST00000373719.3	+	7	1076	c.859G>T	c.(859-861)Gaa>Taa	p.E287*	OGT_ENST00000373701.3_Nonsense_Mutation_p.E277*	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	287					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					GCGGGCTATCGAACTACAACC	0.458																																																	0													109.0	86.0	94.0					X																	70775170		2203	4300	6503	SO:0001587	stop_gained	0			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.859G>T	X.37:g.70775170G>T	ENSP00000362824:p.Glu287*		Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Nonsense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E287*	ENST00000373719.3	37	c.859	CCDS14414.1	X	.	.	.	.	.	.	.	.	.	.	G	38	6.902447	0.97924	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-29.6243	17.5948	0.88009	0.0:0.0:1.0:0.0	.	.	.	.	X	287;277	.	ENSP00000362805:E277X	E	+	1	0	OGT	70691895	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	9.582000	0.98214	2.340000	0.79590	0.600000	0.82982	GAA	OGT	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000147162		0.458	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGT	HGNC	protein_coding	OTTHUMT00000081829.3	-	0.00	35	0	G	NM_003605, NM_181672		70775170	+1	tier1	-	no_errors	ENST00000373719	ensembl	human	known	74_37	nonsense	13.79	25	4	SNP	1.000	T
OR13C5	138799	genome.wustl.edu	37	9	107360968	107360968	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr9:107360968C>A	ENST00000374779.2	-	1	820	c.727G>T	c.(727-729)Gct>Tct	p.A243S		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						GTCAGACGAGCTGAGCAGGTA	0.423																																																	0													143.0	126.0	132.0					9																	107360968		2203	4300	6503	SO:0001583	missense	0				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.727G>T	9.37:g.107360968C>A	ENSP00000363911:p.Ala243Ser		B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A243S	ENST00000374779.2	37	c.727	CCDS35091.1	9	.	.	.	.	.	.	.	.	.	.	C	14.11	2.438765	0.43326	.	.	ENSG00000255800	ENST00000374779	T	0.34667	1.35	4.03	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35870	U	0.002932	T	0.20007	0.0481	N	0.05124	-0.11	0.23820	N	0.99676	P	0.34826	0.471	P	0.44732	0.459	T	0.34601	-0.9822	10	0.02654	T	1	.	9.0624	0.36442	0.2194:0.7806:0.0:0.0	.	243	Q8NGS8	O13C5_HUMAN	S	243	ENSP00000363911:A243S	ENSP00000363911:A243S	A	-	1	0	OR13C5	106400789	0.002000	0.14202	0.779000	0.31741	0.581000	0.36288	-0.068000	0.11561	2.098000	0.63641	0.423000	0.28283	GCT	OR13C5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000255800		0.423	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	HGNC	protein_coding	OTTHUMT00000053479.2		0.00	53	0	C	NM_001004482		107360968	-1			no_errors	ENST00000374779	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.786	A
OR56A3	390083	genome.wustl.edu	37	11	5968694	5968694	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:5968694C>A	ENST00000329564.6	+	1	125	c.118C>A	c.(118-120)Ctc>Atc	p.L40I	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTCCTTTTCCTCTTGGCCGT	0.592																																																	0													103.0	107.0	105.0					11																	5968694		2201	4296	6497	SO:0001583	missense	0				CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.118C>A	11.37:g.5968694C>A	ENSP00000331572:p.Leu40Ile		A6NN77|Q6IFF7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L40I	ENST00000329564.6	37	c.118	CCDS41614.1	11	.	.	.	.	.	.	.	.	.	.	C	7.365	0.625720	0.14257	.	.	ENSG00000184478	ENST00000329564	T	0.16457	2.34	5.12	2.13	0.27403	.	0.529172	0.17335	N	0.177980	T	0.10465	0.0256	L	0.38692	1.165	0.22811	N	0.998703	B	0.10296	0.003	B	0.10450	0.005	T	0.37033	-0.9723	10	0.15066	T	0.55	-24.8603	4.078	0.09912	0.1533:0.4654:0.2978:0.0835	.	40	Q8NH54	O56A3_HUMAN	I	40	ENSP00000331572:L40I	ENSP00000331572:L40I	L	+	1	0	OR56A3	5925270	0.000000	0.05858	0.850000	0.33497	0.503000	0.33858	-1.921000	0.01569	0.301000	0.22738	0.644000	0.83932	CTC	OR56A3	-	prints_GPCR_Rhodpsn	ENSG00000184478		0.592	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR56A3	HGNC	protein_coding	OTTHUMT00000383753.1	-	0.00	36	0	C	NM_001003443		5968694	+1	tier1	-	no_errors	ENST00000329564	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.711	A
OSBPL2	9885	genome.wustl.edu	37	20	60868922	60868922	+	Silent	SNP	C	C	A	rs201552246		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:60868922C>A	ENST00000313733.3	+	14	1624	c.1422C>A	c.(1420-1422)tcC>tcA	p.S474S	OSBPL2_ENST00000471817.1_3'UTR|OSBPL2_ENST00000439951.2_Missense_Mutation_p.P341Q|OSBPL2_ENST00000358053.2_Silent_p.S462S	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	474					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.S474S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			GGAATTTCTCCGACTGCCCAG	0.612																																																	1	Substitution - coding silent(1)	large_intestine(1)											54.0	51.0	52.0					20																	60868922		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.1422C>A	20.37:g.60868922C>A			A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Missense_Mutation	SNP	pfam_Oxysterol-bd	p.P341Q	ENST00000313733.3	37	c.1022	CCDS13495.1	20	.	.	.	.	.	.	.	.	.	.	C	1.752	-0.488949	0.04352	.	.	ENSG00000130703	ENST00000439951	T	0.54675	0.56	4.18	-8.37	0.00976	.	.	.	.	.	T	0.30665	0.0772	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18777	-1.0326	8	0.52906	T	0.07	-10.7496	1.4302	0.02332	0.1821:0.2935:0.1256:0.3988	.	341	E7ET92	.	Q	341	ENSP00000397602:P341Q	ENSP00000397602:P341Q	P	+	2	0	OSBPL2	60302317	0.000000	0.05858	0.250000	0.24296	0.553000	0.35397	-3.465000	0.00462	-3.569000	0.00139	-2.025000	0.00428	CCG	OSBPL2	-	NULL	ENSG00000130703		0.612	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL2	HGNC	protein_coding	OTTHUMT00000080021.1		0.00	48	0	C	NM_014835		60868922	+1			no_errors	ENST00000439951	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.047	A
OTUD7B	56957	genome.wustl.edu	37	1	149931714	149931714	+	Splice_Site	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:149931714G>A	ENST00000369135.4	-	7	1028	c.734C>T	c.(733-735)tCa>tTa	p.S245L	OTUD7B_ENST00000479905.1_5'Flank	NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	245	Catalytic.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			TACCAGCCCTGACTGTGTGAA	0.483																																																	0													142.0	135.0	137.0					1																	149931714		1949	4155	6104	SO:0001630	splice_region_variant	0			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.733-1C>T	1.37:g.149931714G>A			B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.S245L	ENST00000369135.4	37	c.734	CCDS41389.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947987	0.73787	.	.	ENSG00000163113	ENST00000369135;ENST00000543330;ENST00000417191	T;T	0.23552	1.9;1.9	5.47	5.47	0.80525	Ovarian tumour, otubain (2);	0.064544	0.64402	D	0.000005	T	0.16685	0.0401	N	0.12831	0.26	0.80722	D	1	P	0.52170	0.951	P	0.54100	0.742	T	0.04400	-1.0954	9	.	.	.	-16.9807	18.0517	0.89351	0.0:0.0:1.0:0.0	.	245	Q6GQQ9	OTU7B_HUMAN	L	245	ENSP00000358131:S245L;ENSP00000408231:S245L	.	S	-	2	0	OTUD7B	148198338	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	9.145000	0.94634	2.844000	0.97970	0.650000	0.86243	TCA	OTUD7B	-	pfam_OTU,pfscan_OTU	ENSG00000163113		0.483	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7B	HGNC	protein_coding	OTTHUMT00000034146.3	-	0.00	36	0	G	NM_020205	Missense_Mutation	149931714	-1	tier1	-	no_errors	ENST00000369135	ensembl	human	known	74_37	missense	44.90	27	22	SNP	1.000	A
PAMR1	25891	genome.wustl.edu	37	11	35456131	35456131	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:35456131C>A	ENST00000378880.2	-	10	2000	c.1555G>T	c.(1555-1557)Gac>Tac	p.D519Y	PAMR1_ENST00000378878.3_Missense_Mutation_p.D408Y|PAMR1_ENST00000278360.3_Missense_Mutation_p.D536Y|PAMR1_ENST00000532848.1_Missense_Mutation_p.D479Y	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	519	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.D536Y(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						ACTTTCAGGTCTGCTGTCTTG	0.547																																																	1	Substitution - Missense(1)	large_intestine(1)											133.0	118.0	123.0					11																	35456131		2202	4298	6500	SO:0001583	missense	0				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1555G>T	11.37:g.35456131C>A	ENSP00000368158:p.Asp519Tyr		A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_EG-like_dom,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.D536Y	ENST00000378880.2	37	c.1606	CCDS31460.1	11	.	.	.	.	.	.	.	.	.	.	C	16.85	3.235824	0.58886	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57	5.36	5.36	0.76844	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.252679	0.45867	D	0.000339	D	0.91851	0.7421	L	0.41632	1.29	0.44890	D	0.9979	D;D;P	0.71674	0.998;0.963;0.955	D;P;P	0.65323	0.934;0.776;0.748	D	0.92704	0.6177	10	0.87932	D	0	.	19.0909	0.93227	0.0:1.0:0.0:0.0	.	408;519;536	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	Y	536;519;408;479;496	ENSP00000278360:D536Y;ENSP00000368158:D519Y;ENSP00000368156:D408Y;ENSP00000433868:D479Y;ENSP00000432591:D496Y	ENSP00000278360:D536Y	D	-	1	0	PAMR1	35412707	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	3.087000	0.50167	2.526000	0.85167	0.555000	0.69702	GAC	PAMR1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000149090		0.547	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	HGNC	protein_coding	OTTHUMT00000389177.1		0.00	25	0	C	NM_015430		35456131	-1			no_errors	ENST00000278360	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.998	A
P4HA3	283208	genome.wustl.edu	37	11	74013463	74013463	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:74013463G>T	ENST00000331597.4	-	3	563	c.518C>A	c.(517-519)cCc>cAc	p.P173H	P4HA3_ENST00000427714.2_Missense_Mutation_p.P173H	NM_182904.3	NP_878907.1	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha polypeptide III	173						endoplasmic reticulum (GO:0005783)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			NS(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(1)	15	Breast(11;2.31e-05)					GAGCCGTTTGGGGCTGTACAG	0.517																																																	0													118.0	121.0	120.0					11																	74013463		2200	4293	6493	SO:0001583	missense	0			AY327887	CCDS8230.1, CCDS73347.1	11q13	2008-12-09	2008-12-09			ENSG00000149380			30135	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(III)"""	608987	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III"""			14500733	Standard	XM_005273924		Approved	C-P4Halpha(III)	uc001ouz.3	Q7Z4N8		ENST00000331597.4:c.518C>A	11.37:g.74013463G>T	ENSP00000332170:p.Pro173His		A0AV13|B4DUD3|Q5EBL3|Q5JPA9	Missense_Mutation	SNP	pfam_Pro_4_hyd_alph_N,pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.P173H	ENST00000331597.4	37	c.518	CCDS8230.1	11	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080039	0.76528	.	.	ENSG00000149380	ENST00000331597;ENST00000427714	T;T	0.56103	0.53;0.48	4.96	4.96	0.65561	.	0.053759	0.85682	D	0.000000	T	0.67813	0.2933	L	0.56769	1.78	0.48135	D	0.999597	D;B	0.89917	1.0;0.086	D;B	0.68192	0.956;0.029	T	0.67749	-0.5590	10	0.51188	T	0.08	-22.4681	16.0853	0.81042	0.0:0.0:1.0:0.0	.	173;173	B4DUD3;Q7Z4N8	.;P4HA3_HUMAN	H	173	ENSP00000332170:P173H;ENSP00000401749:P173H	ENSP00000332170:P173H	P	-	2	0	P4HA3	73691111	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.454000	0.73493	2.727000	0.93392	0.563000	0.77884	CCC	P4HA3	-	NULL	ENSG00000149380		0.517	P4HA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HA3	HGNC	protein_coding	OTTHUMT00000382988.1	-	0.00	60	0	G	NM_182904		74013463	-1	tier1	-	no_errors	ENST00000331597	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
PANK3	79646	genome.wustl.edu	37	5	167993055	167993055	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:167993055G>T	ENST00000239231.6	-	3	914	c.598C>A	c.(598-600)Cat>Aat	p.H200N	PANK3_ENST00000520504.1_5'UTR	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	200					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		TCTTTGGAATGGACTGCTAAA	0.413																																																	0													158.0	145.0	150.0					5																	167993055		2203	4300	6503	SO:0001583	missense	0			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.598C>A	5.37:g.167993055G>T	ENSP00000239231:p.His200Asn		D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.H200N	ENST00000239231.6	37	c.598	CCDS4368.1	5	.	.	.	.	.	.	.	.	.	.	G	12.03	1.814935	0.32053	.	.	ENSG00000120137	ENST00000239231	D	0.98937	-5.25	4.97	4.97	0.65823	.	0.201330	0.53938	D	0.000053	D	0.93844	0.8031	N	0.04508	-0.205	0.38290	D	0.942678	B	0.02656	0.0	B	0.04013	0.001	D	0.91944	0.5565	10	0.23302	T	0.38	-8.2466	12.3521	0.55155	0.0:0.0:0.8314:0.1686	.	200	Q9H999	PANK3_HUMAN	N	200	ENSP00000239231:H200N	ENSP00000239231:H200N	H	-	1	0	PANK3	167925633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.152000	0.58111	2.277000	0.76020	0.585000	0.79938	CAT	PANK3	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000120137		0.413	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK3	HGNC	protein_coding	OTTHUMT00000252793.2	-	0.00	70	0	G	NM_024594		167993055	-1	tier1	-	no_errors	ENST00000239231	ensembl	human	known	74_37	missense	8.96	61	6	SNP	1.000	T
PAPPA2	60676	genome.wustl.edu	37	1	176525500	176525500	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:176525500G>C	ENST00000367662.3	+	2	1206	c.42G>C	c.(40-42)ttG>ttC	p.L14F	PAPPA2_ENST00000367661.3_Missense_Mutation_p.L14F	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	14					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGGCGATTTTGGCTGGGTGGG	0.507																																																	0													111.0	110.0	110.0					1																	176525500		1995	4175	6170	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.42G>C	1.37:g.176525500G>C	ENSP00000356634:p.Leu14Phe		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.L14F	ENST00000367662.3	37	c.42	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	G	8.181	0.793869	0.16327	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.44881	4.22;0.91	4.82	4.82	0.62117	.	0.314890	0.21608	U	0.071831	T	0.61135	0.2323	M	0.67953	2.075	0.35765	D	0.820493	D;D	0.89917	0.998;1.0	D;D	0.83275	0.994;0.996	T	0.68089	-0.5501	10	0.40728	T	0.16	-8.4555	13.391	0.60825	0.0:0.0:1.0:0.0	.	14;14	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	F	14	ENSP00000356634:L14F;ENSP00000356633:L14F	ENSP00000356633:L14F	L	+	3	2	PAPPA2	174792123	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	2.997000	0.49457	2.232000	0.73038	0.561000	0.74099	TTG	PAPPA2	-	NULL	ENSG00000116183		0.507	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	38	0	G			176525500	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	27.66	34	13	SNP	1.000	C
PCDHB8	56128	genome.wustl.edu	37	5	140559034	140559034	+	Silent	SNP	C	C	T	rs113701735		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:140559034C>T	ENST00000239444.2	+	1	1664	c.1419C>T	c.(1417-1419)agC>agT	p.S473S	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	473	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S473R(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACATCGGCAGCGTCAGCGCCA	0.662																																																	1	Substitution - Missense(1)	lung(1)											81.0	123.0	109.0					5																	140559034		2203	4294	6497	SO:0001819	synonymous_variant	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1419C>T	5.37:g.140559034C>T			B9EGV1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S473	ENST00000239444.2	37	c.1419	CCDS4250.1	5																																																																																			PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000120322		0.662	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	-	0.00	143	0	C	NM_019120		140559034	+1	tier1	rs113701735	no_errors	ENST00000239444	ensembl	human	known	74_37	silent	23.53	78	24	SNP	0.059	T
PCDHGA3	56112	genome.wustl.edu	37	5	140724052	140724052	+	Missense_Mutation	SNP	G	G	T	rs267600447		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:140724052G>T	ENST00000253812.6	+	1	452	c.452G>T	c.(451-453)cGa>cTa	p.R151L	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	151	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGAACCCGATTTCCAATT	0.383																																																	0													58.0	56.0	57.0					5																	140724052		1859	4107	5966	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.452G>T	5.37:g.140724052G>T	ENSP00000253812:p.Arg151Leu		Q9Y5D4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R151L	ENST00000253812.6	37	c.452	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	13.79	2.341228	0.41498	.	.	ENSG00000254245	ENST00000253812	T	0.18657	2.2	5.65	3.84	0.44239	Cadherin (2);Cadherin-like (1);	0.368315	0.15709	U	0.248498	T	0.28532	0.0706	M	0.74881	2.28	0.23568	N	0.997395	P;B	0.39181	0.663;0.103	B;B	0.41088	0.347;0.07	T	0.18429	-1.0337	10	0.87932	D	0	.	9.9398	0.41574	0.2191:0.0:0.7809:0.0	.	151;151	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	L	151	ENSP00000253812:R151L	ENSP00000253812:R151L	R	+	2	0	PCDHGA3	140704236	0.058000	0.20735	1.000000	0.80357	0.922000	0.55478	2.297000	0.43593	1.527000	0.49086	0.655000	0.94253	CGA	PCDHGA3	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000254245		0.383	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	-	0.00	37	0	G	NM_018916		140724052	+1	tier1	-	no_errors	ENST00000253812	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.964	T
PCDHGB2	56103	genome.wustl.edu	37	5	140741236	140741236	+	Missense_Mutation	SNP	G	G	T	rs536902009		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:140741236G>T	ENST00000522605.1	+	1	1534	c.1534G>T	c.(1534-1536)Ggg>Tgg	p.G512W	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	512	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCAGAGCGGGGTGGTGTT	0.662													.|||	1	0.000199681	0.0008	0.0	5008	,	,		16854	0.0		0.0	False		,,,				2504	0.0																0													34.0	37.0	36.0					5																	140741236		1993	4165	6158	SO:0001583	missense	0			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1534G>T	5.37:g.140741236G>T	ENSP00000429018:p.Gly512Trp		Q3MIJ3|Q9UN65	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G512W	ENST00000522605.1	37	c.1534	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	15.85	2.953659	0.53293	.	.	ENSG00000253910	ENST00000522605	D	0.91521	-2.86	5.18	5.18	0.71444	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.97682	0.9240	H	0.99197	4.465	0.48830	D	0.999719	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99482	1.0948	9	0.87932	D	0	.	18.6559	0.91453	0.0:0.0:1.0:0.0	.	512;512	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	W	512	ENSP00000429018:G512W	ENSP00000429018:G512W	G	+	1	0	PCDHGB2	140721420	1.000000	0.71417	0.486000	0.27416	0.172000	0.22775	7.887000	0.87295	2.564000	0.86499	0.467000	0.42956	GGG	PCDHGB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253910		0.662	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1	-	0.00	57	0	G	NM_018923		140741236	+1	tier1	-	no_errors	ENST00000522605	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
CFAP221	200373	genome.wustl.edu	37	2	120366079	120366079	+	Splice_Site	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:120366079C>A	ENST00000413369.3	+	12	1222	c.1135C>A	c.(1135-1137)Cag>Aag	p.Q379K	PCDP1_ENST00000602047.1_Splice_Site_p.Q93K|PCDP1_ENST00000597189.1_Intron	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					TCTCCCCAGGCAGGTGCACCT	0.378																																																	0													72.0	79.0	76.0					2																	120366079		2203	4300	6503	SO:0001630	splice_region_variant	0																														ENST00000413369.3:c.1134-1C>A	2.37:g.120366079C>A				Missense_Mutation	SNP	NULL	p.Q379K	ENST00000413369.3	37	c.1135	CCDS33282.2	2	.	.	.	.	.	.	.	.	.	.	C	15.81	2.941786	0.53079	.	.	ENSG00000163075	ENST00000295220;ENST00000413369	T	0.17370	2.28	4.65	2.78	0.32641	.	0.000000	0.64402	D	0.000002	T	0.20007	0.0481	L	0.43152	1.355	0.80722	D	1	P;P	0.48640	0.865;0.913	P;P	0.48873	0.593;0.493	T	0.01059	-1.1465	10	0.41790	T	0.15	-9.5602	10.9508	0.47327	0.3409:0.6591:0.0:0.0	.	223;379	Q4G0U5-3;Q4G0U5	.;PCDP1_HUMAN	K	93;379	ENSP00000393222:Q379K	ENSP00000295220:Q93K	Q	+	1	0	AC069154.2	120082549	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.913000	0.39956	0.629000	0.30376	0.655000	0.94253	CAG	PCDP1	-	NULL	ENSG00000163075		0.378	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCDP1	Uniprot_gn	protein_coding	OTTHUMT00000464236.1	-	0.00	155	0	C		Missense_Mutation	120366079	+1	tier1	-	no_errors	ENST00000413369	ensembl	human	known	74_37	missense	13.50	173	27	SNP	1.000	A
