#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ADAM18	8749	genome.wustl.edu	37	8	39463837	39463837	+	Silent	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr8:39463837C>T	ENST00000265707.5	+	3	189	c.144C>T	c.(142-144)atC>atT	p.I48I	ADAM18_ENST00000379866.1_Silent_p.I48I|ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000520772.1_Silent_p.I48I	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	48					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TGATTTACATCATTACAATTG	0.264																																																	0													66.0	67.0	66.0					8																	39463837		2201	4285	6486	SO:0001819	synonymous_variant	0			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.144C>T	8.37:g.39463837C>T			B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	NULL	p.H60Y	ENST00000265707.5	37	c.178	CCDS6113.1	8																																																																																			ADAM18	-	NULL	ENSG00000168619		0.264	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM18	HGNC	protein_coding	OTTHUMT00000376916.1	-	0.00	49	0	C	NM_014237		39463837	+1	tier1	-	no_errors	ENST00000520001	ensembl	human	known	74_37	missense	24.19	47	15	SNP	0.334	T
ADAMTS13	11093	genome.wustl.edu	37	9	136321339	136321339	+	Splice_Site	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr9:136321339T>C	ENST00000371929.3	+	26	4159		c.e26+2		ADAMTS13_ENST00000485925.1_Splice_Site|ADAMTS13_ENST00000371916.1_Splice_Site|ADAMTS13_ENST00000356589.2_Splice_Site|ADAMTS13_ENST00000355699.2_Splice_Site|ADAMTS13_ENST00000371910.1_Splice_Site	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13						cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCAGTGCGGGTATGTCTAGGG	0.647																																																	0													52.0	47.0	49.0					9																	136321339		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.3715+2T>C	9.37:g.136321339T>C			Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Splice_Site	SNP	-	e26+2	ENST00000371929.3	37	c.3715+2	CCDS6970.1	9	.	.	.	.	.	.	.	.	.	.	T	14.28	2.487865	0.44249	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000371910	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3297	0.55033	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTS13	135311160	1.000000	0.71417	0.815000	0.32552	0.037000	0.13140	5.538000	0.67193	1.944000	0.56390	0.459000	0.35465	.	ADAMTS13	-	-	ENSG00000160323		0.647	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAMTS13	HGNC	protein_coding	OTTHUMT00000054920.1		0.00	33	0	T	NM_139025	Intron	136321339	+1			no_errors	ENST00000371929	ensembl	human	known	74_37	splice_site	8.82	31	3	SNP	0.971	C
ADAMTS20	80070	genome.wustl.edu	37	12	43819395	43819395	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:43819395G>T	ENST00000389420.3	-	28	4205	c.4206C>A	c.(4204-4206)aaC>aaA	p.N1402K	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.N1402K|ADAMTS20_ENST00000395541.2_Missense_Mutation_p.N520K	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1402	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TAGGTGGCTTGTTTACAATTT	0.408																																																	0													200.0	156.0	171.0					12																	43819395		2203	4300	6503	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4206C>A	12.37:g.43819395G>T	ENSP00000374071:p.Asn1402Lys		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.N1402K	ENST00000389420.3	37	c.4206	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	6.208	0.406496	0.11754	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.60171	0.33;0.23;0.23;0.21	4.71	2.85	0.33270	.	0.538062	0.16638	N	0.205759	T	0.33177	0.0854	N	0.17800	0.525	0.27862	N	0.940379	B;B	0.32862	0.033;0.387	B;B	0.36030	0.145;0.216	T	0.28138	-1.0053	10	0.06365	T	0.9	.	3.0537	0.06177	0.1479:0.1499:0.5478:0.1545	.	1402;520	P59510;E9PBD5	ATS20_HUMAN;.	K	1402;532;520;1402;1402	ENSP00000374071:N1402K;ENSP00000447427:N532K;ENSP00000378911:N520K;ENSP00000448341:N1402K	ENSP00000374068:N1402K	N	-	3	2	ADAMTS20	42105662	1.000000	0.71417	0.954000	0.39281	0.777000	0.43975	1.449000	0.35123	1.266000	0.44231	0.650000	0.86243	AAC	ADAMTS20	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000173157		0.408	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	-	0.00	40	0	G	NM_025003		43819395	-1	tier1	-	no_errors	ENST00000389420	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
ADAMTS6	11174	genome.wustl.edu	37	5	64468685	64468685	+	5'UTR	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:64468685G>T	ENST00000314351.5	-	0	720							Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R192C(1)|p.R1021C(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		GTGACCCAGCGAGGAGGAGGG	0.557																																																	2	Substitution - Missense(2)	pancreas(2)											96.0	89.0	92.0					5																	64468685		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000314351.5:c.-602C>A	5.37:g.64468685G>T			Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.R1021S	ENST00000314351.5	37	c.3061		5	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434433	0.83776	.	.	ENSG00000049192	ENST00000381055	T	0.18016	2.24	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.29491	0.0735	L	0.48362	1.52	0.80722	D	1	P	0.49253	0.921	P	0.53062	0.717	T	0.00313	-1.1825	10	0.29301	T	0.29	.	19.5135	0.95154	0.0:0.0:1.0:0.0	.	1021	Q9UKP5	ATS6_HUMAN	S	1021	ENSP00000370443:R1021S	ENSP00000370443:R1021S	R	-	1	0	ADAMTS6	64504441	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.288000	0.72679	2.622000	0.88805	0.650000	0.86243	CGC	ADAMTS6	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000049192		0.557	ADAMTS6-006	KNOWN	basic	processed_transcript	ADAMTS6	HGNC	protein_coding	OTTHUMT00000157334.2		0.00	14	0	G	NM_197941		64468685	-1			no_errors	ENST00000381055	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105420323	105420323	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr14:105420323A>C	ENST00000333244.5	-	7	1584	c.1465T>G	c.(1465-1467)Tta>Gta	p.L489V	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	489						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGTGTCTTTAAATCGTGTACT	0.502																																																	0													53.0	56.0	55.0					14																	105420323		1966	4146	6112	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1465T>G	14.37:g.105420323A>C	ENSP00000353114:p.Leu489Val		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L489V	ENST00000333244.5	37	c.1465	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	a	12.10	1.835704	0.32421	.	.	ENSG00000185567	ENST00000333244	T	0.05258	3.47	5.03	-5.55	0.02536	.	.	.	.	.	T	0.02807	0.0084	N	0.19112	0.55	0.09310	N	1	P	0.36412	0.552	B	0.37650	0.255	T	0.38866	-0.9641	9	0.10902	T	0.67	.	1.2083	0.01899	0.3101:0.1232:0.325:0.2417	.	489	Q8IVF2	AHNK2_HUMAN	V	489	ENSP00000353114:L489V	ENSP00000353114:L489V	L	-	1	2	AHNAK2	104491368	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.557000	0.00432	-1.310000	0.02312	-0.379000	0.06801	TTA	AHNAK2	-	NULL	ENSG00000185567		0.502	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	59	0	A	NM_138420		105420323	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	16.39	51	10	SNP	0.000	C
ALDH4A1	8659	genome.wustl.edu	37	1	19215874	19215874	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:19215874G>T	ENST00000375341.3	-	3	488	c.231C>A	c.(229-231)gaC>gaA	p.D77E	RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000538309.1_Missense_Mutation_p.D17E|ALDH4A1_ENST00000290597.5_Missense_Mutation_p.D77E|ALDH4A1_ENST00000538839.1_Missense_Mutation_p.D77E	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	77					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGTACTGCACGTCCGACGTCC	0.577																																																	0													97.0	70.0	79.0					1																	19215874		2158	4180	6338	SO:0001583	missense	0			U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.231C>A	1.37:g.19215874G>T	ENSP00000364490:p.Asp77Glu		A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH	p.D77E	ENST00000375341.3	37	c.231	CCDS188.1	1	.	.	.	.	.	.	.	.	.	.	G	6.990	0.552676	0.13374	.	.	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000538309;ENST00000375335;ENST00000375334;ENST00000432718	T;T;T;T;T	0.29655	1.65;1.65;1.65;1.65;1.56	5.34	-5.64	0.02466	Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.170606	0.49305	D	0.000150	T	0.16342	0.0393	L	0.32530	0.975	0.26916	N	0.966775	B	0.06786	0.001	B	0.13407	0.009	T	0.23868	-1.0176	10	0.18276	T	0.48	-24.1887	10.3015	0.43654	0.613:0.0:0.2946:0.0924	.	77	P30038	AL4A1_HUMAN	E	77;77;77;17;77;17;77	ENSP00000290597:D77E;ENSP00000364490:D77E;ENSP00000446071:D77E;ENSP00000442988:D17E;ENSP00000393209:D77E	ENSP00000290597:D77E	D	-	3	2	ALDH4A1	19088461	0.000000	0.05858	0.000000	0.03702	0.463000	0.32649	-3.368000	0.00495	-1.082000	0.03101	-0.251000	0.11542	GAC	ALDH4A1	-	superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH	ENSG00000159423		0.577	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH4A1	HGNC	protein_coding	OTTHUMT00000006954.1	-	0.00	28	0	G			19215874	-1	tier1	-	no_errors	ENST00000290597	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.493	T
ALOX5	240	genome.wustl.edu	37	10	45878049	45878049	+	Missense_Mutation	SNP	C	C	T	rs551364951		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr10:45878049C>T	ENST00000374391.2	+	2	322	c.269C>T	c.(268-270)aCg>aTg	p.T90M	ALOX5_ENST00000542434.1_Missense_Mutation_p.T90M	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	90	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	ACGCTGAAGACGCCCCACGGG	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		20212	0.0		0.0	False		,,,				2504	0.001																0													111.0	82.0	92.0					10																	45878049		2203	4300	6503	SO:0001583	missense	0			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.269C>T	10.37:g.45878049C>T	ENSP00000363512:p.Thr90Met		B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C,pfscan_PLAT/LH2_dom	p.T90M	ENST00000374391.2	37	c.269	CCDS7212.1	10	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241974	0.79912	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.64803	-0.12;-0.12	5.07	5.07	0.68467	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.100904	0.64402	D	0.000003	T	0.73869	0.3642	L	0.48986	1.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.991;0.989	T	0.73094	-0.4091	10	0.45353	T	0.12	-23.0727	15.9724	0.80031	0.0:1.0:0.0:0.0	.	90;90;90	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	M	90	ENSP00000437634:T90M;ENSP00000363512:T90M	ENSP00000363512:T90M	T	+	2	0	ALOX5	45198055	1.000000	0.71417	0.991000	0.47740	0.835000	0.47333	4.831000	0.62752	2.639000	0.89480	0.655000	0.94253	ACG	ALOX5	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	ENSG00000012779		0.592	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	HGNC	protein_coding	OTTHUMT00000047780.1		0.00	33	0	C			45878049	+1			no_errors	ENST00000374391	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
ANGPT1	284	genome.wustl.edu	37	8	108296965	108296965	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr8:108296965G>A	ENST00000520734.1	-	6	835	c.550C>T	c.(550-552)Cga>Tga	p.R184*	ANGPT1_ENST00000518386.1_Intron|ANGPT1_ENST00000520052.1_Nonsense_Mutation_p.R183*			Q15389	ANGP1_HUMAN	angiopoietin 1	384					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			GAATAGGCTCGGTTCCCTTCC	0.428																																																	0													150.0	127.0	135.0					8																	108296965		2203	4300	6503	SO:0001587	stop_gained	0			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.550C>T	8.37:g.108296965G>A	ENSP00000430750:p.Arg184*		Q5HYA0	Nonsense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.R384*	ENST00000520734.1	37	c.1150		8	.	.	.	.	.	.	.	.	.	.	G	37	6.136955	0.97315	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520734;ENST00000520052	.	.	.	5.73	3.94	0.45596	.	0.292338	0.39759	N	0.001264	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	11.1259	0.48317	0.0664:0.0:0.805:0.1286	.	.	.	.	X	384;383;184;183	.	ENSP00000297450:R383X	R	-	1	2	ANGPT1	108366141	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	2.821000	0.48065	0.773000	0.33404	-0.143000	0.13931	CGA	ANGPT1	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000154188		0.428	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	ANGPT1	HGNC	protein_coding	OTTHUMT00000380428.2	-	0.00	73	0	G	NM_001146, NM_139290		108296965	-1	tier1	-	no_errors	ENST00000517746	ensembl	human	known	74_37	nonsense	25.00	89	30	SNP	1.000	A
AOX1	316	genome.wustl.edu	37	2	201473943	201473943	+	Intron	SNP	A	A	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:201473943A>T	ENST00000374700.2	+	11	1300					NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1						inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TTCTTTTGGAACAGACAAAAA	0.333																																																	0																																										SO:0001627	intron_variant	0			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1059+85A>T	2.37:g.201473943A>T			O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	RNA	SNP	-	NULL	ENST00000374700.2	37	NULL	CCDS33360.1	2																																																																																			AOX1	-	-	ENSG00000138356		0.333	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	HGNC	protein_coding	OTTHUMT00000335844.1	-	0.00	39	0	A	NM_001159		201473943	+1	tier1	-	no_errors	ENST00000465297	ensembl	human	known	74_37	rna	30.49	57	25	SNP	0.000	T
APAF1	317	genome.wustl.edu	37	12	99053025	99053025	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:99053025G>A	ENST00000551964.1	+	5	1350	c.614G>A	c.(613-615)cGg>cAg	p.R205Q	APAF1_ENST00000359972.2_Missense_Mutation_p.R194Q|APAF1_ENST00000357310.1_Missense_Mutation_p.R205Q|APAF1_ENST00000547045.1_Missense_Mutation_p.R205Q|APAF1_ENST00000549007.1_Missense_Mutation_p.R205Q|APAF1_ENST00000339433.3_Missense_Mutation_p.R205Q|APAF1_ENST00000552268.1_Missense_Mutation_p.R205Q|APAF1_ENST00000333991.1_Missense_Mutation_p.R205Q|APAF1_ENST00000550527.1_Missense_Mutation_p.R194Q	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	205	NB-ARC.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	CTTTGCACACGGTTGGATCAG	0.473																																																	0													134.0	134.0	134.0					12																	99053025		2203	4300	6503	SO:0001583	missense	0			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.614G>A	12.37:g.99053025G>A	ENSP00000448165:p.Arg205Gln		B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NB-ARC,pfam_CARD,superfamily_WD40_repeat_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_CARD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Disease_R,prints_G-protein_beta_WD-40_rep	p.R205Q	ENST00000551964.1	37	c.614	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.423705	0.96111	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000333991;ENST00000552268;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.53	5.53	0.82687	NB-ARC (1);	0.111024	0.64402	D	0.000008	D	0.85309	0.5667	L	0.60957	1.885	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.97110	0.996;1.0;0.998;0.996;0.959	T	0.79860	-0.1625	10	0.11794	T	0.64	-0.3734	19.4752	0.94985	0.0:0.0:1.0:0.0	.	205;205;194;205;194	O14727-6;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	Q	205;194;205;205;205;205;194;205;205	ENSP00000448165:R205Q;ENSP00000353059:R194Q;ENSP00000349862:R205Q;ENSP00000341830:R205Q;ENSP00000334558:R205Q;ENSP00000448826:R205Q;ENSP00000448449:R194Q;ENSP00000449791:R205Q;ENSP00000448161:R205Q	ENSP00000334558:R205Q	R	+	2	0	APAF1	97577156	1.000000	0.71417	0.718000	0.30602	0.985000	0.73830	8.933000	0.92911	2.610000	0.88304	0.650000	0.86243	CGG	APAF1	-	pfam_NB-ARC,superfamily_P-loop_NTPase,pirsf_Apoptotic_pept-activating_1	ENSG00000120868		0.473	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	-	0.00	46	0	G	NM_181861.1		99053025	+1	tier1	-	no_errors	ENST00000551964	ensembl	human	known	74_37	missense	17.35	81	17	SNP	0.997	A
ARHGEF26	26084	genome.wustl.edu	37	3	153935682	153935682	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:153935682G>A	ENST00000356448.4	+	10	2154	c.1870G>A	c.(1870-1872)Gcc>Acc	p.A624T	ARHGEF26_ENST00000465817.1_Intron|ARHGEF26_ENST00000465093.1_Missense_Mutation_p.A624T	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	624					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						CAATGAGGGCGCCCGGAAGAT	0.438																																					GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)												0													94.0	88.0	90.0					3																	153935682		1862	4108	5970	SO:0001583	missense	0			BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1870G>A	3.37:g.153935682G>A	ENSP00000348828:p.Ala624Thr		B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.A624T	ENST00000356448.4	37	c.1870	CCDS46938.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.190185	0.94923	.	.	ENSG00000114790	ENST00000356448;ENST00000465093	T;T	0.29142	1.58;1.58	5.05	5.05	0.67936	Dbl homology (DH) domain (2);	0.000000	0.85682	D	0.000000	T	0.63129	0.2485	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.83275	0.85;0.996	T	0.70335	-0.4900	10	0.72032	D	0.01	-24.8228	18.7816	0.91934	0.0:0.0:1.0:0.0	.	624;624	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	T	624	ENSP00000348828:A624T;ENSP00000423418:A624T	ENSP00000348828:A624T	A	+	1	0	ARHGEF26	155418372	1.000000	0.71417	0.964000	0.40570	0.911000	0.54048	9.036000	0.93758	2.504000	0.84457	0.655000	0.94253	GCC	ARHGEF26	-	superfamily_DH-domain	ENSG00000114790		0.438	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF26	HGNC	protein_coding	OTTHUMT00000353287.3	-	0.00	49	0	G	NM_015595		153935682	+1	tier1	-	no_errors	ENST00000356448	ensembl	human	known	74_37	missense	36.36	35	20	SNP	0.999	A
ARVCF	421	genome.wustl.edu	37	22	19974605	19974605	+	Intron	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr22:19974605T>C	ENST00000263207.3	-	3	502				ARVCF_ENST00000401994.1_Silent_p.E4E|ARVCF_ENST00000487793.1_5'UTR|ARVCF_ENST00000406522.1_Silent_p.E4E|ARVCF_ENST00000344269.3_Silent_p.E4E|ARVCF_ENST00000406259.1_Intron	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome						calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CCTGTCTGAGTTCGGCCGGCA	0.756																																																	0													3.0	3.0	3.0					22																	19974605		753	1819	2572	SO:0001627	intron_variant	0				CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.210+3502A>G	22.37:g.19974605T>C			B7WNV2	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.E4	ENST00000263207.3	37	c.12	CCDS13771.1	22																																																																																			ARVCF	-	NULL	ENSG00000099889		0.756	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARVCF	HGNC	protein_coding	OTTHUMT00000075314.5	-	0.00	25	0	T	NM_001670		19974605	-1	tier1	-	no_errors	ENST00000344269	ensembl	human	known	74_37	silent	34.48	19	10	SNP	1.000	C
BAGE2	85319	genome.wustl.edu	37	21	11038730	11038730	+	RNA	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr21:11038730G>A	ENST00000470054.1	-	0	1473							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CACCCTACCTGTTTGGACCGA	0.373																																																	0																																												0			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11038730G>A			A8K925|Q08ER0	RNA	SNP	-	NULL	ENST00000470054.1	37	NULL		21																																																																																			BAGE2	-	-	ENSG00000187172		0.373	BAGE2-001	KNOWN	basic	processed_transcript	BAGE2	HGNC	pseudogene	OTTHUMT00000157417.3	-	0.00	170	0	G	NM_182482		11038730	-1	tier1	-	no_errors	ENST00000470054	ensembl	human	known	74_37	rna	10.84	148	18	SNP	1.000	A
BNIP3P1	319138	genome.wustl.edu	37	14	28735149	28735150	+	RNA	INS	-	-	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr14:28735149_28735150insA	ENST00000550043.1	+	0	1554_1555									BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene 1																		ACTGGAAATGGAAAAAAAAATA	0.297																																																	0																																												0					14q12	2014-02-04	2011-03-18	2011-03-18	ENSG00000197358	ENSG00000197358			19922	pseudogene	pseudogene			"""BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene"""	BNIP3P			Standard	NG_002516		Approved				OTTHUMG00000170378		14.37:g.28735158_28735158dupA				RNA	INS	-	NULL	ENST00000550043.1	37	NULL		14																																																																																			BNIP3P1	-	-	ENSG00000197358		0.297	BNIP3P1-002	KNOWN	basic	processed_transcript	BNIP3P1	HGNC	pseudogene	OTTHUMT00000408770.1		0.00	18	0	-			28735150	+1	tier1		no_errors	ENST00000550043	ensembl	human	known	74_37	rna	31.58	26	12	INS	0.126:0.195	A
