#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AATF	26574	genome.wustl.edu	37	17	35310415	35310415	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:35310415G>T	ENST00000225402.5	+	3	764	c.513G>T	c.(511-513)gaG>gaT	p.E171D		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	171	Glu-rich.				apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				GGAGCAGTGAGGAGGAGGAAG	0.522																																					NSCLC(49;901 1159 19183 41572 46244)												0													157.0	144.0	148.0					17																	35310415		2203	4300	6503	SO:0001583	missense	0			AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.513G>T	17.37:g.35310415G>T	ENSP00000225402:p.Glu171Asp		A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Missense_Mutation	SNP	pfam_AATF_C	p.E171D	ENST00000225402.5	37	c.513	CCDS32632.1	17	.	.	.	.	.	.	.	.	.	.	G	6.760	0.509065	0.12883	.	.	ENSG00000108270	ENST00000225402	T	0.39056	1.1	5.8	2.61	0.31194	.	0.246542	0.48286	N	0.000194	T	0.29684	0.0741	L	0.46157	1.445	0.36527	D	0.870522	B	0.10296	0.003	B	0.09377	0.004	T	0.17379	-1.0371	10	0.10377	T	0.69	-9.8874	8.4014	0.32588	0.0728:0.0:0.4642:0.463	.	171	Q9NY61	AATF_HUMAN	D	171	ENSP00000225402:E171D	ENSP00000225402:E171D	E	+	3	2	AATF	32384528	0.015000	0.18098	0.995000	0.50966	0.901000	0.52897	-0.410000	0.07151	0.787000	0.33731	0.655000	0.94253	GAG	AATF	-	NULL	ENSG00000108270		0.522	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AATF	HGNC	protein_coding	OTTHUMT00000451543.1	-	0.00	68	0	G	NM_012138		35310415	+1	tier1	-	no_errors	ENST00000225402	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
ABCA13	154664	genome.wustl.edu	37	7	48564007	48564007	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:48564007G>T	ENST00000435803.1	+	54	14239	c.14215G>T	c.(14215-14217)Gat>Tat	p.D4739Y	ABCA13_ENST00000544596.1_Missense_Mutation_p.D469Y	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4739	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGCTGTGCAAGATATTAGTTT	0.368																																																	0													95.0	94.0	94.0					7																	48564007		1818	4084	5902	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14215G>T	7.37:g.48564007G>T	ENSP00000411096:p.Asp4739Tyr		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.D4739Y	ENST00000435803.1	37	c.14215	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	14.76	2.631166	0.46944	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.48522	0.81;0.81;0.81	5.52	4.64	0.57946	ABC transporter-like (1);	0.240170	0.29059	N	0.013261	T	0.64011	0.2560	M	0.79805	2.47	0.09310	N	1	P;D;D	0.67145	0.898;0.995;0.996	P;P;P	0.62560	0.789;0.904;0.862	T	0.59332	-0.7474	10	0.72032	D	0.01	.	8.3453	0.32270	0.1865:0.0:0.8135:0.0	.	469;2441;4739	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	Y	4739;512;469	ENSP00000411096:D4739Y;ENSP00000391042:D512Y;ENSP00000442634:D469Y	ENSP00000391042:D512Y	D	+	1	0	ABCA13	48534553	0.122000	0.22280	0.026000	0.17262	0.696000	0.40369	3.220000	0.51207	1.439000	0.47511	0.655000	0.94253	GAT	ABCA13	-	superfamily_P-loop_NTPase,pfscan_ABC_transporter-like	ENSG00000179869		0.368	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2		0.00	79	0	G	NM_152701		48564007	+1			no_errors	ENST00000435803	ensembl	human	known	74_37	missense	5.26	53	3	SNP	0.091	T
ABCC4	10257	genome.wustl.edu	37	13	95887085	95887085	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr13:95887085delT	ENST00000376887.4	-	4	424	c.310delA	c.(310-312)agtfs	p.S104fs	ABCC4_ENST00000412704.1_Frame_Shift_Del_p.S104fs|ABCC4_ENST00000536256.1_Intron|ABCC4_ENST00000431522.1_Frame_Shift_Del_p.S104fs|ABCC4_ENST00000538287.1_3'UTR	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	104	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	ACTTTGGCACTTTCCTAAAAG	0.333																																																	0													9.0	10.0	10.0					13																	95887085		2157	4256	6413	SO:0001589	frameshift_variant	0			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.310delA	13.37:g.95887085delT	ENSP00000366084:p.Ser104fs		A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Frame_Shift_Del	DEL	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM	p.S104fs	ENST00000376887.4	37	c.310	CCDS9474.1	13																																																																																			ABCC4	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM	ENSG00000125257		0.333	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	HGNC	protein_coding	OTTHUMT00000045478.2		0.00	49	0	T	NM_005845		95887085	-1	tier1		no_errors	ENST00000376887	ensembl	human	known	74_37	frame_shift_del	13.33	13	2	DEL	0.001	-
ABCD2	225	genome.wustl.edu	37	12	39973422	39973422	+	Splice_Site	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:39973422C>T	ENST00000308666.3	-	8	1928		c.e8-1			NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2						fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						GCATCCCATCCTTAAGaaaat	0.318																																																	0													111.0	109.0	110.0					12																	39973422		2203	4300	6503	SO:0001630	splice_region_variant	0			U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.1793-1G>A	12.37:g.39973422C>T			B2RAM3|Q13210|Q2M3H9	Splice_Site	SNP	-	e8-1	ENST00000308666.3	37	c.1793-1	CCDS8734.1	12	.	.	.	.	.	.	.	.	.	.	C	25.1	4.600347	0.87055	.	.	ENSG00000173208	ENST00000308666	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8662	0.92293	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCD2	38259689	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	7.520000	0.81821	2.459000	0.83118	0.579000	0.79373	.	ABCD2	-	-	ENSG00000173208		0.318	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD2	HGNC	protein_coding	OTTHUMT00000403591.1	-	0.00	39	0	C	NM_005164	Intron	39973422	-1	tier1	-	no_errors	ENST00000308666	ensembl	human	known	74_37	splice_site	25.00	32	11	SNP	1.000	T
ABCF3	55324	genome.wustl.edu	37	3	183910411	183910411	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr3:183910411A>G	ENST00000429586.2	+	17	1777	c.1592A>G	c.(1591-1593)aAg>aGg	p.K531R	EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Missense_Mutation_p.K525R	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	531	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGGGCTGGGAAGTCTACCATG	0.517																																																	0													54.0	51.0	52.0					3																	183910411		2203	4300	6503	SO:0001583	missense	0			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1592A>G	3.37:g.183910411A>G	ENSP00000411471:p.Lys531Arg		A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K531R	ENST00000429586.2	37	c.1592	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	A	21.5	4.159692	0.78226	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.98044	-4.68;-4.68	5.41	5.41	0.78517	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.045636	0.85682	D	0.000000	D	0.99269	0.9745	H	0.98314	4.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98645	1.0677	10	0.87932	D	0	-21.8234	14.6933	0.69101	1.0:0.0:0.0:0.0	.	525;531	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	R	531;525	ENSP00000411471:K531R;ENSP00000292808:K525R	ENSP00000292808:K525R	K	+	2	0	ABCF3	185393105	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	8.962000	0.93254	2.056000	0.61249	0.529000	0.55759	AAG	ABCF3	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000161204		0.517	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	HGNC	protein_coding	OTTHUMT00000346047.1	-	0.00	46	0	A	NM_018358		183910411	+1	tier1	-	no_errors	ENST00000429586	ensembl	human	known	74_37	missense	25.42	44	15	SNP	1.000	G
ACAN	176	genome.wustl.edu	37	15	89391161	89391161	+	Silent	SNP	C	C	A	rs143697605		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:89391161C>A	ENST00000561243.1	+	8	1624	c.1624C>A	c.(1624-1626)Cgg>Agg	p.R542R	ACAN_ENST00000559004.1_Silent_p.R542R|ACAN_ENST00000352105.7_Silent_p.R542R|ACAN_ENST00000439576.2_Silent_p.R542R|ACAN_ENST00000558207.1_Silent_p.R542R			P16112	PGCA_HUMAN	aggrecan	542	G2-B.|Link 3. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.R542W(1)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TGTGAGCCCCCGGACCCCATG	0.607																																																	1	Substitution - Missense(1)	large_intestine(1)											72.0	75.0	74.0					15																	89391161		1949	4147	6096	SO:0001819	synonymous_variant	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.1624C>A	15.37:g.89391161C>A			Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.R542	ENST00000561243.1	37	c.1624	CCDS53970.1	15																																																																																			ACAN	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link	ENSG00000157766		0.607	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2		0.00	49	0	C	NM_001135		89391161	+1			no_errors	ENST00000439576	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.689	A
ANGEL2	90806	genome.wustl.edu	37	1	213181560	213181560	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:213181560C>G	ENST00000366962.3	-	3	788	c.634G>C	c.(634-636)Gat>Cat	p.D212H	ANGEL2_ENST00000544555.1_Missense_Mutation_p.D43H|ANGEL2_ENST00000535388.1_Missense_Mutation_p.D43H|ANGEL2_ENST00000360506.2_Missense_Mutation_p.D43H|ANGEL2_ENST00000540642.1_Missense_Mutation_p.D86H	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	212										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		ACGTCTGCATCAAAATGTTTA	0.403																																																	0													35.0	37.0	36.0					1																	213181560		2203	4300	6503	SO:0001583	missense	0			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.634G>C	1.37:g.213181560C>G	ENSP00000355929:p.Asp212His		B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.D212H	ENST00000366962.3	37	c.634	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839452	0.71488	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642;ENST00000535388;ENST00000310246	D;D;D;D;D	0.96041	-3.89;-1.58;-1.58;-3.89;-1.58	5.41	4.49	0.54785	Endonuclease/exonuclease/phosphatase (2);	0.253347	0.46145	D	0.000312	D	0.96237	0.8773	M	0.62266	1.93	0.54753	D	0.999989	D;D;D	0.64830	0.973;0.994;0.979	P;D;P	0.67900	0.784;0.954;0.903	D	0.95554	0.8623	10	0.72032	D	0.01	-22.552	8.2909	0.31956	0.0:0.7762:0.0:0.2238	.	86;190;212	F5H476;Q96AL9;Q5VTE6	.;.;ANGE2_HUMAN	H	212;43;43;86;43;190	ENSP00000355929:D212H;ENSP00000353696:D43H;ENSP00000443193:D43H;ENSP00000446124:D86H;ENSP00000438141:D43H	ENSP00000309755:D190H	D	-	1	0	ANGEL2	211248183	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	1.371000	0.34250	2.513000	0.84729	0.591000	0.81541	GAT	ANGEL2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000174606		0.403	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1	-	0.00	43	0	C	NM_144567		213181560	-1	tier1	-	no_errors	ENST00000366962	ensembl	human	known	74_37	missense	71.88	18	46	SNP	0.935	G
ANK3	288	genome.wustl.edu	37	10	61834479	61834479	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr10:61834479C>T	ENST00000280772.2	-	37	6351	c.6160G>A	c.(6160-6162)Gag>Aag	p.E2054K	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2054					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTTGCATCCTCAAACTTGTAT	0.388																																																	0													112.0	107.0	109.0					10																	61834479		2203	4300	6503	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.6160G>A	10.37:g.61834479C>T	ENSP00000280772:p.Glu2054Lys		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.E2054K	ENST00000280772.2	37	c.6160	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	17.51	3.408293	0.62399	.	.	ENSG00000151150	ENST00000280772	T	0.57595	0.39	5.8	5.8	0.92144	.	0.000000	0.42548	D	0.000700	T	0.49626	0.1568	L	0.53249	1.67	0.80722	D	1	P	0.43094	0.799	B	0.35931	0.214	T	0.50259	-0.8849	10	0.36615	T	0.2	.	20.0609	0.97674	0.0:1.0:0.0:0.0	.	2054	Q12955	ANK3_HUMAN	K	2054	ENSP00000280772:E2054K	ENSP00000280772:E2054K	E	-	1	0	ANK3	61504485	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	4.930000	0.63462	2.755000	0.94549	0.655000	0.94253	GAG	ANK3	-	NULL	ENSG00000151150		0.388	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4		0.00	54	0	C	NM_020987		61834479	-1			no_errors	ENST00000280772	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
ANKLE1	126549	genome.wustl.edu	37	19	17396582	17396582	+	Silent	SNP	C	C	T	rs370950297		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:17396582C>T	ENST00000394458.3	+	8	1905	c.1629C>T	c.(1627-1629)gtC>gtT	p.V543V	ANKLE1_ENST00000433424.2_3'UTR|ANKLE1_ENST00000598347.1_Intron|ANKLE1_ENST00000404085.1_Silent_p.V539V|ANKLE1_ENST00000594072.1_Silent_p.V506V	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	543	GIY-YIG. {ECO:0000255|PROSITE- ProRule:PRU00977}.									large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						AGCACGTGGTCGCTGTGGAGG	0.582																																																	0								C		0,4406		0,0,2203	123.0	101.0	109.0		1629	-9.1	0.3	19		109	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ANKLE1	NM_152363.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		543/616	17396582	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1629C>T	19.37:g.17396582C>T			A8VU82|Q8N8J8	Silent	SNP	pfam_Ankyrin_rpt,pfam_LEM_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_LEM/LEM-like_dom,superfamily_Lactate_DH/Glyco_Ohase_4_C,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_LEM_dom	p.V543	ENST00000394458.3	37	c.1629	CCDS12354.2	19																																																																																			ANKLE1	-	NULL	ENSG00000160117		0.582	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE1	HGNC	protein_coding	OTTHUMT00000325392.2	-	0.00	63	0	C	NM_152363		17396582	+1	tier1	-	no_errors	ENST00000394458	ensembl	human	known	74_37	silent	30.00	21	9	SNP	0.394	T
ANKLE2	23141	genome.wustl.edu	37	12	133310659	133310660	+	Intron	INS	-	-	A	rs372085055		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:133310659_133310660insA	ENST00000357997.5	-	10	1981				ANKLE2_ENST00000539605.1_Intron|ANKLE2_ENST00000337516.5_Splice_Site|ANKLE2_ENST00000542374.1_Intron|ANKLE2_ENST00000542282.1_5'Flank|ANKLE2_ENST00000542657.1_5'Flank	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2						mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		gcatctccactaaaaaaaaaaa	0.505																																																	0																																										SO:0001627	intron_variant	0			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.1891+310->T	12.37:g.133310670_133310670dupA			A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Splice_Site	INS	-	e11-2	ENST00000357997.5	37	c.1892-3_1892-2	CCDS41869.1	12																																																																																			ANKLE2	-	-	ENSG00000176915		0.505	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1		0.00	14	0	0			133310660	-1			no_errors	ENST00000337516	ensembl	human	known	74_37	splice_site_ins	36.36	7	4	INS	0.024:0.026	A
ANKRD32	84250	genome.wustl.edu	37	5	93990359	93990359	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr5:93990359G>T	ENST00000265140.5	+	9	1476	c.1057G>T	c.(1057-1059)Gct>Tct	p.A353S		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	353						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		TTCTATTTTTGCTGAATATGC	0.323																																																	0													97.0	89.0	91.0					5																	93990359		692	1588	2280	SO:0001583	missense	0			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.1057G>T	5.37:g.93990359G>T	ENSP00000265140:p.Ala353Ser		B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A353S	ENST00000265140.5	37	c.1057	CCDS4071.2	5	.	.	.	.	.	.	.	.	.	.	G	10.11	1.260072	0.23051	.	.	ENSG00000133302	ENST00000265140	T	0.30981	1.51	4.58	-1.4	0.08968	.	0.986072	0.08245	N	0.975458	T	0.18425	0.0442	N	0.25647	0.755	0.20563	N	0.999884	B	0.20261	0.043	B	0.17433	0.018	T	0.28744	-1.0034	10	0.39692	T	0.17	.	4.6657	0.12664	0.5053:0.1718:0.3228:0.0	.	353	Q9BQI6	ANR32_HUMAN	S	353	ENSP00000265140:A353S	ENSP00000265140:A353S	A	+	1	0	ANKRD32	94016115	0.640000	0.27243	0.882000	0.34594	0.938000	0.57974	0.048000	0.14078	-0.160000	0.11002	0.655000	0.94253	GCT	ANKRD32	-	NULL	ENSG00000133302		0.323	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD32	HGNC	protein_coding	OTTHUMT00000241610.1	-	0.00	70	0	G	NM_032290		93990359	+1	tier1	-	no_errors	ENST00000265140	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.916	T
ANO9	338440	genome.wustl.edu	37	11	432006	432006	+	Silent	SNP	C	C	T	rs552399217	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr11:432006C>T	ENST00000332826.6	-	5	483	c.399G>A	c.(397-399)tcG>tcA	p.S133S		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	133					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						TACCACCAGCCGAGGTCTTGT	0.622													C|||	2	0.000399361	0.0	0.0	5008	,	,		14733	0.001		0.0	False		,,,				2504	0.001																0													84.0	72.0	76.0					11																	432006		2203	4299	6502	SO:0001819	synonymous_variant	0			U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.399G>A	11.37:g.432006C>T			B3KUC4|B4E134|Q8TEN4	Silent	SNP	pfam_Anoctamin	p.S133	ENST00000332826.6	37	c.399	CCDS31326.1	11																																																																																			ANO9	-	NULL	ENSG00000185101		0.622	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO9	HGNC	protein_coding	OTTHUMT00000384116.1	-	0.00	75	0	C	NM_001012302		432006	-1	tier1	-	no_errors	ENST00000332826	ensembl	human	known	74_37	silent	16.36	46	9	SNP	0.000	T
AP1G1	164	genome.wustl.edu	37	16	71842857	71842857	+	5'UTR	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr16:71842857C>T	ENST00000299980.4	-	0	247				AP1G1_ENST00000570297.1_5'Flank|AP1G1_ENST00000569748.1_5'UTR|AP1G1_ENST00000393512.3_5'UTR|AP1G1_ENST00000433195.2_5'UTR|AP1G1_ENST00000423132.2_5'UTR	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				GTCCTCCTCTCCTGGTCGTTT	0.532																																																	0																																										SO:0001623	5_prime_UTR_variant	0			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.-195G>A	16.37:g.71842857C>T			O75709|O75842|Q9UG09|Q9Y3U4	RNA	SNP	-	NULL	ENST00000299980.4	37	NULL	CCDS32480.1	16																																																																																			AP1G1	-	-	ENSG00000166747		0.532	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G1	HGNC	protein_coding	OTTHUMT00000434147.1	-	0.00	32	0	C			71842857	-1	tier1	-	no_errors	ENST00000565161	ensembl	human	known	74_37	rna	21.05	45	12	SNP	0.000	T
APAF1	317	genome.wustl.edu	37	12	99117533	99117533	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:99117533G>T	ENST00000551964.1	+	24	4057	c.3321G>T	c.(3319-3321)aaG>aaT	p.K1107N	APAF1_ENST00000552268.1_Intron|APAF1_ENST00000359972.2_Missense_Mutation_p.K1053N|APAF1_ENST00000357310.1_Missense_Mutation_p.K1064N|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000339433.3_Missense_Mutation_p.K1064N|APAF1_ENST00000549007.1_Missense_Mutation_p.K1064N|APAF1_ENST00000550527.1_Missense_Mutation_p.K1096N|APAF1_ENST00000547045.1_Missense_Mutation_p.K1064N	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	1107					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	CTGCTGACAAGACTGCAAAGG	0.363																																																	0													98.0	102.0	101.0					12																	99117533		2203	4300	6503	SO:0001583	missense	0			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.3321G>T	12.37:g.99117533G>T	ENSP00000448165:p.Lys1107Asn		B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NB-ARC,pfam_CARD,superfamily_WD40_repeat_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_CARD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Disease_R,prints_G-protein_beta_WD-40_rep	p.K1107N	ENST00000551964.1	37	c.3321	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689734	0.48097	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.60171	0.21;0.21;0.21;1.1;0.21;0.21;1.1	5.72	4.82	0.62117	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.134229	0.64402	D	0.000003	T	0.42630	0.1211	N	0.25426	0.745	0.80722	D	1	B;B;B;B;B	0.14012	0.006;0.005;0.004;0.009;0.002	B;B;B;B;B	0.23419	0.021;0.046;0.018;0.038;0.007	T	0.33137	-0.9880	10	0.40728	T	0.16	-8.7913	8.2993	0.32004	0.214:0.0:0.786:0.0	.	1064;1064;1053;1107;1096	C9JLV4;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	N	1107;1053;1064;1064;1096;1064;1064	ENSP00000448165:K1107N;ENSP00000353059:K1053N;ENSP00000349862:K1064N;ENSP00000341830:K1064N;ENSP00000448449:K1096N;ENSP00000449791:K1064N;ENSP00000448161:K1064N	ENSP00000341830:K1064N	K	+	3	2	APAF1	97641664	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.218000	0.42889	2.690000	0.91761	0.655000	0.94253	AAG	APAF1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000120868		0.363	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	-	0.00	76	0	G	NM_181861.1		99117533	+1	tier1	-	no_errors	ENST00000551964	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
APC2	10297	genome.wustl.edu	37	19	1456085	1456085	+	Missense_Mutation	SNP	C	C	G	rs565260681		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:1456085C>G	ENST00000535453.1	+	6	2363	c.650C>G	c.(649-651)tCg>tGg	p.S217W	CTB-25B13.12_ENST00000588225.1_RNA|APC2_ENST00000238483.4_Intron|APC2_ENST00000233607.2_Missense_Mutation_p.S217W			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCCGCGCCTCGCGCCTGGAG	0.701													C|||	1	0.000199681	0.0	0.0	5008	,	,		12367	0.001		0.0	False		,,,				2504	0.0																0													12.0	14.0	14.0					19																	1456085		2183	4286	6469	SO:0001583	missense	0				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.650C>G	19.37:g.1456085C>G	ENSP00000442954:p.Ser217Trp		C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_APC_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.S217W	ENST00000535453.1	37	c.650	CCDS12068.1	19	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857304	0.71834	.	.	ENSG00000115266	ENST00000233607;ENST00000535453	D;D	0.90900	-2.75;-2.75	3.79	3.79	0.43588	.	0.406210	0.22063	U	0.065156	D	0.92805	0.7712	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	D	0.93183	0.6576	10	0.87932	D	0	-7.7863	12.545	0.56195	0.0:1.0:0.0:0.0	.	216;217	O95996-3;O95996	.;APC2_HUMAN	W	217	ENSP00000233607:S217W;ENSP00000442954:S217W	ENSP00000233607:S217W	S	+	2	0	APC2	1407085	0.995000	0.38212	0.392000	0.26245	0.828000	0.46876	5.621000	0.67743	1.971000	0.57363	0.306000	0.20318	TCG	APC2	-	NULL	ENSG00000115266		0.701	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2		0.00	15	0	C	NM_005883		1456085	+1			no_errors	ENST00000233607	ensembl	human	known	74_37	missense	25.00	9	3	SNP	0.982	G
BCAT2	587	genome.wustl.edu	37	19	49309924	49309924	+	Silent	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:49309924G>T	ENST00000316273.6	-	3	162	c.150C>A	c.(148-150)ggC>ggA	p.G50G	BCAT2_ENST00000402551.1_Silent_p.G10G|BCAT2_ENST00000545387.2_Intron|BCAT2_ENST00000598162.1_Silent_p.G50G|BCAT2_ENST00000601496.1_5'Flank|BCAT2_ENST00000597011.1_Silent_p.G10G|BCAT2_ENST00000599246.1_Intron	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	50					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	GCTCGCCGGGGCCAGGCTTCT	0.577																																																	0													86.0	89.0	88.0					19																	49309924		2203	4300	6503	SO:0001819	synonymous_variant	0			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.150C>A	19.37:g.49309924G>T			B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Silent	SNP	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.G50	ENST00000316273.6	37	c.150	CCDS12735.1	19																																																																																			BCAT2	-	superfamily_Aminotrans_IV,pirsf_B_amino_transII	ENSG00000105552		0.577	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAT2	HGNC	protein_coding	OTTHUMT00000466202.1		0.00	74	0	G			49309924	-1			no_errors	ENST00000316273	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.000	T
BCL2L1	598	genome.wustl.edu	37	20	30309595	30309595	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:30309595A>G	ENST00000307677.4	-	2	837	c.427T>C	c.(427-429)Ttt>Ctt	p.F143L	BCL2L1_ENST00000376055.4_Intron|BCL2L1_ENST00000420653.1_Missense_Mutation_p.F143L|BCL2L1_ENST00000376062.2_Missense_Mutation_p.F143L	NM_138578.1	NP_612815.1	Q07817	B2CL1_HUMAN	BCL2-like 1	143					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process in bone marrow (GO:0071839)|cell proliferation (GO:0008283)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to alkaloid (GO:0071312)|cellular response to amino acid stimulus (GO:0071230)|cellular response to gamma radiation (GO:0071480)|cytokinesis (GO:0000910)|endocytosis (GO:0006897)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fertilization (GO:0009566)|germ cell development (GO:0007281)|growth (GO:0040007)|hepatocyte apoptotic process (GO:0097284)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male gonad development (GO:0008584)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|release of cytochrome c from mitochondria (GO:0001836)|response to cycloheximide (GO:0046898)|response to cytokine (GO:0034097)|spermatogenesis (GO:0007283)|suppression by virus of host apoptotic process (GO:0019050)	Bcl-2 family protein complex (GO:0097136)|cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synapse (GO:0045202)	BH3 domain binding (GO:0051434)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			AAGGAGAAAAAGGCCACAATG	0.537																																					Colon(51;693 1004 1401 20431 21026)												0													201.0	200.0	200.0					20																	30309595		2203	4300	6503	SO:0001583	missense	0			Z23115	CCDS13188.1, CCDS13189.1	20q11.21	2014-03-07			ENSG00000171552	ENSG00000171552		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	992	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 52"""	600039				8358789	Standard	NM_001191		Approved	BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, PPP1R52	uc002wwl.3	Q07817	OTTHUMG00000032192	ENST00000307677.4:c.427T>C	20.37:g.30309595A>G	ENSP00000302564:p.Phe143Leu		E1P5L6|Q5CZ89|Q5TE65|Q92976	Missense_Mutation	SNP	pfam_Blc2_fam,pfam_Bcl2_BH4,smart_Bcl2_BH4,pfscan_Bcl2-like,pfscan_Bcl2_BH4,prints_Apop_reg_BclX,prints_Blc2_fam,tigrfam_Bcl2/BclX	p.F143L	ENST00000307677.4	37	c.427	CCDS13189.1	20	.	.	.	.	.	.	.	.	.	.	A	14.43	2.534051	0.45073	.	.	ENSG00000171552	ENST00000376062;ENST00000307677;ENST00000420653;ENST00000450273;ENST00000420488;ENST00000456404;ENST00000422920;ENST00000439267	T;T;T;T;T;T;T;T	0.05855	3.38;3.38;3.38;3.38;3.38;3.38;3.38;3.38	5.4	5.4	0.78164	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (3);Apoptosis regulator, Bcl-2, BH1 motif, conserved site (1);	0.051853	0.85682	D	0.000000	T	0.03095	0.0091	N	0.00879	-1.12	0.58432	D	0.999995	B	0.26081	0.141	B	0.34180	0.177	T	0.58567	-0.7614	10	0.29301	T	0.29	-7.7013	14.7657	0.69637	1.0:0.0:0.0:0.0	.	143	Q07817	B2CL1_HUMAN	L	143	ENSP00000365230:F143L;ENSP00000302564:F143L;ENSP00000405563:F143L;ENSP00000406203:F143L;ENSP00000390760:F143L;ENSP00000395545:F143L;ENSP00000411252:F143L;ENSP00000389688:F143L	ENSP00000302564:F143L	F	-	1	0	BCL2L1	29773256	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.886000	0.69743	2.277000	0.76020	0.528000	0.53228	TTT	BCL2L1	-	pfam_Blc2_fam,pfscan_Bcl2-like,prints_Blc2_fam,tigrfam_Bcl2/BclX	ENSG00000171552		0.537	BCL2L1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCL2L1	HGNC	protein_coding	OTTHUMT00000078575.1		0.00	136	0	A	NM_138578		30309595	-1			no_errors	ENST00000307677	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	G
BRPF3	27154	genome.wustl.edu	37	6	36193106	36193106	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:36193106G>A	ENST00000357641.6	+	11	3497	c.3244G>A	c.(3244-3246)Gcc>Acc	p.A1082T	BRPF3_ENST00000534400.1_Intron|BRPF3_ENST00000534694.1_Missense_Mutation_p.A748T|BRPF3_ENST00000339717.7_Missense_Mutation_p.A812T|BRPF3_ENST00000543502.1_Missense_Mutation_p.A812T|BRPF3_ENST00000443324.2_Missense_Mutation_p.A748T	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	1082	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						GCTGGTGTGGGCCAAGTGCCG	0.652																																																	0													63.0	62.0	62.0					6																	36193106		2203	4300	6503	SO:0001583	missense	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.3244G>A	6.37:g.36193106G>A	ENSP00000350267:p.Ala1082Thr		A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP_dom,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.A1082T	ENST00000357641.6	37	c.3244	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	37	5.983057	0.97173	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	6.04	6.04	0.98038	PWWP (3);	0.000000	0.85682	D	0.000000	T	0.72724	0.3496	M	0.88310	2.945	0.46521	D	0.999083	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.998;0.996;0.999	T	0.76225	-0.3037	10	0.87932	D	0	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	748;812;1082	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	T	1082;812;748;812;748	ENSP00000350267:A1082T;ENSP00000345419:A812T;ENSP00000434501:A748T;ENSP00000445352:A812T;ENSP00000387368:A748T	ENSP00000345419:A812T	A	+	1	0	BRPF3	36301084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.873000	0.98535	0.561000	0.74099	GCC	BRPF3	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	ENSG00000096070		0.652	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3	-	0.00	65	0	G	NM_015695		36193106	+1	tier1	-	no_errors	ENST00000357641	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
BSCL2	26580	genome.wustl.edu	37	11	62473729	62473729	+	Splice_Site	SNP	A	A	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr11:62473729A>T	ENST00000421906.1	-	1	86		c.e1+1		BSCL2_ENST00000407022.3_5'UTR|BSCL2_ENST00000360796.5_Intron|BSCL2_ENST00000433053.1_Intron|BSCL2_ENST00000537604.1_5'Flank|BSCL2_ENST00000405837.1_Intron|HNRNPUL2-BSCL2_ENST00000403734.2_Intron|BSCL2_ENST00000403550.1_5'Flank|GNG3_ENST00000294117.5_5'Flank|BSCL2_ENST00000278893.7_5'UTR			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)						cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						CTGCCGACTCACCAGCCTCGC	0.711																																																	0																																										SO:0001630	splice_region_variant	0				CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000421906.1:c.104+1T>A	11.37:g.62473729A>T			G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Splice_Site	SNP	-	e0+2	ENST00000421906.1	37	c.1+2	CCDS8031.1	11																																																																																			BSCL2	-	-	ENSG00000168000		0.711	BSCL2-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	BSCL2	HGNC	protein_coding	OTTHUMT00000319183.2	-	0.00	10	0	A	NM_032667	Intron	62473729	-1	tier1	-	no_errors	ENST00000421906	ensembl	human	known	74_37	splice_site	35.71	9	5	SNP	0.999	T
C3P1	388503	genome.wustl.edu	37	19	10172629	10172629	+	RNA	SNP	A	A	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:10172629A>G	ENST00000495140.1	+	0	2329							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						GAGAAGCAGGAGCTGGGAGGA	0.627																																																	0																																												0			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10172629A>G				RNA	SNP	-	NULL	ENST00000495140.1	37	NULL		19																																																																																			C3P1	-	-	ENSG00000167798		0.627	C3P1-002	KNOWN	basic	processed_transcript	C3P1	HGNC	pseudogene	OTTHUMT00000351284.1	-	0.00	54	0	A	NR_027300		10172629	+1	tier1	-	no_errors	ENST00000495140	ensembl	human	known	74_37	rna	12.12	29	4	SNP	0.012	G
C19orf48	84798	genome.wustl.edu	37	19	51302010	51302010	+	5'UTR	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:51302010G>T	ENST00000598463.1	-	0	794				C19orf48_ENST00000596655.1_5'UTR|C19orf48_ENST00000391812.1_5'UTR|SNORD88A_ENST00000408314.1_RNA|C19orf48_ENST00000345523.4_5'UTR|C19orf48_ENST00000595794.1_5'UTR|SNORD88B_ENST00000408454.1_RNA			Q6RUI8	CS048_HUMAN	chromosome 19 open reading frame 48											endometrium(1)|kidney(1)|lung(1)|ovary(1)	4		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00531)|GBM - Glioblastoma multiforme(134;0.0145)		CTCGAGAGCTGAGGCACAAGG	0.622																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC037227	CCDS12803.1	19q13.33	2012-10-26			ENSG00000167747	ENSG00000167747			29667	protein-coding gene	gene with protein product	"""multidrug resistance-related protein"""					12452007	Standard	NM_001290154		Approved	MGC13170	uc002ptg.3	Q6RUI8		ENST00000598463.1:c.-305C>A	19.37:g.51302010G>T				RNA	SNP	-	NULL	ENST00000598463.1	37	NULL	CCDS12803.1	19																																																																																			C19orf48	-	-	ENSG00000167747		0.622	C19orf48-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C19orf48	HGNC	protein_coding	OTTHUMT00000464107.1	-	0.00	36	0	G	NM_032712		51302010	-1	tier1	-	no_errors	ENST00000595794	ensembl	human	known	74_37	rna	15.79	16	3	SNP	0.000	T
ZGRF1	55345	genome.wustl.edu	37	4	113461239	113461239	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr4:113461239A>T	ENST00000505019.1	-	27	6077	c.5952T>A	c.(5950-5952)gaT>gaA	p.D1984E	RP11-402J6.1_ENST00000504009.1_RNA	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		1984						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		CAGTTTTAATATCAGGATGGT	0.403																																																	0													42.0	40.0	40.0					4																	113461239		2202	4298	6500	SO:0001583	missense	0																														ENST00000505019.1:c.5952T>A	4.37:g.113461239A>T	ENSP00000424737:p.Asp1984Glu		B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	pfam_DUF2439,pfam_Znf_GRF,superfamily_P-loop_NTPase	p.D1984E	ENST00000505019.1	37	c.5952		4	.	.	.	.	.	.	.	.	.	.	A	13.27	2.186316	0.38609	.	.	ENSG00000138658	ENST00000505019	D	0.82081	-1.57	5.32	-6.53	0.01866	.	2.146690	0.01530	N	0.018761	T	0.67924	0.2945	L	0.31157	0.91	0.09310	N	1	B;B	0.19583	0.037;0.009	B;B	0.17433	0.017;0.018	T	0.53450	-0.8437	10	0.20519	T	0.43	-0.0723	2.9241	0.05778	0.3204:0.0908:0.3814:0.2073	.	1984;442	G5EA02;B3KQX2	.;.	E	1984	ENSP00000424737:D1984E	ENSP00000424737:D1984E	D	-	3	2	C4orf21	113680688	0.000000	0.05858	0.000000	0.03702	0.439000	0.31926	-1.536000	0.02208	-1.148000	0.02847	0.459000	0.35465	GAT	C4orf21	-	superfamily_P-loop_NTPase	ENSG00000138658		0.403	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	HGNC	protein_coding	OTTHUMT00000256413.1	-	0.00	17	0	A			113461239	-1	tier1	-	no_errors	ENST00000505019	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.000	T
C9orf106	414318	genome.wustl.edu	37	9	132084746	132084746	+	RNA	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:132084746G>A	ENST00000316786.1	+	0	707							Q8NAJ2	CI106_HUMAN	chromosome 9 open reading frame 106											large_intestine(1)|lung(1)|ovary(1)|skin(1)	4		Ovarian(14;0.00556)|Medulloblastoma(224;0.235)				TCCATCCCTGGCCTTTTCCCT	0.577																																																	0													69.0	76.0	74.0					9																	132084746		1990	4158	6148			0			AK092588		9q34.11	2013-12-05	2013-12-05	2013-12-05	ENSG00000179082	ENSG00000179082			31370	other	unknown							Standard	NM_001012715		Approved	bA65J3.5	uc004bxs.2	Q8NAJ2	OTTHUMG00000020781		9.37:g.132084746G>A				RNA	SNP	-	NULL	ENST00000316786.1	37	NULL		9																																																																																			C9orf106	-	-	ENSG00000179082		0.577	C9orf106-001	KNOWN	basic	processed_transcript	C9orf106	HGNC	processed_transcript	OTTHUMT00000054576.2	-	0.00	56	0	G			132084746	+1	tier1	-	no_errors	ENST00000316786	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.002	A