PDLIM2	64236	genome.wustl.edu	37	8	22442538	22442538	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr8:22442538G>T	ENST00000397760.4	+	5	724	c.324G>T	c.(322-324)gtG>gtT	p.V108V	PDLIM2_ENST00000409417.1_Silent_p.V108V|PDLIM2_ENST00000409141.1_Silent_p.V108V|PDLIM2_ENST00000448520.1_3'UTR|PDLIM2_ENST00000308354.7_Silent_p.V358V|PDLIM2_ENST00000397761.2_Silent_p.V108V|PDLIM2_ENST00000339162.7_Silent_p.V108V|PDLIM2_ENST00000265810.4_Silent_p.V108V			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	108						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		AGGGCTCCGTGAGGACATACA	0.632																																																	0													72.0	72.0	72.0					8																	22442538		2203	4300	6503	SO:0001819	synonymous_variant	0			AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.324G>T	8.37:g.22442538G>T			D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Silent	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.V358	ENST00000397760.4	37	c.1074		8																																																																																			PDLIM2	-	NULL	ENSG00000120913		0.632	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	PDLIM2	HGNC	protein_coding	OTTHUMT00000334167.1	-	0.00	47	0	G			22442538	+1	tier1	-	no_errors	ENST00000308354	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.984	T
PDZRN4	29951	genome.wustl.edu	37	12	41966176	41966178	+	In_Frame_Del	DEL	AAG	AAG	-	rs199717682	byFrequency	TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:41966176_41966178delAAG	ENST00000402685.2	+	10	1603_1605	c.1595_1597delAAG	c.(1594-1599)caagaa>caa	p.E536del	PDZRN4_ENST00000298919.7_In_Frame_Del_p.E276del|PDZRN4_ENST00000539469.2_In_Frame_Del_p.E278del	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	536	Poly-Glu.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E278delE(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CCAAAAAAGCAAGAAGAAGAAGA	0.355														3	0.000599042	0.0015	0.0	5008	,	,		24414	0.0		0.001	False		,,,				2504	0.0																1	Deletion - In frame(1)	ovary(1)							,	29,4235		1,27,2104					,	5.1	1.0			55	64,8190		0,64,4063	no	coding,coding	PDZRN4	NM_013377.3,NM_001164595.1	,	1,91,6167	A1A1,A1R,RR		0.7754,0.6801,0.7429	,	,		93,12425				SO:0001651	inframe_deletion	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1595_1597delAAG	12.37:g.41966185_41966187delAAG	ENSP00000384197:p.Glu536del		Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	In_Frame_Del	DEL	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.E536in_frame_del	ENST00000402685.2	37	c.1595_1597	CCDS53777.1	12																																																																																			PDZRN4	-	NULL	ENSG00000165966		0.355	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1		0.00	28	0	AAG	NM_013377		41966178	+1	tier1		no_errors	ENST00000402685	ensembl	human	known	74_37	in_frame_del	10.71	25	3	DEL	0.998:0.971:1.000	-
PHC3	80012	genome.wustl.edu	37	3	169866908	169866908	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:169866908G>A	ENST00000494943.1	-	5	571	c.503C>T	c.(502-504)gCa>gTa	p.A168V	RNU6-315P_ENST00000362666.1_RNA|PHC3_ENST00000467570.1_Intron|PHC3_ENST00000474275.1_Missense_Mutation_p.A164V|PHC3_ENST00000495893.2_Missense_Mutation_p.A180V			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	168	Ser-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AGCTTGGCTTGCCGTTAGGGT	0.433																																																	0													77.0	73.0	74.0					3																	169866908		1859	4117	5976	SO:0001583	missense	0				CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.503C>T	3.37:g.169866908G>A	ENSP00000420271:p.Ala168Val		A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.A180V	ENST00000494943.1	37	c.539		3	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970286	0.92919	.	.	ENSG00000173889	ENST00000494943;ENST00000495893;ENST00000475729;ENST00000474275	T;T	0.37915	1.17;1.19	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.60637	0.2284	M	0.67397	2.05	0.80722	D	1	D;D;D;D	0.71674	0.99;0.998;0.994;0.994	P;D;D;D	0.76071	0.868;0.987;0.938;0.938	T	0.57010	-0.7884	9	.	.	.	-14.6372	19.7398	0.96223	0.0:0.0:1.0:0.0	.	168;164;180;180	Q8NDX5;Q8NDX5-4;Q8NDX5-3;Q8NDX5-7	PHC3_HUMAN;.;.;.	V	168;180;180;164	ENSP00000420271:A168V;ENSP00000420294:A180V	.	A	-	2	0	PHC3	171349602	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.231000	0.78106	2.660000	0.90430	0.655000	0.94253	GCA	PHC3	-	NULL	ENSG00000173889		0.433	PHC3-004	KNOWN	basic	protein_coding	PHC3	HGNC	protein_coding	OTTHUMT00000352182.3	-	0.00	124	0	G	NM_024947		169866908	-1	tier1	-	no_errors	ENST00000495893	ensembl	human	known	74_37	missense	68.62	102	223	SNP	1.000	A
PLCD4	84812	genome.wustl.edu	37	2	219498180	219498180	+	Intron	SNP	T	T	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:219498180T>G	ENST00000450993.2	+	11	1788				RP11-548H3.1_ENST00000607946.1_RNA|PLCD4_ENST00000432688.1_Silent_p.P507P|PLCD4_ENST00000417849.1_Intron	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4						acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TTTCCAAGCCTGAGTCCCTTC	0.552																																																	0																																										SO:0001627	intron_variant	0			AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.1450-148T>G	2.37:g.219498180T>G			Q53FS8	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.P507	ENST00000450993.2	37	c.1521	CCDS46516.1	2																																																																																			PLCD4	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000115556		0.552	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	PLCD4	HGNC	protein_coding	OTTHUMT00000336876.1	-	0.00	92	0	T			219498180	+1	tier1	-	no_errors	ENST00000432688	ensembl	human	novel	74_37	silent	29.55	62	26	SNP	0.942	G
PLEKHA8	84725	genome.wustl.edu	37	7	30118228	30118228	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:30118228C>T	ENST00000449726.1	+	14	1735	c.1385C>T	c.(1384-1386)tCc>tTc	p.S462F	PLEKHA8_ENST00000258679.7_Intron|PLEKHA8_ENST00000396259.1_Intron|PLEKHA8_ENST00000396257.2_Intron	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	462	Glycolipid transfer protein homology domain.				ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						GCAGCTCCATCCTATGAAGAT	0.453																																																	0													79.0	74.0	76.0					7																	30118228		876	1991	2867	SO:0001583	missense	0			BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.1385C>T	7.37:g.30118228C>T	ENSP00000397947:p.Ser462Phe		B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Missense_Mutation	SNP	pfam_Glycolipid_transfer_prot_dom,pfam_Pleckstrin_homology,superfamily_Glycolipid_transfer_prot_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S462F	ENST00000449726.1	37	c.1385	CCDS56473.1	7	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232271	0.58777	.	.	ENSG00000106086	ENST00000449726;ENST00000440706	.	.	.	5.33	5.33	0.75918	.	0.134361	0.51477	D	0.000082	T	0.71533	0.3351	L	0.52126	1.63	0.49582	D	0.999801	D	0.69078	0.997	D	0.66847	0.947	T	0.64002	-0.6509	9	0.11182	T	0.66	-2.0374	17.9469	0.89042	0.0:1.0:0.0:0.0	.	462	B4DH00	.	F	462;488	.	ENSP00000407802:S488F	S	+	2	0	PLEKHA8	30084753	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.594000	0.61041	2.670000	0.90874	0.655000	0.94253	TCC	PLEKHA8	-	pfam_Glycolipid_transfer_prot_dom,superfamily_Glycolipid_transfer_prot_dom	ENSG00000106086		0.453	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA8	HGNC	protein_coding		-	0.00	60	0	C	NM_032639		30118228	+1	tier1	-	no_errors	ENST00000449726	ensembl	human	known	74_37	missense	28.21	56	22	SNP	1.000	T
PLXNA1	5361	genome.wustl.edu	37	3	126748339	126748339	+	Silent	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:126748339C>T	ENST00000393409.2	+	26	4830	c.4830C>T	c.(4828-4830)atC>atT	p.I1610I	PLXNA1_ENST00000251772.4_Silent_p.I1587I	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1610					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CCTACAACATCTCCAACTCCT	0.672																																																	0													140.0	130.0	134.0					3																	126748339		2203	4300	6503	SO:0001819	synonymous_variant	0			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.4830C>T	3.37:g.126748339C>T				Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.I1610	ENST00000393409.2	37	c.4830	CCDS33847.2	3																																																																																			PLXNA1	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000114554		0.672	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	-	0.00	48	0	C	NM_032242		126748339	+1	tier1	-	no_errors	ENST00000393409	ensembl	human	known	74_37	silent	12.61	97	14	SNP	1.000	T
POLR2J4	84820	genome.wustl.edu	37	7	44027341	44027341	+	RNA	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:44027341C>T	ENST00000427076.1	-	0	752				RP5-1165K10.2_ENST00000454572.1_RNA	NR_003655.2				polymerase (RNA) II (DNA directed) polypeptide J4, pseudogene																		CAGTGGGTATCATTGCCAACA	0.612																																																	0																																												0					7p13	2008-08-21			ENSG00000214783	ENSG00000214783			28195	pseudogene	pseudogene						15586814	Standard	NR_003655		Approved	MGC13098	uc010kxw.2		OTTHUMG00000155253		7.37:g.44027341C>T				RNA	SNP	-	NULL	ENST00000427076.1	37	NULL		7																																																																																			POLR2J4	-	-	ENSG00000214783		0.612	POLR2J4-002	KNOWN	basic|readthrough_transcript	processed_transcript	POLR2J4	HGNC	processed_transcript	OTTHUMT00000473169.1	-	0.00	102	0	C	NR_003655		44027341	-1	tier1	-	no_errors	ENST00000422304	ensembl	human	known	74_37	rna	30.19	74	32	SNP	0.034	T
POLRMT	5442	genome.wustl.edu	37	19	629696	629696	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:629696C>G	ENST00000588649.2	-	3	750	c.666G>C	c.(664-666)caG>caC	p.Q222H		NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	222					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTCTGCTGCTGACCTGAGA	0.692																																																	0													13.0	14.0	13.0					19																	629696		2176	4265	6441	SO:0001583	missense	0				CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.666G>C	19.37:g.629696C>G	ENSP00000465759:p.Gln222His		O60370	Missense_Mutation	SNP	pfam_DNA-dir_Rpol_phage-type	p.Q222H	ENST00000588649.2	37	c.666	CCDS12036.1	19	.	.	.	.	.	.	.	.	.	.	C	4.984	0.182713	0.09495	.	.	ENSG00000099821	ENST00000215591	T	0.43688	0.94	3.08	0.764	0.18465	.	1.157020	0.06232	N	0.688839	T	0.35278	0.0926	L	0.44542	1.39	0.23598	N	0.997322	P	0.39964	0.697	B	0.34824	0.19	T	0.33317	-0.9873	10	0.39692	T	0.17	-24.9946	11.895	0.52652	0.0:0.6466:0.3534:0.0	.	222	O00411	RPOM_HUMAN	H	222	ENSP00000215591:Q222H	ENSP00000215591:Q222H	Q	-	3	2	POLRMT	580696	0.651000	0.27340	0.013000	0.15412	0.029000	0.11900	0.850000	0.27737	0.293000	0.22520	0.561000	0.74099	CAG	POLRMT	-	NULL	ENSG00000099821		0.692	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	POLRMT	HGNC	protein_coding	OTTHUMT00000452172.3	-	0.00	62	0	C	NM_005035		629696	-1	tier1	-	no_errors	ENST00000588649	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.841	G
POTEF	728378	genome.wustl.edu	37	2	130834673	130834673	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:130834673A>G	ENST00000409914.2	-	16	2279	c.1880T>C	c.(1879-1881)gTt>gCt	p.V627A	POTEF_ENST00000357462.5_Missense_Mutation_p.V627A|POTEF_ENST00000361163.4_3'UTR|POTEF_ENST00000360967.5_3'UTR	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	627					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CATTTTTTCAACCACTTCTAT	0.279																																																	0													1.0	1.0	1.0					2																	130834673		114	381	495	SO:0001583	missense	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.1880T>C	2.37:g.130834673A>G	ENSP00000386786:p.Val627Ala		A6NC34	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.V627A	ENST00000409914.2	37	c.1880	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	0.082	-1.181086	0.01633	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	T;T	0.74632	-0.86;-0.86	1.14	0.215	0.15253	.	.	.	.	.	T	0.40979	0.1139	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27468	-1.0073	9	0.11485	T	0.65	.	3.7331	0.08500	0.2652:0.0:0.7348:0.0	.	627	A5A3E0	POTEF_HUMAN	A	627	ENSP00000350052:V627A;ENSP00000386786:V627A	ENSP00000350052:V627A	V	-	2	0	POTEF	130551143	0.000000	0.05858	0.002000	0.10522	0.037000	0.13140	-0.314000	0.08092	0.058000	0.16222	-1.392000	0.01152	GTT	POTEF	-	NULL	ENSG00000196604		0.279	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	-	0.00	48	0	A	NM_001099771		130834673	-1	tier1	-	no_errors	ENST00000357462	ensembl	human	known	74_37	missense	35.00	26	14	SNP	0.003	G
POU4F3	5459	genome.wustl.edu	37	5	145719454	145719454	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:145719454T>C	ENST00000230732.4	+	2	553	c.464T>C	c.(463-465)cTg>cCg	p.L155P	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	155					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGGGCCACCTGCACCAGGCC	0.672																																																	0													50.0	51.0	50.0					5																	145719454		2203	4298	6501	SO:0001583	missense	0			U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.464T>C	5.37:g.145719454T>C	ENSP00000230732:p.Leu155Pro		O60557|Q2M3F8	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.L155P	ENST00000230732.4	37	c.464	CCDS4281.1	5	.	.	.	.	.	.	.	.	.	.	T	9.282	1.048489	0.19827	.	.	ENSG00000091010	ENST00000230732	D	0.84800	-1.9	4.49	4.49	0.54785	.	0.086843	0.44483	D	0.000442	T	0.81039	0.4740	L	0.55481	1.735	0.80722	D	1	P	0.47910	0.902	B	0.44278	0.445	T	0.77797	-0.2453	10	0.26408	T	0.33	.	8.1568	0.31173	0.0:0.0958:0.0:0.9042	.	155	Q15319	PO4F3_HUMAN	P	155	ENSP00000230732:L155P	ENSP00000230732:L155P	L	+	2	0	POU4F3	145699647	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.722000	0.84778	1.866000	0.54105	0.379000	0.24179	CTG	POU4F3	-	NULL	ENSG00000091010		0.672	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F3	HGNC	protein_coding	OTTHUMT00000251887.2		0.00	19	0	T	NM_002700		145719454	+1			no_errors	ENST00000230732	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	C
PPT1	5538	genome.wustl.edu	37	1	40544257	40544257	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:40544257G>C	ENST00000433473.3	-	7	1165	c.701C>G	c.(700-702)tCc>tGc	p.S234C	PPT1_ENST00000372775.2_5'UTR|PPT1_ENST00000530076.1_Missense_Mutation_p.S15C|PPT1_ENST00000449045.2_Missense_Mutation_p.S131C	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1	234					adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTCCACAATGGAATCATTGAG	0.483																																																	0													156.0	152.0	153.0					1																	40544257		2203	4300	6503	SO:0001583	missense	0			U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495	ENST00000433473.3:c.701C>G	1.37:g.40544257G>C	ENSP00000394863:p.Ser234Cys		B4DY24|Q6FGQ4	Missense_Mutation	SNP	pfam_Palm_thioest,prints_Palm_thioest	p.S234C	ENST00000433473.3	37	c.701	CCDS447.1	1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230895	0.39399	.	.	ENSG00000131238	ENST00000433473;ENST00000449045;ENST00000439754;ENST00000530076;ENST00000372779	D;D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5;-3.5	5.43	3.53	0.40419	.	0.539403	0.22282	N	0.062107	D	0.94493	0.8227	M	0.71036	2.16	0.40537	D	0.980986	D;P;P	0.62365	0.991;0.596;0.844	P;P;B	0.50825	0.651;0.563;0.348	D	0.93645	0.6968	10	0.66056	D	0.02	-14.7237	10.25	0.43364	0.0731:0.1363:0.7905:0.0	.	131;184;234	P50897-2;B4DWU3;P50897	.;.;PPT1_HUMAN	C	234;131;129;15;263	ENSP00000394863:S234C;ENSP00000392293:S131C;ENSP00000403207:S129C;ENSP00000434007:S15C;ENSP00000361865:S263C	ENSP00000361865:S263C	S	-	2	0	PPT1	40316844	1.000000	0.71417	0.859000	0.33776	0.067000	0.16453	4.148000	0.58085	0.832000	0.34804	-0.140000	0.14226	TCC	PPT1	-	pfam_Palm_thioest	ENSG00000131238		0.483	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPT1	HGNC	protein_coding	OTTHUMT00000013126.2	-	0.00	54	0	G	NM_000310		40544257	-1	tier1	-	no_errors	ENST00000433473	ensembl	human	known	74_37	missense	90.53	123	1205	SNP	0.966	C
PRICKLE2	166336	genome.wustl.edu	37	3	64082740	64082740	+	3'UTR	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:64082740T>C	ENST00000295902.6	-	0	5107				RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)						establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		ACAAACGTAATAGAGTTAATT	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.*1987A>G	3.37:g.64082740T>C			Q0VF44	RNA	SNP	-	NULL	ENST00000295902.6	37	NULL	CCDS2902.1	3																																																																																			RP11-129B22.1	-	-	ENSG00000241111		0.358	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2-AS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000352219.1	-	0.00	73	0	T	NM_198859		64082740	+1	tier1	-	no_errors	ENST00000482609	ensembl	human	known	74_37	rna	63.49	23	40	SNP	1.000	C
PTCH1	5727	genome.wustl.edu	37	9	98224234	98224235	+	Frame_Shift_Ins	INS	-	-	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr9:98224234_98224235insA	ENST00000331920.6	-	16	2905_2906	c.2606_2607insT	c.(2605-2607)atgfs	p.M869fs	PTCH1_ENST00000421141.1_Frame_Shift_Ins_p.M718fs|PTCH1_ENST00000418258.1_Frame_Shift_Ins_p.M718fs|PTCH1_ENST00000430669.2_Frame_Shift_Ins_p.M803fs|PTCH1_ENST00000429896.2_Frame_Shift_Ins_p.M718fs|PTCH1_ENST00000375274.2_Frame_Shift_Ins_p.M868fs|PTCH1_ENST00000437951.1_Frame_Shift_Ins_p.M803fs	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	869					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AATTGTTTGGCATGATTTTCCC	0.485																																																	0																																										SO:0001589	frameshift_variant	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2607dupT	9.37:g.98224235_98224235dupA	ENSP00000332353:p.Met869fs		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Frame_Shift_Ins	INS	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.M869fs	ENST00000331920.6	37	c.2607_2606	CCDS6714.1	9																																																																																			PTCH1	-	pfam_Patched,tigrfam_TM_rcpt_patched	ENSG00000185920		0.485	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2		0.00	98	0	-	NM_000264		98224235	-1	tier1		no_errors	ENST00000331920	ensembl	human	known	74_37	frame_shift_ins	57.01	46	61	INS	1.000:1.000	A