BOD1	91272	genome.wustl.edu	37	5	173043252	173043252	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:173043252C>T	ENST00000311086.4	-	1	411	c.188G>A	c.(187-189)gGc>gAc	p.G63D	BOD1_ENST00000285908.5_Missense_Mutation_p.G63D|BOD1_ENST00000480951.1_Missense_Mutation_p.G63D|BOD1_ENST00000471339.1_5'UTR	NM_138369.2	NP_612378.1	Q96IK1	BOD1_HUMAN	biorientation of chromosomes in cell division 1	63					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|kinetochore (GO:0000776)				endometrium(1)|large_intestine(2)|lung(2)|ovary(2)	7						GTCAAAAAGGCCCCGGCTCTT	0.721																																																	0													4.0	6.0	5.0					5																	173043252		2075	4163	6238	SO:0001583	missense	0			AY303777	CCDS4389.1, CCDS54951.1	5q35.2	2013-10-11	2009-03-04	2009-03-04	ENSG00000145919	ENSG00000145919			25114	protein-coding gene	gene with protein product	"""biorientation defective 1"""		"""family with sequence similarity 44, member B"""	FAM44B		17938248	Standard	NM_138369		Approved		uc003mcq.2	Q96IK1	OTTHUMG00000130540	ENST00000311086.4:c.188G>A	5.37:g.173043252C>T	ENSP00000309644:p.Gly63Asp		B4DXH8|Q9BTW1	Missense_Mutation	SNP	NULL	p.G63D	ENST00000311086.4	37	c.188	CCDS4389.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.136648	0.94517	.	.	ENSG00000145919	ENST00000311086;ENST00000285908;ENST00000477985;ENST00000480951	T;T	0.25912	1.77;1.77	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60964	-0.7158	10	0.87932	D	0	-11.7075	16.2406	0.82405	0.0:1.0:0.0:0.0	.	63;63	Q96IK1-2;Q96IK1	.;BOD1_HUMAN	D	63;63;37;63	ENSP00000309644:G63D;ENSP00000285908:G63D	ENSP00000285908:G63D	G	-	2	0	BOD1	172975858	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.010000	0.76353	2.143000	0.66587	0.563000	0.77884	GGC	BOD1	-	NULL	ENSG00000145919		0.721	BOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1	HGNC	protein_coding	OTTHUMT00000252963.1	-	0.00	24	0	C	NM_138369		173043252	-1	tier1	-	no_errors	ENST00000311086	ensembl	human	known	74_37	missense	59.09	9	13	SNP	1.000	T
BPIFC	254240	genome.wustl.edu	37	22	32815372	32815372	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr22:32815372C>G	ENST00000397452.1	-	13	1347	c.1237G>C	c.(1237-1239)Gag>Cag	p.E413Q	BPIFC_ENST00000534972.1_Missense_Mutation_p.E137Q|BPIFC_ENST00000300399.3_Missense_Mutation_p.E413Q|BPIFC_ENST00000432451.2_Missense_Mutation_p.E170Q			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	413						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										CGATTGGACTCTGGCAAAGCA	0.368																																																	0													117.0	122.0	120.0					22																	32815372		2203	4300	6503	SO:0001583	missense	0			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.1237G>C	22.37:g.32815372C>G	ENSP00000380594:p.Glu413Gln		A2RRF1	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.E413Q	ENST00000397452.1	37	c.1237	CCDS13906.1	22	.	.	.	.	.	.	.	.	.	.	C	12.97	2.097745	0.37048	.	.	ENSG00000184459	ENST00000397452;ENST00000300399;ENST00000534972;ENST00000432451	T;T;T;T	0.10382	2.88;2.88;2.88;2.88	4.87	3.78	0.43462	.	0.277187	0.37348	N	0.002126	T	0.10680	0.0261	L	0.55990	1.75	0.26560	N	0.973754	B;B	0.22080	0.064;0.051	B;B	0.19946	0.027;0.027	T	0.13899	-1.0492	10	0.21014	T	0.42	-15.7258	10.2827	0.43550	0.0:0.7992:0.2008:0.0	.	170;413	A2RRF1;Q8NFQ6	.;BPIFC_HUMAN	Q	413;413;137;170	ENSP00000380594:E413Q;ENSP00000300399:E413Q;ENSP00000439123:E137Q;ENSP00000408920:E170Q	ENSP00000300399:E413Q	E	-	1	0	BPIFC	31145372	0.995000	0.38212	0.874000	0.34290	0.944000	0.59088	1.345000	0.33953	2.238000	0.73509	0.455000	0.32223	GAG	BPIFC	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	ENSG00000184459		0.368	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BPIFC	HGNC	protein_coding	OTTHUMT00000129029.2	-	0.00	62	0	C	NM_174932		32815372	-1	tier1	-	no_errors	ENST00000300399	ensembl	human	known	74_37	missense	30.43	64	28	SNP	0.872	G
BUB1B	701	genome.wustl.edu	37	15	40510661	40510661	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr15:40510661A>T	ENST00000287598.6	+	22	3050	c.2855A>T	c.(2854-2856)gAc>gTc	p.D952V	PAK6_ENST00000441369.1_Intron|BUB1B_ENST00000412359.3_Missense_Mutation_p.D966V|RP11-133K1.2_ENST00000558658.1_Intron|PAK6_ENST00000453867.1_Intron	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	952	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		TTTCAGGTAGACCTGTTTGGT	0.393			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																														yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0													114.0	93.0	100.0					15																	40510661		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2855A>T	15.37:g.40510661A>T	ENSP00000287598:p.Asp952Val		B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I	p.D966V	ENST00000287598.6	37	c.2897	CCDS10053.1	15	.	.	.	.	.	.	.	.	.	.	A	18.73	3.686172	0.68157	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.68025	-0.3;-0.3	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.80204	0.4580	M	0.69523	2.12	0.80722	D	1	D	0.69078	0.997	D	0.68765	0.96	T	0.82494	-0.0429	10	0.87932	D	0	-20.6387	14.7126	0.69244	1.0:0.0:0.0:0.0	.	952	O60566	BUB1B_HUMAN	V	952;966;835	ENSP00000287598:D952V;ENSP00000398470:D966V	ENSP00000287598:D952V	D	+	2	0	BUB1B	38297953	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.674000	0.68117	2.198000	0.70561	0.533000	0.62120	GAC	BUB1B	-	NULL	ENSG00000156970		0.393	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	HGNC	protein_coding	OTTHUMT00000252122.4	-	0.00	62	0	A			40510661	+1	tier1	-	no_errors	ENST00000412359	ensembl	human	known	74_37	missense	27.97	85	33	SNP	1.000	T
C10orf53	282966	genome.wustl.edu	37	10	50902630	50902630	+	Silent	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr10:50902630C>A	ENST00000374111.3	+	3	276	c.264C>A	c.(262-264)gcC>gcA	p.A88A	C10orf53_ENST00000374112.3_Intron|C10orf53_ENST00000374113.3_3'UTR|C10orf53_ENST00000535836.1_Intron	NM_001042427.1	NP_001035892.1	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53	88										endometrium(1)|lung(6)	7		all_neural(218;0.107)				CCAGGATAGCCGTGCTGAATG	0.473																																																	0													100.0	102.0	101.0					10																	50902630		1991	4176	6167	SO:0001819	synonymous_variant	0			BC028127	CCDS31202.1, CCDS41521.1	10q11.23	2012-05-24			ENSG00000178645	ENSG00000178645			27421	protein-coding gene	gene with protein product						12477932	Standard	NM_182554		Approved	Em:AC069546.1	uc001jid.1	Q8N6V4	OTTHUMG00000018199	ENST00000374111.3:c.264C>A	10.37:g.50902630C>A			A6NI81|A6NLE0|B9ZVK6	Silent	SNP	NULL	p.A88	ENST00000374111.3	37	c.264	CCDS41521.1	10																																																																																			C10orf53	-	NULL	ENSG00000178645		0.473	C10orf53-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf53	HGNC	protein_coding	OTTHUMT00000048005.1		0.00	34	0	C	NM_182554		50902630	+1			no_errors	ENST00000374111	ensembl	human	known	74_37	silent	5.68	83	5	SNP	0.032	A
C3AR1	719	genome.wustl.edu	37	12	8212673	8212673	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:8212673C>A	ENST00000307637.4	-	2	312	c.109G>T	c.(109-111)Gga>Tga	p.G37*		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	37					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		CCTGGCAATCCCAGTAAAAAA	0.522																																																	0													73.0	74.0	73.0					12																	8212673		2203	4300	6503	SO:0001587	stop_gained	0			U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.109G>T	12.37:g.8212673C>A	ENSP00000302079:p.Gly37*		O43771|Q92868	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Anaphtx_C3AR1,prints_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_Formyl_pep_rcpt,prints_Anaphtx_C5AR1/C5AR2	p.G37*	ENST00000307637.4	37	c.109	CCDS8588.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.280825	0.97440	.	.	ENSG00000171860	ENST00000307637;ENST00000546241	.	.	.	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.2652	0.87085	0.0:1.0:0.0:0.0	.	.	.	.	X	37	.	ENSP00000302079:G37X	G	-	1	0	C3AR1	8103940	1.000000	0.71417	0.913000	0.36048	0.882000	0.50991	7.747000	0.85070	2.672000	0.90937	0.484000	0.47621	GGA	C3AR1	-	prints_GPCR_Rhodpsn	ENSG00000171860		0.522	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3AR1	HGNC	protein_coding	OTTHUMT00000400254.1		0.00	32	0	C			8212673	-1			no_errors	ENST00000307637	ensembl	human	known	74_37	nonsense	6.45	28	2	SNP	1.000	A
C4orf27	54969	genome.wustl.edu	37	4	170669922	170669922	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr4:170669922T>A	ENST00000393381.2	-	4	545	c.470A>T	c.(469-471)aAt>aTt	p.N157I		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	157						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		ATTATCTCCATTTGGAACAAT	0.289																																																	0													66.0	77.0	73.0					4																	170669922		2189	4288	6477	SO:0001583	missense	0			BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.470A>T	4.37:g.170669922T>A	ENSP00000406598:p.Asn157Ile			Missense_Mutation	SNP	pfam_DUF2228_C2H2_APLF-like	p.N157I	ENST00000393381.2	37	c.470	CCDS3813.1	4	.	.	.	.	.	.	.	.	.	.	T	10.37	1.330343	0.24167	.	.	ENSG00000056050	ENST00000393381	T	0.37584	1.19	5.2	-6.19	0.02078	.	0.659657	0.16951	N	0.192907	T	0.12646	0.0307	N	0.12502	0.225	0.29231	N	0.873254	B	0.11235	0.004	B	0.15052	0.012	T	0.12553	-1.0543	10	0.22109	T	0.4	-11.2101	3.4513	0.07499	0.2321:0.4588:0.097:0.212	.	157	Q9NWY4	CD027_HUMAN	I	157	ENSP00000406598:N157I	ENSP00000406598:N157I	N	-	2	0	C4orf27	170906497	0.971000	0.33674	0.950000	0.38849	0.896000	0.52359	0.365000	0.20348	-0.919000	0.03803	-0.487000	0.04747	AAT	C4orf27	-	pfam_DUF2228_C2H2_APLF-like	ENSG00000056050		0.289	C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf27	HGNC	protein_coding	OTTHUMT00000363140.1	-	0.00	91	0	T	NM_017867		170669922	-1	tier1	-	no_errors	ENST00000393381	ensembl	human	known	74_37	missense	39.84	77	51	SNP	0.977	A
CACHD1	57685	genome.wustl.edu	37	1	65113504	65113504	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:65113504G>C	ENST00000371073.2	+	9	1177	c.1177G>C	c.(1177-1179)Gag>Cag	p.E393Q	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Missense_Mutation_p.E342Q			Q5VU97	CAHD1_HUMAN	cache domain containing 1	393	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TGGTTTGAAAGAGCTGGCTTT	0.463																																																	0													68.0	61.0	64.0					1																	65113504		2203	4300	6503	SO:0001583	missense	0			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.1177G>C	1.37:g.65113504G>C	ENSP00000360113:p.Glu393Gln		Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfscan_VWF_A	p.E393Q	ENST00000371073.2	37	c.1177		1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338877	0.81911	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.22539	1.95;1.95	5.42	4.5	0.54988	von Willebrand factor, type A (2);	0.090748	0.85682	D	0.000000	T	0.08891	0.0220	L	0.27053	0.805	0.80722	D	1	B	0.26635	0.155	B	0.26614	0.071	T	0.05767	-1.0865	10	0.62326	D	0.03	-27.2006	16.2602	0.82536	0.0:0.1328:0.8672:0.0	.	393	Q5VU97	CAHD1_HUMAN	Q	393;342	ENSP00000360113:E393Q;ENSP00000290039:E342Q	ENSP00000290039:E342Q	E	+	1	0	CACHD1	64886092	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.338000	0.96553	1.270000	0.44297	-0.165000	0.13383	GAG	CACHD1	-	pfscan_VWF_A	ENSG00000158966		0.463	CACHD1-201	KNOWN	basic	protein_coding	CACHD1	HGNC	protein_coding		-	0.00	18	0	G	NM_020925		65113504	+1	tier1	-	no_errors	ENST00000371073	ensembl	human	known	74_37	missense	19.05	34	8	SNP	1.000	C
CAPS2	84698	genome.wustl.edu	37	12	75710093	75710093	+	Splice_Site	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:75710093G>A	ENST00000409445.3	-	7	843	c.647C>T	c.(646-648)gCa>gTa	p.A216V	CAPS2_ENST00000409799.1_Splice_Site_p.A166V|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000442339.2_5'UTR|CAPS2_ENST00000393284.3_5'UTR	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	216							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						ACAACTTACTGCATCCAATTT	0.358																																																	0													271.0	213.0	230.0					12																	75710093		692	1591	2283	SO:0001630	splice_region_variant	0			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.648+1C>T	12.37:g.75710093G>A			Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.A216V	ENST00000409445.3	37	c.647	CCDS9008.2	12	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801070	0.50315	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000552497;ENST00000436898	D;D;D;T	0.83755	-1.76;-1.76;-1.76;0.23	5.75	4.85	0.62838	.	0.094666	0.46442	N	0.000282	T	0.79112	0.4391	L	0.52364	1.645	0.80722	D	1	D;P	0.53745	0.962;0.874	B;B	0.43225	0.412;0.223	T	0.77840	-0.2438	10	0.34782	T	0.22	-1.8311	12.8323	0.57752	0.0809:0.0:0.9191:0.0	.	216;166	Q9BXY5;B9A061	CAYP2_HUMAN;.	V	166;216;111;110	ENSP00000386977:A166V;ENSP00000386959:A216V;ENSP00000449797:A111V;ENSP00000411797:A110V	ENSP00000338474:A111V	A	-	2	0	CAPS2	73996360	0.905000	0.30787	0.870000	0.34147	0.822000	0.46500	2.285000	0.43487	1.419000	0.47118	0.655000	0.94253	GCA	CAPS2	-	NULL	ENSG00000180881		0.358	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000327880.2	-	0.00	68	0	G		Missense_Mutation	75710093	-1	tier1	-	no_errors	ENST00000409445	ensembl	human	known	74_37	missense	24.24	50	16	SNP	0.957	A
CCDC163P	126661	genome.wustl.edu	37	1	45962253	45962253	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:45962253C>T	ENST00000432082.1	-	4	669	c.305G>A	c.(304-306)cGa>cAa	p.R102Q	CCDC163P_ENST00000488405.2_Missense_Mutation_p.R102Q|CCDC163P_ENST00000502793.2_5'UTR|CCDC163P_ENST00000490551.3_Missense_Mutation_p.R102Q					coiled-coil domain containing 163, pseudogene											cervix(1)|endometrium(1)	2						CTGAGCCTGTCGTCCCTCAGC	0.527																																																	0													64.0	69.0	68.0					1																	45962253		1999	4182	6181	SO:0001583	missense	0			BC047421		1p34.1	2010-06-14	2009-12-17	2009-12-17	ENSG00000236624	ENSG00000236624			27003	pseudogene	pseudogene			"""chromosome 1 open reading frame 231"""	C1orf231		18672041	Standard	NR_033296		Approved	LOC126661	uc001cnw.3		OTTHUMG00000007741	ENST00000432082.1:c.305G>A	1.37:g.45962253C>T	ENSP00000435596:p.Arg102Gln			Missense_Mutation	SNP	NULL	p.R102Q	ENST00000432082.1	37	c.305		1	.	.	.	.	.	.	.	.	.	.	C	9.520	1.108104	0.20714	.	.	ENSG00000236624	ENST00000490551;ENST00000432082;ENST00000488405	.	.	.	5.12	-5.66	0.02451	.	.	.	.	.	T	0.16811	0.0404	.	.	.	0.09310	N	1	B;B	0.23490	0.04;0.086	B;B	0.15870	0.008;0.014	T	0.16364	-1.0405	7	0.32370	T	0.25	.	2.9164	0.05754	0.1135:0.3164:0.1117:0.4584	.	102;102	E9PLD6;F2Z3K3	.;.	Q	102	.	ENSP00000431736:R102Q	R	-	2	0	CCDC163P	45734840	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.335000	0.02662	-1.267000	0.02443	-0.158000	0.13435	CGA	CCDC163P	-	NULL	ENSG00000236624		0.527	CCDC163P-006	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	CCDC163P	HGNC	protein_coding	OTTHUMT00000349850.4	-	0.00	22	0	C	NM_001102601		45962253	-1	tier1	-	no_errors	ENST00000415578	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.000	T
CCDC22	28952	genome.wustl.edu	37	X	49098512	49098512	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chrX:49098512C>G	ENST00000376227.3	+	3	429	c.259C>G	c.(259-261)Cag>Gag	p.Q87E	CCDC22_ENST00000496651.1_Intron	NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	87										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						GCTTGGCTATCAGAACTTCCT	0.617																																																	0													90.0	62.0	71.0					X																	49098512		2203	4300	6503	SO:0001583	missense	0			BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.259C>G	X.37:g.49098512C>G	ENSP00000365401:p.Gln87Glu		A8K7G1	Missense_Mutation	SNP	pfam_DUF812	p.Q87E	ENST00000376227.3	37	c.259	CCDS14322.1	X	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410618	0.83340	.	.	ENSG00000101997	ENST00000376227;ENST00000538876	.	.	.	5.06	5.06	0.68205	.	0.123265	0.56097	D	0.000031	T	0.77329	0.4114	M	0.68593	2.085	0.47819	D	0.999526	D;P	0.76494	0.999;0.787	D;P	0.83275	0.996;0.485	T	0.78209	-0.2293	9	0.49607	T	0.09	-23.4591	16.1681	0.81785	0.0:1.0:0.0:0.0	.	87;87	B4DLA4;O60826	.;CCD22_HUMAN	E	87	.	ENSP00000365401:Q87E	Q	+	1	0	CCDC22	48985456	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.433000	0.73404	2.334000	0.79466	0.585000	0.79938	CAG	CCDC22	-	pfam_DUF812	ENSG00000101997		0.617	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC22	HGNC	protein_coding	OTTHUMT00000060822.1	-	0.00	16	0	C	NM_014008		49098512	+1	tier1	-	no_errors	ENST00000376227	ensembl	human	known	74_37	missense	56.25	14	18	SNP	1.000	G
CCDC30	728621	genome.wustl.edu	37	1	42948562	42948563	+	Intron	INS	-	-	A	rs202122677	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:42948562_42948563insA	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						TGGAACATGAGAAAAAAAAAAA	0.366																																																	0																																										SO:0001627	intron_variant	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+75->A	1.37:g.42948573_42948573dupA			Q14F06|Q5VVM5	RNA	INS	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			CCDC30	-	-	ENSG00000186409		0.366	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding			0.00	29	0	-	NM_025030		42948563	+1	tier1		no_errors	ENST00000475614	ensembl	human	known	74_37	rna	21.43	22	6	INS	0.001:0.003	A
CDAN1	146059	genome.wustl.edu	37	15	43023524	43023524	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr15:43023524T>C	ENST00000356231.3	-	12	1768	c.1745A>G	c.(1744-1746)cAg>cGg	p.Q582R		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	582					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CTGGTTAAACTGGAAGCTGAG	0.552																																																	0													64.0	67.0	66.0					15																	43023524		2203	4299	6502	SO:0001583	missense	0			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.1745A>G	15.37:g.43023524T>C	ENSP00000348564:p.Gln582Arg		Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	NULL	p.Q582R	ENST00000356231.3	37	c.1745	CCDS32209.1	15	.	.	.	.	.	.	.	.	.	.	T	15.65	2.894940	0.52121	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.87650	-2.28	5.92	5.92	0.95590	.	0.161288	0.56097	D	0.000025	D	0.83505	0.5269	L	0.43152	1.355	0.52099	D	0.999948	B	0.30361	0.277	B	0.30495	0.116	T	0.80569	-0.1324	10	0.30854	T	0.27	-20.0807	16.3648	0.83312	0.0:0.0:0.0:1.0	.	582	Q8IWY9	CDAN1_HUMAN	R	582;580	ENSP00000348564:Q582R	ENSP00000267892:Q580R	Q	-	2	0	CDAN1	40810816	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.393000	0.79851	2.263000	0.75096	0.533000	0.62120	CAG	CDAN1	-	NULL	ENSG00000140326		0.552	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDAN1	HGNC	protein_coding	OTTHUMT00000431103.1	-	0.00	23	0	T	XM_085300		43023524	-1	tier1	-	no_errors	ENST00000356231	ensembl	human	known	74_37	missense	20.83	19	5	SNP	1.000	C
CELSR3	1951	genome.wustl.edu	37	3	48699388	48699388	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:48699388C>T	ENST00000164024.4	-	1	960	c.680G>A	c.(679-681)aGg>aAg	p.R227K	CELSR3_ENST00000544264.1_Missense_Mutation_p.R227K|RP11-148G20.1_ENST00000421275.1_RNA	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	227					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGGGGCTGTCCTTTCTGCTCC	0.652																																																	0													61.0	67.0	65.0					3																	48699388		2202	4299	6501	SO:0001583	missense	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.680G>A	3.37:g.48699388C>T	ENSP00000164024:p.Arg227Lys		O75092	Missense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.R227K	ENST00000164024.4	37	c.680	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	C	7.059	0.565916	0.13560	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.70045	-0.45;-0.45	4.06	3.19	0.36642	.	.	.	.	.	T	0.44030	0.1274	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.06405	0.001;0.002	T	0.29027	-1.0025	9	0.39692	T	0.17	.	8.0893	0.30790	0.0:0.807:0.0:0.193	.	227;297	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	K	227	ENSP00000164024:R227K;ENSP00000445694:R227K	ENSP00000164024:R227K	R	-	2	0	CELSR3	48674392	0.000000	0.05858	0.028000	0.17463	0.369000	0.29798	-1.817000	0.01719	1.316000	0.45131	0.609000	0.83330	AGG	CELSR3	-	NULL	ENSG00000008300		0.652	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1		0.00	27	0	C	NM_001407		48699388	-1			no_errors	ENST00000544264	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.036	T
CEP350	9857	genome.wustl.edu	37	1	180049761	180049761	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:180049761G>T	ENST00000367607.3	+	30	6507	c.6089G>T	c.(6088-6090)aGt>aTt	p.S2030I		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2030					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CACTGTTATAGTTGGTCAGAT	0.408											OREG0004796	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																																					0													158.0	143.0	148.0					1																	180049761		2203	4300	6503	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.6089G>T	1.37:g.180049761G>T	ENSP00000356579:p.Ser2030Ile	1958	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.S2030I	ENST00000367607.3	37	c.6089	CCDS1336.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.71|17.71	3.456222|3.456222	0.63401|0.63401	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000367607;ENST00000437245|ENST00000429851	T;T|.	0.54279|.	0.58;0.58|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.64402|.	D|.	0.000020|.	T|.	0.59088|.	0.2168|.	M|M	0.66939|0.66939	2.045|2.045	0.33737|0.33737	D|D	0.618907|0.618907	D;D|.	0.71674|.	0.998;0.997|.	D;P|.	0.78314|.	0.991;0.759|.	T|.	0.69503|.	-0.5128|.	9|.	.|.	.|.	.|.	.|.	8.5882|8.5882	0.33670|0.33670	0.0867:0.1556:0.7578:0.0|0.0867:0.1556:0.7578:0.0	.|.	2030;2030|.	E7EU22;Q5VT06|.	.;CE350_HUMAN|.	I|Y	2030;37|204	ENSP00000356579:S2030I;ENSP00000409395:S37I|.	.|.	S|X	+|+	2|3	0|2	CEP350|CEP350	178316384|178316384	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.851000|0.851000	0.48451|0.48451	3.063000|3.063000	0.49978|0.49978	2.482000|2.482000	0.83794|0.83794	0.591000|0.591000	0.81541|0.81541	AGT|TAG	CEP350	-	NULL	ENSG00000135837		0.408	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2		0.00	37	0	G	NM_014810		180049761	+1			no_errors	ENST00000367607	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.998	T