CCNB1	891	genome.wustl.edu	37	5	68463111	68463111	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr5:68463111G>T	ENST00000256442.5	+	1	274		c.e1+1			NM_031966.3	NP_114172.1	P14635	CCNB1_HUMAN	cyclin B1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to iron(III) ion (GO:0071283)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle checkpoint (GO:0071174)|mitotic spindle stabilization (GO:0043148)|negative regulation of gene expression (GO:0010629)|negative regulation of protein phosphorylation (GO:0001933)|oocyte maturation (GO:0001556)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of chromosome condensation (GO:0060623)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to DDT (GO:0046680)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|spermatogenesis (GO:0007283)|tissue regeneration (GO:0042246)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase activity (GO:0016301)|patched binding (GO:0005113)|protein kinase binding (GO:0019901)			large_intestine(2)|lung(5)|skin(1)	8		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		AGTCACCAGGGTGAGCCGCTT	0.672																																																	0													60.0	59.0	59.0					5																	68463111		2203	4300	6503	SO:0001630	splice_region_variant	0			U22364	CCDS3997.1	5q12	2008-07-18			ENSG00000134057	ENSG00000134057			1579	protein-coding gene	gene with protein product	"""G2/mitotic-specific cyclin B1"""	123836		CCNB		1386342	Standard	NM_031966		Approved		uc003jvm.3	P14635	OTTHUMG00000097817	ENST00000256442.5:c.21+1G>T	5.37:g.68463111G>T			A8K066|Q5TZP9	Splice_Site	SNP	-	e1+1	ENST00000256442.5	37	c.21+1	CCDS3997.1	5	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543663	0.65198	.	.	ENSG00000134057	ENST00000256442;ENST00000506572;ENST00000508407;ENST00000505500	.	.	.	5.27	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.76	0.57359	0.0:0.0:0.8353:0.1647	.	.	.	.	.	-1	.	.	.	+	.	.	CCNB1	68498867	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	3.674000	0.54598	1.335000	0.45486	0.555000	0.69702	.	CCNB1	-	-	ENSG00000134057		0.672	CCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB1	HGNC	protein_coding	OTTHUMT00000215084.1		0.00	45	0	G	NM_031966	Intron	68463111	+1			no_errors	ENST00000256442	ensembl	human	known	74_37	splice_site	7.50	37	3	SNP	1.000	T
CD101	9398	genome.wustl.edu	37	1	117561053	117561053	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:117561053G>T	ENST00000256652.4	+	6	1946	c.1888G>T	c.(1888-1890)Gcc>Tcc	p.A630S	CD101_ENST00000369470.1_Missense_Mutation_p.A630S	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	630	Ig-like C2-type 5.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AGTCCATGATGCCACTGAGGA	0.468																																																	0													105.0	102.0	103.0					1																	117561053		2203	4300	6503	SO:0001583	missense	0			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1888G>T	1.37:g.117561053G>T	ENSP00000256652:p.Ala630Ser		Q15856	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.A630S	ENST00000256652.4	37	c.1888	CCDS891.1	1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.466656	0.43839	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	D;D	0.94793	-3.52;-3.52	5.09	4.15	0.48705	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000066	D	0.89615	0.6766	M	0.78637	2.42	0.30764	N	0.743815	P	0.36753	0.568	B	0.33568	0.166	D	0.87413	0.2377	10	0.72032	D	0.01	-11.5254	10.5844	0.45273	0.0:0.0:0.8079:0.1921	.	630	Q93033	IGSF2_HUMAN	S	630	ENSP00000256652:A630S;ENSP00000358482:A630S	ENSP00000256652:A630S	A	+	1	0	CD101	117362576	1.000000	0.71417	0.286000	0.24833	0.585000	0.36419	3.497000	0.53295	1.338000	0.45544	0.655000	0.94253	GCC	CD101	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000134256		0.468	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CD101	HGNC	protein_coding	OTTHUMT00000033274.1		0.00	39	0	G	NM_004258		117561053	+1			no_errors	ENST00000256652	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.958	T
CDAN1	146059	genome.wustl.edu	37	15	43021258	43021258	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:43021258C>T	ENST00000356231.3	-	19	2631	c.2608G>A	c.(2608-2610)Gca>Aca	p.A870T		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	870					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		ATTCTTTCTGCCACGAACTCT	0.537																																																	0													112.0	108.0	109.0					15																	43021258		2203	4299	6502	SO:0001583	missense	0			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.2608G>A	15.37:g.43021258C>T	ENSP00000348564:p.Ala870Thr		Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	NULL	p.A870T	ENST00000356231.3	37	c.2608	CCDS32209.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.490676	0.96339	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	T	0.75704	-0.96	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.83436	0.5254	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	1.0;0.98	D;P	0.71870	0.975;0.795	D	0.84330	0.0521	10	0.62326	D	0.03	-7.886	19.185	0.93639	0.0:1.0:0.0:0.0	.	870;868	Q8IWY9;C9K0H8	CDAN1_HUMAN;.	T	870;868	ENSP00000348564:A870T	ENSP00000267892:A868T	A	-	1	0	CDAN1	40808550	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.727000	0.68523	2.521000	0.84997	0.462000	0.41574	GCA	CDAN1	-	NULL	ENSG00000140326		0.537	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDAN1	HGNC	protein_coding	OTTHUMT00000431103.1	-	0.00	104	0	C	XM_085300		43021258	-1	tier1	-	no_errors	ENST00000356231	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
CDC42BPB	9578	genome.wustl.edu	37	14	103440404	103440404	+	Silent	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr14:103440404C>T	ENST00000361246.2	-	12	1878	c.1590G>A	c.(1588-1590)ggG>ggA	p.G530G		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GCTTCTCCAGCCCCCGCAGCC	0.587																																																	0													64.0	56.0	58.0					14																	103440404		2203	4300	6503	SO:0001819	synonymous_variant	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.1590G>A	14.37:g.103440404C>T				Silent	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_CRIB_dom,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.G530	ENST00000361246.2	37	c.1590	CCDS9978.1	14																																																																																			CDC42BPB	-	NULL	ENSG00000198752		0.587	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1		0.00	79	0	C	NM_006035		103440404	-1			no_errors	ENST00000361246	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.592	T
CENPF	1063	genome.wustl.edu	37	1	214818975	214818975	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:214818975C>A	ENST00000366955.3	+	13	6230	c.6062C>A	c.(6061-6063)tCt>tAt	p.S2021Y		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2117					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.S2021C(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ACTTTGTCCTCTGATGTGAGT	0.458																																					Colon(80;575 1284 11000 14801 43496)												1	Substitution - Missense(1)	lung(1)											77.0	76.0	76.0					1																	214818975		2203	4300	6503	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.6062C>A	1.37:g.214818975C>A	ENSP00000355922:p.Ser2021Tyr		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_CenpF/LEK1_Rb-prot-bd	p.S2021Y	ENST00000366955.3	37	c.6062	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512973	0.27123	.	.	ENSG00000117724	ENST00000366955	T	0.45668	0.89	5.2	4.27	0.50696	.	0.207947	0.24396	N	0.038892	T	0.47021	0.1423	L	0.53249	1.67	0.23180	N	0.998162	P	0.50272	0.933	P	0.49012	0.598	T	0.40739	-0.9547	10	0.56958	D	0.05	.	12.8372	0.57780	0.0:0.92:0.0:0.08	.	2117	P49454	CENPF_HUMAN	Y	2021	ENSP00000355922:S2021Y	ENSP00000355922:S2021Y	S	+	2	0	CENPF	212885598	0.107000	0.21998	0.818000	0.32626	0.709000	0.40893	0.466000	0.22019	1.163000	0.42636	0.603000	0.83216	TCT	CENPF	-	NULL	ENSG00000117724		0.458	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1		0.00	46	0	C	NM_016343		214818975	+1			no_errors	ENST00000366955	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.770	A
CEP164	22897	genome.wustl.edu	37	11	117261524	117261526	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr11:117261524_117261526delGAG	ENST00000278935.3	+	16	2113_2115	c.1966_1968delGAG	c.(1966-1968)gagdel	p.E659del	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	659	Glu-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GAAAGCCATTGAGGAGGAGGAGG	0.522																																																	0																																										SO:0001651	inframe_deletion	0			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.1966_1968delGAG	11.37:g.117261533_117261535delGAG	ENSP00000278935:p.Glu659del		Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	In_Frame_Del	DEL	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.E659in_frame_del	ENST00000278935.3	37	c.1966_1968	CCDS31683.1	11																																																																																			CEP164	-	NULL	ENSG00000110274		0.522	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	HGNC	protein_coding	OTTHUMT00000392893.1		0.00	52	0	GAG	NM_014956		117261526	+1	tier1		no_errors	ENST00000278935	ensembl	human	known	74_37	in_frame_del	10.00	18	2	DEL	0.348:0.986:0.998	-
CHGB	1114	genome.wustl.edu	37	20	5904465	5904465	+	Nonsense_Mutation	SNP	G	G	T	rs368972632		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:5904465G>T	ENST00000378961.4	+	4	1879	c.1675G>T	c.(1675-1677)Gag>Tag	p.E559*		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	559						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)	p.E559K(1)		breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						GACCTTGAACGAGAAGAATTT	0.468																																																	1	Substitution - Missense(1)	lung(1)											68.0	66.0	66.0					20																	5904465		2203	4300	6503	SO:0001587	stop_gained	0				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1675G>T	20.37:g.5904465G>T	ENSP00000368244:p.Glu559*		A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Nonsense_Mutation	SNP	pfam_Granin,prints_Chromogranin_AB	p.E559*	ENST00000378961.4	37	c.1675	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	G	39	7.573687	0.98368	.	.	ENSG00000089199	ENST00000378961	.	.	.	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-26.0199	13.2575	0.60087	0.0723:0.0:0.9277:0.0	.	.	.	.	X	559	.	ENSP00000368244:E559X	E	+	1	0	CHGB	5852465	0.999000	0.42202	1.000000	0.80357	0.966000	0.64601	2.998000	0.49465	2.728000	0.93425	0.561000	0.74099	GAG	CHGB	-	pfam_Granin	ENSG00000089199		0.468	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	HGNC	protein_coding	OTTHUMT00000077897.2		0.00	70	0	G	NM_001819		5904465	+1			no_errors	ENST00000378961	ensembl	human	known	74_37	nonsense	6.67	28	2	SNP	1.000	T
CHTOP	26097	genome.wustl.edu	37	1	153610701	153610701	+	Intron	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:153610701G>T	ENST00000368694.3	+	3	377				CHTOP_ENST00000403433.1_Intron|CHTOP_ENST00000495554.1_3'UTR|CHTOP_ENST00000368690.3_Intron|CHTOP_ENST00000368687.1_5'UTR|CHTOP_ENST00000368686.1_5'Flank	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1						mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						GGTCTAGCAAGCCATGAAAAT	0.383																																																	0																																										SO:0001627	intron_variant	0				CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.66-70G>T	1.37:g.153610701G>T			D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	RNA	SNP	-	NULL	ENST00000368694.3	37	NULL	CCDS1048.1	1																																																																																			CHTOP	-	-	ENSG00000160679		0.383	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHTOP	HGNC	protein_coding	OTTHUMT00000089967.1	-	0.00	48	0	G	NM_015607		153610701	+1	tier1	-	no_errors	ENST00000495554	ensembl	human	known	74_37	rna	5.26	72	4	SNP	1.000	T
CHUK	1147	genome.wustl.edu	37	10	101964869	101964871	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	TCT	TCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr10:101964869_101964871delTCT	ENST00000370397.7	-	12	1403_1405	c.1317_1319delAGA	c.(1315-1320)gaagac>gac	p.E439del		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	439					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CCTGCTATAGTCTTCTTTTAGTC	0.394																																					Ovarian(159;52 1904 10536 35305 37148)												0																																										SO:0001651	inframe_deletion	0			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.1317_1319delAGA	10.37:g.101964872_101964874delTCT	ENSP00000359424:p.Glu439del		O14666|Q13132|Q5W0I4|Q92467	In_Frame_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E439in_frame_del	ENST00000370397.7	37	c.1319_1317	CCDS7488.1	10																																																																																			CHUK	-	NULL	ENSG00000213341		0.394	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHUK	HGNC	protein_coding	OTTHUMT00000049836.1		0.00	80	0	TCT	NM_001278		101964871	-1	tier1		no_errors	ENST00000370397	ensembl	human	known	74_37	in_frame_del	29.27	58	24	DEL	1.000:1.000:0.999	-
CMYA5	202333	genome.wustl.edu	37	5	79031681	79031681	+	Nonsense_Mutation	SNP	G	G	T	rs368196442		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr5:79031681G>T	ENST00000446378.2	+	2	7124	c.7093G>T	c.(7093-7095)Gag>Tag	p.E2365*		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2365					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTTTAAGGAAGAGCCAAGAAG	0.378																																																	0													35.0	34.0	34.0					5																	79031681		1837	4102	5939	SO:0001587	stop_gained	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7093G>T	5.37:g.79031681G>T	ENSP00000394770:p.Glu2365*		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.E2365*	ENST00000446378.2	37	c.7093	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	45	11.606060	0.99582	.	.	ENSG00000164309	ENST00000446378	.	.	.	6.17	1.33	0.21861	.	0.348064	0.24757	N	0.035844	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	5.4836	0.16737	0.2087:0.286:0.5053:0.0	.	.	.	.	X	2365	.	ENSP00000394770:E2365X	E	+	1	0	CMYA5	79067437	0.920000	0.31207	0.979000	0.43373	0.304000	0.27724	0.739000	0.26173	0.469000	0.27268	-0.878000	0.02970	GAG	CMYA5	-	NULL	ENSG00000164309		0.378	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1		0.00	65	0	G	NM_153610		79031681	+1			no_errors	ENST00000446378	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	0.066	T
CRB1	23418	genome.wustl.edu	37	1	197411469	197411470	+	Intron	DEL	TT	TT	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:197411469_197411470delTT	ENST00000367400.3	+	11	4140				CRB1_ENST00000367397.1_3'UTR|CRB1_ENST00000544212.1_Intron|CRB1_ENST00000535699.1_Intron|CRB1_ENST00000538660.1_Intron|RP11-75C23.1_ENST00000422250.1_RNA|CRB1_ENST00000367399.2_Intron	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated						cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TGGCAGAATCTTTTTCAGCTTC	0.441																																																	0																																										SO:0001627	intron_variant	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.4005+47TT>-	1.37:g.197411471_197411472delTT			A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Frame_Shift_Del	DEL	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.F1352fs	ENST00000367400.3	37	c.4052_4053	CCDS1390.1	1																																																																																			CRB1	-	NULL	ENSG00000134376		0.441	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2		0.00	38	0	TT	NM_201253		197411470	+1	tier1		no_errors	ENST00000484075	ensembl	human	known	74_37	frame_shift_del	16.67	35	7	DEL	1.000:1.000	-
CSMD1	64478	genome.wustl.edu	37	8	2986325	2986326	+	5'UTR	INS	-	-	T	rs544200463	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr8:2986325_2986326insT	ENST00000523387.1	-	0	2570_2571				CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000602557.1_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000537824.1_Intron|CSMD1_ENST00000520002.1_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1							integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCGAGTTTTTGTTTTTTTTTTA	0.332																																																	0																																										SO:0001623	5_prime_UTR_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000523387.1:c.-1419->A	8.37:g.2986335_2986335dupT			Q0H0J5|Q96QU9|Q96RM4	RNA	INS	-	NULL	ENST00000523387.1	37	NULL		8																																																																																			CSMD1	-	-	ENSG00000183117		0.332	CSMD1-007	KNOWN	basic	processed_transcript	CSMD1	HGNC	protein_coding	OTTHUMT00000374659.2		0.00	35	0	-	NM_033225		2986326	-1	tier1		no_errors	ENST00000523387	ensembl	human	known	74_37	rna	10.26	35	4	INS	0.000:0.001	T
DCAF15	90379	genome.wustl.edu	37	19	14066943	14066943	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:14066943C>T	ENST00000254337.6	+	5	503	c.482C>T	c.(481-483)tCg>tTg	p.S161L	PODNL1_ENST00000538371.2_5'Flank|PODNL1_ENST00000538517.2_5'Flank|PODNL1_ENST00000588317.1_5'Flank	NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	161					protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						AGCACCCGCTCGGCCAACGGG	0.677																																																	0													26.0	23.0	24.0					19																	14066943		2200	4298	6498	SO:0001583	missense	0			BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.482C>T	19.37:g.14066943C>T	ENSP00000254337:p.Ser161Leu		B3KS86|Q96DW0|Q9BU31	Missense_Mutation	SNP	NULL	p.S161L	ENST00000254337.6	37	c.482	CCDS32926.1	19	.	.	.	.	.	.	.	.	.	.	c	18.93	3.728207	0.69074	.	.	ENSG00000132017	ENST00000254337	.	.	.	4.14	4.14	0.48551	.	0.193352	0.36409	N	0.002614	T	0.76292	0.3967	M	0.62723	1.935	0.49483	D	0.999793	D	0.89917	1.0	D	0.83275	0.996	T	0.79988	-0.1571	9	0.87932	D	0	-10.8211	15.5535	0.76173	0.0:1.0:0.0:0.0	.	161	Q66K64	DCA15_HUMAN	L	161	.	ENSP00000254337:S161L	S	+	2	0	DCAF15	13927943	0.993000	0.37304	0.910000	0.35882	0.796000	0.44982	2.669000	0.46825	2.039000	0.60335	0.549000	0.68633	TCG	DCAF15	-	NULL	ENSG00000132017		0.677	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF15	HGNC	protein_coding	OTTHUMT00000458099.1	-	0.00	64	0	C	NM_138353		14066943	+1	tier1	-	no_errors	ENST00000254337	ensembl	human	known	74_37	missense	65.38	9	17	SNP	0.963	T
DCAF4L2	138009	genome.wustl.edu	37	8	88885799	88885799	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr8:88885799G>T	ENST00000319675.3	-	1	497	c.401C>A	c.(400-402)tCa>tAa	p.S134*		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	134										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GTGATTCAGTGAGGCCCAGCA	0.557																																																	0													107.0	100.0	103.0					8																	88885799		2203	4300	6503	SO:0001587	stop_gained	0			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.401C>A	8.37:g.88885799G>T	ENSP00000316496:p.Ser134*			Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S134*	ENST00000319675.3	37	c.401	CCDS6245.1	8	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681632	0.47991	.	.	ENSG00000176566	ENST00000319675	.	.	.	0.86	-1.72	0.08107	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.938	0.03341	0.4269:0.0:0.3083:0.2648	.	.	.	.	X	134	.	ENSP00000316496:S134X	S	-	2	0	DCAF4L2	88954915	1.000000	0.71417	0.001000	0.08648	0.006000	0.05464	3.933000	0.56545	-0.732000	0.04856	-0.518000	0.04402	TCA	DCAF4L2	-	superfamily_WD40_repeat_dom	ENSG00000176566		0.557	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1		0.00	46	0	G	NM_152418		88885799	-1			no_errors	ENST00000319675	ensembl	human	known	74_37	nonsense	8.70	21	2	SNP	0.842	T
DEFB125	245938	genome.wustl.edu	37	20	76735	76735	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:76735A>G	ENST00000382410.2	+	2	148	c.148A>G	c.(148-150)Agg>Ggg	p.R50G	DEFB125_ENST00000608838.1_3'UTR	NM_153325.2	NP_697020.2	Q8N687	DB125_HUMAN	defensin, beta 125	50					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.156)			ACTTCTTTGTAGGAACAAGCT	0.363																																																	0													159.0	150.0	153.0					20																	76735		2203	4300	6503	SO:0001583	missense	0			AA935636	CCDS12989.2	20p13	2008-07-17			ENSG00000178591	ENSG00000178591		"""Defensins, beta"""	18105	protein-coding gene	gene with protein product	"""beta defensin 25"""					11854508	Standard	NM_153325		Approved	DEFB-25	uc002wcw.3	Q8N687	OTTHUMG00000031614	ENST00000382410.2:c.148A>G	20.37:g.76735A>G	ENSP00000371847:p.Arg50Gly		A1A502|Q7Z7B9	Missense_Mutation	SNP	NULL	p.R50G	ENST00000382410.2	37	c.148	CCDS12989.2	20	.	.	.	.	.	.	.	.	.	.	.	13.77	2.337097	0.41398	.	.	ENSG00000178591	ENST00000382410	T	0.11712	2.75	3.49	-1.59	0.08453	.	1.496170	0.04283	N	0.344217	T	0.08044	0.0201	N	0.22421	0.69	0.09310	N	1	P	0.47191	0.891	B	0.42282	0.382	T	0.21655	-1.0239	10	0.59425	D	0.04	-6.9504	3.9829	0.09503	0.4204:0.3721:0.2074:0.0	.	50	Q8N687	DB125_HUMAN	G	50	ENSP00000371847:R50G	ENSP00000371847:R50G	R	+	1	2	DEFB125	24735	0.813000	0.29090	0.170000	0.22879	0.730000	0.41778	0.072000	0.14617	-0.344000	0.08338	-0.313000	0.08912	AGG	DEFB125	-	NULL	ENSG00000178591		0.363	DEFB125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB125	HGNC	protein_coding	OTTHUMT00000077426.2	-	0.00	62	0	A	NM_153325		76735	+1	tier1	-	no_errors	ENST00000382410	ensembl	human	known	74_37	missense	28.89	32	13	SNP	0.235	G
DLX3	1747	genome.wustl.edu	37	17	48072324	48072324	+	Silent	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:48072324G>T	ENST00000434704.2	-	1	264	c.39C>A	c.(37-39)ctC>ctA	p.L13L	DLX3_ENST00000512495.2_5'Flank|RP11-1094H24.3_ENST00000511867.1_lincRNA	NM_005220.2	NP_005211.1	O60479	DLX3_HUMAN	distal-less homeobox 3	13					blood vessel development (GO:0001568)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|placenta development (GO:0001890)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						AGATGTCGGTGAGGATGCTGC	0.652																																																	0													52.0	48.0	49.0					17																	48072324		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11556.1	17q21.33	2011-06-20	2005-12-22			ENSG00000064195		"""Homeoboxes / ANTP class : NKL subclass"""	2916	protein-coding gene	gene with protein product		600525	"""distal-less homeo box 3"""			7613049	Standard	NM_005220		Approved		uc002ipy.3	O60479		ENST00000434704.2:c.39C>A	17.37:g.48072324G>T			B3KQL6	Silent	SNP	pfam_Distal-less_N,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.L13	ENST00000434704.2	37	c.39	CCDS11556.1	17																																																																																			DLX3	-	NULL	ENSG00000064195		0.652	DLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX3	HGNC	protein_coding	OTTHUMT00000366307.1	-	0.00	34	0	G			48072324	-1	tier1	-	no_errors	ENST00000434704	ensembl	human	known	74_37	silent	13.79	25	4	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	20999357	20999357	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr16:20999357G>T	ENST00000261383.3	-	45	6631	c.6632C>A	c.(6631-6633)tCc>tAc	p.S2211Y	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2211	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGCATTGATGGAAATGATATT	0.413																																																	0													129.0	115.0	119.0					16																	20999357		2201	4300	6501	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.6632C>A	16.37:g.20999357G>T	ENSP00000261383:p.Ser2211Tyr		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.S2211Y	ENST00000261383.3	37	c.6632	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889188	0.52014	.	.	ENSG00000158486	ENST00000261383	T	0.36699	1.24	5.09	5.09	0.68999	ATPase, AAA+ type, core (1);	0.234953	0.35179	N	0.003397	T	0.59169	0.2174	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.58098	-0.7696	10	0.40728	T	0.16	.	18.4881	0.90836	0.0:0.0:1.0:0.0	.	2211	Q8TD57	DYH3_HUMAN	Y	2211	ENSP00000261383:S2211Y	ENSP00000261383:S2211Y	S	-	2	0	DNAH3	20906858	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	6.241000	0.72369	2.363000	0.80096	0.585000	0.79938	TCC	DNAH3	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000158486		0.413	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1		0.00	21	0	G	NM_017539		20999357	-1			no_errors	ENST00000261383	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	T
DNAAF1	123872	genome.wustl.edu	37	16	84182611	84182611	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr16:84182611G>T	ENST00000378553.5	+	2	248		c.e2-1		DNAAF1_ENST00000334315.5_Splice_Site	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1						axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						TTATTTTACAGAAATTAATGA	0.403																																																	0													66.0	69.0	68.0					16																	84182611		2200	4300	6500	SO:0001630	splice_region_variant	0			BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.125-1G>T	16.37:g.84182611G>T			B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Splice_Site	SNP	-	e2-1	ENST00000378553.5	37	c.125-1	CCDS10943.2	16	.	.	.	.	.	.	.	.	.	.	G	17.36	3.369859	0.61624	.	.	ENSG00000154099	ENST00000334315;ENST00000378553	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8684	0.57951	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAAF1	82740112	1.000000	0.71417	0.986000	0.45419	0.985000	0.73830	2.666000	0.46799	2.399000	0.81585	0.591000	0.81541	.	DNAAF1	-	-	ENSG00000154099		0.403	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAAF1	HGNC	protein_coding	OTTHUMT00000250328.3	-	0.00	39	0	G	NM_178452	Intron	84182611	+1	tier1	-	no_errors	ENST00000378553	ensembl	human	known	74_37	splice_site	52.38	10	11	SNP	0.995	T
DNAH8	1769	genome.wustl.edu	37	6	38957896	38957896	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:38957896C>T	ENST00000359357.3	+	86	12765	c.12511C>T	c.(12511-12513)Cca>Tca	p.P4171S	DNAH8_ENST00000441566.1_Missense_Mutation_p.P4135S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4171					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CCAGTCACTGCCATCCCTAGA	0.398																																																	0													207.0	194.0	198.0					6																	38957896		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12511C>T	6.37:g.38957896C>T	ENSP00000352312:p.Pro4171Ser		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P4171S	ENST00000359357.3	37	c.12511		6	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605149	0.87157	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.11385	2.78;2.78;2.78	5.01	5.01	0.66863	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.24812	0.0602	M	0.83012	2.62	0.80722	D	1	P	0.50443	0.935	P	0.57620	0.824	T	0.03453	-1.1035	10	0.56958	D	0.05	.	18.3509	0.90338	0.0:1.0:0.0:0.0	.	4171	Q96JB1	DYH8_HUMAN	S	4376;4171;4135	ENSP00000333363:P4376S;ENSP00000352312:P4171S;ENSP00000402294:P4135S	ENSP00000333363:P4376S	P	+	1	0	DNAH8	39065874	1.000000	0.71417	0.997000	0.53966	0.878000	0.50629	5.288000	0.65651	2.323000	0.78572	0.650000	0.86243	CCA	DNAH8	-	pfam_Dynein_heavy_dom	ENSG00000124721		0.398	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	-	0.00	90	0	C	NM_001206927		38957896	+1	tier1	-	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	43.04	45	34	SNP	0.999	T
DNM1P47	100216544	genome.wustl.edu	37	15	102299859	102299859	+	RNA	SNP	T	T	C			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:102299859T>C	ENST00000561463.1	+	0	7905									DNM1 pseudogene 47																		GAGTTCATCTTCTCGGAGCTG	0.592																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299859T>C				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	41	0	T	NG_009149		102299859	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	11.54	23	3	SNP	1.000	C
ELOVL2	54898	genome.wustl.edu	37	6	10995243	10995243	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:10995243G>T	ENST00000354666.3	-	5	585	c.502C>A	c.(502-504)Caa>Aaa	p.Q168K		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	168					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	fatty acid elongase activity (GO:0009922)	p.Q168K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			AACTTACTTTGTCCACAAGGT	0.383																																																	1	Substitution - Missense(1)	lung(1)											142.0	141.0	141.0					6																	10995243		2203	4300	6503	SO:0001583	missense	0			AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977			14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""			12371743, 16564093	Standard	NM_017770		Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.502C>A	6.37:g.10995243G>T	ENSP00000346693:p.Gln168Lys		Q6P9E1|Q86W94	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.Q168K	ENST00000354666.3	37	c.502	CCDS4518.1	6	.	.	.	.	.	.	.	.	.	.	G	31	5.092513	0.94149	.	.	ENSG00000197977	ENST00000354666	T	0.21543	2.0	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	M	0.92268	3.29	0.80722	D	1	P	0.46142	0.873	P	0.49192	0.602	T	0.53809	-0.8386	10	0.66056	D	0.02	.	19.9598	0.97242	0.0:0.0:1.0:0.0	.	168	Q9NXB9	ELOV2_HUMAN	K	168	ENSP00000346693:Q168K	ENSP00000346693:Q168K	Q	-	1	0	ELOVL2	11103229	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	9.640000	0.98453	2.716000	0.92895	0.655000	0.94253	CAA	ELOVL2	-	pfam_GNS1_SUR4	ENSG00000197977		0.383	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL2	HGNC	protein_coding	OTTHUMT00000039849.1		0.00	46	0	G			10995243	-1			no_errors	ENST00000354666	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
ENDOG	2021	genome.wustl.edu	37	9	131584886	131584886	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:131584886G>T	ENST00000372642.4	+	3	1102	c.891G>T	c.(889-891)aaG>aaT	p.K297N	C9orf114_ENST00000361256.5_3'UTR	NM_004435.2	NP_004426.2	Q14249	NUCG_HUMAN	endonuclease G	297					apoptotic DNA fragmentation (GO:0006309)|DNA recombination (GO:0006310)|in utero embryonic development (GO:0001701)|positive regulation of apoptotic process (GO:0043065)|response to antibiotic (GO:0046677)|response to tumor necrosis factor (GO:0034612)	mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|nucleic acid binding (GO:0003676)										CGGGCAGTAAGTGAGGGTGGA	0.607																																																	0													22.0	19.0	20.0					9																	131584886		2172	4278	6450	SO:0001583	missense	0			X79444	CCDS6912.1	9q34.1	2008-06-04			ENSG00000167136	ENSG00000167136			3346	protein-coding gene	gene with protein product		600440				7789991	Standard	NM_004435		Approved		uc004bwc.3	Q14249	OTTHUMG00000020763	ENST00000372642.4:c.891G>T	9.37:g.131584886G>T	ENSP00000361725:p.Lys297Asn		Q5T281|Q9BSP2	Missense_Mutation	SNP	pfam_DNA/RNA_non-sp_Endonuclease,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A	p.K297N	ENST00000372642.4	37	c.891	CCDS6912.1	9	.	.	.	.	.	.	.	.	.	.	G	14.34	2.507279	0.44558	.	.	ENSG00000167136	ENST00000372642	T	0.34667	1.35	5.44	5.44	0.79542	.	0.000000	0.46758	D	0.000267	T	0.33614	0.0869	L	0.36672	1.1	0.80722	D	1	B	0.26635	0.155	B	0.28139	0.086	T	0.14559	-1.0468	10	0.72032	D	0.01	.	16.4141	0.83728	0.0:0.0:1.0:0.0	.	297	Q14249	NUCG_HUMAN	N	297	ENSP00000361725:K297N	ENSP00000361725:K297N	K	+	3	2	ENDOG	130624707	1.000000	0.71417	1.000000	0.80357	0.119000	0.20118	1.692000	0.37731	2.547000	0.85894	0.455000	0.32223	AAG	ENDOG	-	NULL	ENSG00000167136		0.607	ENDOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENDOG	HGNC	protein_coding	OTTHUMT00000054505.1	-	0.00	80	0	G	NM_004435		131584886	+1	tier1	-	no_errors	ENST00000372642	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
ENDOV	284131	genome.wustl.edu	37	17	78397414	78397414	+	Silent	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:78397414C>T	ENST00000518137.1	+	5	526	c.498C>T	c.(496-498)aaC>aaT	p.N166N	ENDOV_ENST00000518644.1_Silent_p.N83N|ENDOV_ENST00000518907.1_5'UTR|ENDOV_ENST00000518901.1_5'UTR|ENDOV_ENST00000517295.2_Silent_p.N83N|ENDOV_ENST00000517795.1_5'UTR|ENDOV_ENST00000522751.1_5'UTR|ENDOV_ENST00000520284.1_5'UTR|ENDOV_ENST00000323854.5_Silent_p.N121N|ENDOV_ENST00000520367.1_Silent_p.N121N	NM_173627.3	NP_775898.2	Q8N8Q3	ENDOV_HUMAN	endonuclease V	166					DNA repair (GO:0006281)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|magnesium ion binding (GO:0000287)|single-stranded RNA binding (GO:0003727)|structure-specific DNA binding (GO:0043566)			endometrium(1)|lung(1)|pancreas(1)|prostate(1)	4						TGGAGAACAACGCCCTGCACA	0.642								Direct reversal of damage																																									0													36.0	41.0	39.0					17																	78397414		2024	4088	6112	SO:0001819	synonymous_variant	0				CCDS54172.1, CCDS54173.1, CCDS54174.1	17q25.3	2011-05-05			ENSG00000173818	ENSG00000173818			26640	protein-coding gene	gene with protein product						12853604	Standard	NM_001164638		Approved	FLJ35220	uc021ueo.1	Q8N8Q3	OTTHUMG00000164638	ENST00000518137.1:c.498C>T	17.37:g.78397414C>T			I3L3S4|Q6P2G2|Q86X99|Q8NAK0	Missense_Mutation	SNP	pfam_Endonuclease-V	p.T108M	ENST00000518137.1	37	c.323	CCDS54172.1	17	.	.	.	.	.	.	.	.	.	.	C	4.158	0.027811	0.08054	.	.	ENSG00000173818	ENST00000521634	.	.	.	4.36	-4.28	0.03732	.	.	.	.	.	T	0.33760	0.0874	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35599	-0.9782	4	.	.	.	-3.0545	11.755	0.51870	0.0:0.4336:0.0:0.5664	.	.	.	.	M	32	.	.	T	+	2	0	ENDOV	76012009	0.000000	0.05858	0.000000	0.03702	0.765000	0.43378	-1.204000	0.03017	-1.126000	0.02929	-0.251000	0.11542	ACG	ENDOV	-	NULL	ENSG00000173818		0.642	ENDOV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENDOV	HGNC	protein_coding	OTTHUMT00000379487.1		0.00	116	0	C	NM_173627		78397414	+1			no_errors	ENST00000522577	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.001	T
MUC3A	4584	genome.wustl.edu	37	7	100608201	100608201	+	Intron	SNP	C	C	T	rs77005990	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:100608201C>T	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000420080.1_RNA|RP11-395B7.2_ENST00000434775.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						CTCCACACTCCCCCAGACGGA	0.602																																																	0																																										SO:0001627	intron_variant	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-106C>T	7.37:g.100608201C>T			O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	SNP	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			RP11-395B7.2	-	-	ENSG00000225946		0.602	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	Clone_based_vega_gene	protein_coding	OTTHUMT00000347215.1	-	0.00	21	0	C	XM_001725354		100608201	-1	tier1	rs77005990	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	30.30	23	10	SNP	0.001	T
SRGAP1	57522	genome.wustl.edu	37	12	64502653	64502653	+	Intron	SNP	T	T	A	rs547111181		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:64502653T>A	ENST00000355086.3	+	16	2337				RP11-196H14.4_ENST00000535806.1_RNA|SRGAP1_ENST00000543397.1_Intron|SRGAP1_ENST00000357825.3_Intron	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1						axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TGTACTGCAGTGTTCTGTTTT	0.418																																																	0																																										SO:0001627	intron_variant	0			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.1814-59T>A	12.37:g.64502653T>A			Q9H8A3|Q9P2P2	RNA	SNP	-	NULL	ENST00000355086.3	37	NULL	CCDS8967.1	12																																																																																			RP11-196H14.4	-	-	ENSG00000255817		0.418	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000255817	Clone_based_vega_gene	protein_coding	OTTHUMT00000400896.1	-	0.00	22	0	T			64502653	-1	tier1	-	no_errors	ENST00000535806	ensembl	human	known	74_37	rna	40.00	15	10	SNP	0.018	A