PTCH1	5727	genome.wustl.edu	37	9	98278916	98278916	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr9:98278916G>T	ENST00000375274.2	-	1	331	c.187C>A	c.(187-189)Cgc>Agc	p.R63S	PTCH1_ENST00000430669.2_5'UTR|RP11-435O5.4_ENST00000604650.1_RNA|PTCH1_ENST00000468211.2_5'UTR|PTCH1_ENST00000437951.1_5'UTR			Q13635	PTC1_HUMAN	patched 1	0					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.R63S(2)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TTGTCGCTGCGGGTCTCTTTG	0.512																																																	2	Substitution - Missense(2)	lung(2)											121.0	123.0	123.0					9																	98278916		1907	4102	6009	SO:0001583	missense	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000375274.2:c.187C>A	9.37:g.98278916G>T	ENSP00000364423:p.Arg63Ser		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.R63S	ENST00000375274.2	37	c.187	CCDS47995.1	9	.	.	.	.	.	.	.	.	.	.	g	8.524	0.869522	0.17322	.	.	ENSG00000185920	ENST00000375274	D	0.89939	-2.59	2.62	-2.36	0.06663	.	.	.	.	.	T	0.73946	0.3652	.	.	.	0.58432	D	0.999995	B	0.18166	0.026	B	0.06405	0.002	T	0.56792	-0.7920	8	0.21540	T	0.41	.	0.6146	0.00767	0.3716:0.1714:0.2839:0.1731	.	63	Q13635-2	.	S	63	ENSP00000364423:R63S	ENSP00000364423:R63S	R	-	1	0	PTCH1	97318737	0.912000	0.30974	0.990000	0.47175	0.866000	0.49608	-0.116000	0.10724	-0.270000	0.09285	0.299000	0.19835	CGC	PTCH1	-	NULL	ENSG00000185920		0.512	PTCH1-007	KNOWN	basic|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000406923.1		0.00	32	0	G	NM_000264		98278916	-1			no_errors	ENST00000375274	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.733	T
PTCHD2	57540	genome.wustl.edu	37	1	11580898	11580898	+	Silent	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:11580898C>A	ENST00000294484.6	+	10	2493	c.2355C>A	c.(2353-2355)acC>acA	p.T785T	PTCHD2_ENST00000389575.3_Silent_p.T785T	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	785					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CCTGCATCACCTGTTCAGGTG	0.627																																																	0													20.0	22.0	22.0					1																	11580898		1950	4150	6100	SO:0001819	synonymous_variant	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2355C>A	1.37:g.11580898C>A			Q5VTU9|Q9UJD6	Silent	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.T785	ENST00000294484.6	37	c.2355	CCDS41247.1	1																																																																																			PTCHD2	-	NULL	ENSG00000204624		0.627	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	-	0.00	48	0	C	XM_052561		11580898	+1	tier1	-	no_errors	ENST00000294484	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	A
RBBP6	5930	genome.wustl.edu	37	16	24581686	24581686	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:24581686A>G	ENST00000319715.4	+	17	4107	c.3675A>G	c.(3673-3675)atA>atG	p.I1225M	RBBP6_ENST00000381039.3_Intron|RBBP6_ENST00000348022.2_Missense_Mutation_p.I1191M	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1225					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CAGAAAATATATCAAACACAA	0.363																																																	0													53.0	56.0	55.0					16																	24581686		2197	4299	6496	SO:0001583	missense	0				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3675A>G	16.37:g.24581686A>G	ENSP00000317872:p.Ile1225Met		Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.I1225M	ENST00000319715.4	37	c.3675	CCDS10621.1	16	.	.	.	.	.	.	.	.	.	.	A	11.19	1.565557	0.27915	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.14516	2.5;2.5	5.97	0.835	0.18886	.	1.315560	0.04821	N	0.436989	T	0.07052	0.0179	N	0.08118	0	0.09310	N	1	B;B	0.19445	0.036;0.021	B;B	0.20955	0.032;0.014	T	0.35847	-0.9772	10	0.48119	T	0.1	0.5473	1.9848	0.03434	0.2489:0.4195:0.1949:0.1367	.	1191;1225	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	M	1225;1191	ENSP00000317872:I1225M;ENSP00000316291:I1191M	ENSP00000317872:I1225M	I	+	3	3	RBBP6	24489187	0.000000	0.05858	0.045000	0.18777	0.839000	0.47603	0.051000	0.14141	0.490000	0.27771	-0.316000	0.08728	ATA	RBBP6	-	NULL	ENSG00000122257		0.363	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	HGNC	protein_coding	OTTHUMT00000214067.2	-	0.00	58	0	A	NM_006910		24581686	+1	tier1	-	no_errors	ENST00000319715	ensembl	human	known	74_37	missense	19.15	38	9	SNP	0.002	G
RHBDF1	64285	genome.wustl.edu	37	16	109811	109811	+	Frame_Shift_Del	DEL	T	T	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:109811delT	ENST00000262316.6	-	14	1878	c.1736delA	c.(1735-1737)aacfs	p.N579fs		NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	579					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				CCCAGCGCTGTTTTTGGTGCA	0.597																																																	0													167.0	126.0	140.0					16																	109811		2203	4300	6503	SO:0001589	frameshift_variant	0			BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1736delA	16.37:g.109811delT	ENSP00000262316:p.Asn579fs		Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Frame_Shift_Del	DEL	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.N579fs	ENST00000262316.6	37	c.1736	CCDS32344.1	16																																																																																			RHBDF1	-	NULL	ENSG00000007384		0.597	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDF1	HGNC	protein_coding	OTTHUMT00000134178.2		0.00	39	0	T	NM_022450		109811	-1	tier1		no_errors	ENST00000262316	ensembl	human	known	74_37	frame_shift_del	9.68	28	3	DEL	0.997	-
RBBP6	5930	genome.wustl.edu	37	16	24583012	24583012	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:24583012C>A	ENST00000319715.4	+	18	5057	c.4625C>A	c.(4624-4626)cCt>cAt	p.P1542H	RBBP6_ENST00000381039.3_Missense_Mutation_p.P702H|RBBP6_ENST00000348022.2_Missense_Mutation_p.P1508H	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1542	Interaction with p53. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		GACAGAAAACCTCATGATCAC	0.363																																																	0													52.0	48.0	50.0					16																	24583012		2197	4299	6496	SO:0001583	missense	0				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4625C>A	16.37:g.24583012C>A	ENSP00000317872:p.Pro1542His		Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.P1542H	ENST00000319715.4	37	c.4625	CCDS10621.1	16	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323905	0.41096	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.22134	1.97;2.32;2.27	6.03	6.03	0.97812	.	0.231906	0.33772	N	0.004571	T	0.32194	0.0821	L	0.29908	0.895	0.41197	D	0.986348	D;D;D	0.65815	0.995;0.995;0.991	P;P;P	0.58873	0.847;0.847;0.707	T	0.01290	-1.1394	10	0.66056	D	0.02	-18.2983	16.8201	0.85743	0.1291:0.8709:0.0:0.0	.	702;1508;1542	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	H	702;1542;1508	ENSP00000370427:P702H;ENSP00000317872:P1542H;ENSP00000316291:P1508H	ENSP00000317872:P1542H	P	+	2	0	RBBP6	24490513	0.023000	0.18921	1.000000	0.80357	0.888000	0.51559	1.454000	0.35178	2.868000	0.98415	0.557000	0.71058	CCT	RBBP6	-	NULL	ENSG00000122257		0.363	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	HGNC	protein_coding	OTTHUMT00000214067.2	-	0.00	85	0	C	NM_006910		24583012	+1	tier1	-	no_errors	ENST00000319715	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	A
RIMS1	22999	genome.wustl.edu	37	6	72960111	72960111	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:72960111G>C	ENST00000521978.1	+	13	2320	c.2320G>C	c.(2320-2322)Gat>Cat	p.D774H	RIMS1_ENST00000348717.5_Missense_Mutation_p.D774H|RIMS1_ENST00000491071.2_Missense_Mutation_p.D774H|RIMS1_ENST00000522291.1_Missense_Mutation_p.D774H|RIMS1_ENST00000517960.1_Missense_Mutation_p.D774H|RIMS1_ENST00000401910.3_Missense_Mutation_p.D248H|RIMS1_ENST00000425662.2_Missense_Mutation_p.D167H|RIMS1_ENST00000523963.1_Missense_Mutation_p.D248H|RIMS1_ENST00000264839.7_Missense_Mutation_p.D774H|RIMS1_ENST00000518273.1_Missense_Mutation_p.D774H|RIMS1_ENST00000520567.1_Missense_Mutation_p.D774H|RIMS1_ENST00000538414.1_5'Flank|RIMS1_ENST00000517827.1_Missense_Mutation_p.D233H	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	774	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TGCTAGAGTAGATGGACGTCC	0.358																																																	0													81.0	76.0	77.0					6																	72960111		1846	4091	5937	SO:0001583	missense	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2320G>C	6.37:g.72960111G>C	ENSP00000428417:p.Asp774His		A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.D774H	ENST00000521978.1	37	c.2320	CCDS47449.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.311739|4.311739	0.81358|0.81358	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827|ENST00000517433	T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.69175|.	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38|.	5.28|5.28	5.28|5.28	0.74379|0.74379	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.56615|0.56615	0.1997|0.1997	L|L	0.38953|0.38953	1.18|1.18	0.80722|0.80722	D|D	1|1	P;D;D;D;D;D;D|.	0.89917|.	0.882;0.999;0.999;1.0;1.0;1.0;1.0|.	P;D;D;D;D;D;D|.	0.97110|.	0.837;0.997;0.999;1.0;1.0;0.999;1.0|.	T|T	0.53056|0.53056	-0.8492|-0.8492	10|5	0.87932|.	D|.	0|.	-19.872|-19.872	19.2624|19.2624	0.93973|0.93973	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	233;248;774;233;248;774;774|.	B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;C9JNW6;Q86UR5|.	.;.;.;.;.;.;RIMS1_HUMAN|.	H|T	774;774;774;774;774;774;774;774;774;774;774;774;248;248;167;167;233|347	ENSP00000430101:D774H;ENSP00000275037:D774H;ENSP00000264839:D774H;ENSP00000429959:D774H;ENSP00000430408:D774H;ENSP00000430502:D774H;ENSP00000430932:D774H;ENSP00000428417:D774H;ENSP00000385649:D248H;ENSP00000428328:D248H;ENSP00000411235:D167H;ENSP00000389503:D167H;ENSP00000428367:D233H|.	ENSP00000264839:D774H|.	D|R	+|+	1|2	0|0	RIMS1|RIMS1	73016832|73016832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.724000|0.724000	0.41520|0.41520	9.615000|9.615000	0.98356|0.98356	2.611000|2.611000	0.88343|0.88343	0.585000|0.585000	0.79938|0.79938	GAT|AGA	RIMS1	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000079841		0.358	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	-	0.00	68	0	G			72960111	+1	tier1	-	no_errors	ENST00000521978	ensembl	human	known	74_37	missense	8.62	53	5	SNP	1.000	C
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037863	10037863	+	RNA	DEL	C	C	-	rs373540942		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrY:10037863delC	ENST00000515896.1	+	0	100									RNA, 5.8S ribosomal pseudogene 6																		ATCGACACTTCGAACGCACTT	0.552																																																	0																																												0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037863delC				RNA	DEL	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.552	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA			0.00	97	0	C			10037863	+1	tier1		no_errors	ENST00000515896	ensembl	human	known	74_37	rna	11.54	69	9	DEL	1.000	-
RNF220	55182	genome.wustl.edu	37	1	45115560	45115560	+	Silent	SNP	G	G	A	rs561320190	byFrequency	TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:45115560G>A	ENST00000355387.2	+	14	2010	c.1560G>A	c.(1558-1560)tcG>tcA	p.S520S	TMEM53_ENST00000372242.3_Intron|TMEM53_ENST00000372244.3_Intron|TMEM53_ENST00000372243.3_Intron|RNF220_ENST00000361799.2_Silent_p.S520S|RNF220_ENST00000480686.1_3'UTR|RNF220_ENST00000372247.2_Silent_p.S520S|RNF220_ENST00000443020.2_Silent_p.S307S			Q5VTB9	RN220_HUMAN	ring finger protein 220	520	Required for targeting to the cytoplasm. {ECO:0000250}.				protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						CCTAGGACTCGTACTCGATGC	0.652													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17377	0.0		0.0	False		,,,				2504	0.001																0													104.0	83.0	90.0					1																	45115560		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.1560G>A	1.37:g.45115560G>A			B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Silent	SNP	superfamily_Peptidase_M20_dimer,pfscan_Znf_RING	p.S520	ENST00000355387.2	37	c.1560	CCDS510.1	1																																																																																			RNF220	-	pfscan_Znf_RING	ENSG00000187147		0.652	RNF220-001	KNOWN	basic|CCDS	protein_coding	RNF220	HGNC	protein_coding	OTTHUMT00000020683.4	-	0.00	46	0	G	NM_018150		45115560	+1	tier1	-	no_errors	ENST00000355387	ensembl	human	known	74_37	silent	40.00	38	26	SNP	0.135	A
RPLP0P2	113157	genome.wustl.edu	37	11	61405030	61405030	+	RNA	SNP	T	T	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:61405030T>A	ENST00000496593.1	+	0	1634					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		ctgctgctgctgcAGCCCCAG	0.552																																																	0																																												0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61405030T>A				RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.552	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1		0.00	98	0	T	NR_002775		61405030	+1			no_errors	ENST00000496593	ensembl	human	known	74_37	rna	5.06	75	4	SNP	0.994	A
RPS6KA2	6196	genome.wustl.edu	37	6	166944794	166944794	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:166944794A>C	ENST00000265678.4	-	3	447	c.224T>G	c.(223-225)cTg>cGg	p.L75R	RPS6KA2_ENST00000503859.1_Missense_Mutation_p.L83R|RPS6KA2_ENST00000481261.2_5'UTR|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.L100R|RPS6KA2_ENST00000366863.2_5'UTR|RPS6KA2_ENST00000405189.3_5'UTR|Z98049.1_ENST00000598601.1_5'Flank	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	75	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CTTCCTCACCAGGAACACCTT	0.502																																																	0													87.0	92.0	90.0					6																	166944794		2203	4300	6503	SO:0001583	missense	0			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.224T>G	6.37:g.166944794A>C	ENSP00000265678:p.Leu75Arg		B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L100R	ENST00000265678.4	37	c.299	CCDS5294.1	6	.	.	.	.	.	.	.	.	.	.	A	16.79	3.220139	0.58560	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000507371;ENST00000506565	T;T;T;T;T	0.65364	1.7;1.7;1.7;-0.15;-0.15	4.27	4.27	0.50696	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.69070	0.3070	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.79108	0.992;0.986;0.984	T	0.73956	-0.3819	10	0.87932	D	0	.	12.6567	0.56791	1.0:0.0:0.0:0.0	.	100;83;75	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	R	75;100;83;59;100	ENSP00000265678:L75R;ENSP00000422435:L100R;ENSP00000427015:L83R;ENSP00000423114:L59R;ENSP00000425148:L100R	ENSP00000265678:L75R	L	-	2	0	RPS6KA2	166864784	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	7.973000	0.88032	1.925000	0.55765	0.455000	0.32223	CTG	RPS6KA2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	ENSG00000071242		0.502	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA2	HGNC	protein_coding	OTTHUMT00000043075.3	-	0.00	44	0	A	NM_021135		166944794	-1	tier1	-	no_errors	ENST00000510118	ensembl	human	known	74_37	missense	24.00	19	6	SNP	1.000	C
RYR2	6262	genome.wustl.edu	37	1	237947387	237947387	+	Silent	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:237947387C>G	ENST00000366574.2	+	90	12692	c.12375C>G	c.(12373-12375)gtC>gtG	p.V4125V	RYR2_ENST00000542537.1_Silent_p.V4109V|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.V4131V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4125					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGAGAGCGTCCTGAATTATT	0.517																																																	0													63.0	63.0	63.0					1																	237947387		1921	4137	6058	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12375C>G	1.37:g.237947387C>G			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.V4131	ENST00000366574.2	37	c.12393	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	29	0	C	NM_001035		237947387	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	37.50	20	12	SNP	0.917	G
S100A5	6276	genome.wustl.edu	37	1	153512658	153512658	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:153512658G>T	ENST00000368718.1	-	3	291	c.10C>A	c.(10-12)Cct>Act	p.P4T	S100A5_ENST00000368717.2_Missense_Mutation_p.P4T|S100A5_ENST00000359215.1_Missense_Mutation_p.P22T	NM_002962.1	NP_002953.2	P33763	S10A5_HUMAN	S100 calcium binding protein A5	4						neuronal cell body (GO:0043025)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	4	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCTCCAGAGGAGTCTCCATC	0.552																																																	0													153.0	131.0	139.0					1																	153512658		2203	4300	6503	SO:0001583	missense	0			Z18954	CCDS1041.1, CCDS1041.2	1q21	2013-01-10	2001-11-28		ENSG00000196420	ENSG00000196420		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10495	protein-coding gene	gene with protein product		176991	"""S100 calcium-binding protein A5"""	S100D		8341667	Standard	NM_002962		Approved		uc001fbx.3	P33763	OTTHUMG00000013547	ENST00000368718.1:c.10C>A	1.37:g.153512658G>T	ENSP00000357707:p.Pro4Thr		Q52LE7|Q5RHS3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_dom,pfscan_EF_hand_dom	p.P22T	ENST00000368718.1	37	c.64	CCDS1041.2	1	.	.	.	.	.	.	.	.	.	.	G	7.398	0.632245	0.14322	.	.	ENSG00000196420	ENST00000368718;ENST00000359215;ENST00000368717	T;T;T	0.06528	3.29;3.29;3.29	4.95	4.03	0.46877	.	0.244410	0.41605	D	0.000858	T	0.02807	0.0084	.	.	.	0.34275	D	0.681472	B	0.30793	0.295	B	0.34722	0.188	T	0.31530	-0.9940	9	0.52906	T	0.07	.	9.469	0.38831	0.0965:0.0:0.9035:0.0	.	22	Q52LE7	.	T	4;22;4	ENSP00000357707:P4T;ENSP00000352148:P22T;ENSP00000357706:P4T	ENSP00000352148:P22T	P	-	1	0	S100A5	151779282	0.987000	0.35691	0.096000	0.21009	0.145000	0.21501	2.065000	0.41442	1.299000	0.44798	0.655000	0.94253	CCT	S100A5	-	NULL	ENSG00000196420		0.552	S100A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A5	HGNC	protein_coding	OTTHUMT00000037719.1		0.00	52	0	G	NM_002962		153512658	-1			no_errors	ENST00000359215	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.711	T
RYR2	6262	genome.wustl.edu	37	1	237955575	237955575	+	Silent	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:237955575G>T	ENST00000366574.2	+	94	14051	c.13734G>T	c.(13732-13734)ctG>ctT	p.L4578L	RYR2_ENST00000542537.1_Silent_p.L4562L|RYR2_ENST00000360064.6_Silent_p.L4584L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4578					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAGCTATTCTGCACACGGTCA	0.478																																																	0													70.0	75.0	74.0					1																	237955575		2069	4196	6265	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13734G>T	1.37:g.237955575G>T			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L4584	ENST00000366574.2	37	c.13752	CCDS55691.1	1																																																																																			RYR2	-	pfam_Ryanrecept_TM4-6	ENSG00000198626		0.478	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2		0.00	17	0	G	NM_001035		237955575	+1			no_errors	ENST00000360064	ensembl	human	known	74_37	silent	13.33	26	4	SNP	0.976	T
SEC63	11231	genome.wustl.edu	37	6	108232548	108232548	+	Splice_Site	SNP	A	A	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:108232548A>C	ENST00000369002.4	-	7	804		c.e7+1			NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)						liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		GCTAAAACTTACCACAACAAC	0.299																																																	0													83.0	73.0	77.0					6																	108232548		2203	4300	6503	SO:0001630	splice_region_variant	0			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.624+1T>G	6.37:g.108232548A>C			O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Splice_Site	SNP	-	e7+2	ENST00000369002.4	37	c.624+2	CCDS5061.1	6	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165500	0.78339	.	.	ENSG00000025796	ENST00000369002;ENST00000423697;ENST00000429168	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3752	0.74598	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEC63	108339241	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	8.704000	0.91351	2.044000	0.60594	0.528000	0.53228	.	SEC63	-	-	ENSG00000025796		0.299	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC63	HGNC	protein_coding	OTTHUMT00000041705.4	-	0.00	84	0	A	NM_007214	Intron	108232548	-1	tier1	-	no_errors	ENST00000369002	ensembl	human	known	74_37	splice_site	27.27	48	18	SNP	1.000	C