CHEK2	11200	genome.wustl.edu	37	22	29092950	29092950	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr22:29092950T>A	ENST00000405598.1	-	11	1225	c.1034A>T	c.(1033-1035)cAc>cTc	p.H345L	CHEK2_ENST00000382580.2_Missense_Mutation_p.H388L|CHEK2_ENST00000403642.1_Missense_Mutation_p.H254L|CHEK2_ENST00000348295.3_Intron|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000402731.1_Intron|CHEK2_ENST00000328354.6_Missense_Mutation_p.H345L|CHEK2_ENST00000464581.1_5'UTR|CHEK2_ENST00000404276.1_Missense_Mutation_p.H345L|CHEK2_ENST00000382578.1_Missense_Mutation_p.H254L|CHEK2_ENST00000544772.1_Missense_Mutation_p.H124L|CHEK2_ENST00000382566.1_3'UTR			O96017	CHK2_HUMAN	checkpoint kinase 2	345	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						TAAGTCACGGTGTATAATACC	0.388			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																															yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	0													131.0	111.0	118.0					22																	29092950		2203	4300	6503	SO:0001583	missense	0			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1034A>T	22.37:g.29092950T>A	ENSP00000386087:p.His345Leu		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_FHA_dom,superfamily_Kinase-like_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FHA_dom,pfscan_Prot_kinase_dom	p.H388L	ENST00000405598.1	37	c.1163	CCDS13843.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	29.3|29.3	4.992537|4.992537	0.93167|0.93167	.|.	.|.	ENSG00000183765|ENSG00000183765	ENST00000382578;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000447421|ENST00000434810	T;T;T;T;T;T;T;T|.	0.79352|.	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88198|0.88198	0.6372|0.6372	H|H	0.97390|0.97390	3.995|3.995	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	0.999;1.0;1.0;0.999;1.0|.	D|D	0.92232|0.92232	0.5793|0.5793	10|5	0.87932|.	D|.	0|.	-17.7835|-17.7835	15.0679|15.0679	0.72011|0.72011	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	254;124;345;345;388|.	O96017-4;Q9HBS5;A8JZZ5;O96017;O96017-9|.	.;.;.;CHK2_HUMAN;.|.	L|S	254;124;345;345;345;388;254;278|89	ENSP00000372021:H254L;ENSP00000442458:H124L;ENSP00000329178:H345L;ENSP00000385747:H345L;ENSP00000386087:H345L;ENSP00000372023:H388L;ENSP00000384919:H254L;ENSP00000397478:H278L|.	ENSP00000329178:H345L|.	H|T	-|-	2|1	0|0	CHEK2|CHEK2	27422950|27422950	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	6.298000|6.298000	0.72763|0.72763	2.143000|2.143000	0.66587|0.66587	0.528000|0.528000	0.53228|0.53228	CAC|ACC	CHEK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000183765		0.388	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHEK2	HGNC	protein_coding	OTTHUMT00000321150.1	-	0.00	48	0	T	NM_001005735		29092950	-1	tier1	-	no_errors	ENST00000382580	ensembl	human	known	74_37	missense	9.33	68	7	SNP	1.000	A
CNKSR2	22866	genome.wustl.edu	37	X	21670529	21670529	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chrX:21670529G>C	ENST00000379510.3	+	22	3031	c.2995G>C	c.(2995-2997)Gat>Cat	p.D999H	CNKSR2_ENST00000425654.2_Missense_Mutation_p.D969H	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	999					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						CCTTTTCTTGGATATCTGTCA	0.393																																																	0													171.0	142.0	152.0					X																	21670529		2203	4300	6503	SO:0001583	missense	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2995G>C	X.37:g.21670529G>C	ENSP00000368824:p.Asp999His		B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.D999H	ENST00000379510.3	37	c.2995	CCDS14198.1	X	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268105	0.40095	.	.	ENSG00000149970	ENST00000425654;ENST00000379510	T;T	0.24908	1.83;1.88	5.8	5.8	0.92144	.	0.056005	0.64402	D	0.000002	T	0.35885	0.0947	L	0.52011	1.625	0.80722	D	1	P;P	0.43938	0.822;0.822	P;P	0.49332	0.607;0.607	T	0.07829	-1.0752	10	0.87932	D	0	-12.7822	14.3654	0.66803	0.0749:0.0:0.9251:0.0	.	969;999	B7ZLJ1;Q8WXI2	.;CNKR2_HUMAN	H	969;999	ENSP00000397906:D969H;ENSP00000368824:D999H	ENSP00000368824:D999H	D	+	1	0	CNKSR2	21580450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.198000	0.72106	2.439000	0.82584	0.544000	0.68410	GAT	CNKSR2	-	NULL	ENSG00000149970		0.393	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	-	0.00	42	0	G	NM_014927		21670529	+1	tier1	-	no_errors	ENST00000379510	ensembl	human	known	74_37	missense	57.45	20	27	SNP	1.000	C
COL11A1	1301	genome.wustl.edu	37	1	103496701	103496701	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:103496701C>A	ENST00000370096.3	-	5	1063	c.751G>T	c.(751-753)Gct>Tct	p.A251S	COL11A1_ENST00000353414.4_Missense_Mutation_p.A251S|COL11A1_ENST00000358392.2_Missense_Mutation_p.A251S|COL11A1_ENST00000512756.1_Missense_Mutation_p.A251S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	251	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGAGCTTGAGCAGCCTTGGGT	0.478																																																	0													100.0	89.0	93.0					1																	103496701		2203	4300	6503	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.751G>T	1.37:g.103496701C>A	ENSP00000359114:p.Ala251Ser		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.A251S	ENST00000370096.3	37	c.751	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.610252	0.28712	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239;ENST00000447608	D;T;D;D;D;T	0.88124	-2.3;-0.58;-2.31;-2.34;-2.0;3.23	5.59	3.65	0.41850	.	0.367633	0.29106	N	0.013126	T	0.73999	0.3659	M	0.79123	2.44	0.32197	N	0.578331	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.08055	0.001;0.002;0.003;0.001	T	0.61272	-0.7096	10	0.14656	T	0.56	.	9.6614	0.39958	0.2627:0.4849:0.2524:0.0	.	251;251;251;251	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	S	251;251;251;251;251;178	ENSP00000359114:A251S;ENSP00000351163:A251S;ENSP00000302551:A251S;ENSP00000426533:A251S;ENSP00000408640:A251S;ENSP00000410177:A178S	ENSP00000302551:A251S	A	-	1	0	COL11A1	103269289	0.992000	0.36948	0.965000	0.40720	0.996000	0.88848	1.504000	0.35726	0.663000	0.31027	0.551000	0.68910	GCT	COL11A1	-	NULL	ENSG00000060718		0.478	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	21	0	C	NM_080630		103496701	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	40.91	13	9	SNP	0.974	A
COL4A3	1285	genome.wustl.edu	37	2	228118856	228118856	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:228118856G>A	ENST00000396578.3	+	14	956	c.794G>A	c.(793-795)gGa>gAa	p.G265E	AC097662.2_ENST00000606119.1_RNA|AC097662.2_ENST00000437673.1_RNA|AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000439598.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	265	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GGAGACAAGGGAGCAATGGGC	0.423																																																	0													106.0	114.0	112.0					2																	228118856		1887	4118	6005	SO:0001583	missense	0				CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.794G>A	2.37:g.228118856G>A	ENSP00000379823:p.Gly265Glu		Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G265E	ENST00000396578.3	37	c.794	CCDS42829.1	2	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223361	0.58668	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.98150	-4.75	5.49	5.49	0.81192	.	0.000000	0.53938	D	0.000054	D	0.99165	0.9711	H	0.96943	3.91	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.99063	1.0831	10	0.87932	D	0	.	14.8792	0.70519	0.0:0.0:1.0:0.0	.	265;265;265;265	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	E	265	ENSP00000379823:G265E	ENSP00000323334:G265E	G	+	2	0	COL4A3	227827100	0.997000	0.39634	0.939000	0.37840	0.339000	0.28857	4.489000	0.60309	2.584000	0.87258	0.467000	0.42956	GGA	COL4A3	-	NULL	ENSG00000169031		0.423	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3	HGNC	protein_coding	OTTHUMT00000331409.2	-	0.00	77	0	G	NM_000091		228118856	+1	tier1	-	no_errors	ENST00000396578	ensembl	human	known	74_37	missense	6.98	78	6	SNP	0.980	A
CRYBG3	131544	genome.wustl.edu	37	3	97617998	97617999	+	In_Frame_Ins	INS	-	-	TTT			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:97617998_97617999insTTT	ENST00000182096.4	+	11	2082_2083	c.2018_2019insTTT	c.(2017-2022)caaaag>caTTTaaag	p.673_673Q>HL		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2621							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						GCCTACCAGCAAAAGTTCTTCT	0.327																																																	0																																										SO:0001652	inframe_insertion	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	Exception_encountered	3.37:g.97617998_97617999insTTT	ENSP00000182096:p.Gln673delinsHisLeu		B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	In_Frame_Ins	INS	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.Q673in_frame_insHL	ENST00000182096.4	37	c.2018_2019		3																																																																																			CRYBG3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	ENSG00000080200		0.327	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1		0.00	44	0	-	NM_153605		97617999	+1	tier1		no_errors	ENST00000182096	ensembl	human	known	74_37	in_frame_ins	36.36	56	32	INS	1.000:1.000	TTT
CSE1L	1434	genome.wustl.edu	37	20	47710714	47710714	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr20:47710714G>C	ENST00000262982.2	+	23	2608	c.2485G>C	c.(2485-2487)Gaa>Caa	p.E829Q	CSE1L_ENST00000542325.1_Missense_Mutation_p.E612Q|CSE1L_ENST00000469700.1_3'UTR|CSE1L_ENST00000396192.3_Missense_Mutation_p.E773Q	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	829					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			TATTATTCCTGAAATTCAGAA	0.303																																																	0													53.0	54.0	54.0					20																	47710714		2203	4300	6503	SO:0001583	missense	0			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.2485G>C	20.37:g.47710714G>C	ENSP00000262982:p.Glu829Gln		A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	pfam_CAS_CSE1_C,pfam_Cse1,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.E829Q	ENST00000262982.2	37	c.2485	CCDS13412.1	20	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804853	0.90623	.	.	ENSG00000124207	ENST00000417408;ENST00000262982;ENST00000542325;ENST00000396192	T;T;T	0.48522	0.81;0.81;0.81	5.22	5.22	0.72569	Armadillo-like helical (1);Armadillo-type fold (1);CAS/CSE, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.55625	0.1932	L	0.43757	1.38	0.80722	D	1	P;P;B;B;D	0.53151	0.82;0.91;0.221;0.046;0.958	P;P;B;B;P	0.54174	0.527;0.744;0.309;0.138;0.744	T	0.52026	-0.8630	10	0.39692	T	0.17	-20.3347	19.1636	0.93544	0.0:0.0:1.0:0.0	.	518;612;773;773;829	F5GX54;B4DUC5;A3RLL6;F8W904;P55060	.;.;.;.;XPO2_HUMAN	Q	427;829;612;773	ENSP00000262982:E829Q;ENSP00000446477:E612Q;ENSP00000379495:E773Q	ENSP00000262982:E829Q	E	+	1	0	CSE1L	47144121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.590000	0.87494	0.655000	0.94253	GAA	CSE1L	-	pfam_CAS_CSE1_C,superfamily_ARM-type_fold	ENSG00000124207		0.303	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	-	0.00	100	0	G	NM_001316		47710714	+1	tier1	-	no_errors	ENST00000262982	ensembl	human	known	74_37	missense	38.89	99	63	SNP	1.000	C
CYLD	1540	genome.wustl.edu	37	16	50785664	50785664	+	Silent	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr16:50785664T>C	ENST00000427738.3	+	3	859	c.654T>C	c.(652-654)ggT>ggC	p.G218G	CYLD_ENST00000568704.2_Silent_p.G218G|CYLD_ENST00000566206.1_Silent_p.G218G|CYLD_ENST00000540145.1_Silent_p.G218G|CYLD_ENST00000569418.1_Silent_p.G218G|CYLD_ENST00000398568.2_Silent_p.G218G|CYLD_ENST00000564326.1_Silent_p.G218G|CYLD_ENST00000311559.9_Silent_p.G218G			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	218	Interaction with TRIP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				ATTACGCAGGTCCTGGGGACA	0.413			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																														yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	familial cylindromatosis gene		E	0													130.0	124.0	126.0					16																	50785664		1939	4139	6078	SO:0001819	synonymous_variant	0	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.654T>C	16.37:g.50785664T>C			O94934|Q7L3N6|Q96EH0|Q9NZX9	Silent	SNP	pfam_CAP-Gly_domain,pfam_Peptidase_C19/C67,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain,pfscan_Peptidase_C19/C67	p.G218	ENST00000427738.3	37	c.654	CCDS45482.1	16																																																																																			CYLD	-	superfamily_CAP-Gly_domain	ENSG00000083799		0.413	CYLD-010	KNOWN	basic|CCDS	protein_coding	CYLD	HGNC	protein_coding	OTTHUMT00000422998.2	-	0.00	54	0	T			50785664	+1	tier1	-	no_errors	ENST00000311559	ensembl	human	known	74_37	silent	52.17	21	24	SNP	0.856	C
DCAF12L1	139170	genome.wustl.edu	37	X	125685869	125685869	+	Silent	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chrX:125685869T>C	ENST00000371126.1	-	1	965	c.723A>G	c.(721-723)gtA>gtG	p.V241V		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	241										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						TGTGGGCATATACGGGGAGAC	0.662																																																	0													37.0	37.0	37.0					X																	125685869		2203	4300	6503	SO:0001819	synonymous_variant	0			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.723A>G	X.37:g.125685869T>C			Q8IYK3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V241	ENST00000371126.1	37	c.723	CCDS14610.1	X																																																																																			DCAF12L1	-	superfamily_WD40_repeat_dom	ENSG00000198889		0.662	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	-	0.00	34	0	T	NM_178470		125685869	-1	tier1	-	no_errors	ENST00000371126	ensembl	human	known	74_37	silent	58.18	23	32	SNP	0.120	C
DDX39B	7919	genome.wustl.edu	37	6	31510159	31510159	+	5'UTR	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:31510159G>T	ENST00000396172.1	-	0	66				DDX39B-AS1_ENST00000420520.1_RNA|DDX39B_ENST00000458640.1_5'UTR|ATP6V1G2-DDX39B_ENST00000376185.1_Intron|DDX39B_ENST00000415382.2_5'Flank|DDX39B_ENST00000417556.2_5'UTR|ATP6V1G2_ENST00000483170.1_5'Flank|DDX39B-AS1_ENST00000416684.1_RNA|ATP6V1G2-DDX39B_ENST00000475917.1_5'UTR|DDX39B_ENST00000376177.2_5'Flank|DDX39B_ENST00000449074.2_5'Flank|DDX39B_ENST00000453105.2_5'Flank|SNORD84_ENST00000584275.1_RNA	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B						ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						CGGGGTCCTTGGCCCGGTAGT	0.612																																																	0																																										SO:0001623	5_prime_UTR_variant	0			Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.-565C>A	6.37:g.31510159G>T			B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	RNA	SNP	-	NULL	ENST00000396172.1	37	NULL	CCDS4697.1	6																																																																																			DDX39B-AS1	-	-	ENSG00000234006		0.612	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39B-AS1	HGNC	protein_coding	OTTHUMT00000259083.1	-	0.00	31	0	G	NM_004640		31510159	+1	tier1	-	no_errors	ENST00000416684	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.022	T
DNAH8	1769	genome.wustl.edu	37	6	38891915	38891915	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:38891915T>C	ENST00000359357.3	+	71	10542	c.10288T>C	c.(10288-10290)Tca>Cca	p.S3430P	DNAH8_ENST00000449981.2_Missense_Mutation_p.S3647P|RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000441566.1_Missense_Mutation_p.S3394P|RP1-207H1.3_ENST00000418399.1_RNA			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3430					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GAATCTTATTTCAATGTTGGT	0.358																																																	0													96.0	108.0	104.0					6																	38891915		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.10288T>C	6.37:g.38891915T>C	ENSP00000352312:p.Ser3430Pro		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S3430P	ENST00000359357.3	37	c.10288		6	.	.	.	.	.	.	.	.	.	.	T	14.91	2.675709	0.47781	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.57273	0.41;0.41;0.41	6.06	4.87	0.63330	.	0.204762	0.42294	D	0.000726	T	0.45296	0.1335	M	0.85373	2.75	0.41383	D	0.987562	B	0.20164	0.042	B	0.29440	0.102	T	0.49293	-0.8955	10	0.44086	T	0.13	.	12.3533	0.55161	0.0:0.0:0.3418:0.6582	.	3430	Q96JB1	DYH8_HUMAN	P	3635;3635;3430;3394	ENSP00000333363:S3635P;ENSP00000352312:S3430P;ENSP00000402294:S3394P	ENSP00000333363:S3635P	S	+	1	0	DNAH8	38999893	0.963000	0.33076	1.000000	0.80357	0.992000	0.81027	1.673000	0.37534	1.026000	0.39733	0.533000	0.62120	TCA	DNAH8	-	NULL	ENSG00000124721		0.358	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	-	0.00	79	0	T	NM_001206927		38891915	+1	tier1	-	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	7.69	84	7	SNP	1.000	C
DOCK5	80005	genome.wustl.edu	37	8	25154103	25154103	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr8:25154103C>G	ENST00000276440.7	+	7	589	c.545C>G	c.(544-546)gCc>gGc	p.A182G	DOCK5_ENST00000481100.1_Missense_Mutation_p.A182G	NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	182					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGCACCATTGCCCTCTTCAAG	0.498																																					Pancreas(145;34 1887 3271 10937 30165)												0													100.0	86.0	91.0					8																	25154103		2203	4300	6503	SO:0001583	missense	0				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.545C>G	8.37:g.25154103C>G	ENSP00000276440:p.Ala182Gly		B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.A182G	ENST00000276440.7	37	c.545	CCDS6047.1	8	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624047	0.66901	.	.	ENSG00000147459	ENST00000481100;ENST00000276440	T;T	0.56776	0.44;0.44	5.65	5.65	0.86999	.	0.189771	0.47852	D	0.000207	T	0.39572	0.1083	N	0.08118	0	0.45015	D	0.998033	B	0.19706	0.038	B	0.26614	0.071	T	0.24404	-1.0161	10	0.49607	T	0.09	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	182	Q9H7D0	DOCK5_HUMAN	G	182	ENSP00000429737:A182G;ENSP00000276440:A182G	ENSP00000276440:A182G	A	+	2	0	DOCK5	25210020	1.000000	0.71417	0.986000	0.45419	0.972000	0.66771	4.768000	0.62293	2.941000	0.99782	0.655000	0.94253	GCC	DOCK5	-	NULL	ENSG00000147459		0.498	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2	-	0.00	30	0	C	NM_024940		25154103	+1	tier1	-	no_errors	ENST00000276440	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	G
DPP6	1804	genome.wustl.edu	37	7	154679398	154679398	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr7:154679398C>T	ENST00000377770.3	+	23	2399	c.2258C>T	c.(2257-2259)tCc>tTc	p.S753F	DPP6_ENST00000332007.3_Missense_Mutation_p.S691F|DPP6_ENST00000404039.1_Missense_Mutation_p.S689F|DPP6_ENST00000427557.1_Missense_Mutation_p.S646F			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	753					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TCTGCGTTTTCCGAGAGGTAC	0.587																																					NSCLC(125;1384 1783 2490 7422 34254)												0													210.0	221.0	217.0					7																	154679398		2074	4207	6281	SO:0001583	missense	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.2258C>T	7.37:g.154679398C>T	ENSP00000367001:p.Ser753Phe			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.S753F	ENST00000377770.3	37	c.2258		7	.	.	.	.	.	.	.	.	.	.	C	19.34	3.809561	0.70797	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	4.65	4.65	0.58169	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.59432	0.2193	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;1.0	T	0.67126	-0.5749	10	0.87932	D	0	-22.9507	17.5478	0.87867	0.0:1.0:0.0:0.0	.	646;691;753;689	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	F	689;753;691;646	ENSP00000385578:S689F;ENSP00000367001:S753F;ENSP00000328226:S691F;ENSP00000397303:S646F	ENSP00000328226:S691F	S	+	2	0	DPP6	154310331	1.000000	0.71417	0.568000	0.28447	0.691000	0.40173	6.434000	0.73408	2.126000	0.65437	0.563000	0.77884	TCC	DPP6	-	pfam_Peptidase_S9	ENSG00000130226		0.587	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	-	0.00	24	0	C	NM_130797		154679398	+1	tier1	-	no_errors	ENST00000377770	ensembl	human	known	74_37	missense	35.29	22	12	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56481466	56481466	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:56481466T>A	ENST00000370765.6	-	24	6906	c.6799A>T	c.(6799-6801)Att>Ttt	p.I2267F	DST_ENST00000370788.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000421834.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1609					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGCAGAGCAATTTCTGGAGGA	0.448																																																	0													94.0	96.0	96.0					6																	56481466		2203	4300	6503	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.6799A>T	6.37:g.56481466T>A	ENSP00000359801:p.Ile2267Phe		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.I2267F	ENST00000370765.6	37	c.6799	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	T	10.00	1.233126	0.22626	.	.	ENSG00000151914	ENST00000370765	T	0.73152	-0.72	5.77	0.539	0.17156	.	.	.	.	.	T	0.44307	0.1287	.	.	.	0.18873	N	0.999983	B	0.26258	0.145	B	0.20384	0.029	T	0.24693	-1.0153	7	0.72032	D	0.01	.	12.0841	0.53688	0.0:0.5096:0.0:0.4904	.	2267	Q03001-3	.	F	2267	ENSP00000359801:I2267F	ENSP00000359801:I2267F	I	-	1	0	DST	56589425	0.000000	0.05858	0.007000	0.13788	0.975000	0.68041	-0.836000	0.04382	-0.059000	0.13154	0.528000	0.53228	ATT	DST	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000151914		0.448	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	-	0.00	42	0	T	NM_001723		56481466	-1	tier1	-	no_errors	ENST00000370765	ensembl	human	known	74_37	missense	19.57	37	9	SNP	0.000	A