EPN2	22905	genome.wustl.edu	37	17	19238487	19238487	+	3'UTR	SNP	T	T	A	rs140366250	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:19238487T>A	ENST00000314728.5	+	0	3330				EPN2_ENST00000395620.2_3'UTR|EPN2_ENST00000395618.3_3'UTR|RP11-135L13.4_ENST00000581122.1_RNA|EPN2_ENST00000395626.1_Intron|EPN2_ENST00000347697.2_3'UTR	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2						embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					GATGTTTATTTAAAAAAAAAA	0.303																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.*920T>A	17.37:g.19238487T>A			A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	RNA	SNP	-	NULL	ENST00000314728.5	37	NULL	CCDS11203.1	17																																																																																			RP11-135L13.4	-	-	ENSG00000265263		0.303	EPN2-001	KNOWN	basic|CCDS	protein_coding	ENSG00000265263	Clone_based_vega_gene	protein_coding	OTTHUMT00000132283.3	-	0.00	86	0	T	NM_014964		19238487	-1	tier1	-	no_errors	ENST00000581122	ensembl	human	known	74_37	rna	10.87	41	5	SNP	0.043	A
DNAI2	64446	genome.wustl.edu	37	17	72305580	72305580	+	Intron	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:72305580G>A	ENST00000311014.6	+	10	1414				DNAI2_ENST00000446837.2_Intron|RP11-647F2.2_ENST00000585167.1_RNA|AC103809.1_ENST00000516976.1_RNA|DNAI2_ENST00000579490.1_Intron|DNAI2_ENST00000582036.1_Intron|DNAI2_ENST00000307504.5_Intron			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2						cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GCCAGGTCCCGGCGTGGGTGT	0.627									Kartagener syndrome																																								0																																										SO:0001627	intron_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1347+53G>A	17.37:g.72305580G>A			C9J0S6|Q8IUW4|Q9H179|Q9NT53	RNA	SNP	-	NULL	ENST00000311014.6	37	NULL	CCDS11697.1	17																																																																																			RP11-647F2.2	-	-	ENSG00000266106		0.627	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000266106	Clone_based_vega_gene	protein_coding	OTTHUMT00000442537.1	-	0.00	43	0	G	NM_023036		72305580	-1	tier1	-	no_errors	ENST00000585167	ensembl	human	known	74_37	rna	16.00	21	4	SNP	0.000	A
F12	2161	genome.wustl.edu	37	5	176829303	176829303	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr5:176829303G>T	ENST00000253496.3	-	14	1886	c.1838C>A	c.(1837-1839)aCc>aAc	p.T613N	PFN3_ENST00000358571.2_5'Flank|F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	613	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	TCAGGAAACGGTGTGCTCCCG	0.587									Hereditary Angioedema																																								0													85.0	60.0	69.0					5																	176829303		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.1838C>A	5.37:g.176829303G>T	ENSP00000253496:p.Thr613Asn		P78339	Missense_Mutation	SNP	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1,pfam_Kringle,pfam_FN_type2_col-bd,pfam_EG-like_dom,pfam_Fibronectin_type1,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1	p.T613N	ENST00000253496.3	37	c.1838	CCDS34302.1	5	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064269	0.55432	.	.	ENSG00000131187	ENST00000253496	T	0.61158	0.13	5.41	-1.3	0.09259	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	1.228460	0.05931	N	0.635180	T	0.61800	0.2376	M	0.78049	2.395	0.09310	N	1	P	0.49961	0.93	P	0.44860	0.462	T	0.60058	-0.7337	10	0.72032	D	0.01	.	10.1019	0.42511	0.6328:0.0:0.3672:0.0	.	613	P00748	FA12_HUMAN	N	613	ENSP00000253496:T613N	ENSP00000253496:T613N	T	-	2	0	F12	176761909	0.046000	0.20272	0.044000	0.18714	0.833000	0.47200	0.155000	0.16362	-0.083000	0.12618	0.561000	0.74099	ACC	F12	-	pirsf_Coagulation_fac_XIIa/HGFA,superfamily_Trypsin-like_Pept_dom,pfscan_Peptidase_S1	ENSG00000131187		0.587	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F12	HGNC	protein_coding	OTTHUMT00000373217.1	-	0.00	40	0	G			176829303	-1	tier1	-	no_errors	ENST00000253496	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.065	T
FAIM	55179	genome.wustl.edu	37	3	138329850	138329850	+	Intron	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr3:138329850C>T	ENST00000393035.2	+	1	87				FAIM_ENST00000360570.3_Intron|FAIM_ENST00000393034.2_Intron|FAIM_ENST00000338446.4_Silent_p.L17L	NM_001033032.1	NP_001028204.1	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)	cytoplasm (GO:0005737)				kidney(1)|upper_aerodigestive_tract(1)	2						ATAATCATCTCTTGGTATCTC	0.478																																																	0													223.0	214.0	217.0					3																	138329850		2203	4300	6503	SO:0001627	intron_variant	0			AK001444	CCDS3103.1, CCDS33864.1, CCDS33865.1	3q23	2008-07-18			ENSG00000158234	ENSG00000158234			18703	protein-coding gene	gene with protein product						10075978	Standard	NM_018147		Approved	FLJ10582, FAIM1	uc003esq.3	Q9NVQ4	OTTHUMG00000159885	ENST00000393035.2:c.-23+2071C>T	3.37:g.138329850C>T			Q6IAN2	Silent	SNP	pfam_FAIM	p.L17	ENST00000393035.2	37	c.51	CCDS3103.1	3																																																																																			FAIM	-	NULL	ENSG00000158234		0.478	FAIM-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAIM	HGNC	protein_coding	OTTHUMT00000357979.1	-	0.00	54	0	C	NM_001033032		138329850	+1	tier1	-	no_errors	ENST00000338446	ensembl	human	known	74_37	silent	35.56	29	16	SNP	0.000	T
FAM114A2	10827	genome.wustl.edu	37	5	153405922	153405922	+	Intron	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr5:153405922G>A	ENST00000351797.4	-	8	990				FAM114A2_ENST00000520667.1_Intron|FAM114A2_ENST00000522858.1_Intron|FAM114A2_ENST00000520313.1_Intron	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2								purine nucleotide binding (GO:0017076)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						CAAACACACTGCATCCTCTCC	0.318																																																	0													28.0	29.0	29.0					5																	153405922		2191	4293	6484	SO:0001627	intron_variant	0			AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.913+36C>T	5.37:g.153405922G>A			B2R8D8|Q9H7E0	RNA	SNP	-	NULL	ENST00000351797.4	37	NULL	CCDS4323.1	5																																																																																			FAM114A2	-	-	ENSG00000055147		0.318	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM114A2	HGNC	protein_coding	OTTHUMT00000252455.1	-	0.00	52	0	G	NM_018691		153405922	-1	tier1	-	no_errors	ENST00000518735	ensembl	human	putative	74_37	rna	12.00	22	3	SNP	0.000	A
FAM120C	54954	genome.wustl.edu	37	X	54186038	54186038	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chrX:54186038G>T	ENST00000375180.2	-	2	767	c.711C>A	c.(709-711)agC>agA	p.S237R	FAM120C_ENST00000328235.4_Missense_Mutation_p.S237R	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	237							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGTCTTCAAGGCTCTGAAAGA	0.438																																																	0													48.0	41.0	43.0					X																	54186038		2203	4300	6503	SO:0001583	missense	0			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.711C>A	X.37:g.54186038G>T	ENSP00000364324:p.Ser237Arg		B2RMT7	Missense_Mutation	SNP	NULL	p.S237R	ENST00000375180.2	37	c.711	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	G	17.08	3.298002	0.60086	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.54279	0.58;0.58	5.0	3.19	0.36642	.	0.139153	0.64402	D	0.000003	T	0.63094	0.2482	L	0.49126	1.545	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.74023	0.979;0.982	T	0.63829	-0.6548	10	0.72032	D	0.01	-10.8182	9.9752	0.41779	0.1803:0.0:0.8197:0.0	.	237;237	F8W881;Q9NX05	.;F120C_HUMAN	R	237	ENSP00000364324:S237R;ENSP00000329896:S237R	ENSP00000329896:S237R	S	-	3	2	FAM120C	54202763	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.577000	0.36515	0.877000	0.35895	0.506000	0.49869	AGC	FAM120C	-	NULL	ENSG00000184083		0.438	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	-	0.00	47	0	G	NM_017848		54186038	-1	tier1	-	no_errors	ENST00000375180	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	T
FAM151B	167555	genome.wustl.edu	37	5	79817926	79817926	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr5:79817926C>T	ENST00000282226.4	+	5	795	c.640C>T	c.(640-642)Cag>Tag	p.Q214*	FAM151B_ENST00000511718.1_3'UTR	NM_205548.2	NP_991111.2	Q6UXP7	F151B_HUMAN	family with sequence similarity 151, member B	214										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	7		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		GTCTTGTTCTCAGTTACTTTG	0.378																																																	0													163.0	144.0	151.0					5																	79817926		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4051.1	5q14.1	2007-12-18	2007-12-18		ENSG00000152380	ENSG00000152380			33716	protein-coding gene	gene with protein product							Standard	NM_205548		Approved	UNQ9217	uc003kgv.2	Q6UXP7	OTTHUMG00000131303	ENST00000282226.4:c.640C>T	5.37:g.79817926C>T	ENSP00000282226:p.Gln214*		A2RRE4	Nonsense_Mutation	SNP	pfam_DUF2181	p.Q214*	ENST00000282226.4	37	c.640	CCDS4051.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.167524	0.94768	.	.	ENSG00000152380	ENST00000282226	.	.	.	5.77	2.85	0.33270	.	0.268095	0.43747	D	0.000537	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-10.8588	10.2337	0.43270	0.0:0.5455:0.3783:0.0763	.	.	.	.	X	214	.	ENSP00000282226:Q214X	Q	+	1	0	FAM151B	79853682	0.999000	0.42202	0.934000	0.37439	0.984000	0.73092	2.599000	0.46231	0.772000	0.33382	0.655000	0.94253	CAG	FAM151B	-	pfam_DUF2181	ENSG00000152380		0.378	FAM151B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM151B	HGNC	protein_coding	OTTHUMT00000254072.1		0.00	96	0	C	NM_205548		79817926	+1			no_errors	ENST00000282226	ensembl	human	known	74_37	nonsense	8.33	33	3	SNP	0.941	T
FAM154A	158297	genome.wustl.edu	37	9	18928887	18928887	+	Silent	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:18928887G>T	ENST00000380534.4	-	4	867	c.588C>A	c.(586-588)ctC>ctA	p.L196L	FAM154A_ENST00000380530.1_3'UTR|FAM154A_ENST00000542071.1_Silent_p.L4L	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A	196										breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		GGATGTTACAGAGCTTTGGCA	0.498																																																	0													134.0	132.0	132.0					9																	18928887		2203	4300	6503	SO:0001819	synonymous_variant	0			BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.588C>A	9.37:g.18928887G>T			Q5VY58	Silent	SNP	NULL	p.L196	ENST00000380534.4	37	c.588	CCDS6487.1	9																																																																																			FAM154A	-	NULL	ENSG00000155875		0.498	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM154A	HGNC	protein_coding	OTTHUMT00000051811.1	-	0.00	80	0	G	NM_153707		18928887	-1	tier1	-	no_errors	ENST00000380534	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.005	T
ERICH6	131831	genome.wustl.edu	37	3	150396294	150396294	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr3:150396294G>T	ENST00000295910.6	-	10	1211	c.1159C>A	c.(1159-1161)Cca>Aca	p.P387T	FAM194A_ENST00000491361.1_Missense_Mutation_p.P241T	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TGTTTTTCTGGAATATCCACA	0.294																																																	0													66.0	63.0	64.0					3																	150396294		2201	4292	6493	SO:0001583	missense	0																														ENST00000295910.6:c.1159C>A	3.37:g.150396294G>T	ENSP00000295910:p.Pro387Thr			Missense_Mutation	SNP	NULL	p.P387T	ENST00000295910.6	37	c.1159	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400856	0.25291	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811	T;T	0.15256	2.66;2.44	3.85	2.88	0.33553	.	0.461248	0.17976	N	0.155706	T	0.16300	0.0392	L	0.45581	1.43	0.09310	N	1	B	0.28998	0.23	B	0.31101	0.124	T	0.15263	-1.0443	10	0.62326	D	0.03	-4.5609	10.2271	0.43231	0.0:0.0:0.802:0.1979	.	387	Q7L0X2	F194A_HUMAN	T	387;241;345	ENSP00000295910:P387T;ENSP00000419366:P241T	ENSP00000295910:P387T	P	-	1	0	FAM194A	151878984	0.024000	0.19004	0.044000	0.18714	0.286000	0.27126	1.960000	0.40422	2.130000	0.65690	0.557000	0.71058	CCA	FAM194A	-	NULL	ENSG00000163645		0.294	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194A	HGNC	protein_coding	OTTHUMT00000257666.1	-	0.00	60	0	G			150396294	-1	tier1	-	no_errors	ENST00000295910	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.008	T
FAT4	79633	genome.wustl.edu	37	4	126400925	126400925	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr4:126400925G>A	ENST00000394329.3	+	14	12516	c.12503G>A	c.(12502-12504)cGc>cAc	p.R4168H	FAT4_ENST00000335110.5_Intron	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4168	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R4168H(1)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GCTTGTACTCGCAGCCCATGC	0.423																																																	1	Substitution - Missense(1)	endometrium(1)											76.0	69.0	71.0					4																	126400925		1568	3582	5150	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.12503G>A	4.37:g.126400925G>A	ENSP00000377862:p.Arg4168His		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R4168H	ENST00000394329.3	37	c.12503	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	7.929	0.740301	0.15642	.	.	ENSG00000196159	ENST00000394329	T	0.73789	-0.78	5.06	0.548	0.17208	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.265750	0.06148	N	0.673647	T	0.52837	0.1759	N	0.16066	0.365	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.0;0.001	T	0.37244	-0.9714	10	0.39692	T	0.17	.	0.7234	0.00944	0.4197:0.1377:0.2063:0.2363	.	4168;4168	Q6V0I7;Q6V0I7-3	FAT4_HUMAN;.	H	4168	ENSP00000377862:R4168H	ENSP00000377862:R4168H	R	+	2	0	FAT4	126620375	0.001000	0.12720	0.232000	0.24009	0.304000	0.27724	0.188000	0.17018	0.147000	0.19030	-0.237000	0.12165	CGC	FAT4	-	superfamily_ConA-like_lec_gl_sf,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000196159		0.423	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2		0.00	67	0	G	NM_024582		126400925	+1			no_errors	ENST00000394329	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.002	A
FERMT2	10979	genome.wustl.edu	37	14	53326257	53326257	+	Intron	SNP	G	G	A	rs375267385		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr14:53326257G>A	ENST00000395631.2	-	14	2086				FERMT2_ENST00000341590.3_Intron|FERMT2_ENST00000553373.1_Intron|FERMT2_ENST00000557255.1_5'UTR|FERMT2_ENST00000343279.4_Intron|FERMT2_ENST00000399304.3_3'UTR			Q96AC1	FERM2_HUMAN	fermitin family member 2						cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TATCAGAGAAGGACTATATTC	0.338																																																	0													110.0	104.0	106.0					14																	53326257		2203	4300	6503	SO:0001627	intron_variant	0			Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.1869+33C>T	14.37:g.53326257G>A			B5TJY2|Q14840|Q86TY7	RNA	SNP	-	NULL	ENST00000395631.2	37	NULL	CCDS9713.1	14																																																																																			FERMT2	-	-	ENSG00000073712		0.338	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FERMT2	HGNC	protein_coding	OTTHUMT00000276907.2	-	0.00	48	0	G	NM_006832		53326257	-1	tier1	-	no_errors	ENST00000557255	ensembl	human	known	74_37	rna	44.74	21	17	SNP	0.000	A
FRMPD2	143162	genome.wustl.edu	37	10	49392645	49392645	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr10:49392645G>T	ENST00000374201.3	-	20	2850	c.2548C>A	c.(2548-2550)Cct>Act	p.P850T	FRMPD2_ENST00000407470.4_Missense_Mutation_p.P818T|FRMPD2_ENST00000305531.3_Missense_Mutation_p.P825T	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	850	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		ATGTTGTCAGGGGAATTCTGG	0.413																																																	0													104.0	100.0	102.0					10																	49392645		2203	4300	6503	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2548C>A	10.37:g.49392645G>T	ENSP00000363317:p.Pro850Thr		B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.P850T	ENST00000374201.3	37	c.2548	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241166	0.58995	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.39229	1.09;1.09;1.09	5.01	4.09	0.47781	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.57858	0.2082	L	0.53780	1.695	0.35220	D	0.775912	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.78314	0.974;0.991;0.974	T	0.68345	-0.5433	9	0.56958	D	0.05	.	12.744	0.57270	0.0:0.165:0.835:0.0	.	825;850;818	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	T	850;825;818	ENSP00000363317:P850T;ENSP00000307079:P825T;ENSP00000384339:P818T	ENSP00000307079:P825T	P	-	1	0	FRMPD2	49062651	1.000000	0.71417	0.969000	0.41365	0.625000	0.37756	5.986000	0.70563	1.075000	0.40932	0.655000	0.94253	CCT	FRMPD2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000170324		0.413	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3		0.00	71	0	G	NM_152428		49392645	-1			no_errors	ENST00000374201	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
GCDH	2639	genome.wustl.edu	37	19	13010666	13010666	+	3'UTR	SNP	C	C	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:13010666C>G	ENST00000222214.5	+	0	1839				GCDH_ENST00000422947.2_3'UTR|GCDH_ENST00000591470.1_3'UTR|GCDH_ENST00000588242.2_3'UTR|GCDH_ENST00000457854.1_3'UTR|SYCE2_ENST00000293695.7_Intron			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase						cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	TCTGCTGCAGCTGACCCCCTC	0.527																																					GBM(123;875 1636 7726 16444 26754)												0																																										SO:0001624	3_prime_UTR_variant	0			AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.*311C>G	19.37:g.13010666C>G			A8K2Z2|O14719	RNA	SNP	-	NULL	ENST00000222214.5	37	NULL	CCDS12286.1	19																																																																																			GCDH	-	-	ENSG00000105607		0.527	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCDH	HGNC	protein_coding	OTTHUMT00000451897.1	-	0.00	32	0	C			13010666	+1	tier1	-	no_errors	ENST00000588242	ensembl	human	known	74_37	rna	68.75	5	11	SNP	0.000	G
GCNT2	2651	genome.wustl.edu	37	6	10586824	10586824	+	Intron	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:10586824G>T	ENST00000379597.3	+	2	1481				GCNT2_ENST00000265012.4_Missense_Mutation_p.R201L|GCNT2_ENST00000316170.3_Intron|GCNT2_ENST00000495262.1_Intron|GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		AAAACCAACCGGGAGATAGTT	0.488																																																	0													85.0	85.0	85.0					6																	10586824		2203	4300	6503	SO:0001627	intron_variant	0			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.926-34760G>T	6.37:g.10586824G>T				Missense_Mutation	SNP	pfam_Glyco_trans_14	p.R201L	ENST00000379597.3	37	c.602	CCDS34338.1	6	.	.	.	.	.	.	.	.	.	.	G	19.26	3.794213	0.70452	.	.	ENSG00000111846	ENST00000265012	T	0.11169	2.8	5.47	-3.63	0.04529	.	.	.	.	.	T	0.02571	0.0078	L	0.28344	0.845	0.19945	N	0.999948	B	0.09022	0.002	B	0.17722	0.019	T	0.40136	-0.9579	9	0.33141	T	0.24	.	14.8594	0.70369	0.2837:0.0:0.7163:0.0	.	201	Q8NFS9	GNT2C_HUMAN	L	201	ENSP00000265012:R201L	ENSP00000265012:R201L	R	+	2	0	GCNT2	10694810	0.002000	0.14202	0.917000	0.36280	0.987000	0.75469	-0.516000	0.06282	-0.658000	0.05366	0.655000	0.94253	CGG	GCNT2	-	pfam_Glyco_trans_14	ENSG00000111846		0.488	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GCNT2	HGNC	protein_coding	OTTHUMT00000327912.3		0.00	48	0	G	NM_145649		10586824	+1			no_errors	ENST00000265012	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.252	T
GGT7	2686	genome.wustl.edu	37	20	33451262	33451262	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:33451262C>T	ENST00000336431.5	-	2	303	c.259G>A	c.(259-261)Gag>Aag	p.E87K		NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	87					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						TTGCGCGTCTCGCGTAGCGGC	0.687																																																	0													26.0	23.0	24.0					20																	33451262		2201	4297	6498	SO:0001583	missense	0			AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.259G>A	20.37:g.33451262C>T	ENSP00000338964:p.Glu87Lys		Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Missense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.E87K	ENST00000336431.5	37	c.259	CCDS13242.2	20	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781365	0.90282	.	.	ENSG00000131067	ENST00000336431;ENST00000427420	T;T	0.37752	3.41;1.18	5.26	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	L	0.43152	1.355	0.46774	D	0.999192	D;D;D	0.89917	0.994;0.992;1.0	P;P;D	0.81914	0.777;0.466;0.995	T	0.50329	-0.8841	10	0.62326	D	0.03	-23.3732	13.2751	0.60182	0.0:0.9243:0.0:0.0757	.	87;87;87	Q9UJ14-5;A4FU32;Q9UJ14	.;.;GGT7_HUMAN	K	87;104	ENSP00000338964:E87K;ENSP00000394993:E104K	ENSP00000338964:E87K	E	-	1	0	GGT7	32914923	1.000000	0.71417	0.936000	0.37596	0.607000	0.37147	4.883000	0.63128	2.472000	0.83506	0.650000	0.86243	GAG	GGT7	-	NULL	ENSG00000131067		0.687	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GGT7	HGNC	protein_coding	OTTHUMT00000078816.2	-	0.00	37	0	C	NM_178026		33451262	-1	tier1	-	no_errors	ENST00000336431	ensembl	human	novel	74_37	missense	16.67	25	5	SNP	0.995	T
GMEB2	26205	genome.wustl.edu	37	20	62221818	62221818	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:62221818G>A	ENST00000266068.1	-	9	1695	c.1217C>T	c.(1216-1218)cCg>cTg	p.P406L	GMEB2_ENST00000370077.1_Missense_Mutation_p.P406L|GMEB2_ENST00000370069.1_Missense_Mutation_p.P355L			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	406					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			GACGGTGGACGGCAGGGTGGA	0.711																																																	0													13.0	13.0	13.0					20																	62221818		2162	4237	6399	SO:0001583	missense	0			AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.1217C>T	20.37:g.62221818G>A	ENSP00000266068:p.Pro406Leu		E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Missense_Mutation	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Sig_transdc_His_kin_Hpt_dom,smart_SAND_dom,pfscan_SAND_dom	p.P406L	ENST00000266068.1	37	c.1217	CCDS13528.1	20	.	.	.	.	.	.	.	.	.	.	G	17.96	3.517162	0.64634	.	.	ENSG00000101216	ENST00000370069;ENST00000370077;ENST00000266068	T;T;T	0.73789	-0.78;-0.19;-0.19	4.49	4.49	0.54785	.	0.000000	0.49305	D	0.000151	T	0.80944	0.4721	L	0.59436	1.845	0.58432	D	0.999998	D	0.65815	0.995	P	0.55923	0.787	D	0.83883	0.0280	10	0.72032	D	0.01	-9.5945	17.1583	0.86797	0.0:0.0:1.0:0.0	.	406	Q9UKD1	GMEB2_HUMAN	L	355;406;406	ENSP00000359086:P355L;ENSP00000359094:P406L;ENSP00000266068:P406L	ENSP00000266068:P406L	P	-	2	0	GMEB2	61692262	1.000000	0.71417	0.779000	0.31741	0.337000	0.28794	3.916000	0.56416	2.207000	0.71202	0.561000	0.74099	CCG	GMEB2	-	NULL	ENSG00000101216		0.711	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMEB2	HGNC	protein_coding	OTTHUMT00000080166.1	-	0.00	20	0	G	NM_012384		62221818	-1	tier1	-	no_errors	ENST00000266068	ensembl	human	known	74_37	missense	45.45	12	10	SNP	0.989	A
GPC6	10082	genome.wustl.edu	37	13	94482415	94482415	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr13:94482415C>T	ENST00000377047.4	+	3	943	c.328C>T	c.(328-330)Cga>Tga	p.R110*	GPC6-AS2_ENST00000445540.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	110					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AGAATTTTTCCGAGAGCTCCT	0.388																																																	0													33.0	34.0	34.0					13																	94482415		2203	4298	6501	SO:0001587	stop_gained	0			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.328C>T	13.37:g.94482415C>T	ENSP00000366246:p.Arg110*		A8K279|Q96SG5|Q96SG8|Q9H1P4	Nonsense_Mutation	SNP	pfam_Glypican	p.R110*	ENST00000377047.4	37	c.328	CCDS9469.1	13	.	.	.	.	.	.	.	.	.	.	C	43	9.954422	0.99304	.	.	ENSG00000183098	ENST00000377047	.	.	.	5.53	4.67	0.58626	.	0.560121	0.16865	N	0.196374	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	13.6268	0.62170	0.2823:0.7177:0.0:0.0	.	.	.	.	X	110	.	ENSP00000366246:R110X	R	+	1	2	GPC6	93280416	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.944000	0.49034	1.447000	0.47661	0.650000	0.86243	CGA	GPC6	-	pfam_Glypican	ENSG00000183098		0.388	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4		0.00	84	0	C	NM_005708		94482415	+1			no_errors	ENST00000377047	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	1.000	T
GPR116	221395	genome.wustl.edu	37	6	46828573	46828573	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:46828573G>T	ENST00000283296.7	-	16	2546	c.2258C>A	c.(2257-2259)tCt>tAt	p.S753Y	GPR116_ENST00000362015.4_Missense_Mutation_p.S753Y|GPR116_ENST00000545669.1_Missense_Mutation_p.S182Y|GPR116_ENST00000456426.2_Missense_Mutation_p.S611Y|GPR116_ENST00000265417.7_Missense_Mutation_p.S753Y	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	753					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TATGCTAATAGAAAGATCCTT	0.418																																					NSCLC(59;410 1274 8751 36715 50546)												0													112.0	109.0	110.0					6																	46828573		2203	4300	6503	SO:0001583	missense	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.2258C>A	6.37:g.46828573G>T	ENSP00000283296:p.Ser753Tyr		O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.S753Y	ENST00000283296.7	37	c.2258	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883738	0.51908	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.31510	1.53;1.91;1.55;1.53;1.49	5.68	5.68	0.88126	.	0.237953	0.30085	N	0.010456	T	0.44644	0.1303	M	0.72118	2.19	0.32325	N	0.561857	D;D;D;D;D	0.71674	0.998;0.997;0.997;0.998;0.998	D;D;P;D;P	0.71414	0.969;0.94;0.897;0.973;0.896	T	0.43294	-0.9400	10	0.48119	T	0.1	-25.4902	15.296	0.73910	0.0:0.0:1.0:0.0	.	182;308;753;611;753	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	Y	753;753;753;611;124;753;182	ENSP00000283296:S753Y;ENSP00000354563:S753Y;ENSP00000412866:S611Y;ENSP00000265417:S753Y;ENSP00000441581:S182Y	ENSP00000265417:S753Y	S	-	2	0	GPR116	46936532	0.550000	0.26489	0.946000	0.38457	0.340000	0.28889	1.614000	0.36911	2.689000	0.91719	0.655000	0.94253	TCT	GPR116	-	NULL	ENSG00000069122		0.418	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2		0.00	62	0	G	NM_015234		46828573	-1			no_errors	ENST00000265417	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.950	T
GPR142	350383	genome.wustl.edu	37	17	72363872	72363872	+	Silent	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:72363872C>A	ENST00000335666.4	+	1	276	c.228C>A	c.(226-228)tcC>tcA	p.S76S		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	76						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CCAAGGACTCCAGCAGTTTCC	0.562																																																	0													54.0	50.0	51.0					17																	72363872		2203	4300	6503	SO:0001819	synonymous_variant	0			AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.228C>A	17.37:g.72363872C>A			A4CYJ8|Q86SL3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S76	ENST00000335666.4	37	c.228	CCDS11698.1	17																																																																																			GPR142	-	NULL	ENSG00000257008		0.562	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR142	HGNC	protein_coding	OTTHUMT00000442545.1	-	0.00	30	0	C	NM_181790		72363872	+1	tier1	-	no_errors	ENST00000335666	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.991	A
HECTD4	283450	genome.wustl.edu	37	12	112720968	112720968	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:112720968G>A	ENST00000430131.2	-	8	1437	c.292C>T	c.(292-294)Ctt>Ttt	p.L98F	HECTD4_ENST00000550722.1_Missense_Mutation_p.L348F|HECTD4_ENST00000377560.5_Missense_Mutation_p.L348F			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	98					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										AGGGCAGCAAGCGTTGCTGAC	0.463																																																	0													103.0	101.0	102.0					12																	112720968		1986	4159	6145	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.292C>T	12.37:g.112720968G>A	ENSP00000404379:p.Leu98Phe		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.L348F	ENST00000430131.2	37	c.1042		12	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420118	0.62622	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.63096	0.35;-0.02;0.32	5.58	4.69	0.59074	.	.	.	.	.	T	0.63153	0.2487	N	0.14661	0.345	0.34847	D	0.741266	D	0.65815	0.995	D	0.72982	0.979	T	0.73946	-0.3822	9	0.72032	D	0.01	.	11.3332	0.49487	0.1928:0.0:0.8072:0.0	.	98	Q9Y4D8	K0614_HUMAN	F	348;98;348	ENSP00000366783:L348F;ENSP00000404379:L98F;ENSP00000449784:L348F	ENSP00000366783:L348F	L	-	1	0	C12orf51	111205351	1.000000	0.71417	0.360000	0.25837	0.631000	0.37964	3.037000	0.49775	1.370000	0.46153	0.555000	0.69702	CTT	HECTD4	-	NULL	ENSG00000173064		0.463	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	46	0	G	NM_173813		112720968	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	missense	45.28	29	24	SNP	0.777	A
HECW1	23072	genome.wustl.edu	37	7	43157831	43157831	+	Intron	DEL	A	A	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:43157831delA	ENST00000395891.2	+	2	574				HECW1_ENST00000453890.1_Intron|HECW1-IT1_ENST00000322220.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TGTGTGAAAGAAAAAAAAAAG	0.348																																																	0																																										SO:0001627	intron_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.-32+3841A>-	7.37:g.43157831delA			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	RNA	DEL	-	NULL	ENST00000395891.2	37	NULL	CCDS5469.2	7																																																																																			HECW1-IT1	-	-	ENSG00000181211		0.348	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1-IT1	HGNC	protein_coding	OTTHUMT00000250893.2		0.00	45	0	A	NM_015052		43157831	+1	tier1		no_errors	ENST00000322220	ensembl	human	known	74_37	rna	8.70	42	4	DEL	0.000	-
HGS	9146	genome.wustl.edu	37	17	79662971	79662971	+	Silent	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:79662971C>T	ENST00000329138.4	+	15	1470	c.1335C>T	c.(1333-1335)tcC>tcT	p.S445S		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	445	Interaction with SNAP25 and TRAK2. {ECO:0000250}.|Interaction with SNX1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			TCTTCCAGTCCATCAACGGCA	0.652																																																	0													65.0	51.0	56.0					17																	79662971		2203	4300	6503	SO:0001819	synonymous_variant	0			D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.1335C>T	17.37:g.79662971C>T			Q9NR36	Silent	SNP	pfam_VHS,pfam_HRS_helical,pfam_Znf_FYVE,superfamily_ENTH_VHS,superfamily_Znf_FYVE_PHD,smart_VHS_subgr,smart_Znf_FYVE,pirsf_Ubi-bd_Hrs_VPS27,pfscan_Ubiquitin-int_motif,pfscan_VHS,pfscan_Znf_FYVE-rel	p.S445	ENST00000329138.4	37	c.1335	CCDS11784.1	17																																																																																			HGS	-	pfam_HRS_helical,pirsf_Ubi-bd_Hrs_VPS27	ENSG00000185359		0.652	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGS	HGNC	protein_coding	OTTHUMT00000440541.1	-	0.00	35	0	C	NM_004712		79662971	+1	tier1	-	no_errors	ENST00000329138	ensembl	human	known	74_37	silent	45.83	13	11	SNP	1.000	T
HOXD10	3236	genome.wustl.edu	37	2	176983939	176983939	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr2:176983939G>T	ENST00000249501.4	+	2	1258	c.1003G>T	c.(1003-1005)Gcc>Tcc	p.A335S	HOXD10_ENST00000490088.2_3'UTR|HOXD-AS2_ENST00000440016.2_RNA	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	335					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		AGAACTGACCGCCAACCTCAC	0.577																																																	0													34.0	36.0	35.0					2																	176983939		2203	4299	6502	SO:0001583	missense	0				CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.1003G>T	2.37:g.176983939G>T	ENSP00000249501:p.Ala335Ser		Q6NT10	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.A335S	ENST00000249501.4	37	c.1003	CCDS2266.1	2	.	.	.	.	.	.	.	.	.	.	G	9.300	1.052845	0.19907	.	.	ENSG00000128710	ENST00000249501	D	0.93659	-3.26	5.94	5.94	0.96194	.	0.053033	0.85682	D	0.000000	D	0.86674	0.5989	N	0.11870	0.19	0.50632	D	0.999888	B	0.23377	0.084	B	0.18871	0.023	T	0.82094	-0.0627	10	0.11794	T	0.64	.	19.9695	0.97278	0.0:0.0:1.0:0.0	.	335	P28358	HXD10_HUMAN	S	335	ENSP00000249501:A335S	ENSP00000249501:A335S	A	+	1	0	HOXD10	176692185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.348000	0.79366	2.816000	0.96949	0.561000	0.74099	GCC	HOXD10	-	NULL	ENSG00000128710		0.577	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXD10	HGNC	protein_coding	OTTHUMT00000255692.2		0.00	81	0	G			176983939	+1			no_errors	ENST00000249501	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
IGHMBP2	3508	genome.wustl.edu	37	11	68675711	68675711	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr11:68675711G>A	ENST00000255078.3	+	3	466	c.355G>A	c.(355-357)Gat>Aat	p.D119N	IGHMBP2_ENST00000539224.1_Missense_Mutation_p.D119N	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	119					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GGTGGCCTTTGATGAGTCCCA	0.512																																																	0													135.0	129.0	131.0					11																	68675711		2200	4294	6494	SO:0001583	missense	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.355G>A	11.37:g.68675711G>A	ENSP00000255078:p.Asp119Asn		A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	pfam_R3H_ss-bd,pfam_Znf_AN1,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_R3H_ss-bd,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_R3H_ss-bd,tigrfam_DNA_helicase_put	p.D119N	ENST00000255078.3	37	c.355	CCDS8187.1	11	.	.	.	.	.	.	.	.	.	.	G	31	5.062597	0.93898	.	.	ENSG00000132740	ENST00000255078;ENST00000539224	D;T	0.91631	-2.88;-0.93	4.09	4.09	0.47781	.	0.127194	0.50627	D	0.000104	D	0.92378	0.7581	M	0.83312	2.635	0.58432	D	0.999999	P	0.38167	0.621	B	0.38683	0.279	D	0.93389	0.6750	10	0.54805	T	0.06	1.0E-4	15.2642	0.73649	0.0:0.0:1.0:0.0	.	119	P38935	SMBP2_HUMAN	N	119	ENSP00000255078:D119N;ENSP00000440465:D119N	ENSP00000255078:D119N	D	+	1	0	IGHMBP2	68432287	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.049000	0.93837	2.117000	0.64856	0.549000	0.68633	GAT	IGHMBP2	-	tigrfam_DNA_helicase_put	ENSG00000132740		0.512	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	-	0.00	84	0	G	NM_002180		68675711	+1	tier1	-	no_errors	ENST00000255078	ensembl	human	known	74_37	missense	13.37	635	98	SNP	1.000	A
IKBKE	9641	genome.wustl.edu	37	1	206653841	206653841	+	Silent	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:206653841C>T	ENST00000367120.3	+	13	1765	c.1392C>T	c.(1390-1392)tcC>tcT	p.S464S	IKBKE_ENST00000537984.1_Silent_p.S379S	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	464	Interaction with DDX3X.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					CAAGGACATCCCTCCTCTACC	0.617																																																	0													106.0	79.0	88.0					1																	206653841		2203	4300	6503	SO:0001819	synonymous_variant	0			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1392C>T	1.37:g.206653841C>T			D3DT78|Q3B754|Q3KR43|Q5JTS6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S464	ENST00000367120.3	37	c.1392	CCDS30996.1	1																																																																																			IKBKE	-	NULL	ENSG00000143466		0.617	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKE	HGNC	protein_coding	OTTHUMT00000088484.1	-	0.00	56	0	C			206653841	+1	tier1	-	no_errors	ENST00000367120	ensembl	human	known	74_37	silent	73.53	18	50	SNP	0.745	T