SEH1L	81929	genome.wustl.edu	37	18	12986927	12986929	+	3'UTR	DEL	TCC	TCC	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr18:12986927_12986929delTCC	ENST00000262124.11	+	0	2886_2888				SEH1L_ENST00000399892.2_In_Frame_Del_p.P385del|RP11-773H22.4_ENST00000588211.1_RNA	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)						attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						CCCAGCTCCTtcctcctcctcct	0.522																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.*1678TCC>-	18.37:g.12986936_12986938delTCC			A8K5B1|Q8NFU6|Q96MH3|Q9C069	In_Frame_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P383in_frame_del	ENST00000262124.11	37	c.1137_1139	CCDS45832.1	18																																																																																			SEH1L	-	NULL	ENSG00000085415		0.522	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEH1L	HGNC	protein_coding	OTTHUMT00000458254.1		0.00	26	0	TCC	NM_031216		12986929	+1	tier1		no_errors	ENST00000399892	ensembl	human	known	74_37	in_frame_del	12.50	28	4	DEL	0.997:1.000:1.000	-
SERPINB4	6318	genome.wustl.edu	37	18	61305185	61305185	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr18:61305185A>G	ENST00000341074.5	-	8	1056	c.941T>C	c.(940-942)cTc>cCc	p.L314P	SERPINB4_ENST00000356424.6_Missense_Mutation_p.L262P	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	314					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						CATGCCTGAGAGGTCTGCATC	0.507																																																	0													169.0	148.0	155.0					18																	61305185		2203	4300	6503	SO:0001583	missense	0			X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.941T>C	18.37:g.61305185A>G	ENSP00000343445:p.Leu314Pro		A8K847	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.L314P	ENST00000341074.5	37	c.941	CCDS11986.1	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.6|20.6	4.018743|4.018743	0.75275|0.75275	.|.	.|.	ENSG00000206073|ENSG00000206073	ENST00000341074;ENST00000356424|ENST00000413673	D;D|.	0.88975|.	-2.45;-2.45|.	4.41|4.41	4.41|4.41	0.53225|0.53225	Serpin domain (3);|.	0.377447|.	0.19187|.	N|.	0.120539|.	D|D	0.85336|0.85336	0.5673|0.5673	H|H	0.94886|0.94886	3.595|3.595	0.51233|0.51233	D|D	0.999917|0.999917	D;D;P|.	0.89917|.	0.994;1.0;0.953|.	D;D;P|.	0.77557|.	0.958;0.99;0.905|.	D|D	0.89356|0.89356	0.3664|0.3664	10|5	0.87932|.	D|.	0|.	.|.	13.2594|13.2594	0.60097|0.60097	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	314;314;293|.	Q5K684;P48594;Q9BYF7|.	.;SPB4_HUMAN;.|.	P|P	314;262|295	ENSP00000343445:L314P;ENSP00000348795:L262P|.	ENSP00000343445:L314P|.	L|S	-|-	2|1	0|0	SERPINB4|SERPINB4	59456165|59456165	0.993000|0.993000	0.37304|0.37304	0.182000|0.182000	0.23118|0.23118	0.283000|0.283000	0.27025|0.27025	6.943000|6.943000	0.75934|0.75934	1.967000|1.967000	0.57214|0.57214	0.496000|0.496000	0.49642|0.49642	CTC|TCT	SERPINB4	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000206073		0.507	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB4	HGNC	protein_coding	OTTHUMT00000133794.2	-	0.00	63	0	A	NM_175041		61305185	-1	tier1	-	no_errors	ENST00000341074	ensembl	human	known	74_37	missense	21.79	61	17	SNP	0.973	G
SERPINB2	5055	genome.wustl.edu	37	18	61570462	61570462	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr18:61570462G>T	ENST00000299502.4	+	8	1251	c.1171G>T	c.(1171-1173)Gat>Tat	p.D391Y	SERPINB2_ENST00000457692.1_Missense_Mutation_p.D391Y	NM_002575.2	NP_002566.1	P05120	PAI2_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 2	391					blood coagulation (GO:0007596)|fibrinolysis (GO:0042730)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|liver(1)|lung(12)|prostate(2)|skin(2)|stomach(1)	32		Esophageal squamous(42;0.131)			Tenecteplase(DB00031)|Urokinase(DB00013)	GTTTGTGGCAGATCATCCTTT	0.463																																																	0													96.0	99.0	98.0					18																	61570462		2203	4300	6503	SO:0001583	missense	0			Y00630	CCDS11989.1	18q21.3	2014-02-18	2005-08-18		ENSG00000197632	ENSG00000197632		"""Serine (or cysteine) peptidase inhibitors"""	8584	protein-coding gene	gene with protein product		173390	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2"""	PLANH2, PAI2		24172014	Standard	NM_002575		Approved	HsT1201	uc002ljo.3	P05120	OTTHUMG00000060592	ENST00000299502.4:c.1171G>T	18.37:g.61570462G>T	ENSP00000299502:p.Asp391Tyr		Q96E96	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.D391Y	ENST00000299502.4	37	c.1171	CCDS11989.1	18	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666332	0.88251	.	.	ENSG00000197632	ENST00000299502;ENST00000457692	D;D	0.89552	-2.53;-2.53	5.64	5.64	0.86602	Serpin domain (3);Protease inhibitor I4, serpin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97182	0.9079	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98374	1.0555	10	0.87932	D	0	.	19.0463	0.93020	0.0:0.0:1.0:0.0	.	391	P05120	PAI2_HUMAN	Y	391	ENSP00000299502:D391Y;ENSP00000401645:D391Y	ENSP00000299502:D391Y	D	+	1	0	SERPINB2	59721442	1.000000	0.71417	0.752000	0.31206	0.939000	0.58152	6.712000	0.74681	2.812000	0.96745	0.557000	0.71058	GAT	SERPINB2	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000197632		0.463	SERPINB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB2	HGNC	protein_coding	OTTHUMT00000134009.1	-	0.00	55	0	G	NM_002575		61570462	+1	tier1	-	no_errors	ENST00000299502	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.999	T
SETD1A	9739	genome.wustl.edu	37	16	30982838	30982840	+	Missense_Mutation	TNP	CTC	CTC	TGA	rs150754116		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C|T|C	C|T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:30982838_30982840CTC>TGA	ENST00000262519.8	+	13	3842_3844	c.3156_3158CTC>TGA	c.(3154-3159)tcCTCg>tcTGAg	p.S1053E		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1053	Ser-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						cctcatcctcctcgtcctcttca	0.586																																																	0																																										SO:0001583	missense	0			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3156_3158CTC>TGA	16.37:g.30982838CTC>TGA	ENSP00000262519:p.Ser1053Glu		A6NP62|Q6PIF3|Q8TAJ6	Silent|Missense_Mutation|Nonsense_Mutation	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.S1052|p.S1053A|p.S1053*	ENST00000262519.8	37	c.3156|c.3157|c.3158	CCDS32435.1	16																																																																																			SETD1A	-	NULL	ENSG00000099381		0.586	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	HGNC	protein_coding	OTTHUMT00000318244.2	-	0.00	34|35|34	0	C|T|C	NM_014712		30982838|30982839|30982840	+1	tier1	-	no_errors	ENST00000262519	ensembl	human	known	74_37	silent|missense|nonsense	16.22|16.22|16.67	31|31|30	6	SNP	0.009|0.727|0.750	T|G|A
SIGLEC1	6614	genome.wustl.edu	37	20	3682019	3682019	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:3682019C>T	ENST00000344754.4	-	6	1497	c.1498G>A	c.(1498-1500)Gca>Aca	p.A500T	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.A500T	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	500	Ig-like C2-type 4.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.A500T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GTGGAGGTTGCATTTCCAAGG	0.587																																																	1	Substitution - Missense(1)	large_intestine(1)											80.0	64.0	70.0					20																	3682019		2203	4300	6503	SO:0001583	missense	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.1498G>A	20.37:g.3682019C>T	ENSP00000341141:p.Ala500Thr		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A500T	ENST00000344754.4	37	c.1498	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387390	0.61956	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.68903	-0.36;-0.36	5.69	-0.303	0.12792	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.976540	0.08323	N	0.963596	T	0.73606	0.3608	M	0.65975	2.015	0.09310	N	1	P;P	0.49559	0.925;0.846	P;P	0.53760	0.734;0.611	T	0.64791	-0.6324	10	0.17832	T	0.49	.	15.7684	0.78146	0.6833:0.3167:0.0:0.0	.	500;500	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	T	500	ENSP00000341141:A500T;ENSP00000202578:A500T	ENSP00000202578:A500T	A	-	1	0	SIGLEC1	3630019	0.000000	0.05858	0.001000	0.08648	0.977000	0.68977	-1.114000	0.03293	-0.342000	0.08363	0.655000	0.94253	GCA	SIGLEC1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000088827		0.587	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2		0.00	21	0	C	NM_023068		3682019	-1			no_errors	ENST00000344754	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.001	T
SIGLEC7	27036	genome.wustl.edu	37	19	51645657	51645658	+	Frame_Shift_Ins	INS	-	-	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:51645657_51645658insG	ENST00000317643.6	+	1	100_101	c.31_32insG	c.(31-33)tggfs	p.W11fs	SIGLEC7_ENST00000305628.7_Frame_Shift_Ins_p.W11fs|SIGLEC7_ENST00000600577.1_Frame_Shift_Ins_p.W11fs	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	11					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		gcccctgctCTGGGGGAGGGAG	0.599																																																	0																																										SO:0001589	frameshift_variant	0			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.36dupG	19.37:g.51645662_51645662dupG	ENSP00000323328:p.Trp11fs		Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Frame_Shift_Ins	INS	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R13fs	ENST00000317643.6	37	c.31_32	CCDS12826.1	19																																																																																			SIGLEC7	-	NULL	ENSG00000168995		0.599	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2		0.00	38	0	-	NM_016543		51645658	+1	tier1		no_errors	ENST00000317643	ensembl	human	known	74_37	frame_shift_ins	35.56	29	16	INS	0.189:0.205	G
SIX6	4990	genome.wustl.edu	37	14	60976248	60976248	+	Silent	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr14:60976248C>T	ENST00000327720.5	+	1	580	c.132C>T	c.(130-132)tgC>tgT	p.C44C		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	44					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.C44C(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		CTGCGGCCTGCGAGGCCCTCA	0.632																																																	1	Substitution - coding silent(1)	endometrium(1)											39.0	43.0	41.0					14																	60976248		2203	4300	6503	SO:0001819	synonymous_variant	0			AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.132C>T	14.37:g.60976248C>T			Q6NT42|Q9P1X8	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.C44	ENST00000327720.5	37	c.132	CCDS9747.1	14																																																																																			SIX6	-	NULL	ENSG00000184302		0.632	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX6	HGNC	protein_coding	OTTHUMT00000276952.2	-	0.00	40	0	C			60976248	+1	tier1	-	no_errors	ENST00000327720	ensembl	human	known	74_37	silent	10.00	36	4	SNP	1.000	T
SKIDA1	387640	genome.wustl.edu	37	10	21805497	21805499	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:21805497_21805499delCTC	ENST00000449193.2	-	4	3505_3507	c.1253_1255delGAG	c.(1252-1257)ggagag>gag	p.G418del	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_In_Frame_Del_p.G339del	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	337						nucleus (GO:0005634)											tcctcctcctctccctcctcctc	0.621																																																	0																																										SO:0001651	inframe_deletion	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1253_1255delGAG	10.37:g.21805497_21805499delCTC	ENSP00000410041:p.Gly418del		B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Del	DEL	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.G418in_frame_del	ENST00000449193.2	37	c.1255_1253	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.621	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2		0.00	44	0	CTC	NM_207371		21805499	-1	tier1		no_errors	ENST00000449193	ensembl	human	known	74_37	in_frame_del	12.82	34	5	DEL	0.948:0.561:0.435	-
SLC12A5	57468	genome.wustl.edu	37	20	44675020	44675020	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr20:44675020G>A	ENST00000454036.2	+	14	1850	c.1801G>A	c.(1801-1803)Gtg>Atg	p.V601M	SLC12A5_ENST00000243964.3_Missense_Mutation_p.V578M	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	601					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.V578L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGCCTGTGCAGTGCAGACGCT	0.552																																																	1	Substitution - Missense(1)	lung(1)											129.0	110.0	116.0					20																	44675020		2203	4300	6503	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1801G>A	20.37:g.44675020G>A	ENSP00000387694:p.Val601Met		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.V601M	ENST00000454036.2	37	c.1801	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848397	0.32699	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.98717	-5.09;-5.09	4.45	3.5	0.40072	Amino acid permease domain (1);	0.260809	0.33005	N	0.005383	D	0.97829	0.9287	L	0.46819	1.47	0.80722	D	1	B;B	0.33857	0.429;0.142	P;B	0.45343	0.477;0.127	D	0.95997	0.8990	10	0.44086	T	0.13	.	15.3791	0.74637	0.0:0.0:0.8579:0.1421	.	601;578	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	M	601;578	ENSP00000387694:V601M;ENSP00000243964:V578M	ENSP00000243964:V578M	V	+	1	0	SLC12A5	44108427	0.998000	0.40836	0.349000	0.25694	0.139000	0.21198	2.966000	0.49208	0.518000	0.28383	-1.469000	0.01011	GTG	SLC12A5	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.552	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1		0.00	36	0	G			44675020	+1			no_errors	ENST00000454036	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.952	A
SLC12A7	10723	genome.wustl.edu	37	5	1093658	1093658	+	Missense_Mutation	SNP	C	C	G	rs562501613		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:1093658C>G	ENST00000264930.5	-	3	375	c.332G>C	c.(331-333)cGg>cCg	p.R111P		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	111					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CTTGGCCTCCCGCCGCCGGCT	0.662																																																	0													67.0	47.0	54.0					5																	1093658		2185	4289	6474	SO:0001583	missense	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.332G>C	5.37:g.1093658C>G	ENSP00000264930:p.Arg111Pro		A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.R111P	ENST00000264930.5	37	c.332	CCDS34129.1	5	.	.	.	.	.	.	.	.	.	.	C	3.909	-0.020394	0.07634	.	.	ENSG00000113504	ENST00000264930;ENST00000343658	D	0.84800	-1.9	3.86	1.57	0.23409	.	0.437879	0.21556	N	0.072652	T	0.67942	0.2947	N	0.19112	0.55	0.09310	N	1	P	0.36199	0.543	B	0.34301	0.179	T	0.56347	-0.7994	10	0.15066	T	0.55	.	6.1389	0.20249	0.0:0.6289:0.0:0.3711	.	111	Q9Y666	S12A7_HUMAN	P	111	ENSP00000264930:R111P	ENSP00000264930:R111P	R	-	2	0	SLC12A7	1146658	0.000000	0.05858	0.022000	0.16811	0.029000	0.11900	0.545000	0.23268	0.757000	0.33036	0.455000	0.32223	CGG	SLC12A7	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000113504		0.662	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2	-	0.00	31	0	C	NM_006598		1093658	-1	tier1	-	no_errors	ENST00000264930	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.059	G
SLC13A1	6561	genome.wustl.edu	37	7	122774582	122774582	+	Splice_Site	SNP	G	G	T	rs140244991	byFrequency	TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:122774582G>T	ENST00000194130.2	-	8	853	c.814C>A	c.(814-816)Cgc>Agc	p.R272S	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	272					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TCAGGATAGCGTCTGTGTGAA	0.483																																																	0													154.0	126.0	135.0					7																	122774582		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.813-1C>A	7.37:g.122774582G>T			Q9H5Z0	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.R272S	ENST00000194130.2	37	c.814	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760486	0.69763	.	.	ENSG00000081800	ENST00000194130	T	0.66280	-0.2	5.72	5.72	0.89469	.	0.392833	0.33457	N	0.004886	T	0.61311	0.2337	L	0.46819	1.47	0.80722	D	1	P;P	0.46395	0.877;0.877	P;P	0.45660	0.489;0.489	T	0.55283	-0.8165	10	0.22109	T	0.4	-22.7284	17.7332	0.88384	0.0:0.0:1.0:0.0	.	272;272	A4D0X1;Q9BZW2	.;S13A1_HUMAN	S	272	ENSP00000194130:R272S	ENSP00000194130:R272S	R	-	1	0	SLC13A1	122561818	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	5.089000	0.64492	2.865000	0.98341	0.655000	0.94253	CGC	SLC13A1	-	pfam_Na/sul_symport	ENSG00000081800		0.483	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	HGNC	protein_coding	OTTHUMT00000347404.1	-	0.00	65	0	G	NM_022444	Missense_Mutation	122774582	-1	tier1	-	no_errors	ENST00000194130	ensembl	human	known	74_37	missense	30.77	36	16	SNP	1.000	T
SLC13A4	26266	genome.wustl.edu	37	7	135366322	135366322	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:135366322C>A	ENST00000354042.4	-	16	2559	c.1870G>T	c.(1870-1872)Gat>Tat	p.D624Y	SLC13A4_ENST00000491630.1_5'UTR|C7orf73_ENST00000422968.1_Intron	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	624					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						TAGGCTTGATCAGTGATGTTG	0.527																																																	0													187.0	147.0	160.0					7																	135366322		2203	4300	6503	SO:0001583	missense	0			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1870G>T	7.37:g.135366322C>A	ENSP00000297282:p.Asp624Tyr		A4D1Q4|Q8N631	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.D624Y	ENST00000354042.4	37	c.1870	CCDS5840.1	7	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395543	0.42512	.	.	ENSG00000164707	ENST00000354042	T	0.69040	-0.37	5.11	2.1	0.27182	.	0.464248	0.20601	N	0.089160	T	0.41650	0.1168	N	0.08118	0	0.31028	N	0.717802	P;P	0.41265	0.744;0.61	B;B	0.30943	0.122;0.086	T	0.50906	-0.8772	10	0.54805	T	0.06	.	14.4984	0.67704	0.0:0.5648:0.4352:0.0	.	493;624	Q59HF0;Q9UKG4	.;S13A4_HUMAN	Y	624	ENSP00000297282:D624Y	ENSP00000297282:D624Y	D	-	1	0	SLC13A4	135016862	0.427000	0.25514	0.997000	0.53966	0.847000	0.48162	1.198000	0.32223	0.705000	0.31890	0.555000	0.69702	GAT	SLC13A4	-	NULL	ENSG00000164707		0.527	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	HGNC	protein_coding	OTTHUMT00000340558.1	-	0.00	44	0	C	NM_012450		135366322	-1	tier1	-	no_errors	ENST00000354042	ensembl	human	known	74_37	missense	31.51	50	23	SNP	0.956	A
SLC22A24	283238	genome.wustl.edu	37	11	62850786	62850786	+	Missense_Mutation	SNP	C	C	A	rs373291441		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:62850786C>A	ENST00000417740.1	-	7	1655	c.1214G>T	c.(1213-1215)cGt>cTt	p.R405L		NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	0					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						GCTTATTCGACGACCCATATG	0.473																																																	0													151.0	122.0	130.0					11																	62850786		692	1591	2283	SO:0001583	missense	0				CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.1214G>T	11.37:g.62850786C>A	ENSP00000396586:p.Arg405Leu			Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R405L	ENST00000417740.1	37	c.1214		11	.	.	.	.	.	.	.	.	.	.	C	15.73	2.918691	0.52546	.	.	ENSG00000197658	ENST00000417740	D	0.83914	-1.78	3.8	1.92	0.25849	.	.	.	.	.	D	0.93507	0.7928	H	0.98388	4.22	0.09310	N	0.999997	D	0.76494	0.999	D	0.77557	0.99	D	0.84104	0.0397	9	0.87932	D	0	.	7.7017	0.28627	0.0:0.7857:0.0:0.2143	.	405	C9JC66	.	L	405	ENSP00000396586:R405L	ENSP00000396586:R405L	R	-	2	0	SLC22A24	62607362	0.001000	0.12720	0.016000	0.15963	0.136000	0.21042	0.228000	0.17814	0.307000	0.22880	0.596000	0.82720	CGT	SLC22A24	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197658		0.473	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	SLC22A24	HGNC	protein_coding	OTTHUMT00000383747.1		0.00	42	0	C	NM_173586		62850786	-1			no_errors	ENST00000417740	ensembl	human	putative	74_37	missense	5.26	36	2	SNP	0.078	A