CRACR2A	84766	genome.wustl.edu	37	12	3788201	3788201	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:3788201C>T	ENST00000252322.1	-	6	872	c.404G>A	c.(403-405)cGc>cAc	p.R135H	EFCAB4B_ENST00000444507.1_Missense_Mutation_p.R135H|EFCAB4B_ENST00000440314.2_Missense_Mutation_p.R135H	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		135					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			CTCTTCATGGCGCTGGGCCAC	0.552																																																	0													176.0	143.0	154.0					12																	3788201		2203	4300	6503	SO:0001583	missense	0																														ENST00000252322.1:c.404G>A	12.37:g.3788201C>T	ENSP00000252322:p.Arg135His		B4E1X0|B9EK63	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_EF_hand_dom,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,pfscan_EF_hand_dom,tigrfam_Small_GTP-bd_dom	p.R135H	ENST00000252322.1	37	c.404	CCDS8522.1	12	.	.	.	.	.	.	.	.	.	.	C	3.826	-0.036680	0.07497	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.61859	0.07;2.52;2.54	4.9	-3.96	0.04106	EF-hand-like domain (1);	0.683858	0.14371	N	0.323805	T	0.27594	0.0678	N	0.11255	0.115	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.06232	-1.0838	10	0.44086	T	0.13	-1.3352	2.5154	0.04667	0.3607:0.147:0.3734:0.1189	.	135;135;135	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	H	135	ENSP00000409382:R135H;ENSP00000412496:R135H;ENSP00000252322:R135H	ENSP00000252322:R135H	R	-	2	0	EFCAB4B	3658462	0.042000	0.20092	0.001000	0.08648	0.013000	0.08279	0.399000	0.20916	-0.668000	0.05296	-0.254000	0.11334	CGC	EFCAB4B	-	NULL	ENSG00000130038		0.552	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	EFCAB4B	HGNC	protein_coding	OTTHUMT00000398673.1		0.00	37	0	C			3788201	-1			no_errors	ENST00000440314	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.000	T
EHBP1	23301	genome.wustl.edu	37	2	63176060	63176060	+	Silent	SNP	C	C	T	rs143884885	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:63176060C>T	ENST00000263991.5	+	14	2666	c.2184C>T	c.(2182-2184)atC>atT	p.I728I	EHBP1_ENST00000405289.1_Silent_p.I693I|EHBP1_ENST00000354487.3_Silent_p.I693I|EHBP1_ENST00000431489.1_Silent_p.I693I|EHBP1_ENST00000405015.3_Silent_p.I693I	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	728						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			CTCTAGACATCGGTAGTAACT	0.348																																																	0								C	,,,	0,4406		0,0,2203	61.0	67.0	65.0		2079,2079,2079,2184	3.8	0.1	2	dbSNP_134	65	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	EHBP1	NM_001142614.1,NM_001142615.2,NM_001142616.1,NM_015252.3	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	693/1197,693/1161,693/1161,728/1232	63176060	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.2184C>T	2.37:g.63176060C>T			O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Silent	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.I728	ENST00000263991.5	37	c.2184	CCDS1872.1	2																																																																																			EHBP1	-	NULL	ENSG00000115504		0.348	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	-	0.00	54	0	C	NM_015252		63176060	+1	tier1	rs143884885	no_errors	ENST00000263991	ensembl	human	known	74_37	silent	32.76	39	19	SNP	0.069	T
EMILIN2	84034	genome.wustl.edu	37	18	2891551	2891551	+	Missense_Mutation	SNP	C	C	T	rs546388595	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr18:2891551C>T	ENST00000254528.3	+	4	1585	c.1426C>T	c.(1426-1428)Cgg>Tgg	p.R476W		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	476					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.R476W(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GGAAACCCTTCGGGGCGCCAT	0.463													C|||	3	0.000599042	0.0	0.0014	5008	,	,		21889	0.0		0.0	False		,,,				2504	0.002																1	Substitution - Missense(1)	large_intestine(1)											87.0	96.0	93.0					18																	2891551		2203	4300	6503	SO:0001583	missense	0			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.1426C>T	18.37:g.2891551C>T	ENSP00000254528:p.Arg476Trp		B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	pfam_EMI_domain,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,pfscan_EMI_domain	p.R476W	ENST00000254528.3	37	c.1426	CCDS11828.1	18	.	.	.	.	.	.	.	.	.	.	C	15.33	2.801904	0.50315	.	.	ENSG00000132205	ENST00000254528	T	0.03689	3.84	5.4	4.52	0.55395	.	0.000000	0.64402	D	0.000007	T	0.14614	0.0353	M	0.62723	1.935	0.21527	N	0.999655	D	0.89917	1.0	D	0.76575	0.988	T	0.01935	-1.1244	10	0.54805	T	0.06	-39.8923	13.2759	0.60188	0.2884:0.7116:0.0:0.0	.	476	Q9BXX0	EMIL2_HUMAN	W	476	ENSP00000254528:R476W	ENSP00000254528:R476W	R	+	1	2	EMILIN2	2881551	0.045000	0.20229	0.866000	0.34008	0.642000	0.38348	0.473000	0.22132	1.242000	0.43836	0.563000	0.77884	CGG	EMILIN2	-	NULL	ENSG00000132205		0.463	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN2	HGNC	protein_coding	OTTHUMT00000250337.2		0.00	21	0	C	NM_032048		2891551	+1			no_errors	ENST00000254528	ensembl	human	known	74_37	missense	10.00	18	2	SNP	0.235	T
SMG1P4	100507526	genome.wustl.edu	37	16	21916139	21916139	+	IGR	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr16:21916139C>G								snoU13 (15148 upstream) : UQCRC2 (47841 downstream)																							TGATTATATTCAAAGGAGCAG	0.408																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.21916139C>G				RNA	SNP	-	NULL		37	NULL		16																																																																																			RP11-645C24.2	-	-	ENSG00000185710	0	0.408					ENSG00000185710	Clone_based_vega_gene			-	0.00	23	0	C			21916139	-1	tier1	-	no_errors	ENST00000517529	ensembl	human	known	74_37	rna	33.33	30	15	SNP	0.236	G
RP11-764K9.1	0	genome.wustl.edu	37	9	68400407	68400407	+	lincRNA	SNP	A	A	G	rs199879074		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr9:68400407A>G	ENST00000417843.2	-	0	1412																											GGCCACTCTCACCCTGCTTAT	0.532																																																	0																																												0																															9.37:g.68400407A>G				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.532	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	15	0	A			68400407	-1	tier1	rs199879074	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	33.33	8	4	SNP	0.035	G
MIER3	166968	genome.wustl.edu	37	5	56224783	56224784	+	Intron	DEL	CT	CT	-	rs370942198|rs150959650|rs150635397	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:56224783_56224784delCT	ENST00000381199.3	-	10	840				CTD-2310F14.1_ENST00000606813.1_RNA|MIER3_ENST00000409421.1_Intron|MIER3_ENST00000381226.3_Intron|MIER3_ENST00000381213.3_Intron			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		AGGTCACAAActctctctctct	0.376																																																	0																																										SO:0001627	intron_variant	0			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.830-95AG>-	5.37:g.56224793_56224794delCT			B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	RNA	DEL	-	NULL	ENST00000381199.3	37	NULL		5																																																																																			CTD-2310F14.1	-	-	ENSG00000271828		0.376	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	ENSG00000271828	Clone_based_vega_gene	protein_coding	OTTHUMT00000132523.2		0.00	11	0	CT	NM_152622		56224784	+1	tier1		no_errors	ENST00000606813	ensembl	human	known	74_37	rna	50.00	2	2	DEL	0.011:0.009	-
AGBL5	60509	genome.wustl.edu	37	2	27276520	27276520	+	Intron	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:27276520T>C	ENST00000360131.4	+	3	546				RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Intron	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5						protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTTCCTTGATACAAGTATGA	0.458																																																	0																																										SO:0001627	intron_variant	0			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.387+79T>C	2.37:g.27276520T>C			A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	RNA	SNP	-	NULL	ENST00000360131.4	37	NULL	CCDS1732.3	2																																																																																			RP11-503P10.1	-	-	ENSG00000272056		0.458	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000272056	Clone_based_vega_gene	protein_coding	OTTHUMT00000309033.1	-	0.00	13	0	T	NM_021831		27276520	-1	tier1	-	no_errors	ENST00000607407	ensembl	human	known	74_37	rna	38.46	8	5	SNP	0.000	C
FAIM	55179	genome.wustl.edu	37	3	138340279	138340279	+	Silent	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:138340279T>C	ENST00000393035.2	+	2	118	c.9T>C	c.(7-9)gaT>gaC	p.D3D	FAIM_ENST00000464668.1_Silent_p.D3D|FAIM_ENST00000360570.3_Silent_p.D25D|FAIM_ENST00000393034.2_Silent_p.D3D|FAIM_ENST00000338446.4_Silent_p.D37D	NM_001033032.1	NP_001028204.1	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule	3					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)	cytoplasm (GO:0005737)				kidney(1)|upper_aerodigestive_tract(1)	2						AAATGACAGATCTCGTAGCTG	0.368																																																	0													125.0	124.0	125.0					3																	138340279		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001444	CCDS3103.1, CCDS33864.1, CCDS33865.1	3q23	2008-07-18			ENSG00000158234	ENSG00000158234			18703	protein-coding gene	gene with protein product						10075978	Standard	NM_018147		Approved	FLJ10582, FAIM1	uc003esq.3	Q9NVQ4	OTTHUMG00000159885	ENST00000393035.2:c.9T>C	3.37:g.138340279T>C			Q6IAN2	Silent	SNP	pfam_FAIM	p.D37	ENST00000393035.2	37	c.111	CCDS3103.1	3																																																																																			FAIM	-	pfam_FAIM	ENSG00000158234		0.368	FAIM-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAIM	HGNC	protein_coding	OTTHUMT00000357979.1	-	0.00	64	0	T	NM_001033032		138340279	+1	tier1	-	no_errors	ENST00000338446	ensembl	human	known	74_37	silent	33.33	60	30	SNP	0.982	C
FAM46B	115572	genome.wustl.edu	37	1	27333125	27333125	+	Silent	SNP	G	G	A	rs143879440		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:27333125G>A	ENST00000289166.5	-	2	753	c.588C>T	c.(586-588)agC>agT	p.S196S		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	196										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		CGTTCTTGCCGCTCTTGTTGG	0.532																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	136.0	130.0	132.0		588	-2.5	0.9	1	dbSNP_134	132	0,8600		0,0,4300	no	coding-synonymous	FAM46B	NM_052943.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		196/426	27333125	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.588C>T	1.37:g.27333125G>A				Silent	SNP	pfam_DUF1693	p.S196	ENST00000289166.5	37	c.588	CCDS294.2	1																																																																																			FAM46B	-	pfam_DUF1693	ENSG00000158246		0.532	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM46B	HGNC	protein_coding	OTTHUMT00000012347.2	-	0.00	22	0	G	NM_052943		27333125	-1	tier1	rs143879440	no_errors	ENST00000289166	ensembl	human	known	74_37	silent	41.18	10	7	SNP	0.741	A
FKBP5	2289	genome.wustl.edu	37	6	35588005	35588005	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:35588005T>A	ENST00000539068.1	-	4	499	c.297A>T	c.(295-297)aaA>aaT	p.K99N	FKBP5_ENST00000540787.1_Intron|FKBP5_ENST00000542713.1_Missense_Mutation_p.K99N|FKBP5_ENST00000536438.1_Missense_Mutation_p.K99N|FKBP5_ENST00000357266.4_Missense_Mutation_p.K99N	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	99	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						ATATCTCTCCTTTCTTCATGG	0.428																																																	0													164.0	135.0	145.0					6																	35588005		2203	4300	6503	SO:0001583	missense	0			U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.297A>T	6.37:g.35588005T>A	ENSP00000441205:p.Lys99Asn		F5H7R1|Q59EB8|Q5TGM6	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.K99N	ENST00000539068.1	37	c.297	CCDS4808.1	6	.	.	.	.	.	.	.	.	.	.	T	21.2	4.113170	0.77210	.	.	ENSG00000096060	ENST00000536438;ENST00000357266;ENST00000539068;ENST00000337746;ENST00000543400;ENST00000542713;ENST00000373875	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.75	2.18	0.27775	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.159876	0.53938	D	0.000046	T	0.53883	0.1824	M	0.87758	2.905	0.52501	D	0.999959	P;D	0.56746	0.953;0.977	P;P	0.55508	0.777;0.749	T	0.58008	-0.7712	10	0.52906	T	0.07	-4.2287	5.5088	0.16868	0.122:0.2414:0.0:0.6367	.	99;99	F5H7R1;Q13451	.;FKBP5_HUMAN	N	99;99;99;99;62;99;97	ENSP00000444810:K99N;ENSP00000349811:K99N;ENSP00000441205:K99N;ENSP00000442340:K99N	ENSP00000338160:K99N	K	-	3	2	FKBP5	35695983	0.950000	0.32346	1.000000	0.80357	0.991000	0.79684	0.001000	0.13038	0.998000	0.38996	0.528000	0.53228	AAA	FKBP5	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	ENSG00000096060		0.428	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP5	HGNC	protein_coding	OTTHUMT00000040309.2	-	0.00	62	0	T			35588005	-1	tier1	-	no_errors	ENST00000357266	ensembl	human	known	74_37	missense	35.63	56	31	SNP	0.994	A
FLT4	2324	genome.wustl.edu	37	5	180038364	180038364	+	Missense_Mutation	SNP	G	G	T	rs201698561		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:180038364G>T	ENST00000261937.6	-	27	3731	c.3653C>A	c.(3652-3654)cCg>cAg	p.P1218Q	FLT4_ENST00000502649.1_Missense_Mutation_p.P1218Q|FLT4_ENST00000393347.3_Missense_Mutation_p.P1218Q	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1218					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGGCTTGGCGGGCTGTCCTC	0.637																																					Colon(97;1075 1466 27033 27547 35871)												0													70.0	74.0	73.0					5																	180038364		2203	4300	6503	SO:0001583	missense	0			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3653C>A	5.37:g.180038364G>T	ENSP00000261937:p.Pro1218Gln		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR3_rcpt	p.P1218Q	ENST00000261937.6	37	c.3653	CCDS4457.1	5	.	.	.	.	.	.	.	.	.	.	G	7.857	0.725169	0.15439	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649	T;T;T	0.76060	-0.99;-0.98;-0.98	3.95	3.05	0.35203	.	.	.	.	.	T	0.52948	0.1766	N	0.08118	0	0.43191	D	0.995023	B;B	0.14805	0.011;0.011	B;B	0.15870	0.006;0.014	T	0.51220	-0.8733	9	0.54805	T	0.06	.	8.8433	0.35155	0.0:0.0:0.7763:0.2237	.	1218;1218	E9PD35;P35916	.;VGFR3_HUMAN	Q	1218	ENSP00000261937:P1218Q;ENSP00000377016:P1218Q;ENSP00000426057:P1218Q	ENSP00000261937:P1218Q	P	-	2	0	FLT4	179970970	0.843000	0.29541	0.776000	0.31678	0.035000	0.12851	0.999000	0.29757	1.202000	0.43218	0.555000	0.69702	CCG	FLT4	-	NULL	ENSG00000037280		0.637	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4	-	0.00	45	0	G			180038364	-1	tier1	-	no_errors	ENST00000261937	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.828	T
FRMD4B	23150	genome.wustl.edu	37	3	69230096	69230096	+	Silent	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:69230096C>G	ENST00000398540.3	-	21	2888	c.2805G>C	c.(2803-2805)ctG>ctC	p.L935L	FRMD4B_ENST00000542259.1_Silent_p.L881L|FRMD4B_ENST00000478263.1_Silent_p.L587L	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	935					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		AAGGTACTTGCAGCCCCGCAA	0.532																																																	0													88.0	85.0	86.0					3																	69230096		1992	4159	6151	SO:0001819	synonymous_variant	0			AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2805G>C	3.37:g.69230096C>G			Q8TAI3	Silent	SNP	pfam_DUF3338,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.L935	ENST00000398540.3	37	c.2805	CCDS46863.1	3																																																																																			FRMD4B	-	NULL	ENSG00000114541		0.532	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD4B	HGNC	protein_coding	OTTHUMT00000352111.1		0.00	10	0	C			69230096	-1			no_errors	ENST00000398540	ensembl	human	known	74_37	silent	41.67	7	5	SNP	1.000	G
GAS7	8522	genome.wustl.edu	37	17	9821406	9821406	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr17:9821406C>A	ENST00000432992.2	-	13	1389	c.1229G>T	c.(1228-1230)cGg>cTg	p.R410L	GAS7_ENST00000583882.1_Intron|GAS7_ENST00000540214.1_Missense_Mutation_p.R115L|GAS7_ENST00000579158.1_Missense_Mutation_p.R346L|GAS7_ENST00000542249.1_Missense_Mutation_p.R346L|GAS7_ENST00000437099.2_Missense_Mutation_p.R346L|GAS7_ENST00000580865.1_Missense_Mutation_p.R270L|GAS7_ENST00000585266.1_Missense_Mutation_p.R350L|GAS7_ENST00000323816.4_Missense_Mutation_p.R350L|GAS7_ENST00000396115.2_Missense_Mutation_p.R115L	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	410					actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						CACCTCCAGCCGCTCTAGCTC	0.582			T	MLL	AML*																																			Dom	yes		17	17p	8522	growth arrest-specific 7		L	0													59.0	51.0	54.0					17																	9821406		2203	4300	6503	SO:0001583	missense	0			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.1229G>T	17.37:g.9821406C>A	ENSP00000407552:p.Arg410Leu		A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	pfam_FCH_dom,pfam_WW_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_WW_dom,smart_SH3_domain,smart_WW_dom,smart_FCH_dom,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_WW_dom	p.R410L	ENST00000432992.2	37	c.1229	CCDS11152.1	17	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928144	0.73327	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000540214;ENST00000537970;ENST00000542249;ENST00000541114	T;T	0.42131	0.98;0.98	5.08	5.08	0.68730	.	0.127287	0.47455	D	0.000224	T	0.35998	0.0951	L	0.27053	0.805	0.54753	D	0.999984	B;P;B;D	0.54207	0.09;0.826;0.031;0.965	B;B;B;P	0.45071	0.031;0.247;0.017;0.468	T	0.06445	-1.0826	9	.	.	.	2.5616	17.4073	0.87477	0.0:1.0:0.0:0.0	.	362;350;270;410	B7Z2L1;A8KAC2;O60861-2;O60861	.;.;.;GAS7_HUMAN	L	410;350;349;270;115;350;59;224	ENSP00000379421:R350L;ENSP00000446214:R115L	.	R	-	2	0	GAS7	9762131	0.998000	0.40836	1.000000	0.80357	0.965000	0.64279	3.150000	0.50662	2.652000	0.90054	0.655000	0.94253	CGG	GAS7	-	NULL	ENSG00000007237		0.582	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS7	HGNC	protein_coding	OTTHUMT00000439883.1	-	0.00	27	0	C	NM_003644, NM_201432, NM_201433		9821406	-1	tier1	-	no_errors	ENST00000432992	ensembl	human	known	74_37	missense	38.46	16	10	SNP	1.000	A
GDPGP1	390637	genome.wustl.edu	37	15	90784897	90784897	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr15:90784897C>T	ENST00000558017.1	+	4	1177	c.757C>T	c.(757-759)Cct>Tct	p.P253S	GDPGP1_ENST00000329600.6_Missense_Mutation_p.P253S	NM_001013657.2	NP_001013679.2	Q6ZNW5	GDPP1_HUMAN	GDP-D-glucose phosphorylase 1	253					glucose metabolic process (GO:0006006)	cytoplasm (GO:0005737)	GDP-D-glucose phosphorylase activity (GO:0080048)|guanyl-nucleotide exchange factor activity (GO:0005085)|hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)|nucleotidyltransferase activity (GO:0016779)										CCTCCCAGCTCCTGGCTTCCT	0.592																																																	0													58.0	51.0	54.0					15																	90784897		2199	4298	6497	SO:0001583	missense	0				CCDS32327.1	15q26.1	2012-05-04	2012-05-04	2012-05-04	ENSG00000183208	ENSG00000183208	2.7.7.78		34360	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 58"""	C15orf58		21507950	Standard	NM_001013657		Approved		uc002bpc.3	Q6ZNW5		ENST00000558017.1:c.757C>T	15.37:g.90784897C>T	ENSP00000452793:p.Pro253Ser			Missense_Mutation	SNP	NULL	p.P253S	ENST00000558017.1	37	c.757	CCDS32327.1	15	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263383	0.59431	.	.	ENSG00000183208	ENST00000329600	T	0.21932	1.98	5.95	5.95	0.96441	.	0.000000	0.56097	D	0.000023	T	0.41994	0.1183	L	0.47190	1.495	0.54753	D	0.99998	D	0.89917	1.0	D	0.91635	0.999	T	0.01626	-1.1309	10	0.36615	T	0.2	-11.7228	18.957	0.92662	0.0:1.0:0.0:0.0	.	253	Q6ZNW5	VTC2_HUMAN	S	253	ENSP00000368405:P253S	ENSP00000368405:P253S	P	+	1	0	C15orf58	88585901	0.844000	0.29557	0.883000	0.34634	0.185000	0.23345	4.791000	0.62460	2.824000	0.97209	0.655000	0.94253	CCT	GDPGP1	-	NULL	ENSG00000183208		0.592	GDPGP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPGP1	HGNC	protein_coding	OTTHUMT00000416973.1	-	0.00	21	0	C	NM_001013657		90784897	+1	tier1	-	no_errors	ENST00000329600	ensembl	human	known	74_37	missense	53.85	30	35	SNP	0.986	T