PLA2G4B	100137049	genome.wustl.edu	37	15	42133260	42133260	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:42133260G>T	ENST00000452633.1	+	6	711	c.359G>T	c.(358-360)gGg>gTg	p.G120V	JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.G351V|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.G351V|PLA2G4B_ENST00000458483.1_Missense_Mutation_p.G120V|PLA2G4B_ENST00000542534.2_Missense_Mutation_p.G351V			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	120					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		CAGGGTGAGGGGCGCCTGGAA	0.557																																																	0													101.0	104.0	103.0					15																	42133260		2203	4300	6503	SO:0001583	missense	0			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.359G>T	15.37:g.42133260G>T	ENSP00000396045:p.Gly120Val		B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.G351V	ENST00000452633.1	37	c.1052	CCDS45241.1	15	.	.	.	.	.	.	.	.	.	.	.	11.69	1.715320	0.30413	.	.	ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000342159;ENST00000458483;ENST00000452633	T;T;T;T	0.07021	3.23;3.23;3.23;3.23	4.7	-2.42	0.06542	C2 calcium/lipid-binding domain, CaLB (1);	1.047430	0.07494	N	0.906083	T	0.04998	0.0134	N	0.22421	0.69	0.18873	N	0.999985	B;B;B	0.23249	0.007;0.013;0.082	B;B;B	0.21917	0.005;0.037;0.037	T	0.43686	-0.9376	10	0.35671	T	0.21	-9.2673	3.191	0.06616	0.3825:0.0:0.3171:0.3004	.	120;351;351	P0C869;P0C869-7;P0C869-6	PA24B_HUMAN;.;.	V	351;351;120;120	ENSP00000371886:G351V;ENSP00000342785:G351V;ENSP00000416610:G120V;ENSP00000396045:G120V	ENSP00000342785:G351V	G	+	2	0	JMJD7-PLA2G4B;PLA2G4B	39920552	0.003000	0.15002	0.000000	0.03702	0.147000	0.21601	0.572000	0.23684	-0.529000	0.06358	-0.345000	0.07892	GGG	JMJD7-PLA2G4B	-	superfamily_C2_dom	ENSG00000168970		0.557	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000345969.1		0.00	58	0	G	NM_001114633		42133260	+1			no_errors	ENST00000382448	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.000	T
IQGAP1	8826	genome.wustl.edu	37	15	91026647	91026647	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:91026647G>A	ENST00000268182.5	+	29	3734	c.3610G>A	c.(3610-3612)Gat>Aat	p.D1204N	IQGAP1_ENST00000560738.1_Missense_Mutation_p.D632N	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1204	C1.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TGTTGCTCCTGATGCCTTTGA	0.448																																																	0													79.0	72.0	74.0					15																	91026647		2198	4298	6496	SO:0001583	missense	0			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.3610G>A	15.37:g.91026647G>A	ENSP00000268182:p.Asp1204Asn		A7MBM3	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,pfam_WW_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_WW_dom,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_dom,pfscan_RasGAP	p.D1204N	ENST00000268182.5	37	c.3610	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.276420	0.95459	.	.	ENSG00000140575	ENST00000268182	D	0.82803	-1.65	5.34	5.34	0.76211	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.114616	0.64402	D	0.000017	D	0.93070	0.7794	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.93792	0.7093	10	0.72032	D	0.01	-31.8402	18.5696	0.91130	0.0:0.0:1.0:0.0	.	1204	P46940	IQGA1_HUMAN	N	1204	ENSP00000268182:D1204N	ENSP00000268182:D1204N	D	+	1	0	IQGAP1	88827651	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.410000	0.97335	2.937000	0.99478	0.650000	0.86243	GAT	IQGAP1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000140575		0.448	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1	-	0.00	68	0	G	NM_003870		91026647	+1	tier1	-	no_errors	ENST00000268182	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
KBTBD6	89890	genome.wustl.edu	37	13	41705906	41705906	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr13:41705906C>A	ENST00000379485.1	-	1	976	c.742G>T	c.(742-744)Gag>Tag	p.E248*	KBTBD6_ENST00000499385.2_Nonsense_Mutation_p.E182*	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	248										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		GGAGCAGCCTCCAGCCACTGC	0.582																																																	0													67.0	68.0	68.0					13																	41705906		2203	4300	6503	SO:0001587	stop_gained	0			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.742G>T	13.37:g.41705906C>A	ENSP00000368799:p.Glu248*		Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Nonsense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.E248*	ENST00000379485.1	37	c.742	CCDS9376.1	13	.	.	.	.	.	.	.	.	.	.	c	37	6.601346	0.97697	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	.	.	.	3.69	2.83	0.33086	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	10.4062	0.44258	0.197:0.803:0.0:0.0	.	.	.	.	X	248;182	.	ENSP00000368799:E248X	E	-	1	0	KBTBD6	40603906	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	4.215000	0.58534	0.875000	0.35847	0.462000	0.41574	GAG	KBTBD6	-	pfam_BACK,smart_BACK	ENSG00000165572		0.582	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD6	HGNC	protein_coding	OTTHUMT00000044657.1		0.00	42	0	C	NM_152903		41705906	-1			no_errors	ENST00000379485	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	1.000	A
KIAA1407	57577	genome.wustl.edu	37	3	113697175	113697175	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr3:113697175C>A	ENST00000295878.3	-	16	2610	c.2464G>T	c.(2464-2466)Gtg>Ttg	p.V822L	KIAA1407_ENST00000545063.1_3'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	822										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						AGATCAATCACGTACTGGGGA	0.353																																																	0													57.0	57.0	57.0					3																	113697175		2203	4300	6503	SO:0001583	missense	0			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2464G>T	3.37:g.113697175C>A	ENSP00000295878:p.Val822Leu		B4DYL1|Q9P2E0	Missense_Mutation	SNP	NULL	p.V822L	ENST00000295878.3	37	c.2464	CCDS2977.1	3	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361727	0.01235	.	.	ENSG00000163617	ENST00000295878	T	0.32753	1.44	4.31	-7.5	0.01351	.	1.842820	0.02270	N	0.068417	T	0.08044	0.0201	N	0.02674	-0.535	0.21579	N	0.999639	B	0.02656	0.0	B	0.04013	0.001	T	0.25606	-1.0127	10	0.02654	T	1	.	2.0642	0.03599	0.1514:0.3411:0.1426:0.365	.	822	Q8NCU4	K1407_HUMAN	L	822	ENSP00000295878:V822L	ENSP00000295878:V822L	V	-	1	0	KIAA1407	115179865	0.053000	0.20554	0.001000	0.08648	0.017000	0.09413	-0.460000	0.06720	-1.366000	0.02155	-1.910000	0.00522	GTG	KIAA1407	-	NULL	ENSG00000163617		0.353	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	HGNC	protein_coding	OTTHUMT00000354724.2	-	0.00	49	0	C	NM_020817		113697175	-1	tier1	-	no_errors	ENST00000295878	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.000	A
KLHL9	55958	genome.wustl.edu	37	9	21333629	21333629	+	Silent	SNP	A	A	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:21333629A>G	ENST00000359039.4	-	1	1750	c.1230T>C	c.(1228-1230)gcT>gcC	p.A410A	KLHL9_ENST00000537938.1_Silent_p.A342A			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	410					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.A410A(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		CCAGTTCACCAGCTGCACTGC	0.443																																																	1	Substitution - coding silent(1)	ovary(1)											112.0	101.0	105.0					9																	21333629		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.1230T>C	9.37:g.21333629A>G			Q8TCQ2	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A410	ENST00000359039.4	37	c.1230	CCDS6503.1	9																																																																																			KLHL9	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000198642		0.443	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL9	HGNC	protein_coding	OTTHUMT00000051898.2		0.00	59	0	A	NM_018847		21333629	-1			no_errors	ENST00000359039	ensembl	human	known	74_37	silent	5.41	35	2	SNP	1.000	G
LAMA5	3911	genome.wustl.edu	37	20	60912736	60912736	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:60912736G>A	ENST00000252999.3	-	16	2140	c.2074C>T	c.(2074-2076)Cgg>Tgg	p.R692W		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	692	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TGCCCACTCCGGGGGTCACAG	0.662																																																	0													28.0	29.0	29.0					20																	60912736		2202	4294	6496	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.2074C>T	20.37:g.60912736G>A	ENSP00000252999:p.Arg692Trp		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.R692W	ENST00000252999.3	37	c.2074	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025086	0.35701	.	.	ENSG00000130702	ENST00000252999	T	0.62105	0.05	4.89	2.79	0.32731	EGF-like, laminin (3);	1.182250	0.06200	N	0.683052	T	0.61048	0.2316	L	0.32530	0.975	0.25765	N	0.984908	D	0.67145	0.996	P	0.51229	0.663	T	0.51474	-0.8701	10	0.52906	T	0.07	.	8.876	0.35345	0.0:0.2548:0.6239:0.1213	.	692	O15230	LAMA5_HUMAN	W	692	ENSP00000252999:R692W	ENSP00000252999:R692W	R	-	1	2	LAMA5	60346131	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.864000	0.27926	0.980000	0.38523	0.650000	0.86243	CGG	LAMA5	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin	ENSG00000130702		0.662	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	-	0.00	61	0	G	NM_005560		60912736	-1	tier1	-	no_errors	ENST00000252999	ensembl	human	known	74_37	missense	35.21	46	25	SNP	0.003	A
LGI2	55203	genome.wustl.edu	37	4	25005844	25005844	+	Silent	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr4:25005844G>A	ENST00000382114.4	-	8	1052	c.867C>T	c.(865-867)gtC>gtT	p.V289V		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	289						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				CCACCACAAAGACCTGATCAT	0.463																																																	0													162.0	163.0	163.0					4																	25005844		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.867C>T	4.37:g.25005844G>A			Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Silent	SNP	pfam_EPTP,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.V289	ENST00000382114.4	37	c.867	CCDS3431.1	4																																																																																			LGI2	-	pfam_EPTP	ENSG00000153012		0.463	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI2	HGNC	protein_coding	OTTHUMT00000214978.1		0.00	27	0	G			25005844	-1			no_errors	ENST00000382114	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.997	A
LGSN	51557	genome.wustl.edu	37	6	63995557	63995557	+	Silent	SNP	G	G	T	rs556886901		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:63995557G>T	ENST00000370657.4	-	3	298	c.265C>A	c.(265-267)Cga>Aga	p.R89R	LGSN_ENST00000370658.5_Silent_p.R89R			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	89					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)	p.R89*(1)		NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GCTTCAAATCGTACAAACTGG	0.433																																																	1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											123.0	103.0	109.0					6																	63995557		2203	4300	6503	SO:0001819	synonymous_variant	0			AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.265C>A	6.37:g.63995557G>T			A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Silent	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.R89	ENST00000370657.4	37	c.265	CCDS4964.1	6																																																																																			LGSN	-	pfam_Gln_synt_beta,superfamily_Gln_synt_beta	ENSG00000146166		0.433	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGSN	HGNC	protein_coding	OTTHUMT00000041076.2		0.00	74	0	G	NM_016571		63995557	-1			no_errors	ENST00000370657	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.999	T
LILRB5	10990	genome.wustl.edu	37	19	54761022	54761022	+	Splice_Site	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:54761022C>T	ENST00000316219.5	-	1	142		c.e1+1		LILRB5_ENST00000449561.2_Splice_Site|LILRB5_ENST00000450632.1_Splice_Site|LILRB5_ENST00000345866.6_Splice_Site	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCAAACCTCACCGAGGCAAAT	0.582																																																	0													83.0	77.0	79.0					19																	54761022		2203	4300	6503	SO:0001630	splice_region_variant	0			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.34+1G>A	19.37:g.54761022C>T			Q8N760	Splice_Site	SNP	-	e1+1	ENST00000316219.5	37	c.34+1	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	.	10.91	1.483497	0.26598	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	.	.	.	3.13	3.13	0.36017	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8749	0.41197	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LILRB5	59452834	0.777000	0.28628	0.845000	0.33349	0.057000	0.15508	3.218000	0.51192	1.747000	0.51819	0.573000	0.79308	.	LILRB5	-	-	ENSG00000105609		0.582	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	-	0.00	77	0	C		Intron	54761022	-1	tier1	-	no_errors	ENST00000450632	ensembl	human	known	74_37	splice_site	12.50	28	4	SNP	0.978	T
CADM3	57863	genome.wustl.edu	37	1	159166613	159166613	+	Intron	DEL	T	T	-	rs533935187		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:159166613delT	ENST00000368125.4	+	7	939				CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Intron	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CTCCCAGTTATTTTTTTTTTT	0.527											OREG0013913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.783-68T>-	1.37:g.159166613delT		1799	Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	DEL	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			CTA-134P22.2	-	-	ENSG00000225670		0.527	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1		0.00	17	0	T	NM_021189		159166613	-1	tier1		no_errors	ENST00000415675	ensembl	human	known	74_37	rna	13.64	19	3	DEL	0.000	-
LRRC63	220416	genome.wustl.edu	37	13	46844683	46844683	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr13:46844683G>T	ENST00000446175.1	+	11	2017	c.1672G>T	c.(1672-1674)Gaa>Taa	p.E558*	LRRC63_ENST00000595396.1_Intron	NM_001282460.1	NP_001269389.1	Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	557										lung(1)|ovary(1)	2						AAACATAACAGAAGGGTTACT	0.383																																																	0																																										SO:0001587	stop_gained	0				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000446175.1:c.1672G>T	13.37:g.46844683G>T	ENSP00000408828:p.Glu558*		Q5TBN0	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E558*	ENST00000446175.1	37	c.1672		13	.	.	.	.	.	.	.	.	.	.	G	35	5.542874	0.96474	.	.	ENSG00000173988	ENST00000446175	.	.	.	1.53	0.526	0.17078	.	.	.	.	.	.	.	.	.	.	.	0.51482	D	0.999921	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	4.7277	0.12948	0.0:0.0:0.6341:0.3659	.	.	.	.	X	558	.	ENSP00000408828:E558X	E	+	1	0	LRRC63	45742684	0.976000	0.34144	0.729000	0.30791	0.048000	0.14542	0.433000	0.21477	-0.053000	0.13289	-0.694000	0.03704	GAA	LRRC63	-	NULL	ENSG00000173988		0.383	LRRC63-201	KNOWN	basic|appris_candidate	protein_coding	LRRC63	HGNC	protein_coding		-	0.00	48	0	G	XM_001718341		46844683	+1	tier1	-	no_errors	ENST00000446175	ensembl	human	known	74_37	nonsense	20.00	16	4	SNP	0.983	T
MAPK6	5597	genome.wustl.edu	37	15	52356854	52356854	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:52356854A>T	ENST00000261845.5	+	6	2630	c.1823A>T	c.(1822-1824)aAt>aTt	p.N608I	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	608					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TTTTTCATAAATCAGTTTTGT	0.408																																																	0													74.0	75.0	75.0					15																	52356854		2195	4293	6488	SO:0001583	missense	0			L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.1823A>T	15.37:g.52356854A>T	ENSP00000261845:p.Asn608Ile		B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK3/4	p.N608I	ENST00000261845.5	37	c.1823	CCDS10147.1	15	.	.	.	.	.	.	.	.	.	.	A	10.16	1.274695	0.23307	.	.	ENSG00000069956	ENST00000261845	T	0.71698	-0.59	5.27	1.12	0.20585	.	0.216427	0.53938	D	0.000046	T	0.53174	0.1780	N	0.24115	0.695	0.29103	N	0.881341	B	0.14438	0.01	B	0.17433	0.018	T	0.50083	-0.8869	10	0.87932	D	0	-6.4461	8.5705	0.33567	0.7333:0.0:0.2667:0.0	.	608	Q16659	MK06_HUMAN	I	608	ENSP00000261845:N608I	ENSP00000261845:N608I	N	+	2	0	MAPK6	50144146	1.000000	0.71417	0.985000	0.45067	0.964000	0.63967	4.856000	0.62932	-0.031000	0.13781	-0.486000	0.04755	AAT	MAPK6	-	NULL	ENSG00000069956		0.408	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	-	0.00	111	0	A	NM_002748		52356854	+1	tier1	-	no_errors	ENST00000261845	ensembl	human	known	74_37	missense	59.74	31	46	SNP	1.000	T
MED12L	116931	genome.wustl.edu	37	3	151148114	151148116	+	In_Frame_Del	DEL	CAG	CAG	-	rs147600909		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr3:151148114_151148116delCAG	ENST00000474524.1	+	42	6369_6371	c.6331_6333delCAG	c.(6331-6333)cagdel	p.Q2115del	MED12L_ENST00000273432.4_In_Frame_Del_p.Q1779del	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2115	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q2111E(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GCAGCAGACCCAGCAGCAGCAGC	0.527																																																	1	Substitution - Missense(1)	lung(1)																																								SO:0001651	inframe_deletion	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6331_6333delCAG	3.37:g.151148123_151148125delCAG	ENSP00000417235:p.Gln2115del		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	In_Frame_Del	DEL	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.Q2114in_frame_del	ENST00000474524.1	37	c.6331_6333	CCDS33876.1	3																																																																																			MED12L	-	NULL	ENSG00000144893		0.527	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2		0.00	37	0	CAG	NM_053002		151148116	+1	tier1		no_errors	ENST00000474524	ensembl	human	known	74_37	in_frame_del	5.41	35	2	DEL	0.998:1.000:1.000	-
CENPU	79682	genome.wustl.edu	37	4	185631239	185631239	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr4:185631239G>T	ENST00000281453.5	-	8	854	c.784C>A	c.(784-786)Cac>Aac	p.H262N	MLF1IP_ENST00000541971.1_Missense_Mutation_p.H262N|MLF1IP_ENST00000506535.1_5'UTR	NM_024629.3	NP_078905.2														endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|stomach(1)	13		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		TGCTCTAGGTGGGTTTTCTCA	0.363																																																	0													131.0	118.0	123.0					4																	185631239		2203	4300	6503	SO:0001583	missense	0																														ENST00000281453.5:c.784C>A	4.37:g.185631239G>T	ENSP00000281453:p.His262Asn			Missense_Mutation	SNP	NULL	p.H262N	ENST00000281453.5	37	c.784	CCDS3838.1	4	.	.	.	.	.	.	.	.	.	.	G	1.854	-0.464423	0.04476	.	.	ENSG00000151725	ENST00000281453;ENST00000541665;ENST00000541971	T;T	0.22134	1.97;1.97	4.24	-8.47	0.00939	.	1.533070	0.03686	N	0.246341	T	0.10723	0.0262	N	0.22421	0.69	0.09310	N	1	P;P	0.45768	0.716;0.866	B;B	0.38655	0.206;0.278	T	0.26677	-1.0096	10	0.36615	T	0.2	-31.7426	5.8052	0.18436	0.4442:0.0:0.1106:0.4452	.	262;262	Q09GN1;Q71F23	.;CENPU_HUMAN	N	262	ENSP00000281453:H262N;ENSP00000445862:H262N	ENSP00000281453:H262N	H	-	1	0	MLF1IP	185868233	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-2.304000	0.01134	-1.992000	0.00975	0.655000	0.94253	CAC	MLF1IP	-	NULL	ENSG00000151725		0.363	MLF1IP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLF1IP	HGNC	protein_coding	OTTHUMT00000360841.2	-	0.00	48	0	G			185631239	-1	tier1	-	no_errors	ENST00000281453	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.000	T
MLXIPL	51085	genome.wustl.edu	37	7	73008267	73008267	+	Silent	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:73008267C>T	ENST00000313375.3	-	17	2534	c.2487G>A	c.(2485-2487)ctG>ctA	p.L829L	MLXIPL_ENST00000429400.2_Silent_p.L810L|MLXIPL_ENST00000434326.1_3'UTR|MLXIPL_ENST00000395189.1_Silent_p.L736L|MLXIPL_ENST00000414749.2_Silent_p.L827L|MLXIPL_ENST00000354613.1_Silent_p.L808L	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	829					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				CCGGGTCGGTCAGGATACTGG	0.612																																																	0													75.0	69.0	71.0					7																	73008267		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.2487G>A	7.37:g.73008267C>T			C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L829	ENST00000313375.3	37	c.2487	CCDS5553.1	7																																																																																			MLXIPL	-	NULL	ENSG00000009950		0.612	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLXIPL	HGNC	protein_coding	OTTHUMT00000252262.1	-	0.00	53	0	C	NM_032951		73008267	-1	tier1	-	no_errors	ENST00000313375	ensembl	human	known	74_37	silent	57.14	6	8	SNP	1.000	T
MROH1	727957	genome.wustl.edu	37	8	145247236	145247236	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr8:145247236G>T	ENST00000528919.1	+	9	1001	c.880G>T	c.(880-882)Gct>Tct	p.A294S	MROH1_ENST00000423230.2_Missense_Mutation_p.A294S|MROH1_ENST00000398656.4_Missense_Mutation_p.A294S|MROH1_ENST00000534366.1_Missense_Mutation_p.A294S|MROH1_ENST00000326134.5_Missense_Mutation_p.A294S	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1	294																	CCTCGAGGCAGCTGTGAGTGT	0.662																																																	0													20.0	26.0	24.0					8																	145247236		2052	4201	6253	SO:0001583	missense	0				CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.880G>T	8.37:g.145247236G>T	ENSP00000435565:p.Ala294Ser		C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A294S	ENST00000528919.1	37	c.880	CCDS47938.1	8	.	.	.	.	.	.	.	.	.	.	G	8.317	0.823536	0.16678	.	.	ENSG00000179832	ENST00000423230;ENST00000398656;ENST00000534366;ENST00000528919;ENST00000326134;ENST00000356585	T;T;T;T;T	0.78364	-0.15;-1.17;-1.17;-1.17;-1.17	5.25	3.26	0.37387	Armadillo-like helical (1);Armadillo-type fold (1);	0.080992	0.50627	U	0.000105	T	0.52075	0.1712	N	0.11064	0.09	0.80722	D	1	B;P;P;B;P	0.43750	0.204;0.816;0.816;0.184;0.708	B;B;B;B;B	0.36534	0.084;0.152;0.152;0.172;0.227	T	0.47898	-0.9081	10	0.20519	T	0.43	.	7.3655	0.26770	0.0968:0.0:0.7025:0.2007	.	294;294;294;294;294	Q8NDA8-2;E9PHY8;Q8NDA8;Q8NDA8-4;Q8NDA8-5	.;.;HTR7A_HUMAN;.;.	S	294;294;294;294;294;226	ENSP00000388174:A294S;ENSP00000381649:A294S;ENSP00000436636:A294S;ENSP00000435565:A294S;ENSP00000321737:A294S	ENSP00000321737:A294S	A	+	1	0	HEATR7A	145319224	0.811000	0.29063	0.026000	0.17262	0.368000	0.29767	1.478000	0.35442	1.218000	0.43458	0.563000	0.77884	GCT	MROH1	-	superfamily_ARM-type_fold	ENSG00000179832		0.662	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MROH1	HGNC	protein_coding	OTTHUMT00000386183.1	-	0.00	72	0	G	NM_032450		145247236	+1	tier1	-	no_errors	ENST00000326134	ensembl	human	known	74_37	missense	20.75	42	11	SNP	0.540	T
MRPS12	6183	genome.wustl.edu	37	19	39422990	39422990	+	Missense_Mutation	SNP	C	C	T	rs150096976	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:39422990C>T	ENST00000407800.2	+	2	408	c.67C>T	c.(67-69)Cgg>Tgg	p.R23W	MRPS12_ENST00000308018.4_Missense_Mutation_p.R23W|CTC-360G5.8_ENST00000599996.1_Intron|CTC-360G5.9_ENST00000599320.1_lincRNA|SARS2_ENST00000448145.2_Intron|SARS2_ENST00000430193.3_5'Flank|SARS2_ENST00000221431.6_5'Flank|SARS2_ENST00000594171.1_5'Flank|SARS2_ENST00000600042.1_5'Flank|MRPS12_ENST00000402029.3_Missense_Mutation_p.R23W	NM_021107.1	NP_066930.1	O15235	RT12_HUMAN	mitochondrial ribosomal protein S12	23					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)	2	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TCTGGTTCCCCGGCTCTGGGC	0.607																																																	0								C	TRP/ARG,TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	42.0	49.0	47.0		67,67,67	3.5	0.1	19	dbSNP_134	47	0,8600		0,0,4300	no	missense,missense,missense	MRPS12	NM_021107.1,NM_033362.3,NM_033363.1	101,101,101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	23/139,23/139,23/139	39422990	2,13004	2203	4300	6503	SO:0001583	missense	0			Y11681	CCDS12525.1	19q13.1-q13.2	2012-09-13			ENSG00000128626	ENSG00000128626		"""Mitochondrial ribosomal proteins / small subunits"""	10380	protein-coding gene	gene with protein product		603021		RPMS12		9545647, 9790755	Standard	NM_021107		Approved	RPS12, RPSM12	uc002oke.3	O15235		ENST00000407800.2:c.67C>T	19.37:g.39422990C>T	ENSP00000384952:p.Arg23Trp		Q53X98	Missense_Mutation	SNP	pfam_Ribosomal_S12/S23,superfamily_NA-bd_OB-fold,pirsf_Ribosomal_S12/S23,prints_Ribosomal_S12_bac,tigrfam_Ribosomal_S12_bac	p.R23W	ENST00000407800.2	37	c.67	CCDS12525.1	19	.	.	.	.	.	.	.	.	.	.	C	9.245	1.039349	0.19669	4.54E-4	0.0	ENSG00000128626	ENST00000308018;ENST00000407800;ENST00000402029	T;T;T	0.48201	0.82;0.82;0.82	5.63	3.5	0.40072	.	1.379600	0.04404	N	0.364758	T	0.37073	0.0990	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.31888	-0.9927	10	0.87932	D	0	-13.6901	8.3656	0.32385	0.0:0.6241:0.2962:0.0797	.	23	O15235	RT12_HUMAN	W	23	ENSP00000308845:R23W;ENSP00000384952:R23W;ENSP00000384579:R23W	ENSP00000308845:R23W	R	+	1	2	MRPS12	44114830	0.000000	0.05858	0.079000	0.20413	0.071000	0.16799	0.651000	0.24873	0.839000	0.34971	0.655000	0.94253	CGG	MRPS12	-	NULL	ENSG00000128626		0.607	MRPS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS12	HGNC	protein_coding	OTTHUMT00000463154.1	-	0.00	101	0	C			39422990	+1	tier1	rs150096976	no_errors	ENST00000308018	ensembl	human	known	74_37	missense	44.30	44	35	SNP	0.127	T
MUC12	10071	genome.wustl.edu	37	7	100652423	100652423	+	Silent	SNP	G	G	T	rs547857513		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:100652423G>T	ENST00000379442.3	+	8	15663	c.15663G>T	c.(15661-15663)gtG>gtT	p.V5221V	MUC12_ENST00000536621.1_Silent_p.V5078V			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	5221	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ATAGAGGGGTGAACATTCGGA	0.483																																																	0													240.0	200.0	212.0					7																	100652423		692	1591	2283	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.15663G>T	7.37:g.100652423G>T			A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA_dom	p.V5078	ENST00000379442.3	37	c.15234		7																																																																																			MUC12	-	pfam_SEA_dom	ENSG00000205277		0.483	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1		0.00	55	0	G	XM_379904		100652423	+1			no_errors	ENST00000536621	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.005	T
MUM1L1	139221	genome.wustl.edu	37	X	105450010	105450010	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chrX:105450010delT	ENST00000357175.2	+	4	1234	c.585delT	c.(583-585)actfs	p.T195fs	MUM1L1_ENST00000372552.1_Frame_Shift_Del_p.T195fs|MUM1L1_ENST00000337685.2_Frame_Shift_Del_p.T195fs	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	195						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGTGCGAGACTTTCCCTTCAC	0.388																																																	0													72.0	61.0	64.0					X																	105450010		1883	4097	5980	SO:0001589	frameshift_variant	0			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.585delT	X.37:g.105450010delT	ENSP00000349699:p.Thr195fs		D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Frame_Shift_Del	DEL	superfamily_PyrdxlP-dep_Trfase	p.F196fs	ENST00000357175.2	37	c.585	CCDS55469.1	X																																																																																			MUM1L1	-	NULL	ENSG00000157502		0.388	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	HGNC	protein_coding	OTTHUMT00000057795.1		0.00	34	0	T	NM_152423		105450010	+1	tier1		no_errors	ENST00000337685	ensembl	human	known	74_37	frame_shift_del	22.22	7	2	DEL	0.000	-
MVP	9961	genome.wustl.edu	37	16	29853263	29853263	+	Silent	SNP	G	G	A	rs537113581		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr16:29853263G>A	ENST00000357402.5	+	10	1602	c.1464G>A	c.(1462-1464)tcG>tcA	p.S488S	MVP_ENST00000395353.1_Silent_p.S488S|MVP_ENST00000452209.2_3'UTR	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	488					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						AGCTGGTGTCGCTGGGTCCTG	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		17155	0.0		0.0	False		,,,				2504	0.001																0													45.0	48.0	47.0					16																	29853263		2197	4300	6497	SO:0001819	synonymous_variant	0			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.1464G>A	16.37:g.29853263G>A			Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Silent	SNP	pfam_Vault_N,pfam_MVP_shoulder	p.S488	ENST00000357402.5	37	c.1464	CCDS10656.1	16																																																																																			MVP	-	NULL	ENSG00000013364		0.672	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVP	HGNC	protein_coding	OTTHUMT00000109711.3		0.00	48	0	G	NM_005115		29853263	+1			no_errors	ENST00000357402	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.001	A
MYOM2	9172	genome.wustl.edu	37	8	2040194	2040194	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr8:2040194C>T	ENST00000262113.4	+	16	1990	c.1849C>T	c.(1849-1851)Cgg>Tgg	p.R617W	MYOM2_ENST00000523438.1_Missense_Mutation_p.R42W	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	617	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TGCTCCGGGTCGGGTTCTTGC	0.547																																																	0													194.0	194.0	194.0					8																	2040194		2203	4300	6503	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1849C>T	8.37:g.2040194C>T	ENSP00000262113:p.Arg617Trp		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R617W	ENST00000262113.4	37	c.1849	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	C	17.19	3.326075	0.60743	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.58060	0.36;0.36	5.72	5.72	0.89469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.119371	0.64402	D	0.000017	T	0.73009	0.3532	M	0.79011	2.435	0.49213	D	0.999765	D	0.76494	0.999	D	0.65874	0.939	T	0.70215	-0.4933	10	0.34782	T	0.22	.	19.8835	0.96906	0.0:1.0:0.0:0.0	.	617	P54296	MYOM2_HUMAN	W	617;42	ENSP00000262113:R617W;ENSP00000428396:R42W	ENSP00000262113:R617W	R	+	1	2	MYOM2	2027601	1.000000	0.71417	0.924000	0.36721	0.015000	0.08874	4.525000	0.60559	2.705000	0.92388	0.555000	0.69702	CGG	MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000036448		0.547	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	-	0.00	82	0	C	NM_003970		2040194	+1	tier1	-	no_errors	ENST00000262113	ensembl	human	known	74_37	missense	13.89	61	10	SNP	0.996	T
NCAPD3	23310	genome.wustl.edu	37	11	134027864	134027864	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr11:134027864delA	ENST00000534548.2	-	31	4197	c.4133delT	c.(4132-4134)ttcfs	p.F1378fs		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1378					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ATTTAAAGTGAAAGGCAGCAC	0.478																																																	0													203.0	204.0	204.0					11																	134027864		2201	4297	6498	SO:0001589	frameshift_variant	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.4133delT	11.37:g.134027864delA	ENSP00000433681:p.Phe1378fs		A6NFS2|Q4KMQ9	Frame_Shift_Del	DEL	superfamily_ARM-type_fold,pirsf_NCAPD3	p.F1378fs	ENST00000534548.2	37	c.4133	CCDS31723.1	11																																																																																			NCAPD3	-	pirsf_NCAPD3	ENSG00000151503		0.478	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2		0.00	71	0	A	NM_015261		134027864	-1	tier1		no_errors	ENST00000534548	ensembl	human	known	74_37	frame_shift_del	12.50	14	2	DEL	0.015	-
NCF4	4689	genome.wustl.edu	37	22	37271717	37271717	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr22:37271717G>A	ENST00000248899.6	+	8	834	c.650G>A	c.(649-651)gGc>gAc	p.G217D	NCF4_ENST00000397147.4_Missense_Mutation_p.G217D	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	217	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	GGAGCCACGGGCATCTTCCCT	0.602																																																	0													66.0	59.0	62.0					22																	37271717		2203	4300	6503	SO:0001583	missense	0			X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.650G>A	22.37:g.37271717G>A	ENSP00000248899:p.Gly217Asp		A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain,prints_NCF_P40,prints_p67phox	p.G217D	ENST00000248899.6	37	c.650	CCDS13934.1	22	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383783	0.82792	.	.	ENSG00000100365	ENST00000447071;ENST00000248899;ENST00000397147	D;D;D	0.88201	-2.35;-2.35;-2.35	4.45	4.45	0.53987	Src homology-3 domain (4);	0.105050	0.64402	D	0.000004	D	0.96577	0.8883	H	0.97940	4.11	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.77004	0.989;0.976	D	0.98204	1.0469	10	0.87932	D	0	-32.0388	15.6722	0.77286	0.0:0.0:1.0:0.0	.	217;217	A8K4F9;Q15080	.;NCF4_HUMAN	D	114;217;217	ENSP00000414958:G114D;ENSP00000248899:G217D;ENSP00000380334:G217D	ENSP00000248899:G217D	G	+	2	0	NCF4	35601663	1.000000	0.71417	0.977000	0.42913	0.908000	0.53690	6.864000	0.75494	2.204000	0.70986	0.650000	0.86243	GGC	NCF4	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox	ENSG00000100365		0.602	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF4	HGNC	protein_coding	OTTHUMT00000318863.1	-	0.00	37	0	G	NM_000631		37271717	+1	tier1	-	no_errors	ENST00000397147	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	A
NDUFA13	51079	genome.wustl.edu	37	19	19638875	19638875	+	Silent	SNP	C	C	T	rs141026032	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:19638875C>T	ENST00000507754.4	+	5	859	c.375C>T	c.(373-375)taC>taT	p.Y125Y	CTC-260F20.3_ENST00000586674.1_3'UTR|NDUFA13_ENST00000252576.5_Silent_p.Y208Y|YJEFN3_ENST00000608404.1_Intron|CTC-260F20.3_ENST00000555938.1_Intron|NDUFA13_ENST00000503283.1_Intron|YJEFN3_ENST00000514277.4_5'Flank|YJEFN3_ENST00000436027.5_5'Flank|NDUFA13_ENST00000512771.3_Silent_p.Y125Y			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13	125	Important for inducing cell death.				apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						GGGAGCTGTACGGGCTGCGCA	0.667																																																	0								C		0,4406		0,0,2203	46.0	41.0	43.0		375	-8.9	0.0	19	dbSNP_134	43	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NDUFA13	NM_015965.6		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		125/145	19638875	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.375C>T	19.37:g.19638875C>T			B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Silent	SNP	pfam_GRIM-19	p.Y208	ENST00000507754.4	37	c.624	CCDS12404.2	19																																																																																			NDUFA13	-	pfam_GRIM-19	ENSG00000186010		0.667	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	NDUFA13	HGNC	protein_coding	OTTHUMT00000367916.6	-	0.00	141	0	C	NM_015965		19638875	+1	tier1	rs141026032	no_errors	ENST00000252576	ensembl	human	known	74_37	silent	7.41	50	4	SNP	0.003	T