SLC25A11	8402	genome.wustl.edu	37	17	4841060	4841060	+	Silent	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:4841060G>A	ENST00000225665.7	-	8	1261	c.921C>T	c.(919-921)taC>taT	p.Y307Y	RNF167_ENST00000572430.1_5'Flank|RNF167_ENST00000576229.1_5'Flank|RNF167_ENST00000262482.6_5'Flank|SLC25A11_ENST00000544061.2_Silent_p.Y256Y|RNF167_ENST00000575111.1_5'Flank|RNF167_ENST00000571816.1_5'Flank	NM_001165417.1|NM_003562.4	NP_001158889.1|NP_003553.2	Q02978	M2OM_HUMAN	solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11	307					alpha-ketoglutarate transport (GO:0015742)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxoglutarate:malate antiporter activity (GO:0015367)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	10						AGAGACGCTTGTAGGCCTTGT	0.647																																					Esophageal Squamous(144;1178 2388 18010 48797)												0													70.0	78.0	75.0					17																	4841060		2203	4300	6503	SO:0001819	synonymous_variant	0			X66114	CCDS11059.1, CCDS54069.1	17p13.3	2013-05-22			ENSG00000108528	ENSG00000108528		"""Solute carriers"""	10981	protein-coding gene	gene with protein product		604165		SLC20A4		10072597, 1457818	Standard	NM_003562		Approved	OGC	uc002fzo.2	Q02978	OTTHUMG00000099395	ENST00000225665.7:c.921C>T	17.37:g.4841060G>A			F5GY65|O75537|Q969P7	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.Y307	ENST00000225665.7	37	c.921	CCDS11059.1	17																																																																																			SLC25A11	-	pfam_Mitochondrial_sb/sol_carrier	ENSG00000108528		0.647	SLC25A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A11	HGNC	protein_coding	OTTHUMT00000216852.4	-	0.00	46	0	G	NM_003562		4841060	-1	tier1	-	no_errors	ENST00000225665	ensembl	human	known	74_37	silent	76.19	10	32	SNP	1.000	A
SLC35G3	146861	genome.wustl.edu	37	17	33520817	33520817	+	Silent	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:33520817G>A	ENST00000297307.5	-	1	595	c.510C>T	c.(508-510)atC>atT	p.I170I	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	170	EamA 1.					integral component of membrane (GO:0016021)											CCACAATGATGATTAGTCCTA	0.607																																																	0													175.0	171.0	173.0					17																	33520817		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.510C>T	17.37:g.33520817G>A			B9EGE9	Silent	SNP	pfam_DMT	p.I170	ENST00000297307.5	37	c.510	CCDS11293.1	17																																																																																			SLC35G3	-	pfam_DMT	ENSG00000164729		0.607	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G3	HGNC	protein_coding	OTTHUMT00000256445.2	-	0.00	69	0	G	NM_152462		33520817	-1	tier1	-	no_errors	ENST00000297307	ensembl	human	known	74_37	silent	38.14	73	45	SNP	0.999	A
SLITRK4	139065	genome.wustl.edu	37	X	142718626	142718626	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrX:142718626C>A	ENST00000381779.4	-	2	524	c.299G>T	c.(298-300)gGa>gTa	p.G100V	SLITRK4_ENST00000356928.1_Missense_Mutation_p.G100V|SLITRK4_ENST00000338017.4_Missense_Mutation_p.G100V	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	100						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					AAAGGCTCCTCCCTCAATGTT	0.378																																																	0													63.0	61.0	62.0					X																	142718626		2203	4300	6503	SO:0001583	missense	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.299G>T	X.37:g.142718626C>A	ENSP00000371198:p.Gly100Val		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G100V	ENST00000381779.4	37	c.299	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	C	13.52	2.263088	0.39995	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.57595	0.39;0.39;0.39	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.36963	0.0986	N	0.12746	0.255	0.80722	D	1	B	0.22276	0.067	B	0.20955	0.032	T	0.14587	-1.0467	10	0.27785	T	0.31	-6.7835	17.0458	0.86502	0.0:1.0:0.0:0.0	.	100	Q8IW52	SLIK4_HUMAN	V	100	ENSP00000371198:G100V;ENSP00000349400:G100V;ENSP00000336627:G100V	ENSP00000336627:G100V	G	-	2	0	SLITRK4	142546292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.289000	0.51747	2.345000	0.79718	0.600000	0.82982	GGA	SLITRK4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000179542		0.378	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	-	0.00	41	0	C	NM_173078		142718626	-1	tier1	-	no_errors	ENST00000338017	ensembl	human	known	74_37	missense	42.22	26	19	SNP	1.000	A
SLITRK2	84631	genome.wustl.edu	37	X	144905265	144905265	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrX:144905265C>G	ENST00000370490.1	+	1	5577	c.1322C>G	c.(1321-1323)tCt>tGt	p.S441C	SLITRK2_ENST00000434188.2_Missense_Mutation_p.S441C|SLITRK2_ENST00000447897.2_Missense_Mutation_p.S441C|SLITRK2_ENST00000413937.2_Missense_Mutation_p.S441C|SLITRK2_ENST00000428560.2_Missense_Mutation_p.S441C			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	441					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CTGTACCCTTCTATGTTTGAT	0.393																																																	0													137.0	142.0	140.0					X																	144905265		2203	4300	6503	SO:0001583	missense	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1322C>G	X.37:g.144905265C>G	ENSP00000359521:p.Ser441Cys		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S441C	ENST00000370490.1	37	c.1322	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170774	0.57584	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41	5.49	5.49	0.81192	.	0.257041	0.40554	N	0.001070	T	0.67401	0.2889	L	0.49256	1.55	0.50313	D	0.999869	D	0.76494	0.999	D	0.77557	0.99	T	0.69312	-0.5178	10	0.62326	D	0.03	-2.4831	15.6062	0.76672	0.0:1.0:0.0:0.0	.	441	Q9H156	SLIK2_HUMAN	C	441	ENSP00000334374:S441C;ENSP00000411681:S441C;ENSP00000359521:S441C;ENSP00000397015:S441C;ENSP00000407347:S441C;ENSP00000412010:S441C	ENSP00000334374:S441C	S	+	2	0	SLITRK2	144712957	0.779000	0.28652	0.798000	0.32154	0.992000	0.81027	3.913000	0.56394	2.280000	0.76307	0.594000	0.82650	TCT	SLITRK2	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000185985		0.393	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	-	0.00	43	0	C	NM_032539		144905265	+1	tier1	-	no_errors	ENST00000370490	ensembl	human	known	74_37	missense	30.95	29	13	SNP	0.973	G
SMAD2	4087	genome.wustl.edu	37	18	45394822	45394822	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr18:45394822G>C	ENST00000402690.2	-	5	921	c.527C>G	c.(526-528)cCt>cGt	p.P176R	SMAD2_ENST00000587353.1_5'UTR|SMAD2_ENST00000591214.1_Missense_Mutation_p.P146R|SMAD2_ENST00000356825.4_Missense_Mutation_p.P146R|SMAD2_ENST00000262160.6_Missense_Mutation_p.P176R|SMAD2_ENST00000586040.1_Missense_Mutation_p.P146R	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	176	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						TAATACTGGAGGCAAAACTGA	0.438																																																	0													68.0	63.0	65.0					18																	45394822		2203	4300	6503	SO:0001583	missense	0			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.527C>G	18.37:g.45394822G>C	ENSP00000384449:p.Pro176Arg			Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.P176R	ENST00000402690.2	37	c.527	CCDS11934.1	18	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901558	0.72754	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.95069	-3.59;-3.6;-3.59	5.58	5.58	0.84498	MAD homology, MH1 (2);	0.096454	0.85682	D	0.000000	D	0.96827	0.8964	M	0.64567	1.98	0.80722	D	1	D;P;D	0.89917	1.0;0.902;0.999	D;P;D	0.76071	0.987;0.74;0.98	D	0.96718	0.9530	10	0.62326	D	0.03	.	19.9474	0.97186	0.0:0.0:1.0:0.0	.	146;146;176	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	R	176;146;176	ENSP00000262160:P176R;ENSP00000349282:P146R;ENSP00000384449:P176R	ENSP00000262160:P176R	P	-	2	0	SMAD2	43648820	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	9.813000	0.99286	2.774000	0.95407	0.655000	0.94253	CCT	SMAD2	-	pfscan_MAD_homology_MH1	ENSG00000175387		0.438	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD2	HGNC	protein_coding	OTTHUMT00000450571.1	-	0.00	69	0	G	NM_005901		45394822	-1	tier1	-	no_errors	ENST00000262160	ensembl	human	known	74_37	missense	40.62	38	26	SNP	1.000	C
SMAD5	4090	genome.wustl.edu	37	5	135514076	135514076	+	3'UTR	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:135514076G>T	ENST00000514641.2	+	0	2667				SMAD5_ENST00000545620.1_3'UTR|SMAD5_ENST00000545279.1_3'UTR			Q99717	SMAD5_HUMAN	SMAD family member 5						BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAGTGACTTGGACTTAGATGC	0.313																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000514641.2:c.*2664G>T	5.37:g.135514076G>T			O14688|Q15798|Q9UQA1	RNA	SNP	-	NULL	ENST00000514641.2	37	NULL		5																																																																																			SMAD5	-	-	ENSG00000113658		0.313	SMAD5-001	KNOWN	basic	processed_transcript	SMAD5	HGNC	protein_coding	OTTHUMT00000372096.2	-	0.00	77	0	G	NM_005903		135514076	+1	tier1	-	no_errors	ENST00000514641	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.995	T
SMC4	10051	genome.wustl.edu	37	3	160149603	160149603	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:160149603A>G	ENST00000357388.3	+	21	3738	c.3287A>G	c.(3286-3288)tAt>tGt	p.Y1096C	RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Missense_Mutation_p.Y1038C|SMC4_ENST00000360111.2_Missense_Mutation_p.Y1038C|SMC4_ENST00000469762.1_Missense_Mutation_p.Y1071C|SMC4_ENST00000344722.5_Missense_Mutation_p.Y1096C	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	1096					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ATCGCAGAGTATAAAAAGAAG	0.358																																																	0													65.0	71.0	69.0					3																	160149603		2203	4300	6503	SO:0001583	missense	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.3287A>G	3.37:g.160149603A>G	ENSP00000349961:p.Tyr1096Cys		A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.Y1096C	ENST00000357388.3	37	c.3287	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	A	19.70	3.877197	0.72294	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	T;T;T;T;T	0.78816	-1.2;-1.21;-1.18;-1.21;-1.2	6.06	4.87	0.63330	RecF/RecN/SMC (1);	0.109652	0.64402	D	0.000004	D	0.90683	0.7077	H	0.94462	3.54	0.58432	D	0.999997	D;D;D;D	0.89917	0.996;1.0;0.999;1.0	D;D;D;D	0.87578	0.937;0.998;0.964;0.974	D	0.92172	0.5744	10	0.87932	D	0	-8.4388	12.5071	0.55987	0.8747:0.0:0.0:0.1252	.	1038;1071;1071;1096	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	C	1096;1038;1071;1038;1096;690	ENSP00000349961:Y1096C;ENSP00000353225:Y1038C;ENSP00000417964:Y1071C;ENSP00000420734:Y1038C;ENSP00000341382:Y1096C	ENSP00000341382:Y1096C	Y	+	2	0	SMC4	161632297	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.777000	0.68931	1.054000	0.40438	0.533000	0.62120	TAT	SMC4	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000113810		0.358	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	-	0.00	70	0	A			160149603	+1	tier1	-	no_errors	ENST00000344722	ensembl	human	known	74_37	missense	76.68	45	148	SNP	1.000	G
SMCR8	140775	genome.wustl.edu	37	17	18219576	18219576	+	Frame_Shift_Del	DEL	T	T	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:18219576delT	ENST00000406438.3	+	1	953	c.473delT	c.(472-474)atcfs	p.I158fs	TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000542570.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	158						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						ATGGCTTATATCTCTGCAGAC	0.517																																																	0													58.0	61.0	60.0					17																	18219576		2203	4300	6503	SO:0001589	frameshift_variant	0			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.473delT	17.37:g.18219576delT	ENSP00000385025:p.Ile158fs		A5PKZ5|Q3ZCN0|Q6PJL3	Frame_Shift_Del	DEL	pfam_Folliculin	p.I158fs	ENST00000406438.3	37	c.473	CCDS11195.2	17																																																																																			SMCR8	-	pfam_Folliculin	ENSG00000176994		0.517	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2		0.00	22	0	T	NM_144775		18219576	+1	tier1		no_errors	ENST00000406438	ensembl	human	known	74_37	frame_shift_del	29.41	24	10	DEL	1.000	-
SMPD4	55627	genome.wustl.edu	37	2	130910744	130910744	+	Splice_Site	SNP	T	T	C	rs553662129		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:130910744T>C	ENST00000409031.1	-	19	3291	c.2143A>G	c.(2143-2145)Atc>Gtc	p.I715V	SMPD4_ENST00000351288.6_Splice_Site_p.I686V|SMPD4_ENST00000473720.1_5'Flank|SMPD4_ENST00000339679.7_Splice_Site_p.I573V|SMPD4_ENST00000431183.2_Splice_Site_p.I613V|SMPD4_ENST00000443958.2_Splice_Site_p.I379V|SMPD4_ENST00000453750.1_Splice_Site_p.I464V|SMPD4_ENST00000426662.2_Splice_Site_p.I351V|SMPD4_ENST00000452225.2_Splice_Site_p.I456V	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	676					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	CCATTGATGATCTAGAAAGCC	0.582													.|||	1	0.000199681	0.0	0.0	5008	,	,		17673	0.0		0.0	False		,,,				2504	0.001																0													49.0	56.0	54.0					2																	130910744		2203	4300	6503	SO:0001630	splice_region_variant	0			AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.2143-1A>G	2.37:g.130910744T>C			B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	NULL	p.I715V	ENST00000409031.1	37	c.2143	CCDS42751.1	2	.	.	.	.	.	.	.	.	.	.	.	9.257	1.042246	0.19748	.	.	ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750;ENST00000443958;ENST00000339679;ENST00000452225;ENST00000426662	.	.	.	4.09	4.09	0.47781	.	0.155506	0.56097	D	0.000036	T	0.44435	0.1293	L	0.29908	0.895	0.37439	D	0.914353	B;B;B;B;P;B;B;B;B;B	0.44309	0.028;0.075;0.061;0.061;0.832;0.095;0.007;0.063;0.119;0.075	B;B;B;B;P;B;B;B;B;B	0.48627	0.019;0.032;0.031;0.031;0.584;0.033;0.013;0.023;0.037;0.058	T	0.38845	-0.9642	9	0.11182	T	0.66	.	11.0769	0.48036	0.0:0.0:0.0:1.0	.	351;456;613;573;464;647;676;715;722;247	B4E0L6;B4DQ31;E7ESA2;B4E0T5;B4DM23;Q9NXE4-2;Q9NXE4;B1PBA3;Q9NXE4-4;Q9NXE4-5	.;.;.;.;.;.;NSMA3_HUMAN;.;.;.	V	686;715;613;464;379;573;456;351	.	ENSP00000339721:I573V	I	-	1	0	SMPD4	130627214	1.000000	0.71417	0.999000	0.59377	0.665000	0.39181	5.811000	0.69187	1.485000	0.48380	0.449000	0.29647	ATC	SMPD4	-	NULL	ENSG00000136699		0.582	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD4	HGNC	protein_coding	OTTHUMT00000254516.3	-	0.00	38	0	T	NM_017751	Missense_Mutation	130910744	-1	tier1	-	no_errors	ENST00000409031	ensembl	human	known	74_37	missense	33.33	30	15	SNP	1.000	C
SND1	27044	genome.wustl.edu	37	7	127637865	127637865	+	Intron	DEL	C	C	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:127637865delC	ENST00000354725.3	+	16	1973				SND1_ENST00000467238.1_3'UTR	NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1						gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)	p.T40K(1)		central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						ggtagacttacactttcggcc	0.458																																																	1	Substitution - Missense(1)	prostate(1)											282.0	254.0	264.0					7																	127637865		2203	4300	6503	SO:0001627	intron_variant	0				CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.1779+6756C>-	7.37:g.127637865delC			Q13122|Q96AG0	RNA	DEL	-	NULL	ENST00000354725.3	37	NULL	CCDS34747.1	7																																																																																			SND1	-	-	ENSG00000197157		0.458	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SND1	HGNC	protein_coding	OTTHUMT00000349148.1		0.00	47	0	C	NM_014390		127637865	+1	tier1		no_errors	ENST00000467238	ensembl	human	known	74_37	rna	41.67	42	30	DEL	0.000	-
SORCS1	114815	genome.wustl.edu	37	10	108459009	108459009	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:108459009C>G	ENST00000263054.6	-	9	1383	c.1376G>C	c.(1375-1377)aGa>aCa	p.R459T	SORCS1_ENST00000344440.6_Missense_Mutation_p.R459T|SORCS1_ENST00000369698.1_5'UTR	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	459					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CTCAGGGCCTCTGCTGCTCTG	0.547																																																	0													247.0	187.0	207.0					10																	108459009		2203	4300	6503	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1376G>C	10.37:g.108459009C>G	ENSP00000263054:p.Arg459Thr		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.R459T	ENST00000263054.6	37	c.1376	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	C	19.82	3.897711	0.72639	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.33865	1.39;1.39	6.1	6.1	0.99115	VPS10 (1);	0.131035	0.53938	D	0.000058	T	0.53916	0.1826	M	0.68317	2.08	0.32679	N	0.51573	P;P;P;P;P	0.52577	0.615;0.954;0.734;0.615;0.734	P;P;P;P;P	0.58928	0.517;0.848;0.71;0.517;0.71	T	0.63019	-0.6730	9	.	.	.	-19.2398	14.2684	0.66135	0.0:0.9242:0.0:0.0758	.	459;459;459;459;459	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	T	459	ENSP00000263054:R459T;ENSP00000345964:R459T	.	R	-	2	0	SORCS1	108448999	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.783000	0.38664	2.902000	0.99343	0.650000	0.86243	AGA	SORCS1	-	smart_VPS10	ENSG00000108018		0.547	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	-	0.00	41	0	C	NM_052918		108459009	-1	tier1	-	no_errors	ENST00000344440	ensembl	human	known	74_37	missense	38.64	27	17	SNP	1.000	G
SPAG17	200162	genome.wustl.edu	37	1	118579442	118579443	+	Frame_Shift_Ins	INS	-	-	T	rs569495336		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:118579442_118579443insT	ENST00000336338.5	-	24	3448_3449	c.3383_3384insA	c.(3382-3384)aatfs	p.N1128fs		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1128						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GGCAGATTCCATTTTCTAAGGT	0.391																																																	0																																										SO:0001589	frameshift_variant	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3384dupA	1.37:g.118579446_118579446dupT	ENSP00000337804:p.Asn1128fs		Q8NAZ1|Q9NT21	Frame_Shift_Ins	INS	NULL	p.N1128fs	ENST00000336338.5	37	c.3384_3383	CCDS899.1	1																																																																																			SPAG17	-	NULL	ENSG00000155761		0.391	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1		0.00	64	0	-	NM_206996		118579443	-1	tier1		no_errors	ENST00000336338	ensembl	human	known	74_37	frame_shift_ins	18.95	77	18	INS	1.000:1.000	T
STARD8	9754	genome.wustl.edu	37	X	67867660	67867660	+	5'UTR	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chrX:67867660C>T	ENST00000252336.6	+	0	150				STARD8_ENST00000488088.1_3'UTR|STARD8_ENST00000374599.3_5'UTR	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AGCCTCGTCCCCAGAGAGGGA	0.711																																																	0													21.0	20.0	20.0					X																	67867660		692	1590	2282	SO:0001623	5_prime_UTR_variant	0			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.-223C>T	X.37:g.67867660C>T			A8K6T2|D3DVT9|Q5JST0|Q68DG7	RNA	SNP	-	NULL	ENST00000252336.6	37	NULL	CCDS14390.1	X																																																																																			STARD8	-	-	ENSG00000130052		0.711	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	HGNC	protein_coding	OTTHUMT00000057026.2	-	0.00	21	0	C	NM_014725		67867660	+1	tier1	-	no_errors	ENST00000488088	ensembl	human	known	74_37	rna	47.06	9	8	SNP	0.001	T
STK3	6788	genome.wustl.edu	37	8	99735078	99735078	+	Intron	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr8:99735078G>T	ENST00000419617.2	-	5	492				STK3_ENST00000523601.1_Intron	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3						apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		AAACACATGAGAGAGGATCTG	0.388																																																	0													46.0	44.0	44.0					8																	99735078		876	1991	2867	SO:0001627	intron_variant	0			BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.352-15539C>A	8.37:g.99735078G>T			A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L157	ENST00000419617.2	37	c.471	CCDS47900.1	8																																																																																			STK3	-	smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000104375		0.388	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK3	HGNC	protein_coding	OTTHUMT00000379635.1	-	0.00	52	0	G	NM_006281		99735078	-1	tier1	-	no_errors	ENST00000424861	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.004	T