GHR	2690	genome.wustl.edu	37	5	42719156	42719156	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:42719156T>C	ENST00000230882.4	+	10	1737	c.1547T>C	c.(1546-1548)aTg>aCg	p.M516T	GHR_ENST00000357703.3_Missense_Mutation_p.M494T|GHR_ENST00000537449.1_Missense_Mutation_p.M329T	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	516					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CAATGTGACATGCACCCGGAA	0.507																																																	0													80.0	74.0	76.0					5																	42719156		2203	4300	6503	SO:0001583	missense	0				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.1547T>C	5.37:g.42719156T>C	ENSP00000230882:p.Met516Thr		Q9HCX2	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.M516T	ENST00000230882.4	37	c.1547	CCDS3940.1	5	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.243866	0.00271	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000537449	T;T;T	0.34275	1.37;1.37;1.37	6.08	-10.4	0.00318	.	1.255480	0.04695	N	0.414928	T	0.18882	0.0453	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.31503	-0.9941	10	0.11485	T	0.65	2.6637	14.4112	0.67115	0.0:0.6605:0.1818:0.1577	.	516	P10912	GHR_HUMAN	T	516;494;329	ENSP00000230882:M516T;ENSP00000350335:M494T;ENSP00000442206:M329T	ENSP00000230882:M516T	M	+	2	0	GHR	42754913	0.000000	0.05858	0.000000	0.03702	0.322000	0.28314	-2.441000	0.01015	-1.369000	0.02147	-0.326000	0.08463	ATG	GHR	-	NULL	ENSG00000112964		0.507	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHR	HGNC	protein_coding	OTTHUMT00000211605.2	-	0.00	63	0	T	NM_000163		42719156	+1	tier1	-	no_errors	ENST00000230882	ensembl	human	known	74_37	missense	19.09	89	21	SNP	0.000	C
GIN1	54826	genome.wustl.edu	37	5	102444392	102444392	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:102444392T>C	ENST00000399004.2	-	2	114	c.20A>G	c.(19-21)aAt>aGt	p.N7S	GIN1_ENST00000508629.1_Missense_Mutation_p.N7S	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	7					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		AAGGTCACCATTTTTTCCACT	0.348																																																	0													141.0	128.0	132.0					5																	102444392		1836	4091	5927	SO:0001583	missense	0			BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.20A>G	5.37:g.102444392T>C	ENSP00000381970:p.Asn7Ser		B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	pfam_Integrase_cat-core,pfam_Znf_H2C2_histone_UAS-bd,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.N7S	ENST00000399004.2	37	c.20	CCDS43349.1	5	.	.	.	.	.	.	.	.	.	.	T	12.71	2.019322	0.35606	.	.	ENSG00000145723	ENST00000399004;ENST00000508629	T;T	0.23552	2.0;1.9	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000007	T	0.12433	0.0302	N	0.08118	0	0.37144	D	0.901859	B;P	0.38535	0.15;0.635	B;B	0.32090	0.046;0.14	T	0.19976	-1.0289	10	0.44086	T	0.13	-13.0006	11.0833	0.48072	0.0:0.0713:0.0:0.9287	.	7;7	Q9NXP7-3;Q9NXP7	.;GIN1_HUMAN	S	7	ENSP00000381970:N7S;ENSP00000427162:N7S	ENSP00000381970:N7S	N	-	2	0	GIN1	102472291	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.326000	0.43849	2.323000	0.78572	0.528000	0.53228	AAT	GIN1	-	NULL	ENSG00000145723		0.348	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIN1	HGNC	protein_coding	OTTHUMT00000370478.3	-	0.00	83	0	T	NM_017676		102444392	-1	tier1	-	no_errors	ENST00000399004	ensembl	human	known	74_37	missense	40.26	46	31	SNP	1.000	C
GJD4	219770	genome.wustl.edu	37	10	35897253	35897253	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr10:35897253G>T	ENST00000321660.1	+	2	970	c.812G>T	c.(811-813)gGa>gTa	p.G271V	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	271			G -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GCACGCGCCGGAGGGGAGGGG	0.701																																																	0													8.0	9.0	9.0					10																	35897253		2098	4139	6237	SO:0001583	missense	0			AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.812G>T	10.37:g.35897253G>T	ENSP00000315070:p.Gly271Val		Q8N2R7	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.G271V	ENST00000321660.1	37	c.812	CCDS7191.1	10	.	.	.	.	.	.	.	.	.	.	G	10.47	1.357866	0.24598	.	.	ENSG00000177291	ENST00000321660	D	0.97598	-4.45	5.34	-3.72	0.04411	.	10.820200	0.00166	N	0.000000	D	0.91764	0.7395	N	0.19112	0.55	0.09310	N	1	B	0.27625	0.183	B	0.22386	0.039	D	0.87038	0.2139	10	0.13108	T	0.6	.	9.0535	0.36392	0.2215:0.5217:0.2568:0.0	.	271	Q96KN9	CXD4_HUMAN	V	271	ENSP00000315070:G271V	ENSP00000315070:G271V	G	+	2	0	GJD4	35937259	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.414000	0.21164	-0.612000	0.05701	-0.938000	0.02693	GGA	GJD4	-	NULL	ENSG00000177291		0.701	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD4	HGNC	protein_coding	OTTHUMT00000047576.1	-	0.00	68	0	G	NM_153368		35897253	+1	tier1	-	no_errors	ENST00000321660	ensembl	human	known	74_37	missense	5.45	104	6	SNP	0.000	T
GLIS3	169792	genome.wustl.edu	37	9	3932889	3932890	+	Intron	INS	-	-	A	rs144551597	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr9:3932889_3932890insA	ENST00000324333.10	-	5	1601				GLIS3_ENST00000381971.3_Intron|GLIS3_ENST00000461870.1_Intron	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		AGAAAGTCCAGAAAAAAACTGG	0.342																																																	0																																										SO:0001627	intron_variant	0			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1408-419->T	9.37:g.3932896_3932896dupA			B1AL19|Q1PHK5	RNA	INS	-	NULL	ENST00000324333.10	37	NULL	CCDS6451.1	9																																																																																			GLIS3	-	-	ENSG00000107249		0.342	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000051559.1		0.00	83	0	-	NM_152629		3932890	-1	tier1		no_errors	ENST00000464391	ensembl	human	known	74_37	rna	20.29	55	14	INS	1.000:1.000	A
GOLGA5	9950	genome.wustl.edu	37	14	93299494	93299494	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr14:93299494A>T	ENST00000163416.2	+	10	2003	c.1747A>T	c.(1747-1749)Agt>Tgt	p.S583C	GOLGA5_ENST00000355976.2_Missense_Mutation_p.S583C	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	583					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		AAGCAATAGCAGTCAGTCTGA	0.378			T	RET	papillary thyroid																																			Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	0													84.0	87.0	86.0					14																	93299494		2203	4300	6503	SO:0001583	missense	0			AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.1747A>T	14.37:g.93299494A>T	ENSP00000163416:p.Ser583Cys		C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Missense_Mutation	SNP	pfam_Golgin_subfamily_A_member_5,superfamily_Prefoldin	p.S583C	ENST00000163416.2	37	c.1747	CCDS9905.1	14	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289972	0.80914	.	.	ENSG00000066455	ENST00000163416;ENST00000355976;ENST00000439315	T;T	0.52983	0.64;0.64	5.66	5.66	0.87406	.	0.000000	0.56097	D	0.000033	T	0.68421	0.2999	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.71642	-0.4531	10	0.66056	D	0.02	-15.7776	15.8997	0.79362	1.0:0.0:0.0:0.0	.	583	Q8TBA6	GOGA5_HUMAN	C	583;583;492	ENSP00000163416:S583C;ENSP00000348252:S583C	ENSP00000163416:S583C	S	+	1	0	GOLGA5	92369247	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.470000	0.80973	2.157000	0.67596	0.482000	0.46254	AGT	GOLGA5	-	pfam_Golgin_subfamily_A_member_5	ENSG00000066455		0.378	GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA5	HGNC	protein_coding	OTTHUMT00000412365.1	-	0.00	57	0	A			93299494	+1	tier1	-	no_errors	ENST00000163416	ensembl	human	known	74_37	missense	51.85	39	42	SNP	1.000	T
GPR161	23432	genome.wustl.edu	37	1	168066315	168066315	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:168066315A>G	ENST00000367838.1	-	5	843	c.530T>C	c.(529-531)aTg>aCg	p.M177T	GPR161_ENST00000546300.1_Missense_Mutation_p.M63T|GPR161_ENST00000271357.5_Missense_Mutation_p.M177T|GPR161_ENST00000367836.1_Missense_Mutation_p.M45T|GPR161_ENST00000537209.1_Missense_Mutation_p.M197T|GPR161_ENST00000367835.1_Missense_Mutation_p.M177T|GPR161_ENST00000361697.2_Missense_Mutation_p.M177T|GPR161_ENST00000539777.1_Missense_Mutation_p.M99T	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	177					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					AGCCACACACATCCATTTGAA	0.572																																																	0													76.0	60.0	66.0					1																	168066315		2203	4300	6503	SO:0001583	missense	0			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.530T>C	1.37:g.168066315A>G	ENSP00000356812:p.Met177Thr		B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.M197T	ENST00000367838.1	37	c.590	CCDS1268.1	1	.	.	.	.	.	.	.	.	.	.	A	7.365	0.625557	0.14257	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.085098	0.85682	D	0.000000	T	0.08088	0.0202	N	0.05124	-0.11	0.37617	D	0.921179	B;B;B;B;B;B	0.15930	0.012;0.01;0.008;0.015;0.001;0.01	B;B;B;B;B;B	0.15484	0.007;0.006;0.01;0.013;0.001;0.009	T	0.13045	-1.0524	9	0.13853	T	0.58	-44.6134	14.7693	0.69662	1.0:0.0:0.0:0.0	.	197;63;99;197;177;177	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;.;.;GP161_HUMAN	T	177;177;45;177;63;99;197;177	ENSP00000356812:M177T;ENSP00000271357:M177T;ENSP00000356810:M45T;ENSP00000356809:M177T;ENSP00000444348:M63T;ENSP00000437576:M99T;ENSP00000441039:M197T;ENSP00000355194:M177T	ENSP00000271357:M177T	M	-	2	0	GPR161	166332939	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.869000	0.63028	2.041000	0.60428	0.459000	0.35465	ATG	GPR161	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000143147		0.572	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR161	HGNC	protein_coding	OTTHUMT00000083829.1	-	0.00	23	0	A	NM_007369		168066315	-1	tier1	-	no_errors	ENST00000537209	ensembl	human	known	74_37	missense	16.13	26	5	SNP	1.000	G
GRIN2D	2906	genome.wustl.edu	37	19	48922912	48922912	+	Silent	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:48922912G>A	ENST00000263269.3	+	9	2020	c.1932G>A	c.(1930-1932)tcG>tcA	p.S644S		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	644					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCAATAATTCGGTGCCCGTGG	0.607																																																	0													82.0	78.0	79.0					19																	48922912		2203	4300	6503	SO:0001819	synonymous_variant	0			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1932G>A	19.37:g.48922912G>A				Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S644	ENST00000263269.3	37	c.1932	CCDS12719.1	19																																																																																			GRIN2D	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000105464		0.607	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2D	HGNC	protein_coding	OTTHUMT00000466121.1	-	0.00	44	0	G			48922912	+1	tier1	-	no_errors	ENST00000263269	ensembl	human	known	74_37	silent	17.24	48	10	SNP	0.045	A
HELB	92797	genome.wustl.edu	37	12	66703557	66703557	+	Silent	SNP	T	T	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:66703557T>G	ENST00000247815.4	+	4	908	c.849T>G	c.(847-849)ctT>ctG	p.L283L		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	283					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		GTGAGTCTCTTCTCCAGCTGA	0.393																																																	0													162.0	160.0	161.0					12																	66703557		2203	4300	6503	SO:0001819	synonymous_variant	0			AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.849T>G	12.37:g.66703557T>G			A8K4C9|Q4G0T2|Q9H7L5	Silent	SNP	superfamily_P-loop_NTPase	p.L283	ENST00000247815.4	37	c.849	CCDS8976.1	12																																																																																			HELB	-	NULL	ENSG00000127311		0.393	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELB	HGNC	protein_coding	OTTHUMT00000401919.1	-	0.00	52	0	T			66703557	+1	tier1	-	no_errors	ENST00000247815	ensembl	human	known	74_37	silent	33.33	54	27	SNP	0.013	G
HLA-B	3106	genome.wustl.edu	37	6	31324886	31324887	+	Frame_Shift_Ins	INS	-	-	C	rs1131165	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:31324886_31324887insC	ENST00000412585.2	-	1	77_78	c.49_50insG	c.(49-51)ctgfs	p.L17fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	17			L -> V (in dbSNP:rs1131165).		antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GGTCAGGGCCAGGGCCGCCGAG	0.703									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0																																										SO:0001589	frameshift_variant	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.49_50insG	6.37:g.31324886_31324887insC	ENSP00000399168:p.Leu17fs		Q29764	Frame_Shift_Ins	INS	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.L17fs	ENST00000412585.2	37	c.50_49	CCDS34394.1	6																																																																																			HLA-B	-	NULL	ENSG00000234745		0.703	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4		0.00	19	0	-	NM_005514		31324887	-1	tier1		no_errors	ENST00000412585	ensembl	human	known	74_37	frame_shift_ins	25.00	18	6	INS	0.408:0.332	C
HMGB4	127540	genome.wustl.edu	37	1	34329981	34329981	+	Silent	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:34329981G>C	ENST00000522796.1	+	4	2094	c.189G>C	c.(187-189)ctG>ctC	p.L63L	HMGB4_ENST00000519684.1_Silent_p.L63L|CSMD2_ENST00000373381.4_Intron|HMGB4_ENST00000425537.1_3'UTR			Q8WW32	HMGB4_HUMAN	high mobility group box 4	63						chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				ATGAAGCCCTGGCCAAACTCG	0.463																																																	0													121.0	137.0	132.0					1																	34329981		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS30668.1	1p35.1	2011-07-01	2011-04-05		ENSG00000176256	ENSG00000176256		"""High-mobility group / Canonical"""	24954	protein-coding gene	gene with protein product			"""high-mobility group box 4"""				Standard	NR_033264		Approved	FLJ40388	uc001bxp.3	Q8WW32	OTTHUMG00000013143	ENST00000522796.1:c.189G>C	1.37:g.34329981G>C			B2R4X7|Q0QWA4	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.L63	ENST00000522796.1	37	c.189	CCDS30668.1	1																																																																																			HMGB4	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000176256		0.463	HMGB4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	HMGB4	HGNC	protein_coding	OTTHUMT00000375773.1	-	0.00	46	0	G	NM_145205		34329981	+1	tier1	-	no_errors	ENST00000519684	ensembl	human	known	74_37	silent	36.84	24	14	SNP	0.985	C
ICA1	3382	genome.wustl.edu	37	7	8260925	8260925	+	Silent	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr7:8260925G>C	ENST00000402384.3	-	5	626	c.360C>G	c.(358-360)ctC>ctG	p.L120L	ICA1_ENST00000476942.1_5'Flank|ICA1_ENST00000265577.7_Silent_p.L119L|ICA1_ENST00000422063.2_Silent_p.L120L|ICA1_ENST00000407906.1_Silent_p.L120L|ICA1_ENST00000401396.1_Silent_p.L108L|ICA1_ENST00000396675.3_Silent_p.L120L|ICA1_ENST00000406470.2_Silent_p.L120L			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	120	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		AAGAAAAGCAGAGGGCCTTTC	0.493																																																	0													128.0	118.0	121.0					7																	8260925		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.360C>G	7.37:g.8260925G>C			A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Silent	SNP	pfam_AH_dom,pfam_Islet_autoAg_Ica1_C,pfscan_AH_dom	p.L120	ENST00000402384.3	37	c.360	CCDS34602.1	7																																																																																			ICA1	-	pfam_AH_dom,pfscan_AH_dom	ENSG00000003147		0.493	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ICA1	HGNC	protein_coding	OTTHUMT00000324793.1	-	0.00	63	0	G	NM_004968		8260925	-1	tier1	-	no_errors	ENST00000422063	ensembl	human	known	74_37	silent	44.68	26	21	SNP	0.987	C
IFI16	3428	genome.wustl.edu	37	1	159024625	159024625	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:159024625G>T	ENST00000295809.7	+	12	2547	c.2292G>T	c.(2290-2292)agG>agT	p.R764S	IFI16_ENST00000359709.3_Missense_Mutation_p.R708S|IFI16_ENST00000448393.2_Missense_Mutation_p.R652S|IFI16_ENST00000368131.4_Missense_Mutation_p.R708S|IFI16_ENST00000368132.3_Missense_Mutation_p.R708S|IFI16_ENST00000430894.2_Missense_Mutation_p.R712S|IFI16_ENST00000340979.6_Missense_Mutation_p.R652S			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	764	Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TCAAGACCAGGAAAAACAAGA	0.393																																																	0													95.0	90.0	92.0					1																	159024625		2201	4300	6501	SO:0001583	missense	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.2292G>T	1.37:g.159024625G>T	ENSP00000295809:p.Arg764Ser		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.R764S	ENST00000295809.7	37	c.2292		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.87|14.87	2.664831|2.664831	0.47572|0.47572	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000448393|ENST00000359709;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	.|T;T;T;T;T	.|0.04809	.|3.58;3.61;3.6;3.6;3.55	3.88|3.88	2.96|2.96	0.34315|0.34315	.|.	.|.	.|.	.|.	.|.	T|T	0.02848|0.02848	0.0085|0.0085	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	.|D;D;D	.|0.63880	.|0.977;0.964;0.993	.|P;P;P	.|0.62491	.|0.713;0.66;0.903	T|T	0.48375|0.48375	-0.9041|-0.9041	5|9	.|0.28530	.|T	.|0.3	.|.	7.7684|7.7684	0.28993|0.28993	0.1172:0.0:0.8828:0.0|0.1172:0.0:0.8828:0.0	.|.	.|712;652;708	.|E7EPR3;Q16666-3;Q16666-2	.|.;.;.	V|S	473|393;764;652;708;708;712	.|ENSP00000295809:R764S;ENSP00000342741:R652S;ENSP00000357113:R708S;ENSP00000357114:R708S;ENSP00000394935:R712S	.|ENSP00000295809:R764S	G|R	+|+	2|3	0|2	IFI16|IFI16	157291249|157291249	0.020000|0.020000	0.18652|0.18652	0.002000|0.002000	0.10522|0.10522	0.334000|0.334000	0.28698|0.28698	1.422000|1.422000	0.34826|0.34826	0.948000|0.948000	0.37687|0.37687	0.561000|0.561000	0.74099|0.74099	GGA|AGG	IFI16	-	NULL	ENSG00000163565		0.393	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	-	0.00	57	0	G	NM_005531		159024625	+1	tier1	-	no_errors	ENST00000295809	ensembl	human	known	74_37	missense	11.11	56	7	SNP	0.005	T
IGSF9	57549	genome.wustl.edu	37	1	159899523	159899523	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:159899523C>A	ENST00000368094.1	-	17	2428	c.2231G>T	c.(2230-2232)tGc>tTc	p.C744F	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.C728F	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	744					dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			TCCCAGAAAGCAGACTCCGCC	0.716																																																	0													9.0	13.0	12.0					1																	159899523		2185	4263	6448	SO:0001583	missense	0			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.2231G>T	1.37:g.159899523C>A	ENSP00000357073:p.Cys744Phe			Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C744F	ENST00000368094.1	37	c.2231	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400254	0.62177	.	.	ENSG00000085552	ENST00000361509;ENST00000368094	T;T	0.67523	-0.27;-0.19	4.83	3.89	0.44902	.	0.000000	0.43260	D	0.000592	T	0.63733	0.2536	M	0.61703	1.905	0.37148	D	0.902023	D	0.61697	0.99	P	0.57548	0.823	T	0.66221	-0.5978	9	.	.	.	-7.9391	10.135	0.42701	0.2001:0.7999:0.0:0.0	.	744	Q9P2J2	TUTLA_HUMAN	F	728;744	ENSP00000355049:C728F;ENSP00000357073:C744F	.	C	-	2	0	IGSF9	158166147	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.387000	0.66243	0.977000	0.38444	0.561000	0.74099	TGC	IGSF9	-	NULL	ENSG00000085552		0.716	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	HGNC	protein_coding	OTTHUMT00000059115.1	-	0.00	26	0	C	NM_020789		159899523	-1	tier1	-	no_errors	ENST00000368094	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	A
IQCG	84223	genome.wustl.edu	37	3	197665569	197665569	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:197665569delA	ENST00000265239.6	-	5	789	c.365delT	c.(364-366)ttafs	p.L122fs	IQCG_ENST00000455191.1_Frame_Shift_Del_p.L122fs|IQCG_ENST00000480302.1_5'UTR|IQCG_ENST00000453254.1_Frame_Shift_Del_p.L122fs	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	122						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		CTCAGTTATTAACGGACTGGG	0.393																																																	0													243.0	258.0	253.0					3																	197665569		2203	4300	6503	SO:0001589	frameshift_variant	0			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.365delT	3.37:g.197665569delA	ENSP00000265239:p.Leu122fs		Q9BST2|Q9HAG8	Frame_Shift_Del	DEL	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.L122fs	ENST00000265239.6	37	c.365	CCDS3331.1	3																																																																																			IQCG	-	NULL	ENSG00000114473		0.393	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1		0.00	72	0	A	NM_032263		197665569	-1	tier1		no_errors	ENST00000265239	ensembl	human	known	74_37	frame_shift_del	20.97	98	26	DEL	0.000	-
ITIH5	80760	genome.wustl.edu	37	10	7683899	7683899	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr10:7683899T>G	ENST00000256861.6	-	3	368	c.290A>C	c.(289-291)aAc>aCc	p.N97T	ITIH5_ENST00000397145.2_Missense_Mutation_p.N97T|ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397146.2_Missense_Mutation_p.N97T|ITIH5_ENST00000434980.1_5'Flank	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	97	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CATAGTGAAGTTGGTGATGAA	0.502																																																	0													166.0	141.0	149.0					10																	7683899		2203	4300	6503	SO:0001583	missense	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.290A>C	10.37:g.7683899T>G	ENSP00000256861:p.Asn97Thr		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.N97T	ENST00000256861.6	37	c.290		10	.	.	.	.	.	.	.	.	.	.	T	19.03	3.746923	0.69418	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000397145	T;T;T	0.25912	1.77;1.77;1.77	5.71	5.71	0.89125	Vault protein inter-alpha-trypsin (2);	0.169078	0.64402	D	0.000007	T	0.53706	0.1813	.	.	.	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.58685	-0.7593	9	0.87932	D	0	-51.5998	15.9699	0.80004	0.0:0.0:0.0:1.0	.	97;97	G5E9D8;Q86UX2	.;ITIH5_HUMAN	T	97	ENSP00000256861:N97T;ENSP00000380333:N97T;ENSP00000380332:N97T	ENSP00000256861:N97T	N	-	2	0	ITIH5	7723905	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	7.587000	0.82613	2.176000	0.68965	0.379000	0.24179	AAC	ITIH5	-	pfam_VIT,smart_VIT	ENSG00000123243		0.502	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	-	0.00	39	0	T	NM_030569		7683899	-1	tier1	-	no_errors	ENST00000256861	ensembl	human	known	74_37	missense	15.38	33	6	SNP	1.000	G