NF1	4763	genome.wustl.edu	37	17	29562747	29562747	+	Missense_Mutation	SNP	G	G	T	rs137854556		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:29562747G>T	ENST00000358273.4	+	28	4210	c.3827G>T	c.(3826-3828)cGa>cTa	p.R1276L	NF1_ENST00000356175.3_Missense_Mutation_p.R1276L	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1276	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.		R -> G (in NF1; dbSNP:rs199474742). {ECO:0000269|PubMed:15060124}.|R -> P (in NF1; complete loss of GAP activity; dbSNP:rs137854556). {ECO:0000269|PubMed:10712197, ECO:0000269|PubMed:9668168}.|R -> Q (in NF1 and mismatch repair deficient cancer cells; dbSNP:rs137854556). {ECO:0000269|PubMed:10712197, ECO:0000269|PubMed:12522551, ECO:0000269|PubMed:15060124}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.R1276Q(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACTCTCTTCCGAGGCAACAGC	0.398			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(4)|Substitution - Missense(2)	soft_tissue(7)|large_intestine(2)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	GRCh37	CM000802|CM983421	NF1	M	rs137854556						165.0	161.0	163.0					17																	29562747		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3827G>T	17.37:g.29562747G>T	ENSP00000351015:p.Arg1276Leu		O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.R1276L	ENST00000358273.4	37	c.3827	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.446474	0.96187	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.93426	-3.22;-3.22;-3.22	6.16	6.16	0.99307	Rho GTPase activation protein (1);Armadillo-type fold (1);Ras GTPase-activating protein (3);	0.000000	0.85682	D	0.000000	D	0.98321	0.9443	H	0.97829	4.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.992;1.0	D;D;D;D	0.97110	1.0;1.0;0.979;1.0	D	0.98581	1.0650	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	1276;326;1276;1276	E1P657;Q59FX3;P21359-2;P21359	.;.;.;NF1_HUMAN	L	1276;1276;942	ENSP00000351015:R1276L;ENSP00000348498:R1276L;ENSP00000389907:R942L	ENSP00000348498:R1276L	R	+	2	0	NF1	26586873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.212000	0.95126	2.937000	0.99478	0.650000	0.86243	CGA	NF1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,smart_RasGAP,pfscan_RasGAP	ENSG00000196712		0.398	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2		0.00	39	0	G	NM_000267		29562747	+1			no_errors	ENST00000358273	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	T
NGRN	51335	genome.wustl.edu	37	15	90814887	90814887	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:90814887G>A	ENST00000379095.3	+	3	751	c.743G>A	c.(742-744)gGc>gAc	p.G248D	NGRN_ENST00000331497.3_3'UTR|RP11-697E2.6_ENST00000561573.1_3'UTR	NM_001033088.1	NP_001028260.2	Q9NPE2	NGRN_HUMAN	neugrin, neurite outgrowth associated	248					neuron differentiation (GO:0030182)	extracellular region (GO:0005576)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			AGAGGAACTGGCAGTGGTGCG	0.552																																																	0													45.0	41.0	42.0					15																	90814887		2199	4298	6497	SO:0001583	missense	0			AB029315	CCDS32329.1	15q26.1	2008-02-05			ENSG00000182768	ENSG00000182768			18077	protein-coding gene	gene with protein product						11118320	Standard	NR_028052		Approved	DSC92	uc002bpf.1	Q9NPE2	OTTHUMG00000149807	ENST00000379095.3:c.743G>A	15.37:g.90814887G>A	ENSP00000368389:p.Gly248Asp		B2R6M8|Q4V9L7|Q9HBL4	Missense_Mutation	SNP	pfam_Neugrin-related	p.G248D	ENST00000379095.3	37	c.743	CCDS32329.1	15	.	.	.	.	.	.	.	.	.	.	G	0.962	-0.703077	0.03255	.	.	ENSG00000182768	ENST00000379095	T	0.29655	1.56	4.53	-2.69	0.06022	.	0.513397	0.18024	N	0.154152	T	0.08313	0.0207	N	0.03016	-0.435	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.33394	-0.9870	10	0.06757	T	0.87	.	5.8569	0.18724	0.3723:0.0:0.467:0.1607	.	248	Q9NPE2	NGRN_HUMAN	D	248	ENSP00000368389:G248D	ENSP00000368389:G248D	G	+	2	0	NGRN	88615891	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.267000	0.08619	-0.596000	0.05821	-0.484000	0.04775	GGC	NGRN	-	pfam_Neugrin-related	ENSG00000182768		0.552	NGRN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NGRN	HGNC	protein_coding	OTTHUMT00000313418.1	-	0.00	64	0	G			90814887	+1	tier1	-	no_errors	ENST00000379095	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.000	A
NOS1	4842	genome.wustl.edu	37	12	117698402	117698402	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:117698402G>T	ENST00000338101.4	-	13	2239	c.2235C>A	c.(2233-2235)ttC>ttA	p.F745L	NOS1_ENST00000317775.6_Missense_Mutation_p.F745L|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.F745L(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GCTTGGCCGAGAACTTGACAG	0.517																																					Esophageal Squamous(162;1748 2599 51982 52956)												1	Substitution - Missense(1)	large_intestine(1)											71.0	69.0	70.0					12																	117698402		1934	4162	6096	SO:0001583	missense	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2235C>A	12.37:g.117698402G>T	ENSP00000337459:p.Phe745Leu			Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.F745L	ENST00000338101.4	37	c.2235	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113672	0.56398	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.01446	4.91;4.88	5.11	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.04048	0.0113	M	0.76002	2.32	0.80722	D	1	P	0.37824	0.609	B	0.40864	0.342	T	0.28004	-1.0057	10	0.66056	D	0.02	-32.7639	9.8821	0.41240	0.155:0.0:0.845:0.0	.	745	P29475	NOS1_HUMAN	L	640;745;745;745	ENSP00000320758:F745L;ENSP00000337459:F745L	ENSP00000320758:F745L	F	-	3	2	NOS1	116182785	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.635000	0.46537	1.385000	0.46445	0.655000	0.94253	TTC	NOS1	-	pirsf_NOS_euk	ENSG00000089250		0.517	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1		0.00	48	0	G			117698402	-1			no_errors	ENST00000317775	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
NR2E3	10002	genome.wustl.edu	37	15	72105933	72105934	+	RNA	DNP	CA	CA	AC	rs201606159		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:72105933_72105934CA>AC	ENST00000398840.2	+	0	1141_1142							Q9Y5X4	NR2E3_HUMAN	nuclear receptor subfamily 2, group E, member 3						eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction (GO:0007602)|positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)	3						GGTGGACCCCCACGGAGTTTGC	0.604																																																	0																																												0				CCDS73750.1, CCDS73751.1	15q23	2013-01-16			ENSG00000031544	ENSG00000278570		"""Nuclear hormone receptors"""	7974	protein-coding gene	gene with protein product		604485				10220376	Standard	NM_016346		Approved	PNR, rd7, RP37	uc002ath.1	Q9Y5X4	OTTHUMG00000172841	Exception_encountered	15.37:g.72105933_72105934delinsAC			B6ZGU0|Q9UHM4	RNA	SNP	-	NULL	ENST00000398840.2	37	NULL		15																																																																																			NR2E3	-	-	ENSG00000031544		0.604	NR2E3-202	KNOWN	basic	processed_transcript	NR2E3	HGNC	processed_transcript			0.00	35|36	0	C|A	NM_014249		72105933|72105934	+1			no_errors	ENST00000326995	ensembl	human	known	74_37	rna	21.74	18	5	SNP	1.000	A|C
NUAK1	9891	genome.wustl.edu	37	12	106532214	106532214	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:106532214G>T	ENST00000261402.2	-	1	1597	c.218C>A	c.(217-219)aCc>aAc	p.T73N		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	73	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						AAACCTCTCGGTGGCCCGCTT	0.672																																																	0													55.0	45.0	49.0					12																	106532214		2203	4300	6503	SO:0001583	missense	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.218C>A	12.37:g.106532214G>T	ENSP00000261402:p.Thr73Asn		A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T73N	ENST00000261402.2	37	c.218	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885690	0.51908	.	.	ENSG00000074590	ENST00000261402;ENST00000359413	T	0.25749	1.78	4.07	4.07	0.47477	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.116604	0.38111	N	0.001816	T	0.31888	0.0811	M	0.72624	2.21	0.37043	D	0.897217	P	0.38788	0.647	B	0.43838	0.433	T	0.38156	-0.9674	10	0.62326	D	0.03	.	7.5553	0.27820	0.2087:0.0:0.7913:0.0	.	73	O60285	NUAK1_HUMAN	N	73	ENSP00000261402:T73N	ENSP00000261402:T73N	T	-	2	0	NUAK1	105056344	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	4.055000	0.57441	1.832000	0.53329	0.313000	0.20887	ACC	NUAK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000074590		0.672	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	-	0.00	59	0	G	NM_014840		106532214	-1	tier1	-	no_errors	ENST00000261402	ensembl	human	known	74_37	missense	7.35	63	5	SNP	1.000	T
NVL	4931	genome.wustl.edu	37	1	224492452	224492452	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:224492452C>A	ENST00000281701.6	-	8	1070	c.811G>T	c.(811-813)Gat>Tat	p.D271Y	NVL_ENST00000482491.1_5'UTR|NVL_ENST00000361463.3_Missense_Mutation_p.D165Y|NVL_ENST00000340871.4_Missense_Mutation_p.D55Y|NVL_ENST00000391875.2_Missense_Mutation_p.D165Y|NVL_ENST00000469075.1_Missense_Mutation_p.D180Y|RNU6-1008P_ENST00000384160.1_RNA	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	271						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		AATGTCATATCATTGCCTCCC	0.343																																																	0													141.0	146.0	144.0					1																	224492452		2203	4300	6503	SO:0001583	missense	0			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.811G>T	1.37:g.224492452C>A	ENSP00000281701:p.Asp271Tyr		B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA-2,pfam_ATPase_dyneun-rel_AAA,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D271Y	ENST00000281701.6	37	c.811	CCDS1541.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.4|23.4	4.416510|4.416510	0.83449|0.83449	.|.	.|.	ENSG00000143748|ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000469075;ENST00000340871;ENST00000361463;ENST00000492281;ENST00000488718;ENST00000436927|ENST00000469968	T;T;T;T;T|.	0.80653|.	-1.4;-1.4;-1.4;-1.4;-1.4|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	0.099053|.	0.64402|.	D|.	0.000002|.	D|.	0.86598|.	0.5971|.	M|M	0.93550|0.93550	3.43|3.43	0.80722|0.80722	D|D	1|1	P;D;D|.	0.71674|.	0.913;0.984;0.998|.	P;P;D|.	0.67231|.	0.635;0.753;0.95|.	D|.	0.90044|.	0.4144|.	10|.	0.72032|.	D|.	0.01|.	-20.9635|-20.9635	17.2423|17.2423	0.87016|0.87016	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	55;180;271|.	B4DMC4;B4DP98;O15381|.	.;.;NVL_HUMAN|.	Y|L	271;165;180;55;165;176;180;167|153	ENSP00000281701:D271Y;ENSP00000375747:D165Y;ENSP00000417826:D180Y;ENSP00000341362:D55Y;ENSP00000354779:D165Y|.	ENSP00000281701:D271Y|.	D|X	-|-	1|2	0|2	NVL|NVL	222559075|222559075	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.879000|0.879000	0.50718|0.50718	6.437000|6.437000	0.73421|0.73421	2.500000|2.500000	0.84329|0.84329	0.655000|0.655000	0.94253|0.94253	GAT|TGA	NVL	-	superfamily_P-loop_NTPase	ENSG00000143748		0.343	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NVL	HGNC	protein_coding	OTTHUMT00000091453.2		0.00	60	0	C	NM_002533		224492452	-1			no_errors	ENST00000281701	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
PAAF1	80227	genome.wustl.edu	37	11	73602202	73602202	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr11:73602202delT	ENST00000310571.3	+	4	291	c.238delT	c.(238-240)tttfs	p.F80fs	PAAF1_ENST00000536003.1_Frame_Shift_Del_p.F63fs|PAAF1_ENST00000376384.5_Frame_Shift_Del_p.F63fs|PAAF1_ENST00000541951.1_5'UTR|PAAF1_ENST00000535604.1_5'UTR|PAAF1_ENST00000544552.1_Frame_Shift_Del_p.F63fs|PAAF1_ENST00000544909.1_Frame_Shift_Del_p.F81fs|PAAF1_ENST00000543079.1_3'UTR	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	80					viral process (GO:0016032)	proteasome complex (GO:0000502)				breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					ATCTTCTAAGTTTTTGGCACC	0.279																																																	0													95.0	90.0	92.0					11																	73602202		2196	4290	6486	SO:0001589	frameshift_variant	0			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.238delT	11.37:g.73602202delT	ENSP00000311665:p.Phe80fs		A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L81fs	ENST00000310571.3	37	c.238	CCDS8226.1	11																																																																																			PAAF1	-	smart_WD40_repeat	ENSG00000175575		0.279	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAAF1	HGNC	protein_coding	OTTHUMT00000397885.1		0.00	40	0	T	NM_025155		73602202	+1	tier1		no_errors	ENST00000310571	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	1.000	-
PANK2	80025	genome.wustl.edu	37	20	3891428	3891428	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:3891428A>T	ENST00000316562.4	+	3	1192	c.1186A>T	c.(1186-1188)Atc>Ttc	p.I396F	PANK2_ENST00000610179.1_Missense_Mutation_p.I273F|PANK2_ENST00000497424.1_Missense_Mutation_p.I105F|PANK2_ENST00000464452.1_3'UTR	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	396					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						AGGGGTTAGCATCTTAGCAGT	0.383																																																	0													119.0	117.0	117.0					20																	3891428		2203	4300	6503	SO:0001583	missense	0			AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.1186A>T	20.37:g.3891428A>T	ENSP00000313377:p.Ile396Phe		B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.I396F	ENST00000316562.4	37	c.1186	CCDS13071.2	20	.	.	.	.	.	.	.	.	.	.	A	20.9	4.059832	0.76074	.	.	ENSG00000125779	ENST00000497424;ENST00000316562;ENST00000399552	D;D	0.99709	-6.48;-6.48	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.99507	0.9824	M	0.69523	2.12	0.54753	D	0.999982	D	0.71674	0.998	D	0.66847	0.947	D	0.98143	1.0437	10	0.62326	D	0.03	.	11.7542	0.51866	1.0:0.0:0.0:0.0	.	396	Q9BZ23	PANK2_HUMAN	F	105;396;212	ENSP00000417609:I105F;ENSP00000313377:I396F	ENSP00000313377:I396F	I	+	1	0	PANK2	3839428	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.244000	0.78228	1.887000	0.54652	0.383000	0.25322	ATC	PANK2	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000125779		0.383	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PANK2	HGNC	protein_coding	OTTHUMT00000077793.2	-	0.00	67	0	A	NM_024960		3891428	+1	tier1	-	no_errors	ENST00000316562	ensembl	human	known	74_37	missense	48.94	24	23	SNP	1.000	T
PAPD5	64282	genome.wustl.edu	37	16	50263693	50263693	+	3'UTR	DEL	T	T	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr16:50263693delT	ENST00000561678.1	+	0	2295				PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR|PAPD5_ENST00000436909.3_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TCTGTGCATGTTTTTTTTTTA	0.308																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.*454T>-	16.37:g.50263693delT			B4DV38|Q9NW67|Q9Y6C0	RNA	DEL	-	NULL	ENST00000561678.1	37	NULL		16																																																																																			PAPD5	-	-	ENSG00000121274		0.308	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423150.1		0.00	73	0	T	NM_022447		50263693	+1	tier1		no_errors	ENST00000573002	ensembl	human	known	74_37	rna	10.64	42	5	DEL	0.737	-
PAPPA	5069	genome.wustl.edu	37	9	118949925	118949925	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:118949925G>T	ENST00000328252.3	+	2	1277	c.908G>T	c.(907-909)gGc>gTc	p.G303V	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	303	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						ATGAAGGATGGCAGCAGCCCC	0.567																																																	0													89.0	82.0	84.0					9																	118949925		2203	4300	6503	SO:0001583	missense	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.908G>T	9.37:g.118949925G>T	ENSP00000330658:p.Gly303Val		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.G303V	ENST00000328252.3	37	c.908	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284401	0.59867	.	.	ENSG00000182752	ENST00000328252	T	0.01947	4.54	6.07	6.07	0.98685	.	0.043842	0.85682	D	0.000000	T	0.13286	0.0322	M	0.80746	2.51	0.80722	D	1	D	0.62365	0.991	P	0.59357	0.856	T	0.00009	-1.2470	10	0.72032	D	0.01	-27.9492	20.6439	0.99570	0.0:0.0:1.0:0.0	.	303	Q13219	PAPP1_HUMAN	V	303	ENSP00000330658:G303V	ENSP00000330658:G303V	G	+	2	0	PAPPA	117989746	1.000000	0.71417	0.325000	0.25375	0.331000	0.28603	9.827000	0.99397	2.884000	0.98904	0.655000	0.94253	GGC	PAPPA	-	NULL	ENSG00000182752		0.567	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	-	0.00	28	0	G	NM_002581		118949925	+1	tier1	-	no_errors	ENST00000328252	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	T
PAX6	5080	genome.wustl.edu	37	11	31822342	31822342	+	Silent	SNP	G	G	A	rs1800427		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr11:31822342G>A	ENST00000379132.3	-	6	700	c.420C>T	c.(418-420)gaC>gaT	p.D140D	PAX6_ENST00000241001.8_Silent_p.D140D|PAX6_ENST00000379115.4_Silent_p.D154D|PAX6_ENST00000533156.1_5'Flank|PAX6_ENST00000379107.2_Silent_p.D154D|PAX6_ENST00000379123.5_Silent_p.D140D|PAX6_ENST00000379129.2_Silent_p.D154D|PAX6_ENST00000379111.2_Silent_p.D140D|PAX6_ENST00000419022.1_Silent_p.D154D			P26367	PAX6_HUMAN	paired box 6	140	Gln/Gly-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					CATACATGCCGTCTGCGCCCA	0.522									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																								0													154.0	131.0	139.0					11																	31822342		2202	4299	6501	SO:0001819	synonymous_variant	0	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.420C>T	11.37:g.31822342G>A			Q6N006|Q99413	Silent	SNP	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,prints_Paired_dom,pfscan_Homeobox_dom,pfscan_Paired_dom	p.D154	ENST00000379132.3	37	c.462	CCDS31451.1	11																																																																																			PAX6	-	NULL	ENSG00000007372		0.522	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	PAX6	HGNC	protein_coding	OTTHUMT00000099293.4	-	0.00	57	0	G	NM_001604		31822342	-1	tier1	rs1800427	no_errors	ENST00000379107	ensembl	human	known	74_37	silent	22.22	28	8	SNP	1.000	A
PDE1C	5137	genome.wustl.edu	37	7	31876883	31876883	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:31876883G>T	ENST00000396191.1	-	11	1569	c.1114C>A	c.(1114-1116)Ctg>Atg	p.L372M	PDE1C_ENST00000321453.7_Missense_Mutation_p.L372M|PDE1C_ENST00000396184.3_Missense_Mutation_p.L372M|PDE1C_ENST00000396182.2_Missense_Mutation_p.L372M|PDE1C_ENST00000396193.1_Missense_Mutation_p.L432M	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	372	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	GCTGTATGCAGCATAAGGGAT	0.433																																																	0													184.0	159.0	167.0					7																	31876883		2203	4300	6503	SO:0001583	missense	0			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1114C>A	7.37:g.31876883G>T	ENSP00000379494:p.Leu372Met		B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.L372M	ENST00000396191.1	37	c.1114	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293546	0.60086	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	4.76	-0.347	0.12617	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.83031	0.5166	M	0.64676	1.99	0.46542	D	0.999093	D;D;D	0.63046	0.963;0.992;0.992	D;D;D	0.74348	0.937;0.983;0.936	T	0.80797	-0.1222	10	0.87932	D	0	.	10.2751	0.43506	0.5901:0.0:0.4099:0.0	.	372;432;372	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	M	432;372;372;372;372	ENSP00000379496:L432M;ENSP00000379494:L372M;ENSP00000318105:L372M;ENSP00000379487:L372M;ENSP00000379485:L372M	ENSP00000318105:L372M	L	-	1	2	PDE1C	31843408	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	0.889000	0.28282	-0.319000	0.08652	0.609000	0.83330	CTG	PDE1C	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	ENSG00000154678		0.433	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1		0.00	22	0	G			31876883	-1			no_errors	ENST00000321453	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.996	T
PAXIP1	22976	genome.wustl.edu	37	7	154739621	154739621	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:154739621G>T	ENST00000404141.1	-	17	3068	c.2914C>A	c.(2914-2916)Ctc>Atc	p.L972I	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.L972I			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	972	BRCT 6. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		ACCTTAAAGAGTGGAGAAACG	0.448																																																	0													193.0	180.0	184.0					7																	154739621		1907	4131	6038	SO:0001583	missense	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2914C>A	7.37:g.154739621G>T	ENSP00000384048:p.Leu972Ile		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.L972I	ENST00000404141.1	37	c.2914	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066673	0.76301	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	T;T	0.48201	0.82;0.82	5.41	5.41	0.78517	BRCT (1);	0.000000	0.49305	U	0.000153	T	0.71592	0.3358	M	0.78285	2.405	0.80722	D	1	D;D;D	0.71674	0.998;0.993;0.989	D;D;D	0.85130	0.992;0.997;0.992	T	0.74250	-0.3726	10	0.72032	D	0.01	-25.2807	19.5534	0.95331	0.0:0.0:1.0:0.0	.	925;938;972	B4DEQ6;Q6ZW49-1;Q6ZW49	.;.;PAXI1_HUMAN	I	972;972;796;925	ENSP00000384048:L972I;ENSP00000380376:L972I	ENSP00000319149:L925I	L	-	1	0	PAXIP1	154370554	1.000000	0.71417	0.995000	0.50966	0.968000	0.65278	6.364000	0.73086	2.697000	0.92050	0.563000	0.77884	CTC	PAXIP1	-	smart_BRCT_dom	ENSG00000157212		0.448	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	43	0	G	NM_007349		154739621	-1			no_errors	ENST00000397192	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	T
PDS5B	23047	genome.wustl.edu	37	13	33349165	33349165	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr13:33349165G>T	ENST00000315596.10	+	35	4505	c.4319G>T	c.(4318-4320)cGa>cTa	p.R1440L		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1440					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GTACGGCGGCGAAGTGCTAAA	0.333																																																	0													93.0	88.0	90.0					13																	33349165		1807	4073	5880	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.4319G>T	13.37:g.33349165G>T	ENSP00000313851:p.Arg1440Leu		Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R1440L	ENST00000315596.10	37	c.4319	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815010	0.70912	.	.	ENSG00000083642	ENST00000315596	.	.	.	5.21	5.21	0.72293	.	0.179883	0.46758	D	0.000278	T	0.63674	0.2531	N	0.19112	0.55	0.44619	D	0.997591	D	0.63046	0.992	D	0.70487	0.969	T	0.67975	-0.5531	9	0.62326	D	0.03	-3.1899	17.3029	0.87187	0.0:0.0:1.0:0.0	.	1440	Q9NTI5	PDS5B_HUMAN	L	1440	.	ENSP00000313851:R1440L	R	+	2	0	PDS5B	32247165	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	6.280000	0.72626	2.581000	0.87130	0.655000	0.94253	CGA	PDS5B	-	NULL	ENSG00000083642		0.333	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3		0.00	56	0	G	NM_015032		33349165	+1			no_errors	ENST00000315596	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	T
PEX19	5824	genome.wustl.edu	37	1	160249322	160249322	+	3'UTR	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:160249322G>T	ENST00000368072.5	-	0	940				PEX19_ENST00000440949.3_3'UTR|PEX19_ENST00000532508.1_5'UTR|DCAF8_ENST00000608310.1_Intron|DCAF8_ENST00000556710.1_Intron	NM_001193644.1|NM_002857.3	NP_001180573.1|NP_002848.1	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19						chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|establishment of protein localization to peroxisome (GO:0072663)|negative regulation of lipid binding (GO:1900131)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	ATPase binding (GO:0051117)|peroxisome membrane class-1 targeting sequence binding (GO:0036105)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)	11	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGGACTCAGAGAGGAAAACGT	0.562																																																	0													84.0	71.0	75.0					1																	160249322		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			Y09048	CCDS1201.1	1q22	2008-07-18	2004-03-17	2004-03-19	ENSG00000162735	ENSG00000162735			9713	protein-coding gene	gene with protein product	"""housekeeping gene, 33kD"""	600279	"""peroxisomal farnesylated protein"""	PXF		9339377, 10051604	Standard	NM_002857		Approved	HK33, D1S2223E, PMP1, PMPI, PXMP1		P40855	OTTHUMG00000033112	ENST00000368072.5:c.*19C>A	1.37:g.160249322G>T			D3DVE7|Q5QNY4|Q8NI97	RNA	SNP	-	NULL	ENST00000368072.5	37	NULL	CCDS1201.1	1																																																																																			PEX19	-	-	ENSG00000162735		0.562	PEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX19	HGNC	protein_coding	OTTHUMT00000080642.2	-	0.00	53	0	G	NM_002857		160249322	-1	tier1	-	no_errors	ENST00000532508	ensembl	human	known	74_37	rna	12.20	36	5	SNP	0.083	T
PHF14	9678	genome.wustl.edu	37	7	11068427	11068427	+	Silent	SNP	A	A	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:11068427A>G	ENST00000403050.3	+	7	1889	c.1437A>G	c.(1435-1437)tcA>tcG	p.S479S	PHF14_ENST00000445996.2_Silent_p.S194S	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	479					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S479S(2)		NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		GTCTGCTTTCAGAGGCAGCGG	0.433																																																	2	Substitution - coding silent(2)	lung(2)											114.0	108.0	110.0					7																	11068427		1940	4149	6089	SO:0001819	synonymous_variant	0			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.1437A>G	7.37:g.11068427A>G			A7MCZ3|B4DI82	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S479	ENST00000403050.3	37	c.1437	CCDS47542.1	7																																																																																			PHF14	-	smart_Znf_PHD	ENSG00000106443		0.433	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	HGNC	protein_coding	OTTHUMT00000318212.1		0.00	67	0	A	NM_014660		11068427	+1			no_errors	ENST00000403050	ensembl	human	known	74_37	silent	5.66	50	3	SNP	1.000	G
PLA2G6	8398	genome.wustl.edu	37	22	38519192	38519192	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr22:38519192C>T	ENST00000332509.3	-	11	1684	c.1501G>A	c.(1501-1503)Gag>Aag	p.E501K	PLA2G6_ENST00000335539.3_Missense_Mutation_p.E447K|PLA2G6_ENST00000490473.1_5'Flank|PLA2G6_ENST00000402064.1_Missense_Mutation_p.E447K	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	501	Patatin.				cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	GAGGCCTTCTCGATGGCGATG	0.627																																																	0			GRCh37	CM063029	PLA2G6	M							68.0	51.0	57.0					22																	38519192		2174	4258	6432	SO:0001583	missense	0			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.1501G>A	22.37:g.38519192C>T	ENSP00000333142:p.Glu501Lys		A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Patatin/PLipase_A2-rel,superfamily_Ankyrin_rpt-contain_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E501K	ENST00000332509.3	37	c.1501	CCDS13967.1	22	.	.	.	.	.	.	.	.	.	.	C	37	5.984351	0.97173	.	.	ENSG00000184381	ENST00000332509;ENST00000419848;ENST00000335539;ENST00000402064	T;T;T	0.79454	-1.27;-1.27;-1.27	5.61	5.61	0.85477	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.000000	0.85682	D	0.000000	D	0.91009	0.7172	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.80764	0.994;0.939	D	0.92473	0.5987	10	0.87932	D	0	-43.9072	19.6496	0.95795	0.0:1.0:0.0:0.0	.	447;501	O60733-2;O60733	.;PA2G6_HUMAN	K	501;362;447;447	ENSP00000333142:E501K;ENSP00000335149:E447K;ENSP00000386100:E447K	ENSP00000333142:E501K	E	-	1	0	PLA2G6	36849138	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.425000	0.80255	2.642000	0.89623	0.514000	0.50259	GAG	PLA2G6	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	ENSG00000184381		0.627	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G6	HGNC	protein_coding	OTTHUMT00000321860.1	-	0.00	54	0	C	NM_001004426		38519192	-1	tier1	-	no_errors	ENST00000332509	ensembl	human	known	74_37	missense	42.31	15	11	SNP	1.000	T
PNLIPRP3	119548	genome.wustl.edu	37	10	118203905	118203905	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr10:118203905G>T	ENST00000369230.3	+	4	482	c.336G>T	c.(334-336)caG>caT	p.Q112H		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	112					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		TGTTGCTACAGCTGGAAGATA	0.358																																																	0													88.0	83.0	84.0					10																	118203905		2203	4300	6503	SO:0001583	missense	0			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.336G>T	10.37:g.118203905G>T	ENSP00000358232:p.Gln112His			Missense_Mutation	SNP	pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.Q112H	ENST00000369230.3	37	c.336	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	G	11.00	1.509373	0.27036	.	.	ENSG00000203837	ENST00000369230	D	0.91237	-2.81	5.28	2.92	0.33932	Lipase, N-terminal (1);	0.507607	0.16803	N	0.198887	D	0.84822	0.5557	L	0.43598	1.365	0.09310	N	1	B	0.21688	0.059	B	0.24974	0.057	T	0.73883	-0.3842	10	0.45353	T	0.12	.	5.3123	0.15837	0.6826:0.1512:0.1662:0.0	.	112	Q17RR3	LIPR3_HUMAN	H	112	ENSP00000358232:Q112H	ENSP00000358232:Q112H	Q	+	3	2	PNLIPRP3	118193895	0.999000	0.42202	0.003000	0.11579	0.132000	0.20833	1.820000	0.39032	0.394000	0.25230	-0.469000	0.05056	CAG	PNLIPRP3	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase_panc	ENSG00000203837		0.358	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1		0.00	61	0	G	XM_058404		118203905	+1			no_errors	ENST00000369230	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.041	T
POTEH	23784	genome.wustl.edu	37	22	16278260	16278260	+	Intron	SNP	C	C	A	rs200660281|rs376762014	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr22:16278260C>A	ENST00000343518.6	-	5	1080				POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H											NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						GGTAAAATAACTAAGAGCTCT	0.363													A|||	1506	0.300719	0.3177	0.2406	5008	,	,		29734	0.254		0.2913	False		,,,				2504	0.3783																0																																										SO:0001627	intron_variant	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1029-375G>T	22.37:g.16278260C>A			A2CEK4|A6NCI1|A9Z1W0	RNA	SNP	-	NULL	ENST00000343518.6	37	NULL	CCDS46658.1	22																																																																																			POTEH-AS1	-	-	ENSG00000236666		0.363	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH-AS1	HGNC	protein_coding	OTTHUMT00000276918.4	-	0.00	8	0	C	NM_001136213		16278260	+1	tier1	rs200660281	no_errors	ENST00000422014	ensembl	human	known	74_37	rna	66.67	2	4	SNP	0.000	A
PRAMEF6	440561	genome.wustl.edu	37	1	13111518	13111518	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:13111518C>T	ENST00000376182.1	-	3	596	c.497G>A	c.(496-498)tGc>tAc	p.C166Y	PRAMEF6_ENST00000376192.5_Missense_Mutation_p.C166Y|PRAMEF6_ENST00000414205.2_Missense_Mutation_p.C166Y	NM_001282323.1	NP_001269252.1	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	166					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|kidney(1)|lung(5)|urinary_tract(2)	9	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAGAAGGAGGCAGGTGAGGTA	0.478																																																	0																																										SO:0001583	missense	0				CCDS30594.1	1p36.21	2013-01-17				ENSG00000232423		"""-"""	30583	protein-coding gene	gene with protein product							Standard	NM_001010889		Approved		uc001auq.2	Q5VXH4	OTTHUMG00000001984	ENST00000376182.1:c.497G>A	1.37:g.13111518C>T	ENSP00000365353:p.Cys166Tyr		A0AUJ9	Missense_Mutation	SNP	NULL	p.C166Y	ENST00000376182.1	37	c.497		1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.669907	0.00006	.	.	ENSG00000232423	ENST00000376192;ENST00000376182;ENST00000414205	T;T;T	0.04015	3.73;3.73;3.73	1.21	-2.41	0.06562	.	0.745300	0.12225	N	0.488004	T	0.01254	0.0041	N	0.01729	-0.75	0.80722	P	0.0	B;B	0.21147	0.052;0.052	B;B	0.18561	0.022;0.022	T	0.38436	-0.9661	9	0.02654	T	1	.	2.6588	0.05020	0.2257:0.1973:0.0:0.577	.	166;166	A6NMV5;Q5TYX0	PRA23_HUMAN;PRAM5_HUMAN	Y	166	ENSP00000365363:C166Y;ENSP00000365353:C166Y;ENSP00000393084:C166Y	ENSP00000365353:C166Y	C	-	2	0	PRAMEF6	13034105	0.000000	0.05858	0.001000	0.08648	0.064000	0.16182	-1.345000	0.02637	-1.902000	0.01094	-1.140000	0.01884	TGC	PRAMEF6	-	NULL	ENSG00000232423		0.478	PRAMEF6-201	KNOWN	basic|appris_candidate_longest	protein_coding	PRAMEF6	HGNC	protein_coding		-	0.00	13	0	C	NM_001010889		13111518	-1	tier1	-	no_errors	ENST00000376182	ensembl	human	known	74_37	missense	70.00	3	7	SNP	0.001	T
PPM1J	333926	genome.wustl.edu	37	1	113254598	113254598	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:113254598G>T	ENST00000309276.6	-	5	1097	c.922C>A	c.(922-924)Ctg>Atg	p.L308M	RP11-426L16.10_ENST00000471038.2_5'Flank|PPM1J_ENST00000464951.1_Missense_Mutation_p.L102M|RP11-426L16.10_ENST00000606505.1_5'Flank|PPM1J_ENST00000359994.4_Missense_Mutation_p.L102M	NM_005167.5	NP_005158.5	Q5JR12	PPM1J_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1J	308	PP2C-like.				protein dephosphorylation (GO:0006470)		protein serine/threonine phosphatase activity (GO:0004722)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	14	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTACAAGCAGCTGAAGACGC	0.547																																																	0													42.0	40.0	40.0					1																	113254598		2203	4300	6503	SO:0001583	missense	0			AK093270	CCDS855.2	1p13.1	2012-04-17	2010-03-05		ENSG00000155367	ENSG00000155367	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	20785	protein-coding gene	gene with protein product	"""protein phosphatase 2C zeta"""	609957	"""protein phosphatase 1J (PP2C domain containing)"""			12633878	Standard	NM_005167		Approved	FLJ35951, MGC19531, DKFZp434P1514, PP2Czeta, PPP2CZ	uc001ect.1	Q5JR12	OTTHUMG00000012019	ENST00000309276.6:c.922C>A	1.37:g.113254598G>T	ENSP00000308926:p.Leu308Met		B3KSB7|Q6DKJ7|Q96EZ7|Q9UF84	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.L308M	ENST00000309276.6	37	c.922	CCDS855.2	1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658887	0.67586	.	.	ENSG00000155367	ENST00000309276;ENST00000359994	T;T	0.09630	2.96;2.96	5.64	3.77	0.43336	Protein phosphatase 2C-like (5);	0.145973	0.47455	D	0.000222	T	0.07188	0.0182	L	0.34521	1.04	0.80722	D	1	D;B	0.58970	0.984;0.171	P;B	0.60541	0.876;0.089	T	0.28332	-1.0047	10	0.34782	T	0.22	-9.8427	4.1814	0.10378	0.2597:0.0:0.5761:0.1642	.	308;102	Q5JR12;Q5JR12-2	PPM1J_HUMAN;.	M	308;102	ENSP00000308926:L308M;ENSP00000353088:L102M	ENSP00000308926:L308M	L	-	1	2	PPM1J	113056121	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.522000	0.35921	0.861000	0.35504	0.561000	0.74099	CTG	PPM1J	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000155367		0.547	PPM1J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1J	HGNC	protein_coding	OTTHUMT00000033251.1		0.00	132	0	G	NM_005167		113254598	-1			no_errors	ENST00000309276	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
PRPF4	9128	genome.wustl.edu	37	9	116050502	116050502	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:116050502G>T	ENST00000374198.4	+	10	1085	c.983G>T	c.(982-984)cGg>cTg	p.R328L	PRPF4_ENST00000374199.4_Missense_Mutation_p.R327L	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	328					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						CGTGTGGCGCGGGTAATGTGG	0.433																																																	0													141.0	114.0	123.0					9																	116050502		2203	4300	6503	SO:0001583	missense	0			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.983G>T	9.37:g.116050502G>T	ENSP00000363313:p.Arg328Leu		O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_PRP4-like,superfamily_WD40_repeat_dom,smart_SFM,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R328L	ENST00000374198.4	37	c.983	CCDS6791.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.431690	0.96150	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.60040	0.22;0.22	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.73393	0.3581	L	0.58510	1.815	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.978;0.978	T	0.74535	-0.3633	10	0.87932	D	0	.	17.3511	0.87324	0.0:0.0:1.0:0.0	.	343;328	Q59EL4;O43172	.;PRP4_HUMAN	L	327;328	ENSP00000363315:R327L;ENSP00000363313:R328L	ENSP00000363313:R328L	R	+	2	0	PRPF4	115090323	1.000000	0.71417	0.989000	0.46669	0.954000	0.61252	9.246000	0.95438	2.780000	0.95670	0.585000	0.79938	CGG	PRPF4	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000136875		0.433	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRPF4	HGNC	protein_coding	OTTHUMT00000053708.2		0.00	83	0	G	NM_004697		116050502	+1			no_errors	ENST00000374198	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