SYDE2	84144	genome.wustl.edu	37	1	85648545	85648546	+	Frame_Shift_Ins	INS	-	-	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:85648545_85648546insA	ENST00000341460.5	-	3	1828_1829	c.1779_1780insT	c.(1777-1782)catcttfs	p.L594fs		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	594					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		CTGGTATCAAGATGGTATCGGC	0.436																																																	0																																										SO:0001589	frameshift_variant	0			AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.1780dupT	1.37:g.85648546_85648546dupA	ENSP00000340594:p.Leu594fs		Q5VT96|Q8NDB8|Q9H8A6	Frame_Shift_Ins	INS	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L593fs	ENST00000341460.5	37	c.1780_1779	CCDS44169.1	1																																																																																			SYDE2	-	NULL	ENSG00000097096		0.436	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE2	HGNC	protein_coding	OTTHUMT00000127989.2		0.00	56	0	-			85648546	-1	tier1		no_errors	ENST00000341460	ensembl	human	known	74_37	frame_shift_ins	20.83	38	10	INS	1.000:0.999	A
SYNC	81493	genome.wustl.edu	37	1	33149975	33149975	+	Silent	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:33149975C>T	ENST00000409190.3	-	3	1700	c.1242G>A	c.(1240-1242)ctG>ctA	p.L414L	RBBP4_ENST00000373493.5_3'UTR|SYNC_ENST00000373484.3_Silent_p.L414L	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	414	Coil 2.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						CCATTTCCTCCAGCTGTTCCT	0.418																																																	0													145.0	130.0	135.0					1																	33149975		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.1242G>A	1.37:g.33149975C>T			B4DNK8|B4DY58|C9IY41	Silent	SNP	pfam_IF	p.L414	ENST00000409190.3	37	c.1242	CCDS367.2	1																																																																																			SYNC	-	pfam_IF	ENSG00000162520		0.418	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNC	HGNC	protein_coding	OTTHUMT00000022129.3	-	0.00	11	0	C	NM_030786		33149975	-1	tier1	-	no_errors	ENST00000409190	ensembl	human	known	74_37	silent	35.71	9	5	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152443205	152443205	+	3'UTR	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr6:152443205C>T	ENST00000367255.5	-	0	27361				SYNE1_ENST00000423061.1_3'UTR|SYNE1_ENST00000539504.1_3'UTR|ESR1_ENST00000427531.2_Intron|SYNE1_ENST00000448038.1_3'UTR|SYNE1_ENST00000356820.4_3'UTR|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000341594.5_3'UTR|SYNE1_ENST00000265368.4_3'UTR	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATGGTTGGAGCAGCACCATGG	0.502										HNSCC(10;0.0054)																																							0																																										SO:0001624	3_prime_UTR_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.*366G>A	6.37:g.152443205C>T			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	RNA	SNP	-	NULL	ENST00000367255.5	37	NULL	CCDS5236.2	6																																																																																			SYNE1	-	-	ENSG00000131018		0.502	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	28	0	C	NM_182961		152443205	-1	tier1	-	no_errors	ENST00000347037	ensembl	human	known	74_37	rna	28.57	15	6	SNP	1.000	T
TAS2R13	50838	genome.wustl.edu	37	12	11061603	11061603	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:11061603G>A	ENST00000390677.2	-	1	558	c.295C>T	c.(295-297)Ctt>Ttt	p.L99F	PRR4_ENST00000536668.1_Intron	NM_023920.2	NP_076409.1	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	99					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						ATTGTAGCAAGCCAGAGATTG	0.353																																																	0													65.0	70.0	69.0					12																	11061603		2203	4300	6503	SO:0001583	missense	0			AF227137	CCDS8635.1	12p13	2012-08-22			ENSG00000212128	ENSG00000212128		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14919	protein-coding gene	gene with protein product		604792				10761934, 10766242	Standard	NM_023920		Approved	T2R13, TRB3	uc001qzg.1	Q9NYV9		ENST00000390677.2:c.295C>T	12.37:g.11061603G>A	ENSP00000375095:p.Leu99Phe		Q4G0I5|Q502V8|Q645X2	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.L99F	ENST00000390677.2	37	c.295	CCDS8635.1	12	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823700	0.32237	.	.	ENSG00000212128	ENST00000390677	T	0.00892	5.57	3.3	-0.396	0.12427	.	0.493528	0.16913	N	0.194407	T	0.00936	0.0031	N	0.25245	0.725	0.80722	D	1	B	0.33212	0.402	B	0.41691	0.364	T	0.67921	-0.5545	10	0.32370	T	0.25	.	5.6038	0.17369	0.5939:0.0:0.4061:0.0	.	99	Q9NYV9	T2R13_HUMAN	F	99	ENSP00000375095:L99F	ENSP00000375095:L99F	L	-	1	0	TAS2R13	10952870	0.172000	0.23043	0.993000	0.49108	0.998000	0.95712	-0.278000	0.08490	0.015000	0.14971	0.655000	0.94253	CTT	TAS2R13	-	pfam_TAS2_rcpt	ENSG00000212128		0.353	TAS2R13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R13	HGNC	protein_coding	OTTHUMT00000400229.1	-	0.00	171	0	G			11061603	-1	tier1	-	no_errors	ENST00000390677	ensembl	human	known	74_37	missense	31.20	86	39	SNP	0.993	A
TCHH	7062	genome.wustl.edu	37	1	152081490	152081490	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:152081490G>T	ENST00000368804.1	-	2	4202	c.4203C>A	c.(4201-4203)tgC>tgA	p.C1401*		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1401	23 X 26 AA approximate tandem repeats.			CQ -> LE (in Ref. 1; AAA65582). {ECO:0000305}.	keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGCGCTCCTGGCAGCGCAGCT	0.582																																																	0													56.0	58.0	58.0					1																	152081490		1860	4101	5961	SO:0001587	stop_gained	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.4203C>A	1.37:g.152081490G>T	ENSP00000357794:p.Cys1401*		Q5VUI3	Nonsense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.C1401*	ENST00000368804.1	37	c.4203	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	g	39	7.326117	0.98214	.	.	ENSG00000159450	ENST00000368804	.	.	.	3.61	-1.26	0.09376	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	3.5388	0.07803	0.1091:0.4476:0.2905:0.1528	.	.	.	.	X	1401	.	ENSP00000357794:C1401X	C	-	3	2	TCHH	150348114	0.000000	0.05858	0.000000	0.03702	0.124000	0.20399	-0.185000	0.09684	-0.063000	0.13065	0.297000	0.19635	TGC	TCHH	-	NULL	ENSG00000159450		0.582	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2		0.00	34	0	G	NM_007113		152081490	-1			no_errors	ENST00000368804	ensembl	human	known	74_37	nonsense	8.33	33	3	SNP	0.000	T
THPO	7066	genome.wustl.edu	37	3	184093777	184093777	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:184093777G>C	ENST00000204615.7	-	3	254	c.40C>G	c.(40-42)Cta>Gta	p.L14V	THPO_ENST00000477594.1_5'Flank|THPO_ENST00000421442.2_Missense_Mutation_p.L14V|EIF2B5_ENST00000444495.1_Intron|THPO_ENST00000445696.2_Missense_Mutation_p.L14V	NM_000460.2|NM_001177597.1|NM_001177598.1	NP_000451.1|NP_001171068.1|NP_001171069.1	P40225	TPO_HUMAN	thrombopoietin	14			L -> P (in dbSNP:rs1042346).		blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|thrombopoietin-mediated signaling pathway (GO:0038163)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTTGCAGTTAGGAGAAGCATG	0.512																																																	0													114.0	100.0	105.0					3																	184093777		2203	4300	6503	SO:0001583	missense	0				CCDS3265.1, CCDS54693.1	3q27	2014-01-30	2008-07-31		ENSG00000090534	ENSG00000090534		"""Endogenous ligands"""	11795	protein-coding gene	gene with protein product	"""prepro-thrombopoietin"", ""megakaryocyte stimulating factor"", ""myeloproliferative leukemia virus oncogene ligand"", ""megakaryocyte growth and development factor"", ""MPL ligand"", ""megakaryocyte colony-stimulating factor"", ""c-mpl ligand"", ""thrombopoietin nirs variant 1"""	600044		MGDF		8202154	Standard	XM_006713738		Approved	TPO, MPLLG	uc003fol.1	P40225	OTTHUMG00000156745	ENST00000204615.7:c.40C>G	3.37:g.184093777G>C	ENSP00000204615:p.Leu14Val		A1L3Y0|B7ZLR8|B9EGA8|Q13020|Q15790|Q15791|Q15792	Missense_Mutation	SNP	pfam_EPO_TPO,superfamily_4_helix_cytokine-like_core,prints_Thrombopoeitin	p.L14V	ENST00000204615.7	37	c.40	CCDS3265.1	3	.	.	.	.	.	.	.	.	.	.	G	9.661	1.144252	0.21205	.	.	ENSG00000090534	ENST00000204615;ENST00000445696;ENST00000421442;ENST00000353488	T;T;T	0.35048	1.36;1.33;1.36	4.19	3.3	0.37823	.	0.456574	0.16222	N	0.223982	T	0.25791	0.0628	L	0.27053	0.805	0.09310	N	0.999996	P;B;B;P;P;P	0.45957	0.793;0.346;0.235;0.869;0.869;0.793	B;B;B;B;P;B	0.44477	0.207;0.142;0.067;0.375;0.451;0.264	T	0.06127	-1.0844	10	0.12430	T	0.62	.	9.9829	0.41824	0.0:0.2049:0.7951:0.0	.	14;14;14;14;14;14	Q5FBX4;P40225-3;Q5FBX8;F8W6L1;P40225-2;P40225	.;.;.;.;.;TPO_HUMAN	V	14	ENSP00000204615:L14V;ENSP00000410763:L14V;ENSP00000411704:L14V	ENSP00000204615:L14V	L	-	1	2	THPO	185576471	1.000000	0.71417	0.603000	0.28903	0.954000	0.61252	1.761000	0.38440	0.942000	0.37525	0.467000	0.42956	CTA	THPO	-	pfam_EPO_TPO	ENSG00000090534		0.512	THPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THPO	HGNC	protein_coding	OTTHUMT00000345554.1	-	0.00	40	0	G	NM_000460		184093777	-1	tier1	-	no_errors	ENST00000204615	ensembl	human	known	74_37	missense	5.39	158	9	SNP	0.488	C
TLN1	7094	genome.wustl.edu	37	9	35707798	35707798	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr9:35707798G>T	ENST00000314888.9	-	35	4915	c.4562C>A	c.(4561-4563)gCc>gAc	p.A1521D	TLN1_ENST00000540444.1_Missense_Mutation_p.A1521D|TLN1_ENST00000464379.1_5'UTR	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1521	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTGGCGCTTGGCAGTAGGATT	0.542																																																	0													204.0	185.0	192.0					9																	35707798		2203	4300	6503	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4562C>A	9.37:g.35707798G>T	ENSP00000316029:p.Ala1521Asp		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.A1521D	ENST00000314888.9	37	c.4562	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.489373	0.96323	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.34275	1.37;1.37	5.62	5.62	0.85841	.	0.049077	0.85682	D	0.000000	T	0.65533	0.2700	M	0.83953	2.67	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.65763	-0.6089	10	0.44086	T	0.13	-14.9227	19.6415	0.95760	0.0:0.0:1.0:0.0	.	1521	Q9Y490	TLN1_HUMAN	D	1521	ENSP00000316029:A1521D;ENSP00000442981:A1521D	ENSP00000316029:A1521D	A	-	2	0	TLN1	35697798	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	9.864000	0.99589	2.651000	0.90000	0.561000	0.74099	GCC	TLN1	-	NULL	ENSG00000137076		0.542	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	-	0.00	75	0	G	NM_006289		35707798	-1	tier1	-	no_errors	ENST00000314888	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
TMCO5B	100652857	genome.wustl.edu	37	15	33534942	33534942	+	RNA	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr15:33534942G>T	ENST00000529696.1	-	0	0							A8MYB1	TMC5B_HUMAN	transmembrane and coiled-coil domains 5B, pseudogene							integral component of membrane (GO:0016021)											ACAGGACTCTGTTGACTTCTG	0.498																																																	0																																												0					15q13.3	2013-09-26	2010-09-29		ENSG00000215296	ENSG00000215296			34243	pseudogene	pseudogene			"""transmembrane and coiled-coil domains 5B"""				Standard	NR_046005		Approved		uc031qri.1	A8MYB1	OTTHUMG00000167569		15.37:g.33534942G>T				RNA	SNP	-	NULL	ENST00000529696.1	37	NULL		15																																																																																			TMCO5B	-	-	ENSG00000215296		0.498	TMCO5B-001	KNOWN	basic	processed_transcript	TMCO5B	HGNC	pseudogene	OTTHUMT00000395082.1		0.00	46	0	G			33534942	-1			no_errors	ENST00000529623	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.750	T
TNFRSF9	3604	genome.wustl.edu	37	1	7980985	7980986	+	Splice_Site	INS	-	-	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:7980985_7980986insA	ENST00000377507.3	-	8	846		c.e8-2			NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9						apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		TCATAAATGCTAAAAAAAAAAT	0.342																																																	0										6,4258		0,6,2126						6.2	1.0			83	12,8238		0,12,4113	no	splice-3	TNFRSF9	NM_001561.5		0,18,6239	A1A1,A1R,RR		0.1455,0.1407,0.1438				18,12496				SO:0001630	splice_region_variant	0			L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.680-2->T	1.37:g.7980995_7980995dupA				Splice_Site	INS	-	e7-2	ENST00000377507.3	37	c.680-3_680-2	CCDS92.1	1																																																																																			TNFRSF9	-	-	ENSG00000049249		0.342	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF9	HGNC	protein_coding	OTTHUMT00000003622.1		0.00	35	0	-		Intron	7980986	-1	tier1		no_errors	ENST00000377507	ensembl	human	known	74_37	splice_site_ins	10.71	25	3	INS	0.994:0.001	A
TNNT2	7139	genome.wustl.edu	37	1	201342324	201342324	+	Splice_Site	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:201342324G>T	ENST00000458432.2	-	3	123		c.e3+1		TNNT2_ENST00000367317.4_Intron|TNNT2_ENST00000367315.2_Intron|TNNT2_ENST00000509001.1_Intron|TNNT2_ENST00000367320.2_Intron|TNNT2_ENST00000236918.7_Intron|TNNT2_ENST00000367322.1_Intron|TNNT2_ENST00000367318.5_Intron|TNNT2_ENST00000360372.4_Intron|TNNT2_ENST00000421663.2_Splice_Site	NM_001276345.1	NP_001263274.1	P45379	TNNT2_HUMAN	troponin T type 2 (cardiac)						ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|positive regulation of ATPase activity (GO:0032781)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle thin filament (GO:0005865)|troponin complex (GO:0005861)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(9)	20						ACTCAGGCAAGATGCTCCAGA	0.552																																																	0													232.0	209.0	217.0					1																	201342324		2203	4300	6503	SO:0001630	splice_region_variant	0			X74819	CCDS30968.1, CCDS30969.1, CCDS60390.1, CCDS73002.1, CCDS73003.1	1q32	2014-09-17	2005-09-12		ENSG00000118194	ENSG00000118194			11949	protein-coding gene	gene with protein product		191045	"""troponin T2, cardiac"", ""cardiomyopathy, hypertrophic 2"", ""cardiomyopathy, dilated 1D (autosomal dominant)"""	CMH2, CMD1D		8088824, 8205619, 9482583	Standard	NM_001001430		Approved	CMPD2	uc001gwf.4	P45379	OTTHUMG00000035733	ENST00000458432.2:c.54+1C>A	1.37:g.201342324G>T			A2TDB9|A8K3K6|O60214|Q99596|Q99597|Q9BUF6|Q9UM96	Splice_Site	SNP	-	e2+1	ENST00000458432.2	37	c.54+1		1	.	.	.	.	.	.	.	.	.	.	G	6.996	0.554007	0.13374	.	.	ENSG00000118194	ENST00000458432;ENST00000421663	.	.	.	4.36	1.34	0.21922	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6868	0.12762	0.2035:0.1797:0.6167:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TNNT2	199608947	0.000000	0.05858	0.001000	0.08648	0.114000	0.19823	-0.172000	0.09868	0.168000	0.19655	0.655000	0.94253	.	TNNT2	-	-	ENSG00000118194		0.552	TNNT2-206	KNOWN	basic|appris_candidate_longest	protein_coding	TNNT2	HGNC	protein_coding			0.00	46	0	G	NM_000364	Intron	201342324	-1			no_errors	ENST00000458432	ensembl	human	known	74_37	splice_site	6.78	55	4	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7577018	7577018	+	Splice_Site	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:7577018C>T	ENST00000269305.4	-	8	1109		c.e8+1		TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(28)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTGCTTACCTCGCTTAGT	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(28)|Whole gene deletion(8)|Deletion - Frameshift(2)	lung(7)|breast(7)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|large_intestine(2)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|ovary(2)|biliary_tract(1)|endometrium(1)|urinary_tract(1)|skin(1)|oesophagus(1)|prostate(1)	GRCh37	CD920913	TP53	D							127.0	112.0	117.0					17																	7577018		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.919+1G>A	17.37:g.7577018C>T			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e7+1	ENST00000269305.4	37	c.919+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	9.710	1.156918	0.21454	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.81	3.84	0.44239	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.038	0.36300	0.0:0.9:0.0:0.1	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517743	1.000000	0.71417	0.939000	0.37840	0.223000	0.24884	4.456000	0.60081	1.259000	0.44117	0.561000	0.74099	.	TP53	-	-	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	54	0	C	NM_000546	Intron	7577018	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	66.23	26	51	SNP	0.976	T
TRAPPC11	60684	genome.wustl.edu	37	4	184580524	184580524	+	5'UTR	DEL	C	C	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:184580524delC	ENST00000334690.6	+	0	105				RWDD4_ENST00000512740.1_5'Flank|RWDD4_ENST00000326397.5_5'Flank|TRAPPC11_ENST00000357207.4_5'UTR|RWDD4_ENST00000327570.9_5'Flank|RWDD4_ENST00000510968.1_5'Flank	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11						vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											TCTGTGACATCCCCCCGCCTC	0.741																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.-98C>-	4.37:g.184580524delC			A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	RNA	DEL	-	NULL	ENST00000334690.6	37	NULL	CCDS34112.1	4																																																																																			TRAPPC11	-	-	ENSG00000168538		0.741	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC11	HGNC	protein_coding	OTTHUMT00000361654.2		0.00	19	0	C	NM_021942		184580524	+1	tier1		no_errors	ENST00000504526	ensembl	human	putative	74_37	rna	7.14	26	2	DEL	0.000	-
CFAP70	118491	genome.wustl.edu	37	10	75091010	75091010	+	Silent	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr10:75091010G>A	ENST00000310715.3	-	9	1032	c.912C>T	c.(910-912)tgC>tgT	p.C304C	TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000401621.2_Silent_p.C304C|TTC18_ENST00000394865.1_Silent_p.C304C|TTC18_ENST00000355577.3_5'UTR|TTC18_ENST00000340329.3_Intron	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		304						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					GCCAAAGCCGGCAATCGGCAA	0.378																																																	0													41.0	43.0	43.0					10																	75091010		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000310715.3:c.912C>T	10.37:g.75091010G>A			C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Silent	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.C304	ENST00000310715.3	37	c.912	CCDS7324.3	10																																																																																			TTC18	-	NULL	ENSG00000156042		0.378	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	HGNC	protein_coding			0.00	68	0	G			75091010	-1			no_errors	ENST00000310715	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179445305	179445305	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:179445305T>G	ENST00000591111.1	-	267	62102	c.61878A>C	c.(61876-61878)ttA>ttC	p.L20626F	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L19699F|TTN_ENST00000589042.1_Missense_Mutation_p.L22267F|TTN_ENST00000342175.6_Missense_Mutation_p.L13394F|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.L13202F|TTN-AS1_ENST00000586831.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L13327F|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20626					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGTCTTCCTTAAGTCCGCAT	0.388																																																	0													67.0	58.0	61.0					2																	179445305		1846	4089	5935	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.61878A>C	2.37:g.179445305T>G	ENSP00000465570:p.Leu20626Phe		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L19699F	ENST00000591111.1	37	c.59097		2	.	.	.	.	.	.	.	.	.	.	T	10.03	1.239280	0.22711	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65916	-0.18;0.04;-0.09;0.0	5.34	2.2	0.27929	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.68751	0.3035	L	0.61387	1.9	0.50467	D	0.999875	D;D;D;D	0.58268	0.982;0.982;0.982;0.967	P;P;P;P	0.60473	0.875;0.875;0.875;0.771	T	0.65903	-0.6055	9	0.87932	D	0	.	6.0579	0.19822	0.0:0.5624:0.1712:0.2664	.	13202;13327;13394;20626	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	19699;13202;13394;13327;13200	ENSP00000343764:L19699F;ENSP00000434586:L13202F;ENSP00000340554:L13394F;ENSP00000352154:L13327F	ENSP00000340554:L13394F	L	-	3	2	TTN	179153551	1.000000	0.71417	0.506000	0.27664	0.966000	0.64601	1.318000	0.33643	0.106000	0.17784	0.460000	0.39030	TTA	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	35	0	T	NM_133378		179445305	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	36.96	29	17	SNP	0.998	G