PLA2G4B	100137049	genome.wustl.edu	37	15	42137203	42137203	+	Silent	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr15:42137203T>C	ENST00000452633.1	+	14	1526	c.1174T>C	c.(1174-1176)Ttg>Ctg	p.L392L	JMJD7-PLA2G4B_ENST00000342159.4_Silent_p.L623L|PLA2G4B_ENST00000542534.2_Silent_p.L623L|JMJD7-PLA2G4B_ENST00000382448.4_Silent_p.L623L|PLA2G4B_ENST00000458483.1_Silent_p.L392L			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	392	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		GCGTGCCCGCTTGGGCTACCC	0.672																																																	0													16.0	17.0	17.0					15																	42137203		2201	4292	6493	SO:0001819	synonymous_variant	0			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.1174T>C	15.37:g.42137203T>C			B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Silent	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.L623	ENST00000452633.1	37	c.1867	CCDS45241.1	15																																																																																			JMJD7-PLA2G4B	-	pfam_LysoPLipase_cat_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	ENSG00000168970		0.672	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000345969.1	-	0.00	20	0	T	NM_001114633		42137203	+1	tier1	-	no_errors	ENST00000382448	ensembl	human	known	74_37	silent	34.78	15	8	SNP	0.089	C
KCNN3	3782	genome.wustl.edu	37	1	154794605	154794605	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:154794605A>G	ENST00000271915.4	-	2	1304	c.989T>C	c.(988-990)cTt>cCt	p.L330P	KCNN3_ENST00000361147.4_Missense_Mutation_p.L25P|KCNN3_ENST00000358505.2_Missense_Mutation_p.L17P	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	335					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	CAAGCCCAAAAGGATGATGGT	0.547																																																	0													154.0	123.0	134.0					1																	154794605		2203	4300	6503	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.989T>C	1.37:g.154794605A>G	ENSP00000271915:p.Leu330Pro		B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.L330P	ENST00000271915.4	37	c.989	CCDS30880.1	1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.121610	0.77436	.	.	ENSG00000143603	ENST00000361147;ENST00000271915;ENST00000358505	D;D;D	0.99637	-6.29;-5.12;-6.15	4.89	4.89	0.63831	Potassium channel, calcium-activated, SK, conserved region (1);	0.000000	0.47455	D	0.000221	D	0.99661	0.9874	M	0.92026	3.265	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	0.999;0.998;1.0	D	0.97617	1.0133	10	0.87932	D	0	-11.936	13.6163	0.62110	1.0:0.0:0.0:0.0	.	336;335;25	Q6JXY2;Q9UGI6;Q9UGI6-2	.;KCNN3_HUMAN;.	P	25;330;17	ENSP00000354764:L25P;ENSP00000271915:L330P;ENSP00000351295:L17P	ENSP00000271915:L330P	L	-	2	0	KCNN3	153061229	1.000000	0.71417	0.971000	0.41717	0.923000	0.55619	8.139000	0.89615	2.069000	0.61940	0.454000	0.30748	CTT	KCNN3	-	pfam_K_chnl_Ca-activ_SK	ENSG00000143603		0.547	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	-	0.00	65	0	A	NM_002249		154794605	-1	tier1	-	no_errors	ENST00000271915	ensembl	human	novel	74_37	missense	7.69	48	4	SNP	0.999	G
KCTD19	146212	genome.wustl.edu	37	16	67325252	67325252	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr16:67325252G>T	ENST00000304372.5	-	14	2580	c.2525C>A	c.(2524-2526)gCc>gAc	p.A842D		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	842					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GGCTGTGATGGCTTTGGGGTC	0.547																																																	0													78.0	79.0	79.0					16																	67325252		2023	4189	6212	SO:0001583	missense	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.2525C>A	16.37:g.67325252G>T	ENSP00000305702:p.Ala842Asp		B4DZ49|Q8N804	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.A842D	ENST00000304372.5	37	c.2525	CCDS42179.1	16	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444780	0.43429	.	.	ENSG00000168676	ENST00000304372	T	0.59224	0.28	5.62	3.67	0.42095	.	0.255590	0.27567	N	0.018789	T	0.37265	0.0997	N	0.19112	0.55	0.30097	N	0.807835	B	0.18741	0.03	B	0.15870	0.014	T	0.32851	-0.9891	10	0.66056	D	0.02	-5.3976	4.7575	0.13092	0.1741:0.0:0.6533:0.1725	.	842	Q17RG1	KCD19_HUMAN	D	842	ENSP00000305702:A842D	ENSP00000305702:A842D	A	-	2	0	KCTD19	65882753	0.972000	0.33761	1.000000	0.80357	0.976000	0.68499	0.833000	0.27504	1.388000	0.46506	0.455000	0.32223	GCC	KCTD19	-	NULL	ENSG00000168676		0.547	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	-	0.00	35	0	G	XM_085367		67325252	-1	tier1	-	no_errors	ENST00000304372	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.996	T
CFAP97	57587	genome.wustl.edu	37	4	186084049	186084049	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr4:186084049C>A	ENST00000458385.2	-	5	1621	c.1502G>T	c.(1501-1503)gGt>gTt	p.G501V		NM_020827.1	NP_065878.1	Q9P2B7	K1430_HUMAN		501										endometrium(3)|kidney(2)|large_intestine(5)|upper_aerodigestive_tract(1)	11		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		ACAACTGAGACCACTCGTAGC	0.463																																																	0													47.0	49.0	49.0					4																	186084049		1911	4135	6046	SO:0001583	missense	0																														ENST00000458385.2:c.1502G>T	4.37:g.186084049C>A	ENSP00000409964:p.Gly501Val		B3KRP7|D3DP60|Q05CU1|Q4W5M4|Q8N6E7|Q9UF45	Missense_Mutation	SNP	NULL	p.G501V	ENST00000458385.2	37	c.1502	CCDS47168.1	4	.	.	.	.	.	.	.	.	.	.	C	8.473	0.857883	0.17178	.	.	ENSG00000164323	ENST00000458385	T	0.31769	1.48	4.7	1.72	0.24424	.	.	.	.	.	T	0.25005	0.0607	N	0.24115	0.695	0.58432	D	0.999991	P	0.50066	0.931	P	0.45310	0.476	T	0.06267	-1.0836	9	0.45353	T	0.12	-4.2851	14.2862	0.66247	0.0:0.3803:0.6197:0.0	.	501	Q9P2B7	K1430_HUMAN	V	501	ENSP00000409964:G501V	ENSP00000409964:G501V	G	-	2	0	KIAA1430	186321043	0.997000	0.39634	0.797000	0.32132	0.039000	0.13416	2.328000	0.43867	0.653000	0.30826	-0.172000	0.13284	GGT	KIAA1430	-	NULL	ENSG00000164323		0.463	KIAA1430-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	KIAA1430	HGNC	protein_coding	OTTHUMT00000360717.2	-	0.00	44	0	C			186084049	-1	tier1	-	no_errors	ENST00000458385	ensembl	human	novel	74_37	missense	54.55	25	30	SNP	0.753	A
KIAA1671	85379	genome.wustl.edu	37	22	25566894	25566894	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr22:25566894G>C	ENST00000406486.4	+	8	5025	c.4638G>C	c.(4636-4638)caG>caC	p.Q1546H	KIAA1671_ENST00000401395.1_Missense_Mutation_p.Q53H|KIAA1671_ENST00000358431.3_Missense_Mutation_p.Q1546H			Q9BY89	K1671_HUMAN	KIAA1671	1546										autonomic_ganglia(1)|breast(1)|endometrium(2)|lung(2)|prostate(1)|stomach(2)	9						AGCAGTGCCAGAGTGGGGAGA	0.612																																																	0													73.0	78.0	77.0					22																	25566894		692	1591	2283	SO:0001583	missense	0				CCDS46676.1	22q11.23	2009-07-09			ENSG00000197077	ENSG00000197077			29345	protein-coding gene	gene with protein product						15289310	Standard	NM_001145206		Approved		uc003abn.3	Q9BY89	OTTHUMG00000150841	ENST00000406486.4:c.4638G>C	22.37:g.25566894G>C	ENSP00000385152:p.Gln1546His		B0QYF2|B7ZW08|Q5THZ5	Missense_Mutation	SNP	NULL	p.Q1546H	ENST00000406486.4	37	c.4638	CCDS46676.1	22	.	.	.	.	.	.	.	.	.	.	G	2.810	-0.247121	0.05867	.	.	ENSG00000197077	ENST00000406486;ENST00000358431;ENST00000401395	.	.	.	4.82	1.24	0.21308	.	0.295825	0.34555	N	0.003878	T	0.28665	0.0710	L	0.32530	0.975	0.25176	N	0.990248	B;B	0.28178	0.202;0.058	B;B	0.28991	0.097;0.022	T	0.18903	-1.0322	9	0.51188	T	0.08	.	7.6186	0.28173	0.0941:0.4248:0.4811:0.0	.	1546;53	Q9BY89;Q9BY89-2	K1671_HUMAN;.	H	1546;1546;53	.	ENSP00000351207:Q1546H	Q	+	3	2	KIAA1671	23896894	1.000000	0.71417	0.397000	0.26308	0.107000	0.19398	0.439000	0.21575	0.423000	0.26033	-0.304000	0.09214	CAG	KIAA1671	-	NULL	ENSG00000197077		0.612	KIAA1671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1671	HGNC	protein_coding	OTTHUMT00000320306.6	-	0.00	21	0	G	NM_001145206		25566894	+1	tier1	-	no_errors	ENST00000358431	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.759	C
LOC105372277	105372277	genome.wustl.edu	37	19	12494426	12494426	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:12494426T>C	ENST00000435033.1	-	2	282	c.79A>G	c.(79-81)Aat>Gat	p.N27D																								TCGTAGAGATTCTTCTGGCAA	0.473																																																	0																																										SO:0001583	missense	0																														ENST00000435033.1:c.79A>G	19.37:g.12494426T>C	ENSP00000394047:p.Asn27Asp			Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.N27D	ENST00000435033.1	37	c.79		19																																																																																			CTD-3105H18.14	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000268744		0.473	CTD-3105H18.14-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	LOC101928664	Clone_based_vega_gene	protein_coding	OTTHUMT00000344100.1	-	0.00	72	0	T			12494426	-1	tier1	-	no_errors	ENST00000435033	ensembl	human	known	74_37	missense	26.13	82	29	SNP	0.754	C
KIAA1683	80726	genome.wustl.edu	37	19	18368268	18368268	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:18368268C>A	ENST00000600328.3	-	4	3458	c.3265G>T	c.(3265-3267)Gag>Tag	p.E1089*	KIAA1683_ENST00000600359.3_Nonsense_Mutation_p.E1043*|PDE4C_ENST00000596647.1_5'Flank|KIAA1683_ENST00000392413.4_Nonsense_Mutation_p.E1276*|PDE4C_ENST00000355502.3_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	1089						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CCGGGGCCCTCAGTGCCCTGG	0.687																																																	0													17.0	18.0	18.0					19																	18368268		2197	4294	6491	SO:0001587	stop_gained	0			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.3265G>T	19.37:g.18368268C>A	ENSP00000470780:p.Glu1089*		B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Nonsense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.E1276*	ENST00000600328.3	37	c.3826	CCDS32958.1	19	.	.	.	.	.	.	.	.	.	.	C	40	8.157717	0.98683	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000358422;ENST00000411671	.	.	.	4.41	-1.98	0.07480	.	7.108390	0.00732	N	0.000942	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	9.3178	1.7318	0.02933	0.411:0.331:0.1349:0.1231	.	.	.	.	X	1276;1089;1043;353;474;703	.	ENSP00000351198:E474X	E	-	1	0	KIAA1683	18229268	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.706000	0.05047	-0.929000	0.03757	0.462000	0.41574	GAG	KIAA1683	-	NULL	ENSG00000130518		0.687	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1683	HGNC	protein_coding	OTTHUMT00000466312.3		0.00	26	0	C			18368268	-1			no_errors	ENST00000392413	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	0.000	A
LOC202181	202181	genome.wustl.edu	37	5	177099140	177099140	+	RNA	SNP	T	T	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:177099140T>A	ENST00000515045.1	-	0	70					NR_026921.1																						GATCACGATGTAATCCTCCAT	0.756																																																	0																																												0																															5.37:g.177099140T>A				RNA	SNP	-	NULL	ENST00000515045.1	37	NULL		5																																																																																			RP11-1277A3.2	-	-	ENSG00000246596		0.756	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	LOC202181	Clone_based_vega_gene	pseudogene	OTTHUMT00000373167.1		0.00	16	0	T			177099140	-1			no_errors	ENST00000515045	ensembl	human	known	74_37	rna	27.27	8	3	SNP	0.986	A
LYST	1130	genome.wustl.edu	37	1	235860435	235860435	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:235860435G>C	ENST00000389794.3	-	46	10686	c.10512C>G	c.(10510-10512)atC>atG	p.I3504M	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.I3504M			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3504					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ACAAACCACAGATTGCTCTGG	0.468																																																	0													86.0	88.0	87.0					1																	235860435		2203	4300	6503	SO:0001583	missense	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10512C>G	1.37:g.235860435G>C	ENSP00000374444:p.Ile3504Met		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I3504M	ENST00000389794.3	37	c.10512	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673820	0.67928	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.63096	-0.02;-0.02	5.88	4.97	0.65823	.	0.300219	0.41500	D	0.000865	T	0.68732	0.3033	L	0.57536	1.79	0.80722	D	1	D	0.67145	0.996	P	0.60236	0.871	T	0.71140	-0.4679	10	0.72032	D	0.01	.	6.4994	0.22160	0.1372:0.0:0.613:0.2498	.	3504	Q99698	LYST_HUMAN	M	3504	ENSP00000374444:I3504M;ENSP00000374443:I3504M	ENSP00000374443:I3504M	I	-	3	3	LYST	233927058	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.851000	0.39338	1.495000	0.48549	-0.216000	0.12614	ATC	LYST	-	NULL	ENSG00000143669		0.468	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	-	0.00	63	0	G			235860435	-1	tier1	-	no_errors	ENST00000389793	ensembl	human	known	74_37	missense	36.26	58	33	SNP	1.000	C
MAP3K7	6885	genome.wustl.edu	37	6	91225524	91225525	+	3'UTR	INS	-	-	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:91225524_91225525insA	ENST00000369329.3	-	0	2677_2678				MAP3K7_ENST00000479630.1_5'UTR|MAP3K7_ENST00000369332.3_3'UTR|MAP3K7_ENST00000369325.3_3'UTR|MAP3K7_ENST00000369320.1_3'UTR|MAP3K7_ENST00000369327.3_3'UTR	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		CTTTACTCCTTAAAAAAAAATG	0.282																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.*696->T	6.37:g.91225533_91225533dupA			B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	RNA	INS	-	NULL	ENST00000369329.3	37	NULL	CCDS5028.1	6																																																																																			MAP3K7	-	-	ENSG00000135341		0.282	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	HGNC	protein_coding	OTTHUMT00000041530.1		0.00	22	0	-	NM_145331		91225525	-1	tier1		no_errors	ENST00000479630	ensembl	human	known	74_37	rna	23.08	10	3	INS	0.000:0.087	A
MATN2	4147	genome.wustl.edu	37	8	99019414	99019414	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr8:99019414C>T	ENST00000520016.1	+	8	1533	c.1409C>T	c.(1408-1410)tCa>tTa	p.S470L	MATN2_ENST00000521689.1_Missense_Mutation_p.S470L|MATN2_ENST00000524308.1_Missense_Mutation_p.S429L|MATN2_ENST00000254898.5_Missense_Mutation_p.S470L|MATN2_ENST00000522025.2_Missense_Mutation_p.S186L			O00339	MATN2_HUMAN	matrilin 2	470	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TGCCAGTGCTCAGAAGGCTTC	0.567																																																	0													62.0	66.0	65.0					8																	99019414		2085	4226	6311	SO:0001583	missense	0			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1409C>T	8.37:g.99019414C>T	ENSP00000430487:p.Ser470Leu		A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.S470L	ENST00000520016.1	37	c.1409	CCDS55264.1	8	.	.	.	.	.	.	.	.	.	.	C	12.22	1.873292	0.33069	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016;ENST00000522270	D;T;D;D;T;D	0.96300	-1.65;-0.81;-2.2;-2.19;-0.78;-3.97	5.55	5.55	0.83447	Epidermal growth factor-like (1);EGF-like region, conserved site (1);EGF-like calcium-binding (1);	0.000000	0.51477	D	0.000097	D	0.94476	0.8222	N	0.11789	0.175	0.37352	D	0.910827	P;P;P	0.52692	0.955;0.936;0.955	P;P;P	0.57720	0.792;0.614;0.826	D	0.93958	0.7238	10	0.21014	T	0.42	-9.1497	16.4252	0.83812	0.0:1.0:0.0:0.0	.	470;470;470	E9PF03;O00339-2;O00339	.;.;MATN2_HUMAN	L	470;470;429;429;186;470;174	ENSP00000429977:S470L;ENSP00000254898:S470L;ENSP00000430221:S429L;ENSP00000429010:S186L;ENSP00000430487:S470L;ENSP00000429825:S174L	ENSP00000254898:S470L	S	+	2	0	MATN2	99088590	0.974000	0.33945	0.962000	0.40283	0.987000	0.75469	2.312000	0.43726	2.612000	0.88384	0.655000	0.94253	TCA	MATN2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000132561		0.567	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	HGNC	protein_coding	OTTHUMT00000380332.1	-	0.00	18	0	C			99019414	+1	tier1	-	no_errors	ENST00000254898	ensembl	human	known	74_37	missense	20.41	39	10	SNP	0.975	T
MIPEP	4285	genome.wustl.edu	37	13	24383997	24383997	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr13:24383997G>A	ENST00000382172.3	-	15	1818	c.1720C>T	c.(1720-1722)Caa>Taa	p.Q574*		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	574					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		ACCTGAAGTTGCATATCAGCT	0.323																																																	0													105.0	108.0	107.0					13																	24383997		2203	4300	6503	SO:0001587	stop_gained	0				CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1720C>T	13.37:g.24383997G>A	ENSP00000371607:p.Gln574*		Q5JV15|Q5T9Q9|Q96G65	Nonsense_Mutation	SNP	pfam_Pept_M3A_M3B	p.Q574*	ENST00000382172.3	37	c.1720	CCDS9303.1	13	.	.	.	.	.	.	.	.	.	.	G	40	7.983062	0.98594	.	.	ENSG00000027001	ENST00000382172	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.5376	0.87837	0.0:0.0:1.0:0.0	.	.	.	.	X	574	.	ENSP00000371607:Q574X	Q	-	1	0	MIPEP	23281997	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	5.943000	0.70211	2.882000	0.98803	0.655000	0.94253	CAA	MIPEP	-	pfam_Pept_M3A_M3B	ENSG00000027001		0.323	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPEP	HGNC	protein_coding	OTTHUMT00000044169.1	-	0.00	51	0	G			24383997	-1	tier1	-	no_errors	ENST00000382172	ensembl	human	known	74_37	nonsense	6.78	55	4	SNP	1.000	A
MIR181A1	406995	genome.wustl.edu	37	1	198828105	198828105	+	RNA	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:198828105G>T	ENST00000385026.1	-	0	110				MIR181B1_ENST00000385240.1_RNA	NR_029626.1				microRNA 181a-1																		AATAATCTCTGCACAGGGAAG	0.458																																																	0													182.0	165.0	170.0					1																	198828105		1568	3582	5150			0					1q32.1	2011-09-12	2006-05-16	2008-12-18	ENSG00000207759	ENSG00000207759		"""ncRNAs / Micro RNAs"""	31590	non-coding RNA	RNA, micro		612742	"""microRNA 213"""	MIRN213, MIRN181A1			Standard	NR_029626		Approved	hsa-mir-213	uc001guy.3				1.37:g.198828105G>T				RNA	SNP	-	NULL	ENST00000385026.1	37	NULL		1																																																																																			MIR181B1	-	-	ENSG00000207975		0.458	MIR181A1-201	KNOWN	basic	miRNA	MIR181B1	HGNC	miRNA			0.00	58	0	G	NR_029626		198828105	-1			no_errors	ENST00000385240	ensembl	human	known	74_37	rna	5.48	69	4	SNP	0.031	T
MLLT3	4300	genome.wustl.edu	37	9	20414340	20414340	+	Silent	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr9:20414340G>A	ENST00000380338.4	-	5	790	c.504C>T	c.(502-504)agC>agT	p.S168S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S165S|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	168	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S168S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.537			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	5	Substitution - coding silent(5)	lung(2)|urinary_tract(1)|endometrium(1)|kidney(1)											9.0	16.0	13.0					9																	20414340		1646	3412	5058	SO:0001819	synonymous_variant	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.504C>T	9.37:g.20414340G>A			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	pfam_YEATS,pfscan_YEATS	p.S168	ENST00000380338.4	37	c.504	CCDS6494.1	9																																																																																			MLLT3	-	NULL	ENSG00000171843		0.537	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1	-	0.00	63	0	G	NM_004529		20414340	-1	tier1	-	no_errors	ENST00000380338	ensembl	human	known	74_37	silent	7.22	90	7	SNP	1.000	A
MOGAT3	346606	genome.wustl.edu	37	7	100843774	100843774	+	Silent	SNP	G	G	C	rs200949443		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr7:100843774G>C	ENST00000223114.4	-	2	298	c.132C>G	c.(130-132)gtC>gtG	p.V44V	MOGAT3_ENST00000440203.2_Silent_p.V44V|MOGAT3_ENST00000379423.3_Silent_p.V44V	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	44					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					GGAGGACAAAGACAAGAAGGG	0.527																																																	0													58.0	61.0	60.0					7																	100843774		2199	4300	6499	SO:0001819	synonymous_variant	0			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.132C>G	7.37:g.100843774G>C			Q496A6|Q496A7|Q496A8|Q9UDW7	Silent	SNP	pfam_DAGAT	p.V44	ENST00000223114.4	37	c.132	CCDS5714.1	7																																																																																			MOGAT3	-	NULL	ENSG00000106384		0.527	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGAT3	HGNC	protein_coding	OTTHUMT00000059649.3	-	0.00	16	0	G	NM_178176		100843774	-1	tier1	-	no_errors	ENST00000440203	ensembl	human	known	74_37	silent	66.67	5	10	SNP	0.006	C