PRRC2C	23215	genome.wustl.edu	37	1	171511112	171511112	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:171511112G>T	ENST00000338920.4	+	16	4738	c.4501G>T	c.(4501-4503)Gaa>Taa	p.E1501*	PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.E1503*|PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.E1501*|PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.E1503*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1501					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										AACAGCTTCTGAAAGCAGTGA	0.398																																																	0													72.0	77.0	75.0					1																	171511112		2203	4300	6503	SO:0001587	stop_gained	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.4501G>T	1.37:g.171511112G>T	ENSP00000343629:p.Glu1501*		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	pfam_BAT2_N	p.E1503*	ENST00000338920.4	37	c.4507	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	G	47	13.134354	0.99722	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	.	.	.	5.65	5.65	0.86999	.	0.000000	0.47852	D	0.000211	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7924	0.96464	0.0:0.0:1.0:0.0	.	.	.	.	X	1503;1502;1501;1503;1501;1258	.	ENSP00000343629:E1501X	E	+	1	0	PRRC2C	169777736	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.461000	0.97646	2.660000	0.90430	0.650000	0.86243	GAA	PRRC2C	-	NULL	ENSG00000117523		0.398	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	-	0.00	43	0	G	NM_015172		171511112	+1	tier1	-	no_errors	ENST00000392078	ensembl	human	known	74_37	nonsense	13.04	20	3	SNP	1.000	T
PSME4	23198	genome.wustl.edu	37	2	54148193	54148193	+	Missense_Mutation	SNP	C	C	A	rs565841263	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr2:54148193C>A	ENST00000404125.1	-	18	2150	c.2095G>T	c.(2095-2097)Gta>Tta	p.V699L	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	699					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGAATCTTTACAAGCTGCTCC	0.378																																																	0													116.0	121.0	120.0					2																	54148193		2203	4300	6503	SO:0001583	missense	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2095G>T	2.37:g.54148193C>A	ENSP00000384211:p.Val699Leu		Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	pfam_DUF3437,superfamily_ARM-type_fold	p.V699L	ENST00000404125.1	37	c.2095	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	C	9.667	1.145708	0.21288	.	.	ENSG00000068878	ENST00000404125	T	0.03580	3.88	5.38	4.47	0.54385	.	0.187955	0.45361	D	0.000377	T	0.02418	0.0074	N	0.22421	0.69	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.30765	-0.9967	10	0.02654	T	1	-0.1047	9.1051	0.36692	0.1438:0.777:0.0:0.0793	.	74;699	Q14997-2;Q14997	.;PSME4_HUMAN	L	699	ENSP00000384211:V699L	ENSP00000384211:V699L	V	-	1	0	PSME4	54001697	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.673000	0.37534	1.222000	0.43521	0.644000	0.83932	GTA	PSME4	-	superfamily_ARM-type_fold	ENSG00000068878		0.378	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1		0.00	98	0	C	XM_040158		54148193	-1			no_errors	ENST00000404125	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	A
PTPRD	5789	genome.wustl.edu	37	9	8341759	8341759	+	Silent	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:8341759G>T	ENST00000381196.4	-	37	5424	c.4881C>A	c.(4879-4881)gcC>gcA	p.A1627A	PTPRD_ENST00000358503.5_Silent_p.A1605A|PTPRD_ENST00000355233.5_Silent_p.A1221A|PTPRD_ENST00000486161.1_Silent_p.A1220A|PTPRD_ENST00000397617.3_Silent_p.A1220A|PTPRD_ENST00000540109.1_Silent_p.A1627A|PTPRD_ENST00000397606.3_Silent_p.A1220A|PTPRD_ENST00000397611.3_Silent_p.A1217A|PTPRD_ENST00000537002.1_Silent_p.A1217A|PTPRD_ENST00000360074.4_Silent_p.A1614A|PTPRD_ENST00000356435.5_Silent_p.A1627A	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1627					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TCTGAATGTAGGCATACAAGT	0.408										TSP Lung(15;0.13)																																							0													304.0	278.0	287.0					9																	8341759		2203	4300	6503	SO:0001819	synonymous_variant	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4881C>A	9.37:g.8341759G>T			B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.A1627	ENST00000381196.4	37	c.4881	CCDS43786.1	9																																																																																			PTPRD	-	NULL	ENSG00000153707		0.408	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3		0.00	64	0	G			8341759	-1			no_errors	ENST00000356435	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
PWAR6	100506965	genome.wustl.edu	37	15	25277593	25277593	+	lincRNA	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:25277593C>T	ENST00000552334.1	+	0	574				RP11-701H24.10_ENST00000552781.1_RNA|RP11-701H24.3_ENST00000546615.1_lincRNA					Prader Willi/Angelman region RNA 6																		ttaaggcaagcagttaactta	0.408																																																	0																																												0			BC043194, AK096584		15q11.2	2014-03-28	2013-09-11		ENSG00000257151	ENSG00000257151		"""Long non-coding RNAs"""	49129	non-coding RNA	RNA, long non-coding							Standard			Approved	HBT8, PAR-6			OTTHUMG00000170276		15.37:g.25277593C>T				RNA	SNP	-	NULL	ENST00000552334.1	37	NULL		15																																																																																			PWAR6	-	-	ENSG00000257151		0.408	PWAR6-001	KNOWN	basic	lincRNA	PWAR6	HGNC	lincRNA	OTTHUMT00000408286.1	-	0.00	37	0	C			25277593	+1	tier1	-	no_errors	ENST00000552334	ensembl	human	known	74_37	rna	16.67	15	3	SNP	0.001	T
RASSF4	83937	genome.wustl.edu	37	10	45480350	45480351	+	Frame_Shift_Ins	INS	-	-	C	rs35924448	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr10:45480350_45480351insC	ENST00000340258.5	+	6	576_577	c.463_464insC	c.(463-465)gccfs	p.A155fs	RASSF4_ENST00000334940.6_Frame_Shift_Ins_p.A164fs|RASSF4_ENST00000374417.2_Frame_Shift_Ins_p.RP124fs|RASSF4_ENST00000472561.1_3'UTR	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	295	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CAAGTGCCGCGCCCCCGGTGAG	0.663																																																	0																																										SO:0001589	frameshift_variant	0			BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.468dupC	10.37:g.45480355_45480355dupC	ENSP00000339692:p.Ala155fs		Q00425|Q5TFT8|Q9BQL3|Q9H071	Frame_Shift_Ins	INS	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH_dom	p.G166fs	ENST00000340258.5	37	c.490_491	CCDS7208.1	10																																																																																			RASSF4	-	NULL	ENSG00000107551		0.663	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF4	HGNC	protein_coding	OTTHUMT00000047745.2		0.00	30	0	-	NM_032023		45480351	+1	tier1		no_errors	ENST00000334940	ensembl	human	known	74_37	frame_shift_ins	33.33	24	12	INS	0.000:0.000	C
RCHY1	25898	genome.wustl.edu	37	4	76407873	76407873	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr4:76407873G>T	ENST00000324439.5	-	9	1059	c.661C>A	c.(661-663)Ctc>Atc	p.L221I	RCHY1_ENST00000380840.2_Missense_Mutation_p.L181I|RCHY1_ENST00000513257.1_Missense_Mutation_p.L212I|RCHY1_ENST00000451788.1_3'UTR|RCHY1_ENST00000512706.1_Missense_Mutation_p.L199I	NM_001278536.1|NM_001278538.1|NM_001278539.1	NP_001265465.1|NP_001265467.1|NP_001265468.1	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase	221					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L221I(1)		large_intestine(2)|pancreas(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TCATTGCAGAGAATCTGAAAA	0.318																																																	1	Substitution - Missense(1)	large_intestine(1)											69.0	68.0	68.0					4																	76407873		2203	4300	6503	SO:0001583	missense	0			AF255666	CCDS3567.1, CCDS34012.1, CCDS63990.1, CCDS63991.1, CCDS63992.1	4q21.1-q21.3	2014-02-17	2012-02-23	2004-03-30	ENSG00000163743	ENSG00000163743		"""RING-type (C3HC4) zinc fingers"""	17479	protein-coding gene	gene with protein product	"""androgen-receptor N-terminal-interacting protein"", ""p53-induced protein with a RING-H2 domain"", ""zinc finger, CHY-type"""	607680	"""zinc finger protein 363"", ""ring finger and CHY zinc finger domain containing 1"""	ZNF363		12654245	Standard	NM_015436		Approved	CHIMP, DKFZp586C1620, PRO1996, RNF199, ARNIP, PIRH2, ZCHY	uc003hik.3	Q96PM5	OTTHUMG00000130105	ENST00000324439.5:c.661C>A	4.37:g.76407873G>T	ENSP00000321239:p.Leu221Ile		B3KRG3|C7E541|C7E542|C7E543|D3YRV2|E7EMC8|E7ETW5|J3KPI0|Q2KN33|Q59GN7|Q86X26|Q96PR5	Missense_Mutation	SNP	pfam_Znf_CHY,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L221I	ENST00000324439.5	37	c.661	CCDS3567.1	4	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705042	0.48412	.	.	ENSG00000163743	ENST00000324439;ENST00000380840;ENST00000512706;ENST00000513257;ENST00000507014	T;T;T	0.33216	1.42;1.43;1.42	5.87	5.87	0.94306	Rubredoxin-type Fe(Cys)4 protein (1);	0.165279	0.53938	D	0.000057	T	0.36026	0.0952	M	0.70787	2.145	0.80722	D	1	B;B;B;B	0.30870	0.208;0.051;0.208;0.298	B;B;B;B	0.25759	0.028;0.012;0.028;0.063	T	0.11767	-1.0574	10	0.46703	T	0.11	-15.3632	17.7183	0.88344	0.0:0.0:1.0:0.0	.	172;199;212;221	E7EMC8;E7ETW5;Q96PM5-2;Q96PM5	.;.;.;ZN363_HUMAN	I	221;181;199;212;172	ENSP00000321239:L221I;ENSP00000370220:L181I;ENSP00000423976:L199I	ENSP00000321239:L221I	L	-	1	0	RCHY1	76626897	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.757000	0.62213	2.770000	0.95276	0.650000	0.86243	CTC	RCHY1	-	NULL	ENSG00000163743		0.318	RCHY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCHY1	HGNC	protein_coding	OTTHUMT00000252411.2		0.00	49	0	G	NM_015436		76407873	-1			no_errors	ENST00000324439	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
RFX2	5990	genome.wustl.edu	37	19	5997222	5997222	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:5997222G>T	ENST00000303657.5	-	16	2011	c.1862C>A	c.(1861-1863)tCc>tAc	p.S621Y	RFX2_ENST00000359161.3_Missense_Mutation_p.S621Y|RFX2_ENST00000592546.1_Missense_Mutation_p.S596Y|CTC-232P5.1_ENST00000587836.1_RNA	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	621					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GATCACCATGGAGCTGGGGAC	0.642																																					Colon(38;171 817 19800 47433 48051)												0													49.0	39.0	42.0					19																	5997222		2203	4300	6503	SO:0001583	missense	0				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.1862C>A	19.37:g.5997222G>T	ENSP00000306335:p.Ser621Tyr		A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.S621Y	ENST00000303657.5	37	c.1862	CCDS12157.1	19	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918050	0.92249	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.49139	0.79	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.75729	0.3889	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82259	-0.0546	10	0.87932	D	0	-44.6037	17.1348	0.86736	0.0:0.0:1.0:0.0	.	596;621	P48378-2;P48378	.;RFX2_HUMAN	Y	621;596;408	ENSP00000306335:S621Y	ENSP00000306335:S621Y	S	-	2	0	RFX2	5948222	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.661000	0.98601	2.374000	0.81015	0.655000	0.94253	TCC	RFX2	-	NULL	ENSG00000087903		0.642	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452687.1	-	0.00	67	0	G	NM_000635		5997222	-1	tier1	-	no_errors	ENST00000303657	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
SART3	9733	genome.wustl.edu	37	12	108919248	108919248	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:108919248C>T	ENST00000228284.3	-	17	2743	c.2509G>A	c.(2509-2511)Gct>Act	p.A837T	SART3_ENST00000431469.2_Missense_Mutation_p.A801T|FICD_ENST00000546448.1_Intron	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	837	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						GGTTTGCCAGCCCGGTTGGTG	0.488									Porokeratosis																																								0													110.0	94.0	99.0					12																	108919248		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.2509G>A	12.37:g.108919248C>T	ENSP00000228284:p.Ala837Thr		A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	pfam_RRM_dom,pfam_LSM_interact,smart_HAT,smart_RRM_dom,pfscan_RRM_dom	p.A837T	ENST00000228284.3	37	c.2509	CCDS9117.1	12	.	.	.	.	.	.	.	.	.	.	C	15.19	2.761432	0.49468	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000535329;ENST00000547397	T;T;T	0.10960	2.82;2.82;2.82	5.87	5.87	0.94306	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.051842	0.85682	D	0.000000	T	0.04815	0.0130	N	0.01128	-1	0.80722	D	1	B;B	0.30914	0.3;0.195	B;B	0.34242	0.178;0.114	T	0.53365	-0.8449	10	0.12766	T	0.61	-17.7337	18.3865	0.90469	0.0:1.0:0.0:0.0	.	801;837	B7ZKM0;Q15020	.;SART3_HUMAN	T	837;801;402;76	ENSP00000228284:A837T;ENSP00000414453:A801T;ENSP00000447875:A76T	ENSP00000228284:A837T	A	-	1	0	SART3	107443378	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.610000	0.54125	2.785000	0.95823	0.655000	0.94253	GCT	SART3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000075856		0.488	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART3	HGNC	protein_coding	OTTHUMT00000404094.1		0.00	62	0	C			108919248	-1			no_errors	ENST00000228284	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
SCUBE1	80274	genome.wustl.edu	37	22	43627758	43627758	+	Splice_Site	DEL	C	C	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr22:43627758delC	ENST00000360835.4	-	8	1094		c.e8+1		Z82214.2_ENST00000419643.1_RNA	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CAGGGGCTCACCCTGGCAGGT	0.701											OREG0026615	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													17.0	15.0	16.0					22																	43627758		2189	4286	6475	SO:0001630	splice_region_variant	0				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.967+1G>-	22.37:g.43627758delC		917	Q5R336	Splice_Site	DEL	-	e8+1	ENST00000360835.4	37	c.967+1	CCDS14048.1	22																																																																																			SCUBE1	-	-	ENSG00000159307		0.701	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3		0.00	11	0	C	NM_173050	Intron	43627758	-1			no_errors	ENST00000360835	ensembl	human	known	74_37	splice_site_del	33.33	4	2	DEL	1.000	0
SEC24B	10427	genome.wustl.edu	37	4	110427668	110427668	+	Splice_Site	SNP	A	A	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr4:110427668A>T	ENST00000265175.5	+	7	1728	c.1673A>T	c.(1672-1674)gAt>gTt	p.D558V	SEC24B_ENST00000399100.2_Splice_Site_p.D523V|SEC24B_ENST00000504968.2_Splice_Site_p.D588V	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	558					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TGTAGCCCAGAGTAGGTATTT	0.323																																																	0													87.0	84.0	85.0					4																	110427668		1795	4058	5853	SO:0001630	splice_region_variant	0			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.1673+1A>T	4.37:g.110427668A>T			B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.D558V	ENST00000265175.5	37	c.1673	CCDS47124.1	4	.	.	.	.	.	.	.	.	.	.	A	26.4	4.738522	0.89573	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.25250	1.81;1.81;1.81	5.67	5.67	0.87782	.	0.163366	0.56097	D	0.000039	T	0.49847	0.1581	M	0.76170	2.325	0.80722	D	1	D;D;D;D;D	0.67145	0.993;0.96;0.993;0.996;0.984	P;P;P;P;P	0.62813	0.809;0.589;0.809;0.907;0.809	T	0.53351	-0.8451	10	0.66056	D	0.02	-19.5476	15.9206	0.79562	1.0:0.0:0.0:0.0	.	472;157;588;523;558	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	V	588;523;558	ENSP00000428564:D588V;ENSP00000382051:D523V;ENSP00000265175:D558V	ENSP00000265175:D558V	D	+	2	0	SEC24B	110647117	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.006000	0.93592	2.148000	0.66965	0.482000	0.46254	GAT	SEC24B	-	NULL	ENSG00000138802		0.323	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24B	HGNC	protein_coding	OTTHUMT00000364693.2	-	0.00	63	0	A		Missense_Mutation	110427668	+1	tier1	-	no_errors	ENST00000265175	ensembl	human	known	74_37	missense	73.08	21	57	SNP	1.000	T
SIGLEC5	8778	genome.wustl.edu	37	19	52132662	52132662	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:52132662G>A	ENST00000534261.2	-	4	1048	c.649C>T	c.(649-651)Cgc>Tgc	p.R217C	SIGLEC5_ENST00000222107.4_Missense_Mutation_p.R217C|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.R217C|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.R217C|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.R217C			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	217	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GCTCCTTGGCGTTTCATCTGA	0.632																																																	0													121.0	108.0	112.0					19																	52132662		2203	4300	6503	SO:0001583	missense	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.649C>T	19.37:g.52132662G>A	ENSP00000473238:p.Arg217Cys			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R217C	ENST00000534261.2	37	c.649	CCDS33088.1	19	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477397	0.44044	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.03242	4.0;4.0	3.69	-0.197	0.13228	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.984930	0.02595	N	0.100423	T	0.02929	0.0087	N	0.03608	-0.345	0.09310	N	1	D	0.67145	0.996	P	0.48368	0.575	T	0.21999	-1.0229	10	0.72032	D	0.01	.	4.0623	0.09844	0.2385:0.2564:0.505:0.0	.	217	O15389	SIGL5_HUMAN	C	217	ENSP00000222107:R217C;ENSP00000415200:R217C	ENSP00000222107:R217C	R	-	1	0	SIGLEC5	56824474	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.500000	0.06405	-0.026000	0.13895	0.491000	0.48974	CGC	SIGLEC5	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000105501		0.632	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	-	0.00	70	0	G	NM_003830		52132662	-1	tier1	-	no_errors	ENST00000222107	ensembl	human	known	74_37	missense	48.44	33	31	SNP	0.000	A
SLC16A11	162515	genome.wustl.edu	37	17	6945037	6945037	+	Silent	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:6945037G>A	ENST00000308009.1	-	4	1714	c.1377C>T	c.(1375-1377)tcC>tcT	p.S459S	SLC16A11_ENST00000447225.1_Silent_p.S427S	NM_153357.1	NP_699188.1	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	459					lipid metabolic process (GO:0006629)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(2)|ovary(1)|skin(2)	9						GGCCTCCTGGGGACAGCAAGA	0.597																																																	0													22.0	27.0	25.0					17																	6945037		2203	4297	6500	SO:0001819	synonymous_variant	0			AK074674	CCDS11086.1	17p13.2	2013-07-18	2013-07-18		ENSG00000174326	ENSG00000174326		"""Solute carriers"""	23093	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 11"""	615765	"""solute carrier family 16 (monocarboxylic acid transporters), member 11"""				Standard	NM_153357		Approved	FLJ90193, MCT11	uc002gei.1	Q8NCK7	OTTHUMG00000102087	ENST00000308009.1:c.1377C>T	17.37:g.6945037G>A				Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S459	ENST00000308009.1	37	c.1377	CCDS11086.1	17																																																																																			SLC16A11	-	NULL	ENSG00000174326		0.597	SLC16A11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC16A11	HGNC	protein_coding	OTTHUMT00000219921.1	-	0.00	25	0	G	NM_153357		6945037	-1	tier1	-	no_errors	ENST00000308009	ensembl	human	known	74_37	silent	78.95	4	15	SNP	0.006	A
SLC25A18	83733	genome.wustl.edu	37	22	18063897	18063897	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr22:18063897C>T	ENST00000327451.6	+	4	653	c.115C>T	c.(115-117)Cag>Tag	p.Q39*	SLC25A18_ENST00000497401.1_3'UTR|AC004019.13_ENST00000443935.1_RNA|SLC25A18_ENST00000399813.1_Nonsense_Mutation_p.Q39*	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	39						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		CCTGCAGAACCAGCATGGGAA	0.617																																					Colon(118;1560 1625 18964 29606 50093)												0													55.0	43.0	47.0					22																	18063897		2197	4297	6494	SO:0001587	stop_gained	0			AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.115C>T	22.37:g.18063897C>T	ENSP00000329033:p.Gln39*			Nonsense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.Q39*	ENST00000327451.6	37	c.115	CCDS13744.1	22	.	.	.	.	.	.	.	.	.	.	C	42	9.171867	0.99089	.	.	ENSG00000182902	ENST00000327451;ENST00000399813	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.0945	17.6423	0.88140	0.0:1.0:0.0:0.0	.	.	.	.	X	39	.	ENSP00000329033:Q39X	Q	+	1	0	SLC25A18	16443897	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.144000	0.77357	2.515000	0.84797	0.655000	0.94253	CAG	SLC25A18	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000182902		0.617	SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A18	HGNC	protein_coding	OTTHUMT00000316214.3	-	0.00	66	0	C	NM_031481		18063897	+1	tier1	-	no_errors	ENST00000327451	ensembl	human	known	74_37	nonsense	50.00	16	16	SNP	1.000	T
SLC25A25	114789	genome.wustl.edu	37	9	130864648	130864648	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:130864648G>T	ENST00000373064.5	+	4	637		c.e4-1		SLC25A25_ENST00000432073.2_Splice_Site|SLC25A25_ENST00000373066.5_Splice_Site|SLC25A25_ENST00000433501.1_Splice_Site|SLC25A25_ENST00000373068.2_Splice_Site|SLC25A25_ENST00000373069.5_Splice_Site	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25						adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						CTGTCTTGCAGCATGGATAAA	0.602																																																	0													163.0	106.0	126.0					9																	130864648		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.375-1G>T	9.37:g.130864648G>T			Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Splice_Site	SNP	-	e5-1	ENST00000373064.5	37	c.513-1	CCDS6890.1	9	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311473	0.81358	.	.	ENSG00000148339	ENST00000373068;ENST00000373069;ENST00000432073;ENST00000373066;ENST00000373064;ENST00000433501	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7705	0.91890	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC25A25	129904469	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	9.869000	0.99810	2.677000	0.91161	0.561000	0.74099	.	SLC25A25	-	-	ENSG00000148339		0.602	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A25	HGNC	protein_coding	OTTHUMT00000054407.1	-	0.00	40	0	G	NM_052901	Intron	130864648	+1	tier1	-	no_errors	ENST00000373069	ensembl	human	known	74_37	splice_site	13.64	19	3	SNP	1.000	T
SLC30A9	10463	genome.wustl.edu	37	4	42024887	42024887	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr4:42024887G>T	ENST00000264451.7	+	5	647	c.467G>T	c.(466-468)cGa>cTa	p.R156L		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	156					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ATCAGACGACGAAGTCCCCAT	0.328																																																	0													87.0	93.0	91.0					4																	42024887		2203	4299	6502	SO:0001583	missense	0			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.467G>T	4.37:g.42024887G>T	ENSP00000264451:p.Arg156Leu		Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.R156L	ENST00000264451.7	37	c.467	CCDS3465.1	4	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887162	0.91814	.	.	ENSG00000014824	ENST00000264451	T	0.56275	0.47	5.72	4.88	0.63580	DNA binding domain, putative (1);	0.000000	0.85682	D	0.000000	T	0.71082	0.3298	M	0.69523	2.12	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.75199	-0.3402	10	0.87932	D	0	-12.3593	14.8238	0.70094	0.0692:0.0:0.9308:0.0	.	156	Q6PML9	ZNT9_HUMAN	L	156	ENSP00000264451:R156L	ENSP00000264451:R156L	R	+	2	0	SLC30A9	41719644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.291000	0.96070	1.425000	0.47237	0.555000	0.69702	CGA	SLC30A9	-	superfamily_DNA-bd_dom_put	ENSG00000014824		0.328	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	HGNC	protein_coding	OTTHUMT00000216842.3		0.00	27	0	G			42024887	+1			no_errors	ENST00000264451	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
SLC51A	200931	genome.wustl.edu	37	3	195956804	195956804	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr3:195956804G>T	ENST00000296327.5	+	7	861	c.652G>T	c.(652-654)Gct>Tct	p.A218S	PCYT1A_ENST00000419333.1_3'UTR	NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	218					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	GGGGAGCACAGCTCTATGGAT	0.532																																																	0													120.0	108.0	112.0					3																	195956804		2203	4300	6503	SO:0001583	missense	0				CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.652G>T	3.37:g.195956804G>T	ENSP00000296327:p.Ala218Ser		Q6ZMC7	Missense_Mutation	SNP	pfam_Ost-alpha	p.A218S	ENST00000296327.5	37	c.652	CCDS3314.1	3	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231630	0.58777	.	.	ENSG00000163959	ENST00000296327	T	0.40756	1.02	5.85	5.85	0.93711	.	0.000000	0.49305	D	0.000146	T	0.67730	0.2924	M	0.81942	2.565	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.66416	-0.5929	10	0.42905	T	0.14	-18.4061	19.1459	0.93467	0.0:0.0:1.0:0.0	.	218	Q86UW1	OSTA_HUMAN	S	218	ENSP00000296327:A218S	ENSP00000296327:A218S	A	+	1	0	AC069257.9	197441201	1.000000	0.71417	0.994000	0.49952	0.020000	0.10135	4.078000	0.57606	2.767000	0.95098	0.655000	0.94253	GCT	SLC51A	-	pfam_Ost-alpha	ENSG00000163959		0.532	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC51A	HGNC	protein_coding	OTTHUMT00000341253.1		0.00	26	0	G	NM_152672		195956804	+1			no_errors	ENST00000296327	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
SLC8A3	6547	genome.wustl.edu	37	14	70634851	70634851	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr14:70634851G>T	ENST00000381269.2	-	2	1042	c.289C>A	c.(289-291)Cgc>Agc	p.R97S	SLC8A3_ENST00000357887.3_Missense_Mutation_p.R97S|SLC8A3_ENST00000356921.2_Missense_Mutation_p.R97S|SLC8A3_ENST00000528359.1_Missense_Mutation_p.R97S|SLC8A3_ENST00000534137.1_Missense_Mutation_p.R97S	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	97					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.R97C(2)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GCCATGAAGCGGTCAGCAATG	0.488																																																	2	Substitution - Missense(2)	kidney(2)											87.0	76.0	80.0					14																	70634851		2203	4300	6503	SO:0001583	missense	0			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.289C>A	14.37:g.70634851G>T	ENSP00000370669:p.Arg97Ser		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.R97S	ENST00000381269.2	37	c.289	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566865	0.65651	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	4.96	4.96	0.65561	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.83133	0.5188	M	0.90019	3.08	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.994;0.998	D;D;D;D	0.91635	0.993;0.999;0.988;0.992	D	0.85631	0.1270	10	0.51188	T	0.08	.	18.3961	0.90499	0.0:0.0:1.0:0.0	.	97;97;97;97	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	S	97	ENSP00000349392:R97S;ENSP00000370669:R97S;ENSP00000350560:R97S;ENSP00000436688:R97S;ENSP00000433531:R97S	ENSP00000349392:R97S	R	-	1	0	SLC8A3	69704604	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.648000	0.98483	2.573000	0.86826	0.650000	0.86243	CGC	SLC8A3	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex	ENSG00000100678		0.488	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	HGNC	protein_coding	OTTHUMT00000390736.1		0.00	57	0	G			70634851	-1			no_errors	ENST00000381269	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
SLCO1B3	28234	genome.wustl.edu	37	12	21069005	21069005	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:21069005T>G	ENST00000381545.3	+	16	2152	c.1933T>G	c.(1933-1935)Ttt>Gtt	p.F645V	SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000553473.1_Intron|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.F645V|LST3_ENST00000540229.1_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	645					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TGTTTTCATTTTTGCTATGAA	0.313																																																	0													67.0	68.0	68.0					12																	21069005		2201	4298	6499	SO:0001583	missense	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1933T>G	12.37:g.21069005T>G	ENSP00000370956:p.Phe645Val		E7EMT8|Q5JAR4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.F645V	ENST00000381545.3	37	c.1933	CCDS8684.1	12	.	.	.	.	.	.	.	.	.	.	.	6.769	0.510754	0.12883	.	.	ENSG00000111700	ENST00000261196;ENST00000381545	T;T	0.57752	0.38;0.38	3.6	-0.539	0.11865	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.566790	0.03492	N	0.216833	T	0.41119	0.1145	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.15752	-1.0426	10	0.32370	T	0.25	.	2.4512	0.04518	0.4368:0.1333:0.0:0.4299	.	645	Q9NPD5	SO1B3_HUMAN	V	645	ENSP00000261196:F645V;ENSP00000370956:F645V	ENSP00000261196:F645V	F	+	1	0	SLCO1B3	20960272	0.028000	0.19301	0.026000	0.17262	0.007000	0.05969	0.282000	0.18829	0.359000	0.24239	0.445000	0.29226	TTT	SLCO1B3	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.313	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	-	0.00	69	0	T	NM_019844		21069005	+1	tier1	-	no_errors	ENST00000261196	ensembl	human	known	74_37	missense	47.27	29	26	SNP	0.002	G
SLCO3A1	28232	genome.wustl.edu	37	15	92459455	92459455	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:92459455G>T	ENST00000318445.6	+	2	627	c.413G>T	c.(412-414)gGc>gTc	p.G138V	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.G138V	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	138					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	TACGAGGCGGGCGAGATCCGC	0.746																																																	0													6.0	6.0	6.0					15																	92459455		2028	3914	5942	SO:0001583	missense	0			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.413G>T	15.37:g.92459455G>T	ENSP00000320634:p.Gly138Val		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.G138V	ENST00000318445.6	37	c.413	CCDS10371.1	15	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643449	0.47258	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000553304	T;T;T	0.38077	1.16;1.16;1.16	5.0	5.0	0.66597	Major facilitator superfamily domain, general substrate transporter (1);	0.272817	0.35615	N	0.003092	T	0.24392	0.0591	N	0.12887	0.27	0.80722	D	1	B;B;B	0.28713	0.22;0.033;0.05	B;B;B	0.28385	0.069;0.046;0.089	T	0.06041	-1.0849	10	0.31617	T	0.26	.	17.6499	0.88161	0.0:0.0:1.0:0.0	.	80;138;138	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	V	138;138;80	ENSP00000320634:G138V;ENSP00000387846:G138V;ENSP00000450559:G80V	ENSP00000320634:G138V	G	+	2	0	SLCO3A1	90260459	1.000000	0.71417	0.980000	0.43619	0.965000	0.64279	5.901000	0.69861	2.494000	0.84150	0.655000	0.94253	GGC	SLCO3A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000176463		0.746	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	HGNC	protein_coding	OTTHUMT00000313529.1	-	0.00	33	0	G	NM_013272		92459455	+1	tier1	-	no_errors	ENST00000318445	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.994	T
SPANXC	64663	genome.wustl.edu	37	X	140335650	140335650	+	Nonstop_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chrX:140335650C>A	ENST00000358993.2	-	2	332	c.294G>T	c.(292-294)taG>taT	p.*98Y		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	0						cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					TAGCTTCTTGCTACTTTGCAG	0.463																																																	0													38.0	41.0	40.0					X																	140335650		1988	3986	5974	SO:0001578	stop_lost	0			AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.294G>T	X.37:g.140335650C>A			Q32WL9|Q5JX88	Nonstop_Mutation	SNP	pfam_SPANX_prot	p.*98Y	ENST00000358993.2	37	c.294	CCDS14673.1	X	.	.	.	.	.	.	.	.	.	.	c	0.009	-1.813281	0.00600	.	.	ENSG00000198573	ENST00000358993	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Y	98	.	.	X	-	3	2	SPANXC	140163316	0.059000	0.20769	0.003000	0.11579	0.003000	0.03518	0.064000	0.14437	-1.174000	0.02754	-1.238000	0.01547	TAG	SPANXC	-	NULL	ENSG00000198573		0.463	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXC	HGNC	protein_coding	OTTHUMT00000058590.1	-	0.00	57	0	C	NM_022661		140335650	-1	tier1	-	no_errors	ENST00000358993	ensembl	human	known	74_37	nonstop	57.58	14	19	SNP	0.003	A
SSPO	23145	genome.wustl.edu	37	7	149485872	149485872	+	RNA	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:149485872G>T	ENST00000378016.2	+	0	4091							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CATTGTGGGGGTGACGGTGGC	0.622																																																	0													79.0	84.0	82.0					7																	149485872		2183	4272	6455			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149485872G>T			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.622	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	42	0	G			149485872	+1	tier1	-	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	20.00	12	3	SNP	0.000	T
STAT6	6778	genome.wustl.edu	37	12	57492339	57492339	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr12:57492339T>A	ENST00000300134.3	-	19	2433	c.2108A>T	c.(2107-2109)tAt>tTt	p.Y703F	STAT6_ENST00000543873.2_Missense_Mutation_p.Y703F|STAT6_ENST00000556155.1_Missense_Mutation_p.Y703F|STAT6_ENST00000454075.3_Missense_Mutation_p.Y703F|STAT6_ENST00000537215.2_Missense_Mutation_p.Y593F|STAT6_ENST00000538913.2_Missense_Mutation_p.Y593F	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	703					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						GAGGCCTTGATACGGGGGGAT	0.572																																																	0													90.0	90.0	90.0					12																	57492339		2203	4300	6503	SO:0001583	missense	0			BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.2108A>T	12.37:g.57492339T>A	ENSP00000300134:p.Tyr703Phe		A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.Y703F	ENST00000300134.3	37	c.2108	CCDS8931.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.28|10.28	1.307301|1.307301	0.23821|0.23821	.|.	.|.	ENSG00000166888|ENSG00000166888	ENST00000555318|ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721	T|D;D;D;D;D;D	0.78003|0.91464	-1.14|-2.64;-2.85;-2.64;-2.64;-2.85;-2.64	4.41|4.41	1.94|1.94	0.25998|0.25998	.|.	.|1.242850	.|0.05687	.|N	.|0.591469	T|T	0.74397|0.74397	0.3711|0.3711	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	0.999998|0.999998	.|B;B	.|0.06786	.|0.001;0.001	.|B;B	.|0.06405	.|0.002;0.001	T|T	0.63545|0.63545	-0.6613|-0.6613	6|10	.|0.09590	.|T	.|0.72	-4.3985|-4.3985	6.977|6.977	0.24681|0.24681	0.3871:0.0:0.0:0.6129|0.3871:0.0:0.0:0.6129	.|.	.|703;703	.|A8K4S9;P42226	.|.;STAT6_HUMAN	F|F	129|703;593;593;703;703;593;703;593	ENSP00000450428:I129F|ENSP00000300134:Y703F;ENSP00000445409:Y593F;ENSP00000438451:Y703F;ENSP00000451742:Y703F;ENSP00000444530:Y593F;ENSP00000401486:Y703F	.|ENSP00000300134:Y703F	I|Y	-|-	1|2	0|0	STAT6|STAT6	55778606|55778606	0.988000|0.988000	0.35896|0.35896	0.299000|0.299000	0.25016|0.25016	0.963000|0.963000	0.63663|0.63663	0.597000|0.597000	0.24059|0.24059	0.415000|0.415000	0.25817|0.25817	0.528000|0.528000	0.53228|0.53228	ATC|TAT	STAT6	-	NULL	ENSG00000166888		0.572	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT6	HGNC	protein_coding	OTTHUMT00000412248.3	-	0.00	80	0	T	NM_003153		57492339	-1	tier1	-	no_errors	ENST00000300134	ensembl	human	known	74_37	missense	57.14	15	20	SNP	0.408	A