UCHL5	51377	genome.wustl.edu	37	1	192998780	192998780	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr1:192998780T>C	ENST00000367455.4	-	4	489	c.254A>G	c.(253-255)aAt>aGt	p.N85S	UCHL5_ENST00000367452.4_5'UTR|UCHL5_ENST00000530098.2_5'UTR|UCHL5_ENST00000367448.1_Missense_Mutation_p.N85S|UCHL5_ENST00000367451.4_Missense_Mutation_p.N85S|UCHL5_ENST00000367454.1_Missense_Mutation_p.N85S|UCHL5_ENST00000367449.1_Missense_Mutation_p.N85S	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	85					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						ACAAGCATTATTAATTACCTA	0.323																																																	0													26.0	26.0	26.0					1																	192998780		2200	4298	6498	SO:0001583	missense	0				CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.254A>G	1.37:g.192998780T>C	ENSP00000356425:p.Asn85Ser		Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Missense_Mutation	SNP	pfam_Peptidase_C12,pirsf_Ubiquitinyl_hydrolase_UCH37,prints_Peptidase_C12	p.N85S	ENST00000367455.4	37	c.254	CCDS1378.1	1	.	.	.	.	.	.	.	.	.	.	T	16.56	3.157168	0.57259	.	.	ENSG00000116750	ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451;ENST00000367448;ENST00000367449;ENST00000391991;ENST00000421683	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	5.67	5.67	0.87782	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (4);	0.000000	0.85682	D	0.000000	T	0.41903	0.1179	L	0.52905	1.665	0.80722	D	1	B;B;B;B	0.26041	0.049;0.097;0.045;0.14	B;B;B;B	0.29440	0.018;0.018;0.018;0.102	T	0.21518	-1.0243	9	.	.	.	-11.0012	16.1924	0.82000	0.0:0.0:0.0:1.0	.	85;85;85;85	Q9Y5K5-2;Q9Y5K5-4;Q9Y5K5-3;Q9Y5K5	.;.;.;UCHL5_HUMAN	S	85;85;97;85;85;85;75;76	ENSP00000356425:N85S;ENSP00000356424:N85S;ENSP00000356420:N97S;ENSP00000356421:N85S;ENSP00000356418:N85S;ENSP00000356419:N85S;ENSP00000389563:N76S	.	N	-	2	0	UCHL5	191265403	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.622000	0.83099	2.287000	0.76781	0.482000	0.46254	AAT	UCHL5	-	pfam_Peptidase_C12,pirsf_Ubiquitinyl_hydrolase_UCH37,prints_Peptidase_C12	ENSG00000116750		0.323	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UCHL5	HGNC	protein_coding	OTTHUMT00000086318.3	-	0.00	55	0	T	NM_015984		192998780	-1	tier1	-	no_errors	ENST00000367451	ensembl	human	known	74_37	missense	26.92	38	14	SNP	1.000	C
UMODL1	89766	genome.wustl.edu	37	21	43541293	43541293	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr21:43541293C>T	ENST00000408910.2	+	16	2786	c.2786C>T	c.(2785-2787)gCc>gTc	p.A929V	UMODL1_ENST00000400424.2_Missense_Mutation_p.A857V|UMODL1_ENST00000400427.1_Missense_Mutation_p.A985V|UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000408989.2_Missense_Mutation_p.A1057V	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	929	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GAGGGAGGAGCCCCCGACTTC	0.493																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												0													110.0	114.0	113.0					21																	43541293		1887	4102	5989	SO:0001583	missense	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.2786C>T	21.37:g.43541293C>T	ENSP00000386147:p.Ala929Val		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_ZP_dom,pfam_SEA_dom,pfam_EGF-like_Ca-bd_dom,pfam_EMI_domain,pfam_WAP-type_4-diS_core,superfamily_Fibronectin_type3,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_EGF-like_Ca-bd_dom,smart_Fibronectin_type3,smart_ZP_dom,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_ZP_dom,prints_ZP_dom	p.A1057V	ENST00000408910.2	37	c.3170	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	C	8.489	0.861490	0.17178	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	D;T;D;T	0.81579	-1.51;-0.53;-1.51;-0.53	3.55	-0.789	0.10935	Epidermal growth factor-like, type 3 (1);	1.390610	0.05046	N	0.477327	T	0.64260	0.2582	N	0.14661	0.345	0.09310	N	1	B;P	0.42161	0.047;0.772	B;B	0.43123	0.025;0.409	T	0.55263	-0.8168	9	.	.	.	-1.6511	0.4162	0.00449	0.3303:0.2845:0.1749:0.2102	.	1057;929	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	V	985;857;1057;929	ENSP00000383279:A985V;ENSP00000383276:A857V;ENSP00000386126:A1057V;ENSP00000386147:A929V	.	A	+	2	0	UMODL1	42414362	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.074000	0.11450	-0.143000	0.11334	0.449000	0.29647	GCC	UMODL1	-	smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	ENSG00000177398		0.493	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	-	0.00	74	0	C			43541293	+1	tier1	-	no_errors	ENST00000408989	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.000	T
USH1C	10083	genome.wustl.edu	37	11	17546007	17546007	+	Silent	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:17546007C>A	ENST00000318024.4	-	9	858	c.750G>T	c.(748-750)gtG>gtT	p.V250V	USH1C_ENST00000527720.1_Silent_p.V219V|USH1C_ENST00000005226.7_Silent_p.V250V|USH1C_ENST00000527020.1_Silent_p.V250V	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	250	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CCTCCAATCCCACCTCAGCAG	0.612																																																	0													53.0	45.0	48.0					11																	17546007		2197	4287	6484	SO:0001819	synonymous_variant	0			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.750G>T	11.37:g.17546007C>A			A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V250	ENST00000318024.4	37	c.750	CCDS31438.1	11																																																																																			USH1C	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000006611		0.612	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	HGNC	protein_coding	OTTHUMT00000389146.1	-	0.00	31	0	C	NM_005709		17546007	-1	tier1	-	no_errors	ENST00000005226	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.609	A
USP32P2	220594	genome.wustl.edu	37	17	18414580	18414580	+	RNA	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr17:18414580G>A	ENST00000425211.1	-	0	4689				USP32P2_ENST00000412260.1_RNA																							AGTACATAAAGGCATCCACAG	0.323																																																	0																																												0																															17.37:g.18414580G>A				RNA	SNP	-	NULL	ENST00000425211.1	37	NULL		17																																																																																			USP32P2	-	-	ENSG00000233327		0.323	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	USP32P2	HGNC	processed_transcript	OTTHUMT00000473021.1	-	0.00	42	0	G			18414580	-1	tier1	-	no_errors	ENST00000412260	ensembl	human	known	74_37	rna	17.46	52	11	SNP	0.784	A
UTP3	57050	genome.wustl.edu	37	4	71554872	71554874	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:71554872_71554874delGAG	ENST00000254803.2	+	1	677_679	c.478_480delGAG	c.(478-480)gagdel	p.E164del		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	164	Glu-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			ggaggaaagagaggaggaggagg	0.552																																																	0										25,4241		1,23,2109						-7.6	0.8			35	22,8232		0,22,4105	no	coding	UTP3	NM_020368.2		1,45,6214	A1A1,A1R,RR		0.2665,0.586,0.3754				47,12473				SO:0001651	inframe_deletion	0			AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.478_480delGAG	4.37:g.71554881_71554883delGAG	ENSP00000254803:p.Glu164del		Q6FI82	In_Frame_Del	DEL	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.E163in_frame_del	ENST00000254803.2	37	c.478_480	CCDS3546.1	4																																																																																			UTP3	-	NULL	ENSG00000132467		0.552	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	HGNC	protein_coding	OTTHUMT00000252163.2		0.00	27	0	GAG	NM_020368		71554874	+1	tier1		no_errors	ENST00000254803	ensembl	human	known	74_37	in_frame_del	6.67	28	2	DEL	1.000:1.000:1.000	-
VSX2	338917	genome.wustl.edu	37	14	74726335	74726335	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr14:74726335A>G	ENST00000261980.2	+	4	700	c.610A>G	c.(610-612)Agg>Ggg	p.R204G		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	204					cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		AGCCAAGTGGAGGAAGCGGGA	0.632																																																	0													114.0	96.0	102.0					14																	74726335		2203	4300	6503	SO:0001583	missense	0			AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.610A>G	14.37:g.74726335A>G	ENSP00000261980:p.Arg204Gly		A1A4X6	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.R204G	ENST00000261980.2	37	c.610	CCDS9827.1	14	.	.	.	.	.	.	.	.	.	.	A	19.65	3.866456	0.72065	.	.	ENSG00000119614	ENST00000261980	D	0.97642	-4.47	5.04	3.87	0.44632	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99233	0.9733	H	0.99903	4.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97786	1.0235	10	0.87932	D	0	.	11.6323	0.51183	0.6468:0.3532:0.0:0.0	.	204	P58304	VSX2_HUMAN	G	204	ENSP00000261980:R204G	ENSP00000261980:R204G	R	+	1	2	VSX2	73796088	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.484000	0.45242	0.915000	0.36847	0.533000	0.62120	AGG	VSX2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000119614		0.632	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX2	HGNC	protein_coding	OTTHUMT00000412323.1	-	0.00	67	0	A	NM_182894		74726335	+1	tier1	-	no_errors	ENST00000261980	ensembl	human	known	74_37	missense	18.97	47	11	SNP	1.000	G
VWCE	220001	genome.wustl.edu	37	11	61048524	61048524	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:61048524C>A	ENST00000335613.5	-	8	1357	c.971G>T	c.(970-972)cGa>cTa	p.R324L		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	324						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TGTGGGTAGTCGTGGGGTGGG	0.706																																																	0													31.0	35.0	34.0					11																	61048524		2201	4297	6498	SO:0001583	missense	0			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.971G>T	11.37:g.61048524C>A	ENSP00000334186:p.Arg324Leu		A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	pfam_VWF_C,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWF_C,smart_VWC_out,pfscan_EG-like_dom,pfscan_VWF_C	p.R324L	ENST00000335613.5	37	c.971	CCDS8002.1	11	.	.	.	.	.	.	.	.	.	.	C	2.148	-0.395210	0.04899	.	.	ENSG00000167992	ENST00000335613	T	0.68903	-0.36	5.51	-1.08	0.09936	.	0.959360	0.08605	N	0.920887	T	0.33614	0.0869	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16012	-1.0417	10	0.19590	T	0.45	.	5.5914	0.17303	0.286:0.2426:0.4714:0.0	.	324	Q96DN2	VWCE_HUMAN	L	324	ENSP00000334186:R324L	ENSP00000334186:R324L	R	-	2	0	VWCE	60805100	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.304000	0.08199	-0.487000	0.06735	-1.048000	0.02349	CGA	VWCE	-	NULL	ENSG00000167992		0.706	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	-	0.00	83	0	C	NM_152718		61048524	-1	tier1	-	no_errors	ENST00000335613	ensembl	human	known	74_37	missense	6.76	69	5	SNP	0.000	A
WDR87	83889	genome.wustl.edu	37	19	38376426	38376426	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:38376426T>C	ENST00000303868.5	-	6	7992	c.7768A>G	c.(7768-7770)Agt>Ggt	p.S2590G	WDR87_ENST00000447313.2_Missense_Mutation_p.S2629G	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	2590										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GACTGTCTACTTGAGATCCTT	0.468																																																	0													138.0	111.0	119.0					19																	38376426		692	1591	2283	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.7768A>G	19.37:g.38376426T>C	ENSP00000368025:p.Ser2590Gly		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S2629G	ENST00000303868.5	37	c.7885	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	T	1.402	-0.577893	0.03854	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.11169	2.8;2.8	1.57	-2.5	0.06384	.	.	.	.	.	T	0.05868	0.0153	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44574	-0.9319	9	0.16420	T	0.52	.	3.6554	0.08218	0.0:0.1749:0.4832:0.3419	.	2590;2629	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	G	2629;2590	ENSP00000405012:S2629G;ENSP00000368025:S2590G	ENSP00000368025:S2590G	S	-	1	0	WDR87	43068266	0.042000	0.20092	0.000000	0.03702	0.001000	0.01503	0.327000	0.19663	-0.939000	0.03709	-1.136000	0.01936	AGT	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.468	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	47	0	T	XM_940478		38376426	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	missense	32.73	37	18	SNP	0.000	C
WHSC1	7468	genome.wustl.edu	37	4	1961467	1961467	+	Splice_Site	SNP	G	G	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:1961467G>T	ENST00000382895.3	+	19	3686	c.3255G>T	c.(3253-3255)aaG>aaT	p.K1085N	WHSC1_ENST00000382891.5_Splice_Site_p.K1085N|WHSC1_ENST00000508803.1_Splice_Site_p.K1085N|WHSC1_ENST00000382892.2_Splice_Site_p.K1085N|WHSC1_ENST00000382888.3_Splice_Site_p.K433N|WHSC1_ENST00000482415.2_3'UTR	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1085	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.K1085N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		ACATCAGAAAGGTATGTGTCG	0.507			T	IGH@	MM																																			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	1	Substitution - Missense(1)	prostate(1)											75.0	73.0	74.0					4																	1961467		2203	4300	6503	SO:0001630	splice_region_variant	0			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3255+1G>T	4.37:g.1961467G>T			A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_box_dom,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_PWWP_dom,smart_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_box_dom	p.K1085N	ENST00000382895.3	37	c.3255	CCDS33940.1	4	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874693	0.72180	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82	5.23	4.37	0.52481	SET domain (3);	0.000000	0.56097	D	0.000031	D	0.93357	0.7882	M	0.91140	3.18	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.71656	0.972;0.974	D	0.94574	0.7773	10	0.72032	D	0.01	.	14.5338	0.67944	0.0724:0.0:0.9276:0.0	.	433;1085	A2A2T2;O96028	.;NSD2_HUMAN	N	1085;1085;1085;1085;433	ENSP00000423972:K1085N;ENSP00000372347:K1085N;ENSP00000372348:K1085N;ENSP00000372351:K1085N;ENSP00000372344:K433N	ENSP00000372344:K433N	K	+	3	2	WHSC1	1931265	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	5.536000	0.67180	1.296000	0.44742	0.655000	0.94253	AAG	WHSC1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000109685		0.507	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	HGNC	protein_coding	OTTHUMT00000366269.2		0.00	59	0	G	NM_133330	Missense_Mutation	1961467	+1			no_errors	ENST00000382891	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
XPO7	23039	genome.wustl.edu	37	8	21829470	21829470	+	Intron	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr8:21829470C>A	ENST00000252512.9	+	5	592				XPO7_ENST00000518017.1_Intron|XPO7_ENST00000434536.1_Missense_Mutation_p.F170L|XPO7_ENST00000433566.4_Intron	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7						mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CTACAGCCTTCCTCATTGAAG	0.358																																																	0													177.0	172.0	173.0					8																	21829470		1915	4131	6046	SO:0001627	intron_variant	0			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.492+18C>A	8.37:g.21829470C>A			O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F170L	ENST00000252512.9	37	c.510	CCDS47818.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.54|13.54	2.268710|2.268710	0.40095|0.40095	.|.	.|.	ENSG00000130227|ENSG00000130227	ENST00000434536|ENST00000521303	T|.	0.63744|.	-0.06|.	5.49|5.49	4.61|4.61	0.57282|0.57282	.|.	.|.	.|.	.|.	.|.	T|T	0.63721|0.63721	0.2535|0.2535	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.62586|0.62586	-0.6823|-0.6823	7|4	.|.	.|.	.|.	.|.	12.4482|12.4482	0.55664|0.55664	0.0:0.921:0.0:0.079|0.0:0.921:0.0:0.079	.|.	170|.	E9PEN8|.	.|.	L|Y	170|175	ENSP00000404853:F170L|.	.|.	F|S	+|+	3|2	2|0	XPO7|XPO7	21885416|21885416	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.129000|3.129000	0.50500|0.50500	1.453000|1.453000	0.47775|0.47775	0.655000|0.655000	0.94253|0.94253	TTC|TCC	XPO7	-	superfamily_ARM-type_fold	ENSG00000130227		0.358	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1	-	0.00	136	0	C	NM_015024		21829470	+1	tier1	-	no_errors	ENST00000434536	ensembl	human	known	74_37	missense	26.67	77	28	SNP	1.000	A
ZAP70	7535	genome.wustl.edu	37	2	98351150	98351150	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:98351150C>A	ENST00000264972.5	+	9	1272	c.1057C>A	c.(1057-1059)Cgc>Agc	p.R353S	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.R227S|ZAP70_ENST00000451498.2_Missense_Mutation_p.R46S	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	353	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						TGGCTCAGTGCGCCAGGGCGT	0.637																																																	0													131.0	110.0	117.0					2																	98351150		2203	4300	6503	SO:0001583	missense	0			L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.1057C>A	2.37:g.98351150C>A	ENSP00000264972:p.Arg353Ser		A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.R353S	ENST00000264972.5	37	c.1057	CCDS33254.1	2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944728	0.73672	.	.	ENSG00000115085	ENST00000264972;ENST00000442208;ENST00000451498	T;T;T	0.62105	0.05;0.05;0.05	5.41	5.41	0.78517	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.174518	0.27068	N	0.021081	T	0.48077	0.1480	N	0.17564	0.495	0.33825	D	0.62953	P;P	0.52463	0.953;0.921	B;P	0.44422	0.423;0.449	T	0.60495	-0.7252	10	0.38643	T	0.18	.	12.0812	0.53671	0.1718:0.8281:0.0:0.0	.	227;353	P43403-3;P43403	.;ZAP70_HUMAN	S	353;227;46	ENSP00000264972:R353S;ENSP00000411141:R227S;ENSP00000400475:R46S	ENSP00000264972:R353S	R	+	1	0	ZAP70	97717582	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	2.655000	0.46707	2.723000	0.93209	0.655000	0.94253	CGC	ZAP70	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_Prot_kinase_dom	ENSG00000115085		0.637	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAP70	HGNC	protein_coding	OTTHUMT00000329278.1		0.00	41	0	C			98351150	+1			no_errors	ENST00000264972	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
ZDHHC17	23390	genome.wustl.edu	37	12	77243230	77243230	+	Silent	SNP	G	G	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr12:77243230G>A	ENST00000426126.2	+	16	2389	c.1740G>A	c.(1738-1740)acG>acA	p.T580T	ZDHHC17_ENST00000334822.5_Silent_p.T580T	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	580					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						TCACAACAACGTCTATTGAAA	0.294																																																	0													55.0	53.0	54.0					12																	77243230		1808	4057	5865	SO:0001819	synonymous_variant	0			AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.1740G>A	12.37:g.77243230G>A			B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Silent	SNP	pfam_Ankyrin_rpt,pfam_Znf_DHHC_palmitoyltrfase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_DHHC_palmitoyltrfase,prints_Ankyrin_rpt	p.T580	ENST00000426126.2	37	c.1740	CCDS44946.1	12																																																																																			ZDHHC17	-	NULL	ENSG00000186908		0.294	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC17	HGNC	protein_coding	OTTHUMT00000406555.1	-	0.00	217	0	G	NM_015336		77243230	+1	tier1	-	no_errors	ENST00000334822	ensembl	human	known	74_37	silent	19.05	170	40	SNP	1.000	A