MRC2	9902	genome.wustl.edu	37	17	60766262	60766262	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr17:60766262G>A	ENST00000303375.5	+	23	3677	c.3275G>A	c.(3274-3276)cGc>cAc	p.R1092H	MRC2_ENST00000446119.2_Missense_Mutation_p.A38T|MRC2_ENST00000580916.1_3'UTR	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1092	C-type lectin 6. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						TTCACTGGCCGCTGGGACGAT	0.662																																																	0													41.0	36.0	38.0					17																	60766262		2203	4300	6503	SO:0001583	missense	0			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3275G>A	17.37:g.60766262G>A	ENSP00000307513:p.Arg1092His		A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.R1092H	ENST00000303375.5	37	c.3275	CCDS11634.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.39|18.39	3.613393|3.613393	0.66672|0.66672	.|.	.|.	ENSG00000011028|ENSG00000011028	ENST00000446119|ENST00000303375	T|T	0.03065|0.19250	4.06|2.16	4.59|4.59	4.59|4.59	0.56863|0.56863	.|C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.|0.058761	.|0.64402	.|D	.|0.000002	T|T	0.37433|0.37433	0.1003|0.1003	L|L	0.47716|0.47716	1.5|1.5	0.20403|0.20403	N|N	0.999903|0.999903	P|D	0.44659|0.89917	0.84|1.0	B|D	0.33799|0.73380	0.17|0.98	T|T	0.08806|0.08806	-1.0704|-1.0704	9|10	0.38643|0.39692	T|T	0.18|0.17	-34.4856|-34.4856	14.117|14.117	0.65161|0.65161	0.0:0.0:0.8495:0.1505|0.0:0.0:0.8495:0.1505	.|.	38|1092	E7EME3|Q9UBG0	.|MRC2_HUMAN	T|H	38|1092	ENSP00000400445:A38T|ENSP00000307513:R1092H	ENSP00000400445:A38T|ENSP00000307513:R1092H	A|R	+|+	1|2	0|0	MRC2|MRC2	58119994|58119994	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	3.816000|3.816000	0.55658|0.55658	2.355000|2.355000	0.79922|0.79922	0.561000|0.561000	0.74099|0.74099	GCT|CGC	MRC2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000011028		0.662	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	HGNC	protein_coding	OTTHUMT00000445152.1		0.00	48	0	G			60766262	+1			no_errors	ENST00000303375	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	A
MRPL9	65005	genome.wustl.edu	37	1	151734490	151734490	+	Intron	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:151734490C>T	ENST00000368830.3	-	4	571				OAZ3_ENST00000479764.1_5'Flank|RP11-98D18.3_ENST00000512280.1_RNA|OAZ3_ENST00000453029.2_5'Flank|RP11-98D18.15_ENST00000601684.1_RNA|OAZ3_ENST00000315067.8_5'Flank|OAZ3_ENST00000321531.5_5'Flank|MRPL9_ENST00000467306.1_Intron|MRPL9_ENST00000368829.3_Intron	NM_031420.2	NP_113608.1	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTTGGGTCTGCAATCAGGAGA	0.498																																																	0																																										SO:0001627	intron_variant	0			AK026363	CCDS1003.1, CCDS72916.1	1q21	2012-09-13			ENSG00000143436	ENSG00000143436		"""Mitochondrial ribosomal proteins / large subunits"""	14277	protein-coding gene	gene with protein product		611824					Standard	XM_005245455		Approved		uc001eyv.3	Q9BYD2	OTTHUMG00000013063	ENST00000368830.3:c.486+90G>A	1.37:g.151734490C>T			B2RD99|Q5SZR2|Q9BSW8	RNA	SNP	-	NULL	ENST00000368830.3	37	NULL	CCDS1003.1	1																																																																																			MRPL9	-	-	ENSG00000143436		0.498	MRPL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL9	HGNC	protein_coding	OTTHUMT00000036653.2	-	0.00	77	0	C	NM_031420		151734490	-1	tier1	-	no_errors	ENST00000478926	ensembl	human	known	74_37	rna	40.26	46	31	SNP	0.002	T
MRPS26	64949	genome.wustl.edu	37	20	3028466	3028466	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr20:3028466C>T	ENST00000380325.3	+	4	693	c.569C>T	c.(568-570)gCc>gTc	p.A190V		NM_030811.3	NP_110438.1	Q9BYN8	RT26_HUMAN	mitochondrial ribosomal protein S26	190					DNA damage response, detection of DNA damage (GO:0042769)|peptide biosynthetic process (GO:0043043)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|lung(1)	2						TACAACTGGGCCATCACCAGA	0.577																																																	0													66.0	55.0	59.0					20																	3028466		2203	4300	6503	SO:0001583	missense	0			AB051354	CCDS13043.1	20p13	2012-09-13	2004-09-22		ENSG00000125901	ENSG00000125901		"""Mitochondrial ribosomal proteins / small subunits"""	14045	protein-coding gene	gene with protein product		611988	"""chromosome 20 open reading frame 193"""	C20orf193		11543634	Standard	NM_030811		Approved	MRP-S13, MRP-S26, RPMS13, dJ534B8.3	uc002whs.3	Q9BYN8	OTTHUMG00000031721	ENST00000380325.3:c.569C>T	20.37:g.3028466C>T	ENSP00000369682:p.Ala190Val		Q96Q58	Missense_Mutation	SNP	NULL	p.A190V	ENST00000380325.3	37	c.569	CCDS13043.1	20	.	.	.	.	.	.	.	.	.	.	C	19.17	3.776587	0.70107	.	.	ENSG00000125901	ENST00000380325	.	.	.	5.74	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.64023	0.2561	M	0.80183	2.485	0.80722	D	1	P	0.52316	0.952	P	0.47673	0.554	T	0.68051	-0.5511	9	0.72032	D	0.01	-13.314	10.74	0.46147	0.0:0.8534:0.0:0.1466	.	190	Q9BYN8	RT26_HUMAN	V	190	.	ENSP00000369682:A190V	A	+	2	0	MRPS26	2976466	1.000000	0.71417	0.930000	0.37139	0.345000	0.29048	4.296000	0.59055	0.802000	0.34089	-0.218000	0.12543	GCC	MRPS26	-	NULL	ENSG00000125901		0.577	MRPS26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS26	HGNC	protein_coding	OTTHUMT00000077692.2	-	0.00	33	0	C	NM_030811		3028466	+1	tier1	-	no_errors	ENST00000380325	ensembl	human	known	74_37	missense	20.51	31	8	SNP	0.998	T
MST1L	11223	genome.wustl.edu	37	1	17083485	17083485	+	RNA	SNP	A	A	G	rs371742490		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:17083485A>G	ENST00000455405.2	-	0	1103							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										acttgtattgataaggcaaaa	0.373																																																	0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083485A>G			B7WPB1|Q13209	RNA	SNP	-	NULL	ENST00000455405.2	37	NULL		1																																																																																			MST1L	-	-	ENSG00000186715		0.373	MST1L-002	KNOWN	basic	processed_transcript	MST1L	HGNC	pseudogene	OTTHUMT00000400328.1		0.00	10	0	A	NM_001271733		17083485	-1			no_errors	ENST00000455405	ensembl	human	known	74_37	rna	13.64	19	3	SNP	0.000	G
MT-ND1	4535	genome.wustl.edu	37	M	1202	1202	+	5'Flank	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chrM:1202G>A	ENST00000361390.2	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CCCTCTAGAGGAGCCTGTTCT	0.468																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1202G>A	Exception_encountered		C0JKH6|Q37523	RNA	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			MT-RNR1	-	-	ENSG00000211459		0.468	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		-	0.00	12	0	G	YP_003024026		1202	+1	tier1	-	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	38.71	19	12	SNP	NULL	A
MUC19	283463	genome.wustl.edu	37	12	40919112	40919113	+	3'UTR	DNP	GG	GG	TT			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:40919112_40919113GG>TT	ENST00000474954.1	+	0	1810_1811				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						ACATACTGTTGGCCACATTTTT	0.426																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	Exception_encountered	12.37:g.40919112_40919113delinsTT			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.426	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	61|60	0	G	XM_003403524		40919112|40919113	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	33.80|33.33	47|48	24	SNP	0.015|0.014	T
MUC4	4585	genome.wustl.edu	37	3	195508450	195508450	+	Frame_Shift_Del	DEL	G	G	-	rs568124972	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:195508450delG	ENST00000463781.3	-	2	10460	c.10001delC	c.(10000-10002)cctfs	p.P3334fs	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Frame_Shift_Del_p.P3334fs	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGGGCTGGTGAC	0.592																																																	1	Deletion - In frame(1)	stomach(1)							,,	22,3408		2,18,1695	29.0	22.0	24.0		,,	-0.9	0.0	3	dbSNP_130	24	130,7010		12,106,3452	no	intron,frameshift,intron	MUC4	NM_138297.4,NM_018406.6,NM_004532.5	,,	14,124,5147	A1A1,A1R,RR		1.8207,0.6414,1.438	,,	,,	195508450	152,10418	689	1574	2263	SO:0001589	frameshift_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10001delC	3.37:g.195508450delG	ENSP00000417498:p.Pro3334fs		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Del	DEL	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P3334fs	ENST00000463781.3	37	c.10001	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6		0.00	65	0	G	NM_018406		195508450	-1			no_errors	ENST00000463781	ensembl	human	known	74_37	frame_shift_del	6.82	123	9	DEL	0.171	0
MUC4	4585	genome.wustl.edu	37	3	195508454	195508455	+	Frame_Shift_Ins	INS	-	-	C	rs201319965	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:195508454_195508455insC	ENST00000463781.3	-	2	10455_10456	c.9996_9997insG	c.(9994-9999)accagcfs	p.S3333fs	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Frame_Shift_Ins_p.S3333fs	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGGGCTGGTGACATGAA	0.594																																																	1	Deletion - In frame(1)	stomach(1)																																								SO:0001589	frameshift_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9996_9997insG	3.37:g.195508454_195508455insC	ENSP00000417498:p.Ser3333fs		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Ins	INS	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3332fs	ENST00000463781.3	37	c.9997_9996	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.594	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6		0.00	60	0	0	NM_018406		195508455	-1			no_errors	ENST00000463781	ensembl	human	known	74_37	frame_shift_ins	5.56	119	7	INS	0.512:0.562	C
MUC5B	727897	genome.wustl.edu	37	11	1253282	1253282	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr11:1253282G>T	ENST00000529681.1	+	15	1793	c.1735G>T	c.(1735-1737)Gtg>Ttg	p.V579L	MUC5B_ENST00000447027.1_Missense_Mutation_p.V582L	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	579	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTCAGCGGGGTGGTGGAGGC	0.662																																																	0													43.0	53.0	50.0					11																	1253282		2073	4201	6274	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1735G>T	11.37:g.1253282G>T	ENSP00000436812:p.Val579Leu		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V582L	ENST00000529681.1	37	c.1744	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	6.124	0.391165	0.11581	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15952	2.38;2.56	3.77	3.77	0.43336	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.20536	0.0494	L	0.45051	1.395	0.24859	N	0.992353	B;P;P	0.42296	0.098;0.775;0.775	B;P;P	0.46758	0.08;0.526;0.526	T	0.07888	-1.0749	9	0.87932	D	0	.	8.2062	0.31456	0.1919:0.0:0.8081:0.0	.	579;1238;582	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	L	579;582;580;615	ENSP00000436812:V579L;ENSP00000415793:V582L	ENSP00000343037:V580L	V	+	1	0	MUC5B	1209858	0.092000	0.21681	0.938000	0.37757	0.233000	0.25261	0.429000	0.21412	1.636000	0.50526	0.462000	0.41574	GTG	MUC5B	-	NULL	ENSG00000117983		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	39	0	G	XM_001126093		1253282	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	53.85	12	14	SNP	0.540	T
MYO6	4646	genome.wustl.edu	37	6	76558106	76558106	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:76558106T>G	ENST00000369977.3	+	11	1075	c.936T>G	c.(934-936)gaT>gaG	p.D312E	MYO6_ENST00000369985.4_Missense_Mutation_p.D312E|MYO6_ENST00000369981.3_Missense_Mutation_p.D312E|MYO6_ENST00000369975.1_Missense_Mutation_p.D312E	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	312	Myosin motor.|Responsible for slow ATPase activity. {ECO:0000250}.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CTCTGCTAGATGACCATGGTG	0.383																																																	0													156.0	153.0	154.0					6																	76558106		2203	4300	6503	SO:0001583	missense	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.936T>G	6.37:g.76558106T>G	ENSP00000358994:p.Asp312Glu		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.D312E	ENST00000369977.3	37	c.936	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	T	20.9	4.073353	0.76415	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;D	0.91180	-2.8;-2.8;-2.8;-2.8	5.23	1.39	0.22231	.	0.000000	0.85682	D	0.000000	D	0.93347	0.7879	M	0.89904	3.07	0.58432	D	0.999998	D;D	0.55385	0.971;0.958	P;D	0.66497	0.578;0.944	D	0.92385	0.5916	10	0.87932	D	0	.	8.9846	0.35986	0.0:0.2174:0.0:0.7826	.	312;312	Q9UM54-2;Q9UM54-1	.;.	E	312	ENSP00000358998:D312E;ENSP00000359002:D312E;ENSP00000358994:D312E;ENSP00000358992:D312E	ENSP00000358992:D312E	D	+	3	2	MYO6	76614826	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	2.465000	0.45075	0.003000	0.14656	0.455000	0.32223	GAT	MYO6	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000196586		0.383	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	-	0.00	77	0	T	NM_004999		76558106	+1	tier1	-	no_errors	ENST00000369981	ensembl	human	known	74_37	missense	15.32	94	17	SNP	1.000	G
MYT1L	23040	genome.wustl.edu	37	2	1893241	1893241	+	Silent	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:1893241G>A	ENST00000399161.2	-	16	3039	c.2292C>T	c.(2290-2292)gaC>gaT	p.D764D	MYT1L_ENST00000428368.2_Silent_p.D762D	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	764					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CCACCTCCATGTCAGGGTTCT	0.597																																																	0													55.0	56.0	56.0					2																	1893241		2062	4207	6269	SO:0001819	synonymous_variant	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2292C>T	2.37:g.1893241G>A			A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.D764	ENST00000399161.2	37	c.2292		2																																																																																			MYT1L	-	pfam_Myelin_TF	ENSG00000186487		0.597	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	-	0.00	36	0	G	NM_015025		1893241	-1	tier1	-	no_errors	ENST00000399161	ensembl	human	known	74_37	silent	25.00	18	6	SNP	1.000	A
MYO7B	4648	genome.wustl.edu	37	2	128341785	128341785	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:128341785C>A	ENST00000409816.2	+	12	1464	c.1432C>A	c.(1432-1434)Cgc>Agc	p.R478S	MYO7B_ENST00000428314.1_Missense_Mutation_p.R478S|MYO7B_ENST00000389524.4_Missense_Mutation_p.R478S			Q6PIF6	MYO7B_HUMAN	myosin VIIB	478	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGAGGAGTACCGCTCGGAGAA	0.572																																																	0													83.0	90.0	88.0					2																	128341785		2202	4299	6501	SO:0001583	missense	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1432C>A	2.37:g.128341785C>A	ENSP00000386461:p.Arg478Ser		Q14786|Q8TEE1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.R478S	ENST00000409816.2	37	c.1432	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	C	8.126	0.782074	0.16189	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.86865	-2.18;-2.18;-2.18	4.7	2.85	0.33270	Myosin head, motor domain (2);	0.568941	0.18439	N	0.141189	T	0.78991	0.4371	L	0.31804	0.96	0.09310	N	0.999997	B	0.32753	0.383	B	0.35607	0.206	T	0.62053	-0.6935	10	0.09084	T	0.74	.	13.1545	0.59509	0.5454:0.4546:0.0:0.0	.	478	Q6PIF6	MYO7B_HUMAN	S	478	ENSP00000374175:R478S;ENSP00000415090:R478S;ENSP00000386461:R478S	ENSP00000374175:R478S	R	+	1	0	MYO7B	128058255	0.122000	0.22280	0.621000	0.29145	0.944000	0.59088	0.531000	0.23052	0.677000	0.31305	0.655000	0.94253	CGC	MYO7B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000169994		0.572	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	-	0.00	64	0	C	XM_291001		128341785	+1	tier1	-	no_errors	ENST00000389524	ensembl	human	known	74_37	missense	24.59	46	15	SNP	0.204	A
NAV3	89795	genome.wustl.edu	37	12	78513439	78513439	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:78513439C>G	ENST00000397909.2	+	15	3636	c.3463C>G	c.(3463-3465)Cac>Gac	p.H1155D	NAV3_ENST00000266692.7_Missense_Mutation_p.H1155D|NAV3_ENST00000536525.2_Missense_Mutation_p.H1155D|NAV3_ENST00000228327.6_Missense_Mutation_p.H1155D			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1155	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CCGAGGAGGCCACAGATCCAG	0.532										HNSCC(70;0.22)																																							0													71.0	73.0	72.0					12																	78513439		1991	4167	6158	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3463C>G	12.37:g.78513439C>G	ENSP00000381007:p.His1155Asp		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.H1155D	ENST00000397909.2	37	c.3463		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.162403|4.162403	0.78226|0.78226	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.28454|.	1.61;1.61;1.61;1.61|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.42420|.	U|.	0.000707|.	T|T	0.71221|0.71221	0.3314|0.3314	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	P;D;D;D|.	0.89917|.	0.877;1.0;1.0;0.991|.	B;D;D;P|.	0.85130|.	0.358;0.997;0.996;0.889|.	T|T	0.66236|0.66236	-0.5974|-0.5974	10|5	0.42905|.	T|.	0.14|.	-16.6887|-16.6887	19.949|19.949	0.97192|0.97192	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1155;1155;1155;1155|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	D|R	1155|226	ENSP00000446132:H1155D;ENSP00000381007:H1155D;ENSP00000228327:H1155D;ENSP00000266692:H1155D|.	ENSP00000228327:H1155D|.	H|P	+|+	1|2	0|0	NAV3|NAV3	77037570|77037570	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.903000|0.903000	0.53119|0.53119	5.510000|5.510000	0.67018|0.67018	2.706000|2.706000	0.92434|0.92434	0.655000|0.655000	0.94253|0.94253	CAC|CCA	NAV3	-	NULL	ENSG00000067798		0.532	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	40	0	C	NM_001024383		78513439	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	19.23	42	10	SNP	1.000	G
NAA25	80018	genome.wustl.edu	37	12	112478314	112478314	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:112478314G>C	ENST00000261745.4	-	21	2757	c.2509C>G	c.(2509-2511)Ctt>Gtt	p.L837V	MIR3657_ENST00000584818.1_RNA	NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	837						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						TTTTCTAAAAGAGTAGGATGT	0.303																																																	0													75.0	75.0	75.0					12																	112478314		2202	4295	6497	SO:0001583	missense	0			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.2509C>G	12.37:g.112478314G>C	ENSP00000261745:p.Leu837Val		A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	pfam_N-acetylTrfase_B_cplx_non-cat,pfscan_TPR-contain_dom	p.L837V	ENST00000261745.4	37	c.2509	CCDS9159.1	12	.	.	.	.	.	.	.	.	.	.	G	8.710	0.911823	0.17907	.	.	ENSG00000111300	ENST00000261745;ENST00000550701	T	0.20598	2.06	5.53	3.49	0.39957	.	0.409426	0.24669	N	0.036566	T	0.09468	0.0233	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.35101	-0.9802	10	0.02654	T	1	-5.5938	9.1544	0.36983	0.0:0.217:0.5587:0.2243	.	837;837	A8K8X0;Q14CX7	.;NAA25_HUMAN	V	837;43	ENSP00000261745:L837V	ENSP00000261745:L837V	L	-	1	0	NAA25	110962697	0.831000	0.29352	0.942000	0.38095	0.999000	0.98932	1.262000	0.32992	1.294000	0.44707	0.655000	0.94253	CTT	NAA25	-	NULL	ENSG00000111300		0.303	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA25	HGNC	protein_coding	OTTHUMT00000405205.1	-	0.00	92	0	G	NM_024953		112478314	-1	tier1	-	no_errors	ENST00000261745	ensembl	human	known	74_37	missense	24.47	71	23	SNP	0.071	C
NBN	4683	genome.wustl.edu	37	8	90990460	90990460	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr8:90990460G>T	ENST00000265433.3	-	5	726	c.572C>A	c.(571-573)cCa>cAa	p.P191Q	NBN_ENST00000409330.1_Missense_Mutation_p.P109Q	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	191	Mediates interaction with SP100. {ECO:0000250}.				blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTCAATTTGTGGAGGCTGCTT	0.313								Homologous recombination																																									0													74.0	74.0	74.0					8																	90990460		2203	4300	6503	SO:0001583	missense	0			AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.572C>A	8.37:g.90990460G>T	ENSP00000265433:p.Pro191Gln		B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Missense_Mutation	SNP	pfam_DNA-repair_Nbs1_C,pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_BRCT_dom,smart_FHA_dom,pirsf_Nibrin_met,pfscan_FHA_dom	p.P191Q	ENST00000265433.3	37	c.572	CCDS6249.1	8	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104109	0.76983	.	.	ENSG00000104320	ENST00000265433;ENST00000409330;ENST00000452387;ENST00000517772	T;T;T	0.75589	-0.38;-0.44;-0.95	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.87394	0.6166	M	0.79343	2.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.87567	0.2475	10	0.87932	D	0	-11.6266	20.4008	0.98991	0.0:0.0:1.0:0.0	.	191;191	A6H8Y5;O60934	.;NBN_HUMAN	Q	191;109;191;109	ENSP00000265433:P191Q;ENSP00000386924:P109Q;ENSP00000428717:P109Q	ENSP00000265433:P191Q	P	-	2	0	NBN	91059636	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.315000	0.78998	2.826000	0.97356	0.655000	0.94253	CCA	NBN	-	pirsf_Nibrin_met	ENSG00000104320		0.313	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBN	HGNC	protein_coding	OTTHUMT00000331583.3	-	0.00	54	0	G	NM_001024688		90990460	-1	tier1	-	no_errors	ENST00000265433	ensembl	human	known	74_37	missense	26.09	51	18	SNP	1.000	T