SUPT5H	6829	genome.wustl.edu	37	19	39949653	39949653	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:39949653G>T	ENST00000599117.1	+	8	765	c.398G>T	c.(397-399)cGa>cTa	p.R133L	SUPT5H_ENST00000402194.2_Missense_Mutation_p.R129L|SUPT5H_ENST00000359191.6_Missense_Mutation_p.R129L|SUPT5H_ENST00000598725.1_Missense_Mutation_p.R133L|SUPT5H_ENST00000432763.2_Missense_Mutation_p.R133L			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	133					7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.R133P(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGGGACCAGCGAGAAGAAGAA	0.567																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											122.0	112.0	116.0					19																	39949653		2203	4300	6503	SO:0001583	missense	0			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.398G>T	19.37:g.39949653G>T	ENSP00000470252:p.Arg133Leu		O43279|Q59G52|Q99639	Missense_Mutation	SNP	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N_dom,smart_KOW,pirsf_TF_Spt5	p.R133L	ENST00000599117.1	37	c.398	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966554	0.92855	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	4.48	4.48	0.54585	Spt5 transcription elongation factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56352	0.1979	L	0.40543	1.245	0.80722	D	1	P;P	0.48350	0.889;0.909	B;P	0.48166	0.433;0.569	T	0.54735	-0.8249	8	.	.	.	-6.0125	16.4662	0.84079	0.0:0.0:1.0:0.0	.	129;133	O00267-2;O00267	.;SPT5H_HUMAN	L	133;129;111;133	.	.	R	+	2	0	SUPT5H	44641493	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.600000	0.98282	2.507000	0.84556	0.650000	0.86243	CGA	SUPT5H	-	pfam_Spt5_N,pirsf_TF_Spt5	ENSG00000196235		0.567	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	HGNC	protein_coding	OTTHUMT00000464918.1		0.00	67	0	G	NM_003169		39949653	+1			no_errors	ENST00000432763	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152737763	152737763	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:152737763G>T	ENST00000367255.5	-	41	6410	c.5809C>A	c.(5809-5811)Ctg>Atg	p.L1937M	SYNE1_ENST00000341594.5_Missense_Mutation_p.L1974M|SYNE1_ENST00000448038.1_Missense_Mutation_p.L1944M|SYNE1_ENST00000423061.1_Missense_Mutation_p.L1944M|SYNE1_ENST00000265368.4_Missense_Mutation_p.L1937M	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1937					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCGATTTTCAGATGGTATTGG	0.478										HNSCC(10;0.0054)																																							0													106.0	102.0	104.0					6																	152737763		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5809C>A	6.37:g.152737763G>T	ENSP00000356224:p.Leu1937Met		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L1937M	ENST00000367255.5	37	c.5809	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304087	0.40795	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13	6.17	4.39	0.52855	.	0.000000	0.49916	D	0.000136	T	0.51907	0.1702	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.996	D;D;D;P	0.70487	0.96;0.969;0.969;0.896	T	0.58070	-0.7701	10	0.59425	D	0.04	.	12.0889	0.53713	0.1907:0.0:0.8093:0.0	.	1920;1937;1937;1944	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	M	1937;1944;1937;1944;1974	ENSP00000356224:L1937M;ENSP00000396024:L1944M;ENSP00000265368:L1937M;ENSP00000390975:L1944M;ENSP00000341887:L1974M	ENSP00000265368:L1937M	L	-	1	2	SYNE1	152779456	1.000000	0.71417	0.846000	0.33378	0.970000	0.65996	2.592000	0.46171	0.927000	0.37143	0.655000	0.94253	CTG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.478	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	23	0	G	NM_182961		152737763	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.750	T
TAF1B	9014	genome.wustl.edu	37	2	9989571	9989571	+	Frame_Shift_Del	DEL	A	A	-	rs528368939		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr2:9989571delA	ENST00000263663.5	+	3	375	c.187delA	c.(187-189)aaafs	p.K65fs	TAF1B_ENST00000402170.1_3'UTR|TAF1B_ENST00000396242.3_5'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	65	B-reader.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCGGGGGCTTAAAAAAAAAAA	0.333																																																	0										139,495,3606		1,2,135,2,489,1491	20.0	22.0	21.0			1.7	0.9	2		23	207,946,7081		0,0,207,0,946,2964	no	codingComplex	TAF1B	NM_005680.2		1,2,342,2,1435,4455	A1A1,A1A2,A1R,A2A2,A2R,RR		14.0029,14.9528,14.3258			9989571	346,1441,10687	2194	4292	6486	SO:0001589	frameshift_variant	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.187delA	2.37:g.9989571delA	ENSP00000263663:p.Lys65fs		B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	pfam_TF_Rrn7	p.N66fs	ENST00000263663.5	37	c.187	CCDS33143.1	2																																																																																			TAF1B	-	NULL	ENSG00000115750		0.333	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2		0.00	22	0	A	NM_005680		9989571	+1	tier1		no_errors	ENST00000263663	ensembl	human	known	74_37	frame_shift_del	11.76	15	2	DEL	0.991	-
TANC1	85461	genome.wustl.edu	37	2	160027186	160027186	+	Silent	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr2:160027186C>T	ENST00000263635.6	+	10	1458	c.1221C>T	c.(1219-1221)aaC>aaT	p.N407N	TANC1_ENST00000454300.1_Silent_p.N301N	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	407					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TGGCAGAAAACAGAGGCGCGG	0.502																																																	0													103.0	115.0	111.0					2																	160027186		1906	4111	6017	SO:0001819	synonymous_variant	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.1221C>T	2.37:g.160027186C>T			C9JD88|Q49AI8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.N407	ENST00000263635.6	37	c.1221	CCDS42766.1	2																																																																																			TANC1	-	superfamily_P-loop_NTPase	ENSG00000115183		0.502	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1	-	0.00	97	0	C			160027186	+1	tier1	-	no_errors	ENST00000263635	ensembl	human	known	74_37	silent	46.27	36	31	SNP	0.452	T
TASP1	55617	genome.wustl.edu	37	20	13567947	13567947	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:13567947C>T	ENST00000337743.4	-	5	473	c.353G>A	c.(352-354)aGc>aAc	p.S118N	TASP1_ENST00000539805.1_Intron|TASP1_ENST00000480436.1_5'UTR	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	118					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						ATCCATTATGCTGGCATCACA	0.363																																																	0													188.0	172.0	177.0					20																	13567947		2203	4300	6503	SO:0001583	missense	0			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.353G>A	20.37:g.13567947C>T	ENSP00000338624:p.Ser118Asn		B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Missense_Mutation	SNP	pfam_Peptidase_T2	p.S118N	ENST00000337743.4	37	c.353	CCDS13116.1	20	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697210	0.88830	.	.	ENSG00000089123	ENST00000378157;ENST00000337743;ENST00000455532	D;D	0.88664	-2.41;-2.41	5.44	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.95787	0.8629	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.81914	0.989;0.995	D	0.96680	0.9503	10	0.87932	D	0	-6.6831	14.1405	0.65316	0.0:0.9276:0.0:0.0724	.	118;95	Q9H6P5;Q5JWM4	TASP1_HUMAN;.	N	95;118;95	ENSP00000338624:S118N;ENSP00000400580:S95N	ENSP00000338624:S118N	S	-	2	0	TASP1	13515947	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.103000	0.77014	1.292000	0.44672	0.655000	0.94253	AGC	TASP1	-	pfam_Peptidase_T2	ENSG00000089123		0.363	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TASP1	HGNC	protein_coding	OTTHUMT00000078041.2	-	0.00	65	0	C	NM_017714		13567947	-1	tier1	-	no_errors	ENST00000337743	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
TBC1D32	221322	genome.wustl.edu	37	6	121526252	121526252	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:121526252T>C	ENST00000398212.2	-	22	2588	c.2539A>G	c.(2539-2541)Aac>Gac	p.N847D	TBC1D32_ENST00000275159.6_Missense_Mutation_p.N847D|TBC1D32_ENST00000398197.2_Intron	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	847					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										TGTTCATAGTTGAATAAAGAA	0.264																																																	0													54.0	55.0	55.0					6																	121526252		1786	4037	5823	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2539A>G	6.37:g.121526252T>C	ENSP00000381270:p.Asn847Asp		Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.N847D	ENST00000398212.2	37	c.2539	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	T	12.54	1.969653	0.34754	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.23348	1.91;1.91	5.74	4.58	0.56647	.	0.126552	0.64402	N	0.000001	T	0.09113	0.0225	L	0.38175	1.15	0.37005	D	0.895463	B;B	0.17667	0.006;0.023	B;B	0.20184	0.005;0.028	T	0.06770	-1.0808	10	0.33940	T	0.23	.	9.7627	0.40541	0.0:0.0793:0.0:0.9207	.	847;847	Q96NH3-4;Q96NH3	.;BROMI_HUMAN	D	847	ENSP00000275159:N847D;ENSP00000381270:N847D	ENSP00000275159:N847D	N	-	1	0	C6orf170	121567951	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.300000	0.51834	1.116000	0.41820	0.459000	0.35465	AAC	TBC1D32	-	NULL	ENSG00000146350		0.264	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TBC1D32	HGNC	protein_coding	OTTHUMT00000380937.2	-	0.00	188	0	T	NM_152730		121526252	-1	tier1	-	no_errors	ENST00000275159	ensembl	human	putative	74_37	missense	44.16	43	34	SNP	1.000	C
GNB1L	54584	genome.wustl.edu	37	22	19770479	19770479	+	IGR	SNP	C	C	T	rs41298848		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr22:19770479C>T	ENST00000329517.6	-	0	6706				TBX1_ENST00000359500.3_Silent_p.D351D	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)		p.D351D(1)		breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					gcttgctggacgtgctcttga	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18599	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	large_intestine(1)						C		2,4404	4.2+/-10.8	0,2,2201	143.0	133.0	136.0		1053	-2.9	0.0	22	dbSNP_127	136	0,8600		0,0,4300	no	coding-synonymous	TBX1	NM_005992.1		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		351/373	19770479	2,13004	2203	4300	6503	SO:0001628	intergenic_variant	0			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279		22.37:g.19770479C>T			Q9H2S2|Q9H4M4	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.D351	ENST00000329517.6	37	c.1053	CCDS13768.1	22																																																																																			TBX1	-	NULL	ENSG00000184058		0.582	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX1	HGNC	protein_coding	OTTHUMT00000075202.1		0.00	84	0	C			19770479	+1			no_errors	ENST00000359500	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.000	T
TCHH	7062	genome.wustl.edu	37	1	152084666	152084666	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:152084666G>C	ENST00000368804.1	-	2	1026	c.1027C>G	c.(1027-1029)Cag>Gag	p.Q343E		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	343	5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ctctcctcctgctcgcgcctc	0.716																																																	0													11.0	15.0	14.0					1																	152084666		1927	3989	5916	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1027C>G	1.37:g.152084666G>C	ENSP00000357794:p.Gln343Glu		Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.Q343E	ENST00000368804.1	37	c.1027	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	N	6.893	0.534184	0.13188	.	.	ENSG00000159450	ENST00000368804	T	0.05649	3.41	4.0	-5.61	0.02489	.	.	.	.	.	T	0.00724	0.0024	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.49113	-0.8973	9	0.02654	T	1	.	13.7826	0.63091	0.0:0.6395:0.2464:0.1142	.	343	Q07283	TRHY_HUMAN	E	343	ENSP00000357794:Q343E	ENSP00000357794:Q343E	Q	-	1	0	TCHH	150351290	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.355000	0.07671	-0.723000	0.04915	-2.716000	0.00133	CAG	TCHH	-	NULL	ENSG00000159450		0.716	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	-	0.00	52	0	G	NM_007113		152084666	-1	tier1	-	no_errors	ENST00000368804	ensembl	human	known	74_37	missense	5.15	128	7	SNP	0.000	C
TGFBI	7045	genome.wustl.edu	37	5	135391471	135391471	+	Missense_Mutation	SNP	G	G	T	rs201775031	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr5:135391471G>T	ENST00000442011.2	+	11	1674	c.1513G>T	c.(1513-1515)Gtc>Ttc	p.V505F	TGFBI_ENST00000305126.8_Missense_Mutation_p.V505F	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	505	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082}.		V -> D (in CDL1). {ECO:0000269|PubMed:15838722}.		angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AATGGGGACTGTCATGGATGT	0.602																																																	0													43.0	45.0	44.0					5																	135391471		1917	4124	6041	SO:0001583	missense	0			M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.1513G>T	5.37:g.135391471G>T	ENSP00000416330:p.Val505Phe		D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_EMI_domain,pfscan_FAS1_domain	p.V505F	ENST00000442011.2	37	c.1513	CCDS47266.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.92|16.92	3.255786|3.255786	0.59321|0.59321	.|.	.|.	ENSG00000120708|ENSG00000120708	ENST00000514554|ENST00000442011;ENST00000398813;ENST00000305126	.|D;D	.|0.92699	.|-3.09;-3.09	5.87|5.87	4.07|4.07	0.47477|0.47477	.|FAS1 domain (3);	.|0.158760	.|0.56097	.|D	.|0.000028	D|D	0.93161|0.93161	0.7822|0.7822	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	.|P;P	.|0.46142	.|0.873;0.764	.|P;P	.|0.46362	.|0.514;0.514	D|D	0.93607|0.93607	0.6935|0.6935	5|10	.|0.56958	.|D	.|0.05	-1.5614|-1.5614	13.4813|13.4813	0.61336|0.61336	0.1326:0.0:0.8674:0.0|0.1326:0.0:0.8674:0.0	.|.	.|238;505	.|B9ZVW9;Q15582	.|.;BGH3_HUMAN	F|F	222|505;238;505	.|ENSP00000416330:V505F;ENSP00000306306:V505F	.|ENSP00000306306:V505F	C|V	+|+	2|1	0|0	TGFBI|TGFBI	135419370|135419370	0.998000|0.998000	0.40836|0.40836	0.995000|0.995000	0.50966|0.50966	0.993000|0.993000	0.82548|0.82548	2.827000|2.827000	0.48112|0.48112	1.632000|1.632000	0.50472|0.50472	0.655000|0.655000	0.94253|0.94253	TGT|GTC	TGFBI	-	pirsf_TGFb-ind_bIGH3/osteoblast_fac2,superfamily_FAS1_domain,pfscan_FAS1_domain	ENSG00000120708		0.602	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBI	HGNC	protein_coding	OTTHUMT00000372108.1		0.00	93	0	G			135391471	+1			no_errors	ENST00000305126	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.978	T
THSD4	79875	genome.wustl.edu	37	15	72057376	72057376	+	Silent	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:72057376G>T	ENST00000355327.3	+	16	2741	c.2607G>T	c.(2605-2607)ggG>ggT	p.G869G	THSD4_ENST00000357769.4_Silent_p.G509G|THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000261862.6_Silent_p.G869G			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	869	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TCGAGTGTGGGAGCGGGACGC	0.498																																																	0													122.0	122.0	122.0					15																	72057376		1956	4154	6110	SO:0001819	synonymous_variant	0			AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2607G>T	15.37:g.72057376G>T			B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Silent	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.G869	ENST00000355327.3	37	c.2607	CCDS10238.2	15																																																																																			THSD4	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000187720		0.498	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THSD4	HGNC	protein_coding	OTTHUMT00000257253.2	-	0.00	105	0	G	NM_024817		72057376	+1	tier1	-	no_errors	ENST00000261862	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.002	T
TLCD1	116238	genome.wustl.edu	37	17	27051812	27051812	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:27051812G>T	ENST00000292090.3	-	4	570	c.460C>A	c.(460-462)Cgc>Agc	p.R154S	SNORD4A_ENST00000459174.1_RNA|TLCD1_ENST00000394933.3_Missense_Mutation_p.R107S|AC010761.8_ENST00000582718.1_RNA|SNORD4B_ENST00000459083.1_RNA|AC010761.14_ENST00000587898.1_RNA|SNORD42A_ENST00000459584.1_RNA	NM_138463.3	NP_612472.1	Q96CP7	TLCD1_HUMAN	TLC domain containing 1	154	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(2)|lung(2)	7	Lung NSC(42;0.00431)					ATCATCATGCGAATGGTGAGG	0.507																																																	0													122.0	115.0	117.0					17																	27051812		2203	4300	6503	SO:0001583	missense	0			BC014072	CCDS11242.1, CCDS54102.1	17q11.2	2007-03-23			ENSG00000160606	ENSG00000160606			25177	protein-coding gene	gene with protein product						12151215	Standard	NM_138463		Approved		uc002hco.3	Q96CP7	OTTHUMG00000132683	ENST00000292090.3:c.460C>A	17.37:g.27051812G>T	ENSP00000292090:p.Arg154Ser		A8MYP9	Missense_Mutation	SNP	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.R154S	ENST00000292090.3	37	c.460	CCDS11242.1	17	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475827	0.63737	.	.	ENSG00000160606	ENST00000292090;ENST00000394933	D;D	0.85411	-1.98;-1.98	5.91	2.36	0.29203	TRAM/LAG1/CLN8 homology domain (3);	0.000000	0.85682	D	0.000000	D	0.91362	0.7275	M	0.78456	2.415	0.45403	D	0.998389	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91659	0.5341	10	0.59425	D	0.04	2.3915	14.1149	0.65146	0.0:0.0:0.59:0.41	.	107;154	A8MYP9;Q96CP7	.;TLCD1_HUMAN	S	154;107	ENSP00000292090:R154S;ENSP00000378391:R107S	ENSP00000292090:R154S	R	-	1	0	TLCD1	24075939	0.962000	0.33011	0.471000	0.27229	0.812000	0.45895	1.534000	0.36051	0.751000	0.32900	0.462000	0.41574	CGC	TLCD1	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000160606		0.507	TLCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLCD1	HGNC	protein_coding	OTTHUMT00000255973.1		0.00	49	0	G	NM_138463		27051812	-1			no_errors	ENST00000292090	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.270	T
TMEM131	23505	genome.wustl.edu	37	2	98435156	98435156	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr2:98435156G>T	ENST00000186436.5	-	12	1331	c.1103C>A	c.(1102-1104)gCt>gAt	p.A368D	TMEM131_ENST00000425805.2_Intron	NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	368						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TACCGTTATAGCATCATTTTG	0.343																																																	0													176.0	157.0	163.0					2																	98435156		1855	4101	5956	SO:0001583	missense	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1103C>A	2.37:g.98435156G>T	ENSP00000186436:p.Ala368Asp			Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.A368D	ENST00000186436.5	37	c.1103	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.156176	0.94686	.	.	ENSG00000075568	ENST00000186436	T	0.35973	1.28	5.93	5.93	0.95920	PapD-like (1);	0.000000	0.85682	D	0.000000	T	0.46908	0.1417	L	0.52364	1.645	0.80722	D	1	P	0.52577	0.954	P	0.51135	0.66	T	0.09271	-1.0682	10	0.28530	T	0.3	-15.2637	20.3539	0.98825	0.0:0.0:1.0:0.0	.	368	Q92545	TM131_HUMAN	D	368	ENSP00000186436:A368D	ENSP00000186436:A368D	A	-	2	0	TMEM131	97801588	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	9.452000	0.97615	2.826000	0.97356	0.655000	0.94253	GCT	TMEM131	-	NULL	ENSG00000075568		0.343	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	-	0.00	66	0	G	XM_371542		98435156	-1	tier1	-	no_errors	ENST00000186436	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
TNFRSF1B	7133	genome.wustl.edu	37	1	12268239	12268239	+	3'UTR	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:12268239C>T	ENST00000376259.3	+	0	2637				TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B						aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	GTGCCTGCAGCCCCGCGCCTC	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.*1162C>T	1.37:g.12268239C>T			B1AJZ3|Q16042|Q6YI29|Q9UIH1	RNA	SNP	-	NULL	ENST00000376259.3	37	NULL	CCDS145.1	1																																																																																			TNFRSF1B	-	-	ENSG00000028137		0.577	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF1B	HGNC	protein_coding	OTTHUMT00000005133.1	-	0.00	21	0	C	NM_001066		12268239	+1	tier1	-	no_errors	ENST00000492361	ensembl	human	known	74_37	rna	43.75	9	7	SNP	0.000	T
TNKS2	80351	genome.wustl.edu	37	10	93576936	93576936	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr10:93576936G>T	ENST00000371627.4	+	3	849	c.470G>T	c.(469-471)gGa>gTa	p.G157V		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	157					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.G157V(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				AATACAGATGGAAGGACAGCA	0.408																																																	1	Substitution - Missense(1)	lung(1)											97.0	78.0	84.0					10																	93576936		2203	4300	6503	SO:0001583	missense	0			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.470G>T	10.37:g.93576936G>T	ENSP00000360689:p.Gly157Val		B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom,prints_Ankyrin_rpt	p.G157V	ENST00000371627.4	37	c.470	CCDS7417.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.179229	0.94846	.	.	ENSG00000107854	ENST00000371627	T	0.26373	1.74	5.69	5.69	0.88448	Ankyrin repeat-containing domain (3);	0.000000	0.52532	D	0.000070	T	0.51652	0.1687	M	0.78049	2.395	0.80722	D	1	D	0.67145	0.996	P	0.59595	0.86	T	0.54583	-0.8272	10	0.87932	D	0	.	19.8154	0.96566	0.0:0.0:1.0:0.0	.	157	Q9H2K2	TNKS2_HUMAN	V	157	ENSP00000360689:G157V	ENSP00000360689:G157V	G	+	2	0	TNKS2	93566916	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.835000	0.99442	2.699000	0.92147	0.655000	0.94253	GGA	TNKS2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000107854		0.408	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	HGNC	protein_coding	OTTHUMT00000049374.1		0.00	46	0	G	NM_025235		93576936	+1			no_errors	ENST00000371627	ensembl	human	known	74_37	missense	5.00	37	2	SNP	1.000	T
TOR3A	64222	genome.wustl.edu	37	1	179057075	179057075	+	Silent	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:179057075G>T	ENST00000367627.3	+	4	1421	c.669G>T	c.(667-669)acG>acT	p.T223T	TOR3A_ENST00000352445.6_Silent_p.T223T|TOR3A_ENST00000495145.1_3'UTR	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	223					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TCCGGGAGACGCAGCAGCTCT	0.627																																																	0													47.0	51.0	50.0					1																	179057075		2203	4300	6503	SO:0001819	synonymous_variant	0			BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.669G>T	1.37:g.179057075G>T			B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Silent	SNP	pfam_Torsin,superfamily_P-loop_NTPase	p.T223	ENST00000367627.3	37	c.669	CCDS1329.1	1																																																																																			TOR3A	-	pfam_Torsin,superfamily_P-loop_NTPase	ENSG00000186283		0.627	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR3A	HGNC	protein_coding	OTTHUMT00000084927.1		0.00	62	0	G	NM_022371		179057075	+1			no_errors	ENST00000367627	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.364	T
TP53	7157	genome.wustl.edu	37	17	7577115	7577115	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:7577115delA	ENST00000269305.4	-	8	1012	c.823delT	c.(823-825)tgtfs	p.C275fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.C275fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C275G(7)|p.C275R(7)|p.C275fs*31(2)|p.?(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.C275fs*70(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGACAGGCACAAACACGCACC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	36	Substitution - Missense(14)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(4)|Insertion - Frameshift(2)|Unknown(2)	bone(5)|stomach(4)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|oesophagus(2)|peritoneum(1)|urinary_tract(1)|skin(1)|lung(1)|prostate(1)											70.0	60.0	64.0					17																	7577115		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.823delT	17.37:g.7577115delA	ENSP00000269305:p.Cys275fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C275fs	ENST00000269305.4	37	c.823	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	40	0	A	NM_000546		7577115	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	50.00	8	8	DEL	1.000	-
TP53	7157	genome.wustl.edu	37	17	7578407	7578407	+	Missense_Mutation	SNP	G	G	C	rs138729528		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:7578407G>C	ENST00000269305.4	-	5	712	c.523C>G	c.(523-525)Cgc>Ggc	p.R175G	TP53_ENST00000445888.2_Missense_Mutation_p.R175G|TP53_ENST00000420246.2_Missense_Mutation_p.R175G|TP53_ENST00000413465.2_Missense_Mutation_p.R175G|TP53_ENST00000455263.2_Missense_Mutation_p.R175G|TP53_ENST00000359597.4_Missense_Mutation_p.R175G|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175G(20)|p.R175C(19)|p.0?(8)|p.R175S(5)|p.R43G(3)|p.R174fs*24(3)|p.R82G(3)|p.R175_E180delRCPHHE(3)|p.R43C(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.R82C(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.S149fs*72(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGGGCAGCGCCTCACAACC	0.657		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	93	Substitution - Missense(54)|Deletion - Frameshift(19)|Deletion - In frame(8)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	large_intestine(25)|lung(19)|breast(11)|upper_aerodigestive_tract(8)|oesophagus(7)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|liver(4)|bone(4)|stomach(2)|salivary_gland(2)|urinary_tract(2)|cervix(1)	GRCh37	CM011013	TP53	M	rs138729528						50.0	50.0	50.0					17																	7578407		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.523C>G	17.37:g.7578407G>C	ENSP00000269305:p.Arg175Gly		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175G	ENST00000269305.4	37	c.523	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.19	3.570086	0.65765	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99891	-7.56;-7.56;-7.56;-7.56;-7.56;-7.56;-7.56;-7.56	5.41	2.14	0.27477	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99862	0.9935	M	0.92784	3.345	0.58432	D	0.999991	D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;0.999;0.997;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.987;1.0;0.999;0.992;0.975;1.0	D	0.98196	1.0465	10	0.87932	D	0	-11.8679	4.599	0.12343	0.171:0.0:0.5642:0.2648	.	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175G;ENSP00000352610:R175G;ENSP00000269305:R175G;ENSP00000398846:R175G;ENSP00000391127:R175G;ENSP00000391478:R175G;ENSP00000425104:R43G;ENSP00000423862:R82G	ENSP00000269305:R175G	R	-	1	0	TP53	7519132	1.000000	0.71417	0.786000	0.31890	0.745000	0.42441	4.630000	0.61297	0.778000	0.33520	-0.140000	0.14226	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.657	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	41	0	G	NM_000546		7578407	-1	tier1	rs138729528	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	38.10	13	8	SNP	0.997	C
TRIM36	55521	genome.wustl.edu	37	5	114477023	114477023	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr5:114477023C>T	ENST00000282369.3	-	5	941	c.820G>A	c.(820-822)Gtg>Atg	p.V274M	TRIM36_ENST00000513154.1_Missense_Mutation_p.V262M|TRIM36_ENST00000514154.1_Missense_Mutation_p.V119M	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	274					acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q273_V274>HL(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TGACTCTTCACCTGGCTTTCC	0.308																																																	1	Complex - compound substitution(1)	lung(1)											104.0	101.0	102.0					5																	114477023		2200	4296	6496	SO:0001583	missense	0			AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.820G>A	5.37:g.114477023C>T	ENSP00000282369:p.Val274Met		A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.V274M	ENST00000282369.3	37	c.820	CCDS4115.1	5	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923811	0.92319	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	T;T;T	0.22336	1.96;1.96;1.96	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.45418	0.1341	M	0.63843	1.955	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.956;0.984	T	0.13629	-1.0502	10	0.38643	T	0.18	.	19.423	0.94729	0.0:1.0:0.0:0.0	.	262;274	E9PFI8;Q9NQ86	.;TRI36_HUMAN	M	274;262;119	ENSP00000282369:V274M;ENSP00000423934:V262M;ENSP00000424259:V119M	ENSP00000282369:V274M	V	-	1	0	TRIM36	114504922	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.045000	0.76585	2.666000	0.90696	0.643000	0.83706	GTG	TRIM36	-	NULL	ENSG00000152503		0.308	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM36	HGNC	protein_coding	OTTHUMT00000250854.2		0.00	56	0	C	NM_018700		114477023	-1			no_errors	ENST00000282369	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
TRMT13	54482	genome.wustl.edu	37	1	100598836	100598836	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:100598836delA	ENST00000370141.2	+	1	118	c.112delA	c.(112-114)aaafs	p.K38fs	SASS6_ENST00000462159.1_5'Flank|TRMT13_ENST00000370139.1_Frame_Shift_Del_p.K7fs|SASS6_ENST00000535161.1_5'Flank|TRMT13_ENST00000370143.1_Frame_Shift_Del_p.K38fs|SASS6_ENST00000287482.5_5'Flank	NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	38					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										GGCCGCAGGGAAAAGATTTTG	0.562																																																	0													72.0	70.0	71.0					1																	100598836		2203	4300	6503	SO:0001589	frameshift_variant	0			BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.112delA	1.37:g.100598836delA	ENSP00000359160:p.Lys38fs		Q5VVL0|Q9NW65	Frame_Shift_Del	DEL	pfam_Methyltransferase_TRM13,pfam_Znf_CCCH-type_TRM13,pfam_TRM13/UPF0224_CHHC_Znf_dom	p.R39fs	ENST00000370141.2	37	c.112	CCDS765.1	1																																																																																			TRMT13	-	pfam_Znf_CCCH-type_TRM13	ENSG00000122435		0.562	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT13	HGNC	protein_coding	OTTHUMT00000029919.1		0.00	36	0	A	NM_019083		100598836	+1	tier1		no_errors	ENST00000370141	ensembl	human	known	74_37	frame_shift_del	7.69	24	2	DEL	0.971	-
TTC39B	158219	genome.wustl.edu	37	9	15211356	15211356	+	Silent	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:15211356G>T	ENST00000512701.2	-	5	558	c.522C>A	c.(520-522)acC>acA	p.T174T	TTC39B_ENST00000355694.2_Silent_p.T108T|TTC39B_ENST00000507285.1_Silent_p.T9T|TTC39B_ENST00000380850.4_Silent_p.T174T|TTC39B_ENST00000541445.1_Silent_p.T108T|TTC39B_ENST00000297615.5_Silent_p.T105T|TTC39B_ENST00000582994.1_5'Flank|TTC39B_ENST00000507993.1_Silent_p.T9T			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	174										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						ACACCACAATGGTACTGTAGC	0.453																																																	0													148.0	126.0	134.0					9																	15211356		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.522C>A	9.37:g.15211356G>T			A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Silent	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.T174	ENST00000512701.2	37	c.522	CCDS6477.2	9																																																																																			TTC39B	-	pfam_OMP_IML2_mit/TPR_39	ENSG00000155158		0.453	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3	-	0.00	47	0	G	NM_152574		15211356	-1	tier1	-	no_errors	ENST00000512701	ensembl	human	known	74_37	silent	14.71	29	5	SNP	1.000	T
TRPM6	140803	genome.wustl.edu	37	9	77416992	77416992	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:77416992G>T	ENST00000360774.1	-	16	2068	c.1831C>A	c.(1831-1833)Ctg>Atg	p.L611M	TRPM6_ENST00000451710.3_Missense_Mutation_p.L611M|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.L611M|TRPM6_ENST00000376872.3_Intron|RN7SKP47_ENST00000365347.1_RNA|TRPM6_ENST00000361255.3_Missense_Mutation_p.L606M|TRPM6_ENST00000449912.2_Missense_Mutation_p.L606M	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	611					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CAAACCAGCAGGTCATTGTAA	0.448																																																	0													116.0	93.0	101.0					9																	77416992		2203	4300	6503	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1831C>A	9.37:g.77416992G>T	ENSP00000354006:p.Leu611Met		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.L611M	ENST00000360774.1	37	c.1831	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	18.43	3.623069	0.66901	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	5.28	3.08	0.35506	.	0.000000	0.85682	D	0.000000	D	0.86892	0.6042	M	0.88181	2.935	0.43321	D	0.99534	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.88966	0.3397	10	0.87932	D	0	.	12.4838	0.55859	0.1599:0.0:0.8401:0.0	.	611;606	Q9BX84;Q9BX84-3	TRPM6_HUMAN;.	M	611;611;606;606;611;274;274	ENSP00000354006:L611M;ENSP00000407341:L611M;ENSP00000396672:L606M;ENSP00000354962:L606M;ENSP00000366060:L611M	ENSP00000309693:L274M	L	-	1	2	TRPM6	76606812	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.959000	0.56744	1.222000	0.43521	0.585000	0.79938	CTG	TRPM6	-	NULL	ENSG00000119121		0.448	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	-	0.00	37	0	G	NM_017662		77416992	-1	tier1	-	no_errors	ENST00000451710	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
TTK	7272	genome.wustl.edu	37	6	80749463	80749463	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:80749463G>T	ENST00000369798.2	+	19	2292	c.2181G>T	c.(2179-2181)atG>atT	p.M727I	TTK_ENST00000509894.1_Missense_Mutation_p.M726I|TTK_ENST00000230510.3_Missense_Mutation_p.M726I	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	727	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TGTACTATATGACTTACGGGA	0.303																																																	0													67.0	69.0	68.0					6																	80749463		2203	4285	6488	SO:0001583	missense	0				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2181G>T	6.37:g.80749463G>T	ENSP00000358813:p.Met727Ile		A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.M727I	ENST00000369798.2	37	c.2181	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478036	0.63849	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.74421	-0.84;-0.84;-0.84	5.75	5.75	0.90469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.78861	0.4350	L	0.37750	1.13	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.91635	0.982;0.999	T	0.80560	-0.1328	10	0.72032	D	0.01	.	18.9361	0.92586	0.0:0.0:1.0:0.0	.	727;726	P33981;A8K8U5	TTK_HUMAN;.	I	726;726;727	ENSP00000422936:M726I;ENSP00000230510:M726I;ENSP00000358813:M727I	ENSP00000230510:M726I	M	+	3	0	TTK	80806182	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	9.467000	0.97671	2.704000	0.92352	0.650000	0.86243	ATG	TTK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000112742		0.303	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	HGNC	protein_coding	OTTHUMT00000041316.2	-	0.00	98	0	G			80749463	+1	tier1	-	no_errors	ENST00000369798	ensembl	human	known	74_37	missense	34.21	25	13	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179425882	179425882	+	Missense_Mutation	SNP	C	C	T	rs200843338		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr2:179425882C>T	ENST00000591111.1	-	276	80278	c.80054G>A	c.(80053-80055)cGg>cAg	p.R26685Q	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R28326Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R19453Q|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R19261Q|TTN_ENST00000359218.5_Missense_Mutation_p.R19386Q|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R25758Q			Q8WZ42	TITIN_HUMAN	titin	26685	Fibronectin type-III 94. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCAAAAACCCGGAATTCATA	0.408													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22320	0.0		0.0	False		,,,				2504	0.0																0								C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,3798		0,0,1899	87.0	84.0	85.0		57782,77273,58157,58358	5.8	1.0	2		85	2,8218		0,2,4108	yes	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	43,43,43,43	0,2,6007	TT,TC,CC		0.0243,0.0,0.0166	probably-damaging,probably-damaging,probably-damaging,probably-damaging	19261/26927,25758/33424,19386/27052,19453/27119	179425882	2,12016	1899	4110	6009	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80054G>A	2.37:g.179425882C>T	ENSP00000465570:p.Arg26685Gln		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R25758Q	ENST00000591111.1	37	c.77273		2	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304938	0.40795	0.0	2.43E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	5.84	5.84	0.93424	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74854	0.3771	M	0.85041	2.73	0.51767	D	0.999939	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	P;P;P;P	0.57371	0.819;0.819;0.819;0.819	T	0.78966	-0.1995	9	0.87932	D	0	.	15.2425	0.73482	0.0:0.9313:0.0:0.0687	.	19261;19386;19453;26685	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	25758;19261;19453;19386;19259	ENSP00000343764:R25758Q;ENSP00000434586:R19261Q;ENSP00000340554:R19453Q;ENSP00000352154:R19386Q	ENSP00000340554:R19453Q	R	-	2	0	TTN	179134128	0.370000	0.25047	0.995000	0.50966	0.995000	0.86356	0.887000	0.28254	2.767000	0.95098	0.561000	0.74099	CGG	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	37	0	C	NM_133378		179425882	-1	tier1	rs200843338	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	58.62	12	17	SNP	0.997	T