ZFYVE28	57732	genome.wustl.edu	37	4	2306902	2306902	+	Missense_Mutation	SNP	G	G	T	rs146433050	byFrequency	TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr4:2306902G>T	ENST00000290974.2	-	8	1504	c.1165C>A	c.(1165-1167)Cgc>Agc	p.R389S	ZFYVE28_ENST00000511071.1_Missense_Mutation_p.R359S|ZFYVE28_ENST00000515312.1_Missense_Mutation_p.R319S|RP11-478C1.7_ENST00000510632.1_RNA	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	389					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						GACCGCAGGCGCGGTCTACCT	0.682																																																	0													43.0	42.0	42.0					4																	2306902		2203	4296	6499	SO:0001583	missense	0			AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.1165C>A	4.37:g.2306902G>T	ENSP00000290974:p.Arg389Ser		B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.R389S	ENST00000290974.2	37	c.1165	CCDS33942.1	4	.	.	.	.	.	.	.	.	.	.	G	8.276	0.814534	0.16607	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312	T;T;T	0.58940	0.3;0.3;0.3	5.18	0.693	0.18056	.	0.983418	0.08333	N	0.961977	T	0.50922	0.1644	L	0.51422	1.61	0.09310	N	1	B;B	0.30634	0.288;0.19	B;B	0.29524	0.103;0.048	T	0.46978	-0.9152	10	0.66056	D	0.02	.	9.7605	0.40530	0.0:0.1969:0.518:0.2851	.	359;389	Q9HCC9-2;Q9HCC9	.;LST2_HUMAN	S	389;359;319	ENSP00000290974:R389S;ENSP00000425706:R359S;ENSP00000426299:R319S	ENSP00000290974:R389S	R	-	1	0	ZFYVE28	2276700	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.289000	0.08365	0.175000	0.19841	0.405000	0.27470	CGC	ZFYVE28	-	NULL	ENSG00000159733		0.682	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE28	HGNC	protein_coding	OTTHUMT00000360078.1		0.00	54	0	G	XM_035371		2306902	-1			no_errors	ENST00000290974	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
ZIC4	84107	genome.wustl.edu	37	3	147120551	147120551	+	Nonsense_Mutation	SNP	G	G	A	rs201698839		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr3:147120551G>A	ENST00000383075.3	-	2	546	c.34C>T	c.(34-36)Cga>Tga	p.R12*	ZIC4_ENST00000491672.1_Nonsense_Mutation_p.R12*|ZIC4_ENST00000473123.1_Nonsense_Mutation_p.R12*|ZIC4_ENST00000425731.3_Nonsense_Mutation_p.R50*|ZIC4_ENST00000484399.1_Nonsense_Mutation_p.R12*|ZIC4_ENST00000525172.2_Nonsense_Mutation_p.R62*	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	12						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R12*(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AGCCGTAATCGTTTCCTCATC	0.358																																																	1	Substitution - Nonsense(1)	large_intestine(1)						G	stop/ARG,stop/ARG,stop/ARG	0,3748		0,0,1874	161.0	147.0	151.0		184,148,34	4.1	1.0	3		151	2,8192		0,2,4095	yes	stop-gained,stop-gained,stop-gained	ZIC4	NM_001168378.1,NM_001168379.1,NM_032153.5	,,	0,2,5969	AA,AG,GG		0.0244,0.0,0.0167	,,	62/385,50/373,12/335	147120551	2,11940	1874	4097	5971	SO:0001587	stop_gained	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.34C>T	3.37:g.147120551G>A	ENSP00000372553:p.Arg12*		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R62*	ENST00000383075.3	37	c.184	CCDS43160.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.583642	0.96578	0.0	2.44E-4	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672;ENST00000462748;ENST00000484586;ENST00000463250	.	.	.	6.06	4.09	0.47781	.	0.000000	0.36591	N	0.002501	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7516	0.57312	0.0:0.0:0.4131:0.5869	.	.	.	.	X	12;50;62;12;12;12;12;12;12	.	ENSP00000372553:R12X	R	-	1	2	ZIC4	148603241	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	1.399000	0.34566	1.532000	0.49169	0.655000	0.94253	CGA	ZIC4	-	NULL	ENSG00000174963		0.358	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	83	0	G			147120551	-1	tier1	rs201698839	no_errors	ENST00000525172	ensembl	human	known	74_37	nonsense	10.78	207	25	SNP	1.000	A
ZIK1	284307	genome.wustl.edu	37	19	58099957	58099957	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:58099957G>C	ENST00000597850.1	+	3	338	c.123G>C	c.(121-123)tgG>tgC	p.W41C	ZIK1_ENST00000307468.4_Intron|ZIK1_ENST00000599456.1_5'UTR|ZIK1_ENST00000598726.1_3'UTR|ZIK1_ENST00000536878.2_Missense_Mutation_p.W28C	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	41	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGGACGAGTGGGGACTTCTTG	0.517																																																	0													266.0	208.0	227.0					19																	58099957		2203	4300	6503	SO:0001583	missense	0			AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.123G>C	19.37:g.58099957G>C	ENSP00000472867:p.Trp41Cys		O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.W41C	ENST00000597850.1	37	c.123	CCDS33135.1	19	.	.	.	.	.	.	.	.	.	.	g	15.13	2.740655	0.49045	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.10288	2.89	3.3	2.25	0.28309	Krueppel-associated box (4);	.	.	.	.	T	0.43010	0.1228	H	0.96943	3.91	0.52099	D	0.999946	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.53049	-0.8493	9	0.87932	D	0	.	9.447	0.38703	0.1117:0.0:0.8883:0.0	.	28;41	F5H435;Q3SY52	.;ZIK1_HUMAN	C	28;22;41	ENSP00000438487:W28C	ENSP00000303820:W41C	W	+	3	0	ZIK1	62791769	0.997000	0.39634	0.542000	0.28115	0.989000	0.77384	3.250000	0.51445	0.713000	0.32060	0.442000	0.29010	TGG	ZIK1	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000171649		0.517	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZIK1	HGNC	protein_coding	OTTHUMT00000466791.1	-	0.00	73	0	G	NM_001010879		58099957	+1	tier1	-	no_errors	ENST00000597850	ensembl	human	known	74_37	missense	5.88	112	7	SNP	0.949	C
ZNF142	7701	genome.wustl.edu	37	2	219505483	219505483	+	Missense_Mutation	SNP	G	G	A	rs367658234		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr2:219505483G>A	ENST00000449707.1	-	9	4919	c.4498C>T	c.(4498-4500)Cgg>Tgg	p.R1500W	ZNF142_ENST00000411696.2_Missense_Mutation_p.R1500W	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TTGTGGATCCGCATGTGGTAC	0.448																																					Colon(170;867 1942 8995 15834 18053)												0								G	TRP/ARG	1,4025		0,1,2012	97.0	97.0	97.0		4498	1.9	1.0	2		97	0,8378		0,0,4189	no	missense	ZNF142	NM_001105537.1	101	0,1,6201	AA,AG,GG		0.0,0.0248,0.0081	probably-damaging	1500/1688	219505483	1,12403	2013	4189	6202	SO:0001583	missense	0			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.4498C>T	2.37:g.219505483G>A	ENSP00000408643:p.Arg1500Trp		Q92510	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1500W	ENST00000449707.1	37	c.4498	CCDS42817.1	2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044053	0.75732	2.48E-4	0.0	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.25579	1.79;1.79	5.94	1.88	0.25563	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.048032	0.85682	D	0.000000	T	0.57403	0.2051	M	0.89968	3.075	0.50813	D	0.999894	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67373	-0.5687	10	0.87932	D	0	-30.7738	15.6004	0.76620	0.0:0.0:0.4981:0.5019	.	1500;1337	P52746;A8MWU9	ZN142_HUMAN;.	W	1500	ENSP00000408643:R1500W;ENSP00000398798:R1500W	ENSP00000398798:R1500W	R	-	1	2	ZNF142	219213727	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	3.259000	0.51515	0.051000	0.15978	-0.188000	0.12872	CGG	ZNF142	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000115568		0.448	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	HGNC	protein_coding	OTTHUMT00000336833.1	-	0.00	60	0	G	NM_005081		219505483	-1	tier1	-	no_errors	ENST00000411696	ensembl	human	known	74_37	missense	13.33	52	8	SNP	1.000	A
ZNF214	7761	genome.wustl.edu	37	11	7021809	7021809	+	Missense_Mutation	SNP	G	G	A	rs547254936		TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr11:7021809G>A	ENST00000278314.4	-	3	1420	c.1105C>T	c.(1105-1107)Cgg>Tgg	p.R369W	ZNF214_ENST00000531083.1_5'Flank|ZNF214_ENST00000536068.1_Missense_Mutation_p.R369W	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	369					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		ACTGAACTCCGATTAAAACTC	0.393																																					Ovarian(22;251 657 736 21522 46864)												0													94.0	97.0	96.0					11																	7021809		2201	4294	6495	SO:0001583	missense	0			AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.1105C>T	11.37:g.7021809G>A	ENSP00000278314:p.Arg369Trp		B2R8Q1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R369W	ENST00000278314.4	37	c.1105	CCDS31418.1	11	.	.	.	.	.	.	.	.	.	.	G	10.76	1.440990	0.25900	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.36520	1.25;1.25	3.44	3.44	0.39384	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.215125	0.23807	N	0.044371	T	0.22205	0.0535	N	0.16307	0.4	0.26765	N	0.969922	B	0.23377	0.084	B	0.15052	0.012	T	0.11941	-1.0567	10	0.33141	T	0.24	.	13.182	0.59660	0.0:0.0:1.0:0.0	.	369	Q9UL59	ZN214_HUMAN	W	369	ENSP00000278314:R369W;ENSP00000445373:R369W	ENSP00000278314:R369W	R	-	1	2	ZNF214	6978385	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	-0.193000	0.09573	2.225000	0.72522	0.655000	0.94253	CGG	ZNF214	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000149050		0.393	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF214	HGNC	protein_coding	OTTHUMT00000385349.1	-	0.00	72	0	G			7021809	-1	tier1	-	no_errors	ENST00000278314	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.976	A
ZNF300	91975	genome.wustl.edu	37	5	150276160	150276160	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr5:150276160T>G	ENST00000274599.5	-	6	1061	c.641A>C	c.(640-642)cAg>cCg	p.Q214P	ZNF300_ENST00000418587.2_Missense_Mutation_p.Q178P|ZNF300_ENST00000446148.2_Missense_Mutation_p.Q230P|ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000394226.2_Missense_Mutation_p.Q214P	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCAAAACTCTGATCAGGTTT	0.338																																																	0													73.0	77.0	76.0					5																	150276160		2203	4296	6499	SO:0001583	missense	0			AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.641A>C	5.37:g.150276160T>G	ENSP00000274599:p.Gln214Pro		A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q230P	ENST00000274599.5	37	c.689	CCDS4311.2	5	.	.	.	.	.	.	.	.	.	.	T	1.633	-0.518530	0.04171	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.08458	3.16;3.16;3.09;3.17	3.04	3.04	0.35103	.	.	.	.	.	T	0.07052	0.0179	L	0.32530	0.975	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21690	-1.0238	9	0.72032	D	0.01	.	6.3845	0.21554	0.0:0.0:0.2541:0.7458	.	214	Q96RE9	ZN300_HUMAN	P	230;214;178;214	ENSP00000397178:Q230P;ENSP00000274599:Q214P;ENSP00000392593:Q178P;ENSP00000377773:Q214P	ENSP00000274599:Q214P	Q	-	2	0	ZNF300	150256353	0.238000	0.23825	0.039000	0.18376	0.008000	0.06430	1.451000	0.35145	1.634000	0.50500	0.455000	0.32223	CAG	ZNF300	-	NULL	ENSG00000145908		0.338	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF300	HGNC	protein_coding		-	0.00	74	0	T	NM_052860		150276160	-1	tier1	-	no_errors	ENST00000446148	ensembl	human	known	74_37	missense	28.42	68	27	SNP	0.001	G
ZNF540	163255	genome.wustl.edu	37	19	38103282	38103282	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:38103282T>A	ENST00000592533.1	+	5	1433	c.1101T>A	c.(1099-1101)agT>agA	p.S367R	ZNF540_ENST00000316433.4_Missense_Mutation_p.S367R|ZNF540_ENST00000589117.1_Missense_Mutation_p.S335R|ZNF540_ENST00000343599.5_Missense_Mutation_p.S367R	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	367					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTAGACTTAGTTTTTACCTTA	0.393																																																	0													74.0	73.0	73.0					19																	38103282		2203	4300	6503	SO:0001583	missense	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1101T>A	19.37:g.38103282T>A	ENSP00000466274:p.Ser367Arg		A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S367R	ENST00000592533.1	37	c.1101	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	T	9.520	1.108150	0.20714	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.15372	2.43	2.39	-3.36	0.04913	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08403	0.0209	L	0.33792	1.035	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.04013	0.001;0.001	T	0.41124	-0.9526	9	0.17369	T	0.5	.	0.4864	0.00557	0.2895:0.2288:0.2929:0.1888	.	335;367	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	R	367;335	ENSP00000324598:S367R	ENSP00000324598:S367R	S	+	3	2	ZNF540	42795122	0.000000	0.05858	0.000000	0.03702	0.899000	0.52679	-3.904000	0.00338	-0.805000	0.04404	0.254000	0.18369	AGT	ZNF540	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171817		0.393	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	-	0.00	77	0	T	NM_152606		38103282	+1	tier1	-	no_errors	ENST00000316433	ensembl	human	known	74_37	missense	20.90	53	14	SNP	0.000	A
ZNF688	146542	genome.wustl.edu	37	16	30581404	30581404	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:30581404T>C	ENST00000223459.6	-	3	1768	c.664A>G	c.(664-666)Agg>Ggg	p.R222G	AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000395219.1_Missense_Mutation_p.R208G|AC002310.7_ENST00000486926.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						GCGAACTTCCTCTTGAAGCGC	0.716																																																	0													14.0	17.0	16.0					16																	30581404		2189	4284	6473	SO:0001583	missense	0			AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.664A>G	16.37:g.30581404T>C	ENSP00000223459:p.Arg222Gly		A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R222G	ENST00000223459.6	37	c.664	CCDS10684.1	16	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459712	0.63401	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.19806	2.12;2.12	4.42	3.23	0.37069	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35393	0.0930	L	0.53729	1.69	0.30151	N	0.803052	D;D	0.76494	0.999;0.991	D;D	0.83275	0.996;0.991	T	0.09818	-1.0657	9	0.27785	T	0.31	.	7.5329	0.27693	0.0:0.0:0.2191:0.7809	.	222;208	P0C7X2;A8MV39	ZN688_HUMAN;.	G	208;222	ENSP00000378645:R208G;ENSP00000223459:R222G	ENSP00000223459:R222G	R	-	1	2	ZNF688	30488905	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.424000	0.34848	1.974000	0.57490	0.383000	0.25322	AGG	ZNF688	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000229809		0.716	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF688	HGNC	protein_coding	OTTHUMT00000255544.2	-	0.00	35	0	T	NM_145271		30581404	-1	tier1	-	no_errors	ENST00000223459	ensembl	human	known	74_37	missense	18.37	40	9	SNP	1.000	C
ZNF720	124411	genome.wustl.edu	37	16	31766875	31766875	+	Intron	SNP	A	A	T			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr16:31766875A>T	ENST00000316491.9	+	4	560				ZNF720_ENST00000539915.1_Intron|ZNF720_ENST00000399681.3_Silent_p.I421I|ZNF720_ENST00000534369.1_Intron|ZNF720_ENST00000531864.2_Intron	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						AACCATATATATGTAAGGATT	0.368																																																	0																																										SO:0001627	intron_variant	0			AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.361+1654A>T	16.37:g.31766875A>T			Q6ZQX1	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I421	ENST00000316491.9	37	c.1263	CCDS45473.1	16																																																																																			ZNF720	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197302		0.368	ZNF720-001	KNOWN	basic|CCDS	protein_coding	ZNF720	HGNC	protein_coding	OTTHUMT00000394883.3	-	0.00	85	0	A	NM_001004300		31766875	+1	tier1	-	no_errors	ENST00000399681	ensembl	human	known	74_37	silent	50.00	36	36	SNP	0.016	T
ZNF726	730087	genome.wustl.edu	37	19	24116358	24116358	+	Silent	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:24116358C>A	ENST00000594466.1	+	4	1545	c.1440C>A	c.(1438-1440)ccC>ccA	p.P480P	ZNF726_ENST00000322487.7_Silent_p.P480P|ZNF726_ENST00000334589.5_Intron|CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Intron	NM_001244038.1	NP_001230967.1	A6NNF4	ZN726_HUMAN	zinc finger protein 726	480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAGAGAAACCCTACAAATGTG	0.403																																																	0																																										SO:0001819	synonymous_variant	0			DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000594466.1:c.1440C>A	19.37:g.24116358C>A			M0R0X8|Q86Y87	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P480	ENST00000594466.1	37	c.1440	CCDS59372.1	19																																																																																			ZNF726	-	pfscan_Znf_C2H2	ENSG00000213967		0.403	ZNF726-005	PUTATIVE	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF726	HGNC	protein_coding	OTTHUMT00000466443.1	-	0.00	63	0	C	XM_001715134		24116358	+1	tier1	-	no_errors	ENST00000322487	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.081	A
ZNF726	730087	genome.wustl.edu	37	19	24116740	24116740	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr19:24116740C>A	ENST00000594466.1	+	4	1927	c.1822C>A	c.(1822-1824)Ctt>Att	p.L608I	ZNF726_ENST00000322487.7_Missense_Mutation_p.L608I|ZNF726_ENST00000334589.5_Intron|CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Intron	NM_001244038.1	NP_001230967.1	A6NNF4	ZN726_HUMAN	zinc finger protein 726	608					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTCCTCAACCCTTTTTAAGCA	0.363																																																	0																																										SO:0001583	missense	0			DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000594466.1:c.1822C>A	19.37:g.24116740C>A	ENSP00000471516:p.Leu608Ile		M0R0X8|Q86Y87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L608I	ENST00000594466.1	37	c.1822	CCDS59372.1	19	.	.	.	.	.	.	.	.	.	.	c	9.923	1.212811	0.22289	.	.	ENSG00000213967	ENST00000322487	T	0.27104	1.69	0.814	-0.526	0.11913	.	.	.	.	.	T	0.23370	0.0565	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31308	-0.9948	6	0.72032	D	0.01	.	4.5028	0.11872	0.0:0.6812:0.0:0.3188	.	.	.	.	I	608	ENSP00000317125:L608I	ENSP00000317125:L608I	L	+	1	0	ZNF726	23908580	0.000000	0.05858	0.334000	0.25495	0.454000	0.32378	0.085000	0.14912	0.183000	0.20059	0.186000	0.17326	CTT	ZNF726	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213967		0.363	ZNF726-005	PUTATIVE	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF726	HGNC	protein_coding	OTTHUMT00000466443.1	-	0.00	88	0	C	XM_001715134		24116740	+1	tier1	-	no_errors	ENST00000322487	ensembl	human	known	74_37	missense	43.27	59	45	SNP	0.004	A
ZNF804B	219578	genome.wustl.edu	37	7	88965181	88965181	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RC-01B-11D-A403-09	TCGA-V5-A7RC-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b77ba28d-ff74-47a9-a811-7349c5b0214b	028aacf0-76b0-49a8-a1e8-d1d8205dd9f0	g.chr7:88965181C>G	ENST00000333190.4	+	4	3494	c.2885C>G	c.(2884-2886)cCa>cGa	p.P962R		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	962							metal ion binding (GO:0046872)	p.P962L(1)|p.P962Q(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TCGCAAGTCCCATGCACAATT	0.388										HNSCC(36;0.09)																																							2	Substitution - Missense(2)	lung(2)											114.0	115.0	115.0					7																	88965181		2203	4300	6503	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2885C>G	7.37:g.88965181C>G	ENSP00000329638:p.Pro962Arg		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.P962R	ENST00000333190.4	37	c.2885	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	C	0.041	-1.282901	0.01398	.	.	ENSG00000182348	ENST00000333190	T	0.04758	3.56	5.34	0.244	0.15507	.	0.393600	0.24476	N	0.038181	T	0.02083	0.0065	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.45906	-0.9229	10	0.22706	T	0.39	-0.299	4.835	0.13460	0.3735:0.4483:0.0681:0.1101	.	962	A4D1E1	Z804B_HUMAN	R	962	ENSP00000329638:P962R	ENSP00000329638:P962R	P	+	2	0	ZNF804B	88803117	0.131000	0.22433	0.000000	0.03702	0.070000	0.16714	1.579000	0.36536	-0.098000	0.12285	-0.274000	0.10170	CCA	ZNF804B	-	NULL	ENSG00000182348		0.388	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2		0.00	53	0	C	NM_181646		88965181	+1			no_errors	ENST00000333190	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.001	G