UHRF1BP1	54887	genome.wustl.edu	37	6	34826288	34826288	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:34826288G>T	ENST00000192788.5	+	14	2326	c.2155G>T	c.(2155-2157)Gta>Tta	p.V719L	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.V719L	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	719							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						CTTGAATTTTGTAGCCCCCTT	0.552																																																	0													68.0	71.0	70.0					6																	34826288		1893	4107	6000	SO:0001583	missense	0			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.2155G>T	6.37:g.34826288G>T	ENSP00000192788:p.Val719Leu		Q9NXE0	Missense_Mutation	SNP	NULL	p.V719L	ENST00000192788.5	37	c.2155	CCDS43455.1	6	.	.	.	.	.	.	.	.	.	.	G	18.08	3.542816	0.65198	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.12879	2.64;2.64	5.55	5.55	0.83447	.	0.069184	0.56097	D	0.000023	T	0.05960	0.0155	L	0.46157	1.445	0.51767	D	0.999933	P	0.49253	0.921	B	0.38880	0.284	T	0.08953	-1.0697	10	0.72032	D	0.01	-15.652	7.2779	0.26294	0.2028:0.0:0.7972:0.0	.	719	Q6BDS2	URFB1_HUMAN	L	719	ENSP00000192788:V719L;ENSP00000400628:V719L	ENSP00000192788:V719L	V	+	1	0	UHRF1BP1	34934266	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.148000	0.58085	2.624000	0.88883	0.585000	0.79938	GTA	UHRF1BP1	-	NULL	ENSG00000065060		0.552	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1		0.00	50	0	G	NM_017754		34826288	+1			no_errors	ENST00000192788	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	T
UNKL	64718	genome.wustl.edu	37	16	1433666	1433666	+	Intron	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr16:1433666C>T	ENST00000389221.4	-	10	1255				UNKL_ENST00000397462.1_Missense_Mutation_p.R710Q|UNKL_ENST00000508903.2_Intron	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				TGAGCAGTTCCGTGTGGGGCA	0.662																																																	0																																										SO:0001627	intron_variant	0			BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1255+1542G>A	16.37:g.1433666C>T			B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.R710Q	ENST00000389221.4	37	c.2129	CCDS53981.1	16	.	.	.	.	.	.	.	.	.	.	C	10.89	1.478954	0.26511	.	.	ENSG00000059145	ENST00000397462	.	.	.	0.659	0.659	0.17861	.	1.862340	0.03412	U	0.204936	T	0.41373	0.1156	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.45585	-0.9251	5	0.87932	D	0	.	.	.	.	.	.	.	.	Q	710	.	ENSP00000380604:R710Q	R	-	2	0	UNKL	1373667	0.036000	0.19791	0.003000	0.11579	0.003000	0.03518	-0.027000	0.12371	0.620000	0.30215	0.491000	0.48974	CGG	UNKL	-	NULL	ENSG00000059145		0.662	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	HGNC	protein_coding		-	0.00	61	0	C	NM_001037125		1433666	-1	tier1	-	no_errors	ENST00000397462	ensembl	human	known	74_37	missense	37.80	51	31	SNP	0.003	T
USP17L2	377630	genome.wustl.edu	37	8	11995473	11995473	+	Missense_Mutation	SNP	G	G	T	rs374048343		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr8:11995473G>T	ENST00000333796.3	-	1	1113	c.797C>A	c.(796-798)aCg>aAg	p.T266K	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	266	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.T266M(1)		central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						TAAAGTTAACGTCTTGGAGGC	0.488																																																	1	Substitution - Missense(1)	large_intestine(1)											25.0	29.0	27.0					8																	11995473		1124	2642	3766	SO:0001583	missense	0			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.797C>A	8.37:g.11995473G>T	ENSP00000333329:p.Thr266Lys			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.T266K	ENST00000333796.3	37	c.797	CCDS43713.1	8	.	.	.	.	.	.	.	.	.	.	G	2.516	-0.311843	0.05422	.	.	ENSG00000223443	ENST00000333796	T	0.28454	1.61	0.745	-0.335	0.12662	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.450195	0.19120	N	0.122213	T	0.12433	0.0302	N	0.05306	-0.075	0.09310	N	1	B	0.18968	0.032	B	0.30401	0.115	T	0.24764	-1.0151	10	0.23891	T	0.37	.	3.3559	0.07169	0.3198:0.0:0.6802:0.0	.	266	Q6R6M4	U17L2_HUMAN	K	266	ENSP00000333329:T266K	ENSP00000333329:T266K	T	-	2	0	USP17L2	12032882	0.026000	0.19158	0.006000	0.13384	0.003000	0.03518	-0.084000	0.11268	-0.078000	0.12730	-0.365000	0.07479	ACG	USP17L2	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000223443		0.488	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2		0.00	130	0	G	NM_201402		11995473	-1			no_errors	ENST00000333796	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.005	T
USP48	84196	genome.wustl.edu	37	1	22074729	22074729	+	Silent	SNP	G	G	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr1:22074729G>A	ENST00000308271.9	-	7	1458	c.810C>T	c.(808-810)tgC>tgT	p.C270C	USP48_ENST00000529637.1_Silent_p.C270C|USP48_ENST00000400301.1_Silent_p.C270C|USP48_ENST00000421625.2_Silent_p.C270C	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	270	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		GACAGTTCTCGCAAAAATAGC	0.353																																																	0													151.0	126.0	134.0					1																	22074729		2203	4300	6503	SO:0001819	synonymous_variant	0			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.810C>T	1.37:g.22074729G>A			B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67,pfscan_Ubiquitin_supergroup	p.C270	ENST00000308271.9	37	c.810	CCDS30623.1	1																																																																																			USP48	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000090686		0.353	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP48	HGNC	protein_coding	OTTHUMT00000021372.1	-	0.00	57	0	G	NM_032236		22074729	-1	tier1	-	no_errors	ENST00000308271	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	A
VPS13B	157680	genome.wustl.edu	37	8	100533161	100533161	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr8:100533161G>C	ENST00000358544.2	+	30	4854	c.4743G>C	c.(4741-4743)ttG>ttC	p.L1581F	VPS13B_ENST00000357162.2_Missense_Mutation_p.L1556F|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1581					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CTGTGGTTTTGAAGATTGGCT	0.408																																					Colon(161;2205 2542 7338 31318)												0													144.0	130.0	134.0					8																	100533161		2203	4300	6503	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4743G>C	8.37:g.100533161G>C	ENSP00000351346:p.Leu1581Phe		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.L1581F	ENST00000358544.2	37	c.4743	CCDS6280.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.74|12.74	2.029736|2.029736	0.35797|0.35797	.|.	.|.	ENSG00000132549|ENSG00000132549	ENST00000357162;ENST00000358544|ENST00000521559	T;T|.	0.74315|.	-0.83;-0.83|.	5.65|5.65	2.89|2.89	0.33648|0.33648	.|.	0.092160|.	0.44097|.	D|.	0.000491|.	T|.	0.56232|.	0.1971|.	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	D;D|.	0.63046|.	0.992;0.986|.	P;P|.	0.59546|.	0.859;0.796|.	T|.	0.50558|.	-0.8814|.	10|.	0.59425|.	D|.	0.04|.	.|.	3.049|3.049	0.06162|0.06162	0.2467:0.1126:0.525:0.1157|0.2467:0.1126:0.525:0.1157	.|.	1556;1581|.	Q7Z7G8-2;Q7Z7G8|.	.;VP13B_HUMAN|.	F|S	1556;1581|12	ENSP00000349685:L1556F;ENSP00000351346:L1581F|.	ENSP00000349685:L1556F|.	L|X	+|+	3|2	2|2	VPS13B|VPS13B	100602337|100602337	0.999000|0.999000	0.42202|0.42202	0.998000|0.998000	0.56505|0.56505	0.992000|0.992000	0.81027|0.81027	0.487000|0.487000	0.22356|0.22356	0.315000|0.315000	0.23110|0.23110	0.557000|0.557000	0.71058|0.71058	TTG|TGA	VPS13B	-	NULL	ENSG00000132549		0.408	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	-	0.00	93	0	G	NM_184042		100533161	+1	tier1	-	no_errors	ENST00000358544	ensembl	human	known	74_37	missense	65.96	16	31	SNP	0.984	C
WASH3P	374666	genome.wustl.edu	37	15	102506815	102506816	+	RNA	DEL	CC	CC	-	rs151176585		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr15:102506815_102506816delCC	ENST00000557932.1	+	0	172							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						tacctctccacctggagcgcac	0.421																																																	0																																												0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102506815_102506816delCC				RNA	DEL	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			WASH3P	-	-	ENSG00000185596		0.421	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1		0.00	9	0	CC	NM_199163		102506816	+1	tier1		no_errors	ENST00000559884	ensembl	human	known	74_37	rna	30.77	9	4	DEL	0.000:0.000	-
WDR75	84128	genome.wustl.edu	37	2	190320168	190320168	+	Nonsense_Mutation	SNP	G	G	T	rs142864260	byFrequency	TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr2:190320168G>T	ENST00000314761.4	+	5	556	c.496G>T	c.(496-498)Gag>Tag	p.E166*		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	166						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			CTTTGGAAACGAGGTAAATTT	0.378																																																	0													171.0	169.0	170.0					2																	190320168		2203	4300	6503	SO:0001587	stop_gained	0			AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.496G>T	2.37:g.190320168G>T	ENSP00000314193:p.Glu166*		Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E166*	ENST00000314761.4	37	c.496	CCDS2298.1	2	.	.	.	.	.	.	.	.	.	.	G	17.47	3.396719	0.62177	.	.	ENSG00000115368	ENST00000314761	.	.	.	5.03	1.04	0.20106	.	0.446577	0.27429	N	0.019411	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-2.2501	5.8215	0.18530	0.2129:0.2487:0.5384:0.0	.	.	.	.	X	166	.	ENSP00000314193:E166X	E	+	1	0	WDR75	190028413	1.000000	0.71417	0.881000	0.34555	0.681000	0.39784	2.885000	0.48570	-0.005000	0.14395	0.585000	0.79938	GAG	WDR75	-	superfamily_WD40_repeat_dom	ENSG00000115368		0.378	WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR75	HGNC	protein_coding	OTTHUMT00000255913.1	-	0.00	135	0	G	NM_032168		190320168	+1	tier1	-	no_errors	ENST00000314761	ensembl	human	known	74_37	nonsense	16.56	136	27	SNP	1.000	T
WDR81	124997	genome.wustl.edu	37	17	1629539	1629539	+	Missense_Mutation	SNP	C	C	T	rs554874427		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr17:1629539C>T	ENST00000409644.1	+	1	1286	c.1286C>T	c.(1285-1287)gCg>gTg	p.A429V	WDR81_ENST00000309182.5_Intron|WDR81_ENST00000437219.2_Intron|WDR81_ENST00000419248.1_Intron|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000446363.1_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	429	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCAGGCGGGGCGGGCGGCGGG	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17470	0.0		0.0	False		,,,				2504	0.0																0													17.0	23.0	21.0					17																	1629539		692	1587	2279	SO:0001583	missense	0			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.1286C>T	17.37:g.1629539C>T	ENSP00000386609:p.Ala429Val		B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A429V	ENST00000409644.1	37	c.1286	CCDS54062.1	17	.	.	.	.	.	.	.	.	.	.	C	0.571	-0.841056	0.02692	.	.	ENSG00000167716	ENST00000409644	T	0.52057	0.68	4.87	2.79	0.32731	.	.	.	.	.	T	0.47040	0.1424	.	.	.	0.19300	N	0.999974	.	.	.	.	.	.	T	0.37244	-0.9714	6	0.46703	T	0.11	.	10.0748	0.42353	0.0:0.7678:0.1495:0.0827	.	.	.	.	V	429	ENSP00000386609:A429V	ENSP00000386609:A429V	A	+	2	0	WDR81	1576289	0.000000	0.05858	0.002000	0.10522	0.054000	0.15201	-0.213000	0.09305	1.286000	0.44565	0.462000	0.41574	GCG	WDR81	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000167716		0.607	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	HGNC	protein_coding	OTTHUMT00000333118.2		0.00	25	0	C	NM_152348		1629539	+1			no_errors	ENST00000409644	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.002	T
WFDC8	90199	genome.wustl.edu	37	20	44184456	44184456	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr20:44184456C>T	ENST00000357199.4	-	4	407	c.329G>A	c.(328-330)cGc>cAc	p.R110H	WFDC8_ENST00000289953.2_Missense_Mutation_p.R110H	NM_181510.2	NP_852611.2	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8	110	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|stomach(1)|upper_aerodigestive_tract(1)	15		Myeloproliferative disorder(115;0.0122)				AAAATGCCAGCGCTGTGCCTC	0.463																																																	0													114.0	102.0	106.0					20																	44184456		2203	4300	6503	SO:0001583	missense	0			AL031663	CCDS13361.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000158901	ENSG00000158901		"""WAP four-disulfide core domain containing"""	16163	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 170"""	C20orf170		12206714	Standard	NM_130896		Approved	dJ461P17.1, WAP8	uc002xow.3	Q8IUA0	OTTHUMG00000046342	ENST00000357199.4:c.329G>A	20.37:g.44184456C>T	ENSP00000361735:p.Arg110His		E1P623|Q5TDV2|Q96A34	Missense_Mutation	SNP	pfam_WAP-type_4-diS_core,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,prints_WAP-type_4-diS_core	p.R110H	ENST00000357199.4	37	c.329	CCDS13361.1	20	.	.	.	.	.	.	.	.	.	.	C	11.21	1.570636	0.28003	.	.	ENSG00000158901	ENST00000357199;ENST00000289953	T;T	0.62639	0.01;0.01	4.26	-3.71	0.04424	Proteinase inhibitor I2, Kunitz metazoa (5);	0.463132	0.20651	N	0.088214	T	0.49133	0.1539	L	0.55990	1.75	0.09310	N	1	B	0.29886	0.26	B	0.26517	0.07	T	0.39860	-0.9593	10	0.46703	T	0.11	.	10.1493	0.42782	0.0:0.3844:0.0:0.6156	.	110	Q8IUA0	WFDC8_HUMAN	H	110	ENSP00000361735:R110H;ENSP00000289953:R110H	ENSP00000289953:R110H	R	-	2	0	WFDC8	43617870	0.048000	0.20356	0.006000	0.13384	0.066000	0.16364	-0.615000	0.05597	-0.730000	0.04869	-0.137000	0.14449	CGC	WFDC8	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000158901		0.463	WFDC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC8	HGNC	protein_coding	OTTHUMT00000106958.1	-	0.00	80	0	C			44184456	-1	tier1	-	no_errors	ENST00000289953	ensembl	human	known	74_37	missense	37.50	35	21	SNP	0.010	T
WWC3	55841	genome.wustl.edu	37	X	10035344	10035344	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chrX:10035344G>T	ENST00000380861.4	+	3	425	c.34G>T	c.(34-36)Gat>Tat	p.D12Y	WWC3_ENST00000454666.1_Missense_Mutation_p.D12Y	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	12					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						CCAGATTGAGGATCCAAGAGA	0.393																																																	0													46.0	39.0	41.0					X																	10035344		2203	4300	6503	SO:0001583	missense	0			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.34G>T	X.37:g.10035344G>T	ENSP00000370242:p.Asp12Tyr		A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	superfamily_C2_dom	p.D12Y	ENST00000380861.4	37	c.34	CCDS14136.1	X	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442155	0.63067	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000398613	T;T	0.15256	2.44;2.44	5.31	5.31	0.75309	.	0.055446	0.64402	D	0.000001	T	0.44685	0.1305	M	0.76170	2.325	0.51767	D	0.999931	D	0.89917	1.0	D	0.78314	0.991	T	0.46219	-0.9207	10	0.87932	D	0	-27.9856	18.105	0.89517	0.0:0.0:1.0:0.0	.	12	Q9ULE0	WWC3_HUMAN	Y	12	ENSP00000370242:D12Y;ENSP00000399584:D12Y	ENSP00000370242:D12Y	D	+	1	0	WWC3	9995344	1.000000	0.71417	0.997000	0.53966	0.815000	0.46073	7.029000	0.76477	2.211000	0.71520	0.506000	0.49869	GAT	WWC3	-	NULL	ENSG00000047644		0.393	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	HGNC	protein_coding	OTTHUMT00000055725.1	-	0.00	57	0	G	NM_015691		10035344	+1	tier1	-	no_errors	ENST00000380861	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
ZBTB49	166793	genome.wustl.edu	37	4	4317368	4317368	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr4:4317368C>T	ENST00000337872.4	+	6	1503	c.1382C>T	c.(1381-1383)gCa>gTa	p.A461V	ZBTB49_ENST00000538529.1_5'UTR|ZBTB49_ENST00000355834.3_Intron	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	461					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						TCTAGGTTTGCAGCCTCTGGC	0.438																																																	0													83.0	84.0	84.0					4																	4317368		2203	4300	6503	SO:0001583	missense	0			AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.1382C>T	4.37:g.4317368C>T	ENSP00000338807:p.Ala461Val		Q59FJ4|Q5EBN0|Q8TB80	Nonsense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q421*	ENST00000337872.4	37	c.1261	CCDS3375.1	4	.	.	.	.	.	.	.	.	.	.	C	39	7.335166	0.98221	.	.	ENSG00000168826	ENST00000337872	T	0.04156	3.69	5.45	5.45	0.79879	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000026	T	0.07369	0.0186	N	0.05158	-0.105	0.80722	D	1	P	0.44090	0.826	P	0.53861	0.736	T	0.54761	-0.8245	10	0.44086	T	0.13	.	19.2829	0.94058	0.0:1.0:0.0:0.0	.	461	Q6ZSB9	ZBT49_HUMAN	V	461	ENSP00000338807:A461V	ENSP00000338807:A461V	A	+	2	0	ZBTB49	4368269	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.085000	0.76875	2.572000	0.86782	0.462000	0.41574	GCA	ZBTB49	-	pfscan_Znf_C2H2	ENSG00000168826		0.438	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB49	HGNC	protein_coding	OTTHUMT00000206688.3	-	0.00	51	0	C	NM_145291		4317368	+1	tier1	-	no_errors	ENST00000515012	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	1.000	T
ZCWPW1	55063	genome.wustl.edu	37	7	99998790	99998790	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:99998790C>A	ENST00000398027.2	-	18	2041	c.1794G>T	c.(1792-1794)gaG>gaT	p.E598D	ZCWPW1_ENST00000490721.1_Missense_Mutation_p.E427D|ZCWPW1_ENST00000360951.4_3'UTR|ZCWPW1_ENST00000324725.6_Missense_Mutation_p.E427D	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	598							zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CACTTCCAGCCTCCTGGGTCA	0.607																																																	0													46.0	47.0	47.0					7																	99998790		1926	4129	6055	SO:0001583	missense	0			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.1794G>T	7.37:g.99998790C>A	ENSP00000381109:p.Glu598Asp		A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_CW	p.E598D	ENST00000398027.2	37	c.1794	CCDS43623.1	7	.	.	.	.	.	.	.	.	.	.	C	12.31	1.898903	0.33535	.	.	ENSG00000078487	ENST00000398027;ENST00000490721;ENST00000324725	T;T;T	0.56941	0.75;0.43;0.43	5.1	-1.48	0.08745	.	.	.	.	.	T	0.32526	0.0832	L	0.29908	0.895	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.11329	0.002;0.002;0.006	T	0.19386	-1.0307	8	.	.	.	-0.2962	3.748	0.08555	0.4135:0.3437:0.0:0.2428	.	559;598;427	B4DXS7;Q9H0M4;Q9H0M4-4	.;ZCPW1_HUMAN;.	D	598;427;427	ENSP00000381109:E598D;ENSP00000419187:E427D;ENSP00000314880:E427D	.	E	-	3	2	ZCWPW1	99836726	0.000000	0.05858	0.003000	0.11579	0.234000	0.25298	-0.471000	0.06631	-0.079000	0.12707	0.655000	0.94253	GAG	ZCWPW1	-	NULL	ENSG00000078487		0.607	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZCWPW1	HGNC	protein_coding	OTTHUMT00000356083.1		0.00	52	0	C	NM_017984		99998790	-1			no_errors	ENST00000398027	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.001	A
ZKSCAN3	80317	genome.wustl.edu	37	6	28333434	28333434	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr6:28333434G>C	ENST00000377255.3	+	7	1286	c.989G>C	c.(988-990)aGt>aCt	p.S330T	ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.S330T|ZKSCAN3_ENST00000341464.5_Missense_Mutation_p.S182T	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	330					autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						TCAGGCCTGAGTAAACACAGG	0.502																																																	0													107.0	96.0	100.0					6																	28333434		2203	4300	6503	SO:0001583	missense	0			U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.989G>C	6.37:g.28333434G>C	ENSP00000366465:p.Ser330Thr		B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S330T	ENST00000377255.3	37	c.989	CCDS4650.1	6	.	.	.	.	.	.	.	.	.	.	.	5.397	0.258529	0.10239	.	.	ENSG00000189298	ENST00000252211;ENST00000341464;ENST00000377255	T;T;T	0.07567	3.18;3.18;3.18	3.73	-5.0	0.03001	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00936	0.0031	N	0.04994	-0.135	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.48570	-0.9024	9	0.17369	T	0.5	.	9.5107	0.39076	0.079:0.6465:0.1696:0.1049	.	330	Q9BRR0	ZKSC3_HUMAN	T	330;182;330	ENSP00000252211:S330T;ENSP00000341883:S182T;ENSP00000366465:S330T	ENSP00000252211:S330T	S	+	2	0	ZKSCAN3	28441413	0.000000	0.05858	0.913000	0.36048	0.997000	0.91878	-4.169000	0.00281	-0.845000	0.04179	0.655000	0.94253	AGT	ZKSCAN3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189298		0.502	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN3	HGNC	protein_coding	OTTHUMT00000040189.3	-	0.00	81	0	G	NM_024493		28333434	+1	tier1	-	no_errors	ENST00000252211	ensembl	human	known	74_37	missense	40.68	35	24	SNP	0.000	C
ZNF22	7570	genome.wustl.edu	37	10	45498900	45498900	+	Silent	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr10:45498900G>T	ENST00000298299.3	+	2	677	c.84G>T	c.(82-84)cgG>cgT	p.R28R	C10orf25_ENST00000298298.1_5'Flank|CEP164P1_ENST00000456938.2_RNA	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22	28					odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				AAACAGGCCGGCAGCGGCAGA	0.458																																																	0													63.0	66.0	65.0					10																	45498900		2203	4300	6503	SO:0001819	synonymous_variant	0			BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.84G>T	10.37:g.45498900G>T			Q5T741|Q96FM4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R28	ENST00000298299.3	37	c.84	CCDS7211.1	10																																																																																			ZNF22	-	NULL	ENSG00000165512		0.458	ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF22	HGNC	protein_coding	OTTHUMT00000047761.1		0.00	55	0	G	NM_006963		45498900	+1			no_errors	ENST00000298299	ensembl	human	known	74_37	silent	8.00	23	2	SNP	0.679	T
ZNF415	55786	genome.wustl.edu	37	19	53611721	53611721	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:53611721C>T	ENST00000500065.4	-	4	1910	c.1577G>A	c.(1576-1578)tGt>tAt	p.C526Y	ZNF415_ENST00000243643.4_Missense_Mutation_p.C526Y|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.C513Y|ZNF415_ENST00000448501.1_Missense_Mutation_p.C574Y|ZNF415_ENST00000421033.1_Missense_Mutation_p.C538Y|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000601493.1_Missense_Mutation_p.C296Y|ZNF415_ENST00000455735.2_Missense_Mutation_p.C574Y|ZNF415_ENST00000595193.1_3'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	574					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		ACAATCACTACATTTGTAAGG	0.378																																																	0													154.0	148.0	150.0					19																	53611721		2203	4300	6503	SO:0001583	missense	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.1577G>A	19.37:g.53611721C>T	ENSP00000439435:p.Cys526Tyr		F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2	p.C574Y	ENST00000500065.4	37	c.1721	CCDS54313.1	19	.	.	.	.	.	.	.	.	.	.	C	14.45	2.538953	0.45176	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	2.43	2.43	0.29744	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94026	0.8086	H	0.95712	3.71	0.27958	N	0.936898	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;1.0;0.999;0.998;0.998;1.0	D	0.86768	0.1971	9	0.72032	D	0.01	.	11.9477	0.52938	0.0:1.0:0.0:0.0	.	526;574;574;526;513;538	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	Y	526;526;574;538;574;513	ENSP00000243643:C526Y;ENSP00000439435:C526Y;ENSP00000396492:C574Y;ENSP00000395055:C538Y;ENSP00000388787:C574Y;ENSP00000414601:C513Y	ENSP00000243643:C526Y	C	-	2	0	ZNF415	58303533	0.647000	0.27304	0.005000	0.12908	0.068000	0.16541	3.614000	0.54160	1.370000	0.46153	0.313000	0.20887	TGT	ZNF415	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170954		0.378	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	-	0.00	193	0	C	NM_018355		53611721	-1	tier1	-	no_errors	ENST00000448501	ensembl	human	known	74_37	missense	24.71	63	21	SNP	0.632	T
ZNF425	155054	genome.wustl.edu	37	7	148802388	148802388	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:148802388C>T	ENST00000378061.2	-	4	707	c.575G>A	c.(574-576)tGc>tAc	p.C192Y		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	192					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C192F(1)		breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			ACAGACATAGCAGGAATAGCA	0.498																																																	1	Substitution - Missense(1)	lung(1)											57.0	57.0	57.0					7																	148802388		2203	4300	6503	SO:0001583	missense	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.575G>A	7.37:g.148802388C>T	ENSP00000367300:p.Cys192Tyr		B3KPM1|Q08AG3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.C192Y	ENST00000378061.2	37	c.575	CCDS34773.1	7	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712797	0.48517	.	.	ENSG00000204947	ENST00000378061	T	0.10668	2.85	2.89	2.89	0.33648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35248	0.0925	M	0.84846	2.72	0.28284	N	0.923856	D	0.89917	1.0	D	0.91635	0.999	T	0.09707	-1.0662	9	0.72032	D	0.01	.	11.555	0.50741	0.0:1.0:0.0:0.0	.	192	Q6IV72	ZN425_HUMAN	Y	192	ENSP00000367300:C192Y	ENSP00000367300:C192Y	C	-	2	0	ZNF425	148433321	0.831000	0.29352	0.017000	0.16124	0.107000	0.19398	1.947000	0.40293	1.627000	0.50400	0.655000	0.94253	TGC	ZNF425	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204947		0.498	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1		0.00	52	0	C	XM_088140		148802388	-1			no_errors	ENST00000378061	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.564	T
ZNF462	58499	genome.wustl.edu	37	9	109687209	109687209	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr9:109687209C>A	ENST00000277225.5	+	3	1305	c.1016C>A	c.(1015-1017)tCg>tAg	p.S339*	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Nonsense_Mutation_p.S339*			Q96JM2	ZN462_HUMAN	zinc finger protein 462	339					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TCCAAGTTTTCGCCCATGTCT	0.483																																																	0													75.0	70.0	72.0					9																	109687209		2203	4300	6503	SO:0001587	stop_gained	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.1016C>A	9.37:g.109687209C>A	ENSP00000277225:p.Ser339*		Q5T0T4|Q8N408	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S339*	ENST00000277225.5	37	c.1016	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	38	7.091637	0.98059	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	.	.	.	5.91	5.91	0.95273	.	0.193777	0.47093	D	0.000251	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4858	0.90828	0.0:1.0:0.0:0.0	.	.	.	.	X	339	.	.	S	+	2	0	ZNF462	108727030	0.999000	0.42202	0.984000	0.44739	0.958000	0.62258	5.314000	0.65804	2.808000	0.96608	0.655000	0.94253	TCG	ZNF462	-	NULL	ENSG00000148143		0.483	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2		0.00	38	0	C	NM_021224		109687209	+1			no_errors	ENST00000457913	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	1.000	A
ZNF562	54811	genome.wustl.edu	37	19	9771405	9771405	+	Missense_Mutation	SNP	T	T	C	rs372227919		TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:9771405T>C	ENST00000448622.1	-	2	178	c.16A>G	c.(16-18)Atg>Gtg	p.M6V	ZNF562_ENST00000453792.2_Intron|ZNF562_ENST00000453372.2_Missense_Mutation_p.M6V|ZNF562_ENST00000541032.1_De_novo_Start_InFrame|ZNF562_ENST00000590155.1_Missense_Mutation_p.M6V|ZNF562_ENST00000587392.1_Missense_Mutation_p.M6V|ZNF562_ENST00000537617.1_De_novo_Start_OutOfFrame|ZNF562_ENST00000293648.4_Missense_Mutation_p.M6V	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	Q6V9R5	ZN562_HUMAN	zinc finger protein 562	6					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	17						CCATGGGACATATCAAAGGCT	0.488																																																	0													271.0	229.0	243.0					19																	9771405		2203	4300	6503	SO:0001583	missense	0			AK000086	CCDS12217.1, CCDS45956.1, CCDS74280.1	19p13.2	2013-09-20			ENSG00000171466	ENSG00000171466		"""Zinc fingers, C2H2-type"", ""-"""	25950	protein-coding gene	gene with protein product							Standard	NM_001130031		Approved	FLJ20079	uc010xks.2	Q6V9R5	OTTHUMG00000180205	ENST00000448622.1:c.16A>G	19.37:g.9771405T>C	ENSP00000411784:p.Met6Val		Q32MN2|Q9NXS5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M6V	ENST00000448622.1	37	c.16	CCDS45956.1	19	.	.	.	.	.	.	.	.	.	.	A	1.127	-0.653417	0.03480	.	.	ENSG00000171466	ENST00000453372;ENST00000448622;ENST00000293648	T;T;T	0.06142	3.34;3.34;3.42	1.55	-3.1	0.05315	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.09310	N	0.999996	B;B;B	0.16603	0.0;0.0;0.018	B;B;B	0.18871	0.0;0.0;0.023	T	0.39683	-0.9602	9	0.22706	T	0.39	.	0.4351	0.00478	0.2018:0.17:0.2878:0.3404	.	6;6;6	B4DMG0;Q6V9R5;Q6V9R5-2	.;ZN562_HUMAN;.	V	6	ENSP00000410734:M6V;ENSP00000411784:M6V;ENSP00000293648:M6V	ENSP00000293648:M6V	M	-	1	0	ZNF562	9632405	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.712000	0.01885	-2.763000	0.00369	-0.958000	0.02645	ATG	ZNF562	-	NULL	ENSG00000171466		0.488	ZNF562-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF562	HGNC	protein_coding	OTTHUMT00000450239.1	-	0.00	73	0	T	NM_017656		9771405	-1	tier1	-	no_errors	ENST00000448622	ensembl	human	known	74_37	missense	23.08	30	9	SNP	0.000	C
ZNF569	148266	genome.wustl.edu	37	19	37904475	37904475	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:37904475G>T	ENST00000316950.6	-	6	1642	c.1085C>A	c.(1084-1086)gCc>gAc	p.A362D	ZNF569_ENST00000392150.2_Missense_Mutation_p.A203D|ZNF569_ENST00000392149.2_Missense_Mutation_p.A362D	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGAGAGAAGGCTTTACCACA	0.368																																																	0													82.0	79.0	80.0					19																	37904475		2203	4300	6503	SO:0001583	missense	0			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.1085C>A	19.37:g.37904475G>T	ENSP00000325018:p.Ala362Asp		A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A362D	ENST00000316950.6	37	c.1085	CCDS12503.1	19	.	.	.	.	.	.	.	.	.	.	G	12.74	2.027350	0.35797	.	.	ENSG00000196437	ENST00000316950;ENST00000392149;ENST00000392150	T;T	0.14266	2.52;2.52	3.97	3.97	0.46021	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.211384	0.23863	N	0.043834	T	0.17959	0.0431	L	0.60012	1.86	0.33628	D	0.605628	P;P	0.44946	0.846;0.643	P;B	0.44860	0.462;0.357	T	0.24870	-1.0148	10	0.66056	D	0.02	.	10.5912	0.45310	0.0:0.3283:0.6717:0.0	.	203;362	Q17RR6;Q5MCW4	.;ZN569_HUMAN	D	362;18;203	ENSP00000325018:A362D;ENSP00000375993:A203D	ENSP00000325018:A362D	A	-	2	0	ZNF569	42596315	0.000000	0.05858	1.000000	0.80357	0.985000	0.73830	-0.478000	0.06575	2.204000	0.70986	0.655000	0.94253	GCC	ZNF569	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196437		0.368	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF569	HGNC	protein_coding	OTTHUMT00000109594.2		0.00	77	0	G	NM_152484		37904475	-1			no_errors	ENST00000316950	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.946	T
ZNF614	80110	genome.wustl.edu	37	19	52520064	52520064	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:52520064C>A	ENST00000270649.6	-	5	1331	c.787G>T	c.(787-789)Gaa>Taa	p.E263*	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TTTCTATATTCATTGGGTATA	0.383																																																	0													64.0	63.0	64.0					19																	52520064		2203	4300	6503	SO:0001587	stop_gained	0			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.787G>T	19.37:g.52520064C>A	ENSP00000270649:p.Glu263*		Q494T8|Q8TCF4|Q9BSN8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E263*	ENST00000270649.6	37	c.787	CCDS12847.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.862355	0.97036	.	.	ENSG00000142556	ENST00000270649	.	.	.	3.76	2.65	0.31530	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	10.9964	0.47578	0.0:0.8103:0.1897:0.0	.	.	.	.	X	263	.	ENSP00000270649:E263X	E	-	1	0	ZNF614	57211876	0.003000	0.15002	0.015000	0.15790	0.010000	0.07245	0.959000	0.29240	1.933000	0.56026	0.655000	0.94253	GAA	ZNF614	-	NULL	ENSG00000142556		0.383	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF614	HGNC	protein_coding	OTTHUMT00000462407.1		0.00	34	0	C	NM_025040		52520064	-1			no_errors	ENST00000270649	ensembl	human	known	74_37	nonsense	6.12	46	3	SNP	0.010	A
ZNF716	441234	genome.wustl.edu	37	7	57529387	57529387	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr7:57529387C>A	ENST00000420713.1	+	4	1332	c.1220C>A	c.(1219-1221)cCc>cAc	p.P407H		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						GGAGAGAAACCCTACAAATGT	0.398																																																	0													29.0	30.0	29.0					7																	57529387		692	1591	2283	SO:0001583	missense	0			AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1220C>A	7.37:g.57529387C>A	ENSP00000394248:p.Pro407His			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P407H	ENST00000420713.1	37	c.1220	CCDS55112.1	7	.	.	.	.	.	.	.	.	.	.	C	13.53	2.263901	0.39995	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.29397	1.57	0.195	0.195	0.15151	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48572	0.1507	M	0.85859	2.78	0.33048	D	0.532342	D	0.71674	0.998	P	0.59889	0.865	T	0.59500	-0.7443	9	0.72032	D	0.01	.	6.2336	0.20750	0.0:0.9997:0.0:3.0E-4	.	395	A6NP11	ZN716_HUMAN	H	407;395	ENSP00000394248:P407H	ENSP00000387687:P395H	P	+	2	0	ZNF716	57533329	0.024000	0.19004	0.118000	0.21660	0.119000	0.20118	2.074000	0.41529	0.300000	0.22699	0.306000	0.20318	CCC	ZNF716	-	pfscan_Znf_C2H2	ENSG00000182111		0.398	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	HGNC	protein_coding	OTTHUMT00000345309.1	-	0.00	62	0	C	NM_001159279		57529387	+1	tier1	-	no_errors	ENST00000420713	ensembl	human	known	74_37	missense	12.96	47	7	SNP	0.996	A
ZNF772	400720	genome.wustl.edu	37	19	57984884	57984884	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EO-01A-11D-A36J-09	TCGA-VR-A8EO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99b4a355-38c5-453d-8af7-596281e04b52	eb9962d2-a032-4cc8-b4b9-8f581df3df66	g.chr19:57984884C>T	ENST00000343280.4	-	5	1488	c.1228G>A	c.(1228-1230)Gca>Aca	p.A410T	ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000356584.3_Missense_Mutation_p.A369T|AC004076.9_ENST00000596831.1_Intron|AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000427512.2_Missense_Mutation_p.A298T|ZNF772_ENST00000601768.1_Intron|ZNF772_ENST00000425074.3_3'UTR	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		TTCCCACATGCGATGCACTCA	0.418																																					Melanoma(5;289 436 14293 15924 30817)												0													128.0	114.0	119.0					19																	57984884		2203	4300	6503	SO:0001583	missense	0			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.1228G>A	19.37:g.57984884C>T	ENSP00000341165:p.Ala410Thr		A6NJK9|B4DH56|B4DYS0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A410T	ENST00000343280.4	37	c.1228	CCDS33133.1	19	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405653	0.62288	.	.	ENSG00000197128	ENST00000343280;ENST00000427512;ENST00000356584;ENST00000291809	T;T;T	0.07567	3.18;3.18;3.18	3.72	2.64	0.31445	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09949	0.0244	N	0.03084	-0.415	0.34007	D	0.651021	B;P;D	0.76494	0.401;0.665;0.999	B;B;D	0.83275	0.073;0.12;0.996	T	0.37197	-0.9716	9	0.87932	D	0	.	9.3404	0.38076	0.0:0.8855:0.0:0.1145	.	298;369;410	Q68DY9-2;A6NJK9;Q68DY9	.;.;ZN772_HUMAN	T	410;298;369;335	ENSP00000341165:A410T;ENSP00000395967:A298T;ENSP00000348992:A369T	ENSP00000291809:A335T	A	-	1	0	ZNF772	62676696	0.000000	0.05858	1.000000	0.80357	0.913000	0.54294	-0.320000	0.08028	1.917000	0.55516	0.305000	0.20034	GCA	ZNF772	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197128		0.418	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF772	HGNC	protein_coding	OTTHUMT00000397447.1		0.00	68	0	C	NM_001024596		57984884	-1			no_errors	ENST00000343280	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.498	T