NOTCH2	4853	genome.wustl.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	GG	-	rs372504208		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	GG	GG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:120612003_120612004delGG	ENST00000256646.2	-	1	236_237	c.17_18delCC	c.(16-18)cccfs	p.P6fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	6					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.P6fs*27(2)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGCAGAGCGGGGCGCAGGGC	0.762			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	2	Deletion - Frameshift(2)	haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)																																								SO:0001589	frameshift_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.17_18delCC	1.37:g.120612005_120612006delGG	ENSP00000256646:p.Pro6fs		Q5T3X7|Q99734|Q9H240	Frame_Shift_Del	DEL	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P6fs	ENST00000256646.2	37	c.18_17	CCDS908.1	1																																																																																			NOTCH2	-	pirsf_Notch	ENSG00000134250		0.762	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1		0.00	18	0	GG	NM_024408		120612004	-1			no_errors	ENST00000256646	ensembl	human	known	74_37	frame_shift_del	17.78	37	8	DEL	0.101:0.700	0
NPHP3	27031	genome.wustl.edu	37	3	132441186	132441186	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:132441186G>C	ENST00000337331.5	-	1	100	c.14C>G	c.(13-15)tCg>tGg	p.S5W	NPHP3_ENST00000326682.8_Missense_Mutation_p.S5W|NPHP3-AS1_ENST00000489343.1_RNA|NPHP3_ENST00000343113.4_Missense_Mutation_p.S5W|NPHP3-AS1_ENST00000504440.1_RNA|NPHP3_ENST00000383282.2_Missense_Mutation_p.S5W	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	5					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CACGAGCGACGAGGCGGTCCC	0.701																																																	0													11.0	12.0	12.0					3																	132441186		1878	3735	5613	SO:0001583	missense	0			AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.14C>G	3.37:g.132441186G>C	ENSP00000338766:p.Ser5Trp		Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR-3,superfamily_P-loop_NTPase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S5W	ENST00000337331.5	37	c.14	CCDS3078.1	3	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473638	0.63737	.	.	ENSG00000113971	ENST00000326682;ENST00000337331;ENST00000343113;ENST00000383282	D;D;D;D	0.94931	-3.56;-3.44;-2.23;-2.33	3.58	3.58	0.41010	.	0.000000	0.64402	D	0.000001	D	0.94722	0.8297	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95631	0.8689	10	0.87932	D	0	-7.2811	15.3629	0.74496	0.0:0.0:1.0:0.0	.	5	Q7Z494	NPHP3_HUMAN	W	5	ENSP00000319909:S5W;ENSP00000338766:S5W;ENSP00000344802:S5W;ENSP00000372769:S5W	ENSP00000319909:S5W	S	-	2	0	NPHP3	133923876	1.000000	0.71417	0.856000	0.33681	0.070000	0.16714	6.479000	0.73600	1.981000	0.57761	0.500000	0.49745	TCG	NPHP3	-	NULL	ENSG00000113971		0.701	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHP3	HGNC	protein_coding	OTTHUMT00000357020.2	-	0.00	9	0	G	NM_153240		132441186	-1	tier1	-	no_errors	ENST00000337331	ensembl	human	known	74_37	missense	43.75	9	7	SNP	1.000	C
NRXN3	9369	genome.wustl.edu	37	14	80319942	80319942	+	Intron	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr14:80319942C>T	ENST00000557594.1	+	6	1941				NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000281127.7_Intron|NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000428277.2_Intron|NRXN3_ENST00000335750.5_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3						adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TGGCGACTCACTTACACATTT	0.463																																																	0													294.0	259.0	270.0					14																	80319942		876	1991	2867	SO:0001627	intron_variant	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.989-7440C>T	14.37:g.80319942C>T			A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G	p.T1377I	ENST00000557594.1	37	c.4130		14	.	.	.	.	.	.	.	.	.	.	C	11.57	1.679380	0.29783	.	.	ENSG00000021645	ENST00000332068	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	T	0.75332	0.3835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73392	-0.3997	4	.	.	.	.	19.4633	0.94927	0.0:1.0:0.0:0.0	.	.	.	.	I	1377	.	.	T	+	2	0	NRXN3	79389695	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.820000	0.55693	2.666000	0.90696	0.655000	0.94253	ACT	NRXN3	-	NULL	ENSG00000021645		0.463	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	-	0.00	56	0	C	NM_001105250		80319942	+1	tier1	-	no_errors	ENST00000554738	ensembl	human	known	74_37	missense	54.88	37	45	SNP	1.000	T
OPA1	4976	genome.wustl.edu	37	3	193380719	193380719	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:193380719G>C	ENST00000392438.3	+	24	2698	c.2464G>C	c.(2464-2466)Gaa>Caa	p.E822Q	OPA1_ENST00000361715.2_Missense_Mutation_p.E841Q|OPA1_ENST00000361510.2_Missense_Mutation_p.E877Q|OPA1_ENST00000361828.2_Missense_Mutation_p.E840Q|OPA1_ENST00000361150.2_Missense_Mutation_p.E823Q|OPA1_ENST00000361908.3_Missense_Mutation_p.E859Q	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	822					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GAAGAACCTTGAATCCCGAGG	0.388																																																	0													91.0	89.0	89.0					3																	193380719		2203	4300	6503	SO:0001583	missense	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2464G>C	3.37:g.193380719G>C	ENSP00000376233:p.Glu822Gln		D3DNW4	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.E877Q	ENST00000392438.3	37	c.2629	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313144	0.60414	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150;ENST00000445863	D;D;D;D;D;D;D	0.94931	-3.15;-3.17;-3.16;-3.15;-3.16;-3.56;-2.29	5.85	5.85	0.93711	.	0.092461	0.64402	D	0.000001	D	0.93595	0.7955	L	0.28776	0.89	0.80722	D	1	B;D;B;B;P;B;P;B	0.56521	0.131;0.976;0.131;0.131;0.929;0.131;0.866;0.22	B;P;B;B;P;B;P;B	0.57152	0.109;0.814;0.109;0.109;0.515;0.109;0.645;0.109	D	0.90231	0.4279	10	0.08381	T	0.77	-25.9139	19.1531	0.93496	0.0:0.0:1.0:0.0	.	786;822;804;823;840;859;841;877	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	Q	859;822;877;841;840;823;14	ENSP00000354681:E859Q;ENSP00000376233:E822Q;ENSP00000355324:E877Q;ENSP00000355311:E841Q;ENSP00000354429:E840Q;ENSP00000354781:E823Q;ENSP00000398358:E14Q	ENSP00000354781:E823Q	E	+	1	0	OPA1	194863413	1.000000	0.71417	0.777000	0.31699	0.998000	0.95712	9.357000	0.97099	2.753000	0.94483	0.655000	0.94253	GAA	OPA1	-	NULL	ENSG00000198836		0.388	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	-	0.00	88	0	G	NM_130837		193380719	+1	tier1	-	no_errors	ENST00000361510	ensembl	human	known	74_37	missense	33.33	78	39	SNP	1.000	C
OR5D13	390142	genome.wustl.edu	37	11	55540951	55540951	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr11:55540951C>A	ENST00000361760.1	+	1	38	c.38C>A	c.(37-39)aCt>aAt	p.T13N		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				AGCACACCCACTTTTATTCTC	0.393																																																	0													103.0	105.0	104.0					11																	55540951		2200	4296	6496	SO:0001583	missense	0			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.38C>A	11.37:g.55540951C>A	ENSP00000354800:p.Thr13Asn		Q6IF68|Q6IFC9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T13N	ENST00000361760.1	37	c.38	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	C	6.935	0.542177	0.13250	.	.	ENSG00000198877	ENST00000361760	T	0.02916	4.11	3.52	-2.63	0.06133	.	0.906034	0.08931	U	0.873050	T	0.02848	0.0085	L	0.48218	1.51	0.09310	N	1	B	0.27316	0.175	B	0.24269	0.052	T	0.43228	-0.9404	10	0.72032	D	0.01	-2.4589	4.1196	0.10099	0.3999:0.3329:0.0:0.2672	.	13	Q8NGL4	OR5DD_HUMAN	N	13	ENSP00000354800:T13N	ENSP00000354800:T13N	T	+	2	0	OR5D13	55297527	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.018000	0.13422	-0.352000	0.08237	-0.549000	0.04216	ACT	OR5D13	-	NULL	ENSG00000198877		0.393	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1	-	0.00	28	0	C	NM_001001967		55540951	+1	tier1	-	no_errors	ENST00000361760	ensembl	human	known	74_37	missense	41.03	23	16	SNP	0.000	A
OTOF	9381	genome.wustl.edu	37	2	26717916	26717916	+	Missense_Mutation	SNP	C	C	T	rs370475628		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:26717916C>T	ENST00000272371.2	-	9	917	c.791G>A	c.(790-792)cGg>cAg	p.R264Q	OTOF_ENST00000403946.3_Missense_Mutation_p.R264Q	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	264	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCAGCTGCCGGGCCTCGAT	0.612																																					GBM(102;732 1451 20652 24062 31372)												0								C	GLN/ARG	0,4406		0,0,2203	75.0	68.0	70.0		791	5.8	1.0	2		70	2,8598	1.2+/-3.3	0,2,4298	no	missense	OTOF	NM_194248.2	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	264/1998	26717916	2,13004	2203	4300	6503	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.791G>A	2.37:g.26717916C>T	ENSP00000272371:p.Arg264Gln		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R264Q	ENST00000272371.2	37	c.791	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760083	0.89932	0.0	2.33E-4	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.69806	-0.43;-0.43	5.83	5.83	0.93111	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.82958	0.5150	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81504	-0.0903	10	0.38643	T	0.18	-27.893	18.679	0.91540	0.0:1.0:0.0:0.0	.	264	Q9HC10	OTOF_HUMAN	Q	264	ENSP00000272371:R264Q;ENSP00000385255:R264Q	ENSP00000272371:R264Q	R	-	2	0	OTOF	26571420	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.687000	0.84139	2.750000	0.94351	0.655000	0.94253	CGG	OTOF	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000115155		0.612	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3		0.00	39	0	C			26717916	-1			no_errors	ENST00000272371	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
PARPBP	55010	genome.wustl.edu	37	12	102558365	102558365	+	Silent	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:102558365G>A	ENST00000358383.5	+	5	690	c.645G>A	c.(643-645)gaG>gaA	p.E215E	PARPBP_ENST00000535811.1_Intron|PARPBP_ENST00000543784.1_Silent_p.E101E|PARPBP_ENST00000327680.2_Silent_p.E134E|PARPBP_ENST00000541394.1_Silent_p.E292E|PARPBP_ENST00000392911.2_Silent_p.E134E|PARPBP_ENST00000378128.3_Silent_p.E215E			Q9NWS1	PARI_HUMAN	PARP1 binding protein	215					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						CTGCTCGAGAGAAACAAATGT	0.383																																																	0													148.0	158.0	155.0					12																	102558365		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.645G>A	12.37:g.102558365G>A			B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Silent	SNP	superfamily_P-loop_NTPase	p.E215	ENST00000358383.5	37	c.645	CCDS9090.2	12																																																																																			PARPBP	-	superfamily_P-loop_NTPase	ENSG00000185480		0.383	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	-	0.00	80	0	G	NM_017915		102558365	+1	tier1	-	no_errors	ENST00000358383	ensembl	human	known	74_37	silent	30.00	77	33	SNP	1.000	A
PCDHGB6	56100	genome.wustl.edu	37	5	140789345	140789345	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:140789345C>T	ENST00000520790.1	+	1	1576	c.1576C>T	c.(1576-1578)Cgc>Tgc	p.R526C	PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R526C(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAGCAGCTGCGCGCCTTCGC	0.687																																																	1	Substitution - Missense(1)	endometrium(1)											19.0	22.0	21.0					5																	140789345		2024	4170	6194	SO:0001583	missense	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.1576C>T	5.37:g.140789345C>T	ENSP00000428603:p.Arg526Cys		Q9Y5C5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R526C	ENST00000520790.1	37	c.1576	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	c	16.05	3.011791	0.54468	.	.	ENSG00000253305	ENST00000520790	T	0.01767	4.65	5.36	5.36	0.76844	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.15912	0.0383	H	0.95816	3.725	0.34954	D	0.751481	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.26395	-1.0104	9	0.87932	D	0	.	12.5011	0.55955	0.2871:0.7129:0.0:0.0	.	526;526	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	C	526	ENSP00000428603:R526C	ENSP00000428603:R526C	R	+	1	0	PCDHGB6	140769529	0.002000	0.14202	1.000000	0.80357	0.577000	0.36160	1.366000	0.34193	2.517000	0.84864	0.462000	0.41574	CGC	PCDHGB6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253305		0.687	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1		0.00	29	0	C	NM_018926		140789345	+1			no_errors	ENST00000520790	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.989	T
PDK3	5165	genome.wustl.edu	37	X	24544323	24544331	+	In_Frame_Del	DEL	CCAGACAAA	CCAGACAAA	-	rs369738728		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	CCAGACAAA	CCAGACAAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chrX:24544323_24544331delCCAGACAAA	ENST00000379162.4	+	7	917_925	c.682_690delCCAGACAAA	c.(682-690)ccagacaaadel	p.PDK228del	PDK3_ENST00000441463.2_In_Frame_Del_p.PDK228del	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	228	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						AGCCAAAGCGCCAGACAAACCTATTCAGG	0.364																																																	0																																										SO:0001651	inframe_deletion	0			L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.682_690delCCAGACAAA	X.37:g.24544323_24544331delCCAGACAAA	ENSP00000368460:p.Pro228_Lys230del		B4DXG6	In_Frame_Del	DEL	pfam_BCDHK/PDK_N,pfam_HATPase_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.DKP229in_frame_del	ENST00000379162.4	37	c.682_690	CCDS14212.1	X																																																																																			PDK3	-	superfamily_HATPase_ATP-bd	ENSG00000067992		0.364	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK3	HGNC	protein_coding	OTTHUMT00000056097.1		0.00	11	0	CCAGACAAA	NM_005391		24544331	+1			no_errors	ENST00000441463	ensembl	human	known	74_37	in_frame_del	33.33	8	4	DEL	1.000:1.000:0.999:0.997:0.998:1.000:1.000:1.000:0.997	0
PHC2	1912	genome.wustl.edu	37	1	33789826	33789826	+	3'UTR	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:33789826G>T	ENST00000257118.5	-	0	3270				PHC2_ENST00000485928.1_5'UTR|PHC2_ENST00000373418.3_3'UTR|RP11-415J8.3_ENST00000587696.1_RNA|RP11-415J8.3_ENST00000588828.1_RNA|PHC2_ENST00000373422.3_3'UTR|RP11-415J8.3_ENST00000457957.2_RNA|PHC2_ENST00000431992.1_3'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)						multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				ACCTGGAGATGCCAGAGAGTA	0.567																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.*640C>A	1.37:g.33789826G>T			A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	RNA	SNP	-	NULL	ENST00000257118.5	37	NULL	CCDS378.1	1																																																																																			PHC2	-	-	ENSG00000134686		0.567	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1	-	0.00	32	0	G	NM_198040		33789826	-1	tier1	-	no_errors	ENST00000485928	ensembl	human	known	74_37	rna	17.39	19	4	SNP	0.989	T
DNM3	26052	genome.wustl.edu	37	1	172362646	172362646	+	Intron	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:172362646C>A	ENST00000355305.5	+	20	2697				DNM3_ENST00000367731.1_Intron|DNM3_ENST00000358155.4_Intron|PIGC_ENST00000484368.1_5'UTR			Q9UQ16	DYN3_HUMAN	dynamin 3						endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TAAGGGTACACGGACAATTAA	0.458																																																	0																																										SO:0001627	intron_variant	0			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.2540+4697C>A	1.37:g.172362646C>A			A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	RNA	SNP	-	NULL	ENST00000355305.5	37	NULL		1																																																																																			PIGC	-	-	ENSG00000135845		0.458	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	PIGC	HGNC	protein_coding	OTTHUMT00000084531.1	-	0.00	27	0	C	NM_015569		172362646	-1	tier1	-	no_errors	ENST00000484368	ensembl	human	known	74_37	rna	41.38	17	12	SNP	0.001	A
PIGN	23556	genome.wustl.edu	37	18	59768391	59768391	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr18:59768391T>A	ENST00000357637.5	-	22	2409	c.1994A>T	c.(1993-1995)tAt>tTt	p.Y665F	PIGN_ENST00000400334.3_Missense_Mutation_p.Y665F	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	665					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				ATACACAACATACATGGAGAG	0.398																																																	0													96.0	85.0	88.0					18																	59768391		1891	4125	6016	SO:0001583	missense	0			AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.1994A>T	18.37:g.59768391T>A	ENSP00000350263:p.Tyr665Phe		Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.Y665F	ENST00000357637.5	37	c.1994	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	T	13.98	2.397783	0.42512	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.54279	0.58;0.58	5.57	1.78	0.24846	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.218074	0.40554	N	0.001079	T	0.47728	0.1461	L	0.58428	1.81	0.52099	D	0.999944	B;B	0.30211	0.063;0.273	B;B	0.39771	0.071;0.309	T	0.19976	-1.0289	10	0.23891	T	0.37	-2.5425	5.5669	0.17175	0.292:0.0762:0.0:0.6319	.	665;665	B2RCI8;O95427	.;PIGN_HUMAN	F	665	ENSP00000350263:Y665F;ENSP00000383188:Y665F	ENSP00000350263:Y665F	Y	-	2	0	PIGN	57919371	0.083000	0.21467	0.801000	0.32222	0.992000	0.81027	0.818000	0.27295	0.050000	0.15949	0.477000	0.44152	TAT	PIGN	-	pfam_GPI_EtnP_transferase_1_C	ENSG00000197563		0.398	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	HGNC	protein_coding	OTTHUMT00000449757.2	-	0.00	43	0	T	NM_176787		59768391	-1	tier1	-	no_errors	ENST00000357637	ensembl	human	known	74_37	missense	38.18	34	21	SNP	0.949	A
PLA2G5	5322	genome.wustl.edu	37	1	20411357	20411357	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:20411357G>A	ENST00000375108.3	+	2	302	c.34G>A	c.(34-36)Gct>Act	p.A12T	PLA2G5_ENST00000486277.1_3'UTR	NM_000929.2	NP_000920.1	P39877	PA2G5_HUMAN	phospholipase A2, group V	12					arachidonic acid secretion (GO:0050482)|glycerophospholipid biosynthetic process (GO:0046474)|leukotriene biosynthetic process (GO:0019370)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|heparin binding (GO:0008201)			NS(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		TTGGTTCCTGGCTTGTAGTAA	0.522																																																	0													151.0	142.0	145.0					1																	20411357		2203	4300	6503	SO:0001583	missense	0			U03090	CCDS202.1	1p36-p34	2008-09-19			ENSG00000127472	ENSG00000127472	3.1.1.4		9038	protein-coding gene	gene with protein product		601192				8838795, 8300559	Standard	NM_000929		Approved		uc001bcy.3	P39877	OTTHUMG00000002698	ENST00000375108.3:c.34G>A	1.37:g.20411357G>A	ENSP00000364249:p.Ala12Thr		Q8N435	Missense_Mutation	SNP	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.A12T	ENST00000375108.3	37	c.34	CCDS202.1	1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.847662	0.51164	.	.	ENSG00000127472	ENST00000375108	T	0.27557	1.66	4.39	3.47	0.39725	.	0.120476	0.37577	N	0.002031	T	0.29783	0.0744	M	0.65975	2.015	0.27137	N	0.961743	B	0.23058	0.079	B	0.15870	0.014	T	0.28933	-1.0028	10	0.66056	D	0.02	-4.0175	8.7071	0.34360	0.1098:0.0:0.8902:0.0	.	12	P39877	PA2G5_HUMAN	T	12	ENSP00000364249:A12T	ENSP00000364249:A12T	A	+	1	0	PLA2G5	20283944	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.355000	0.44107	1.152000	0.42452	0.655000	0.94253	GCT	PLA2G5	-	NULL	ENSG00000127472		0.522	PLA2G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G5	HGNC	protein_coding	OTTHUMT00000007668.1	-	0.00	74	0	G	NM_000929		20411357	+1	tier1	-	no_errors	ENST00000375108	ensembl	human	known	74_37	missense	27.59	42	16	SNP	1.000	A
PLEKHA2	59339	genome.wustl.edu	37	8	38827322	38827322	+	3'UTR	SNP	A	A	G	rs542324482	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr8:38827322A>G	ENST00000388745.4	+	0	1477				CTD-2544N14.3_ENST00000520863.1_RNA|PLEKHA2_ENST00000420274.1_3'UTR|PLEKHA2_ENST00000521746.1_Intron			Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2						positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			GTGCCATgggagggagggagg	0.517																																																	0													2.0	3.0	2.0					8																	38827322		1542	3370	4912	SO:0001624	3_prime_UTR_variant	0			AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000388745.4:c.*1474A>G	8.37:g.38827322A>G				RNA	SNP	-	NULL	ENST00000388745.4	37	NULL		8																																																																																			PLEKHA2	-	-	ENSG00000169499		0.517	PLEKHA2-001	KNOWN	basic	processed_transcript	PLEKHA2	HGNC	protein_coding	OTTHUMT00000377070.3	-	0.00	35	0	A	NM_021623		38827322	+1	tier1	-	no_errors	ENST00000388745	ensembl	human	known	74_37	rna	9.52	38	4	SNP	0.000	G
PMPCB	9512	genome.wustl.edu	37	7	102939017	102939017	+	Silent	SNP	A	A	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr7:102939017A>T	ENST00000249269.4	+	2	140	c.102A>T	c.(100-102)tcA>tcT	p.S34S	PMPCB_ENST00000428154.1_Silent_p.S34S|PMPCB_ENST00000420236.2_5'UTR	NM_004279.2	NP_004270.2	O75439	MPPB_HUMAN	peptidase (mitochondrial processing) beta	34					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(9)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCAACCAGTCATTATATTTTG	0.353																																																	0													171.0	170.0	170.0					7																	102939017		2203	4300	6503	SO:0001819	synonymous_variant	0			AF054182	CCDS5730.1	7q22.1	2007-07-30			ENSG00000105819	ENSG00000105819			9119	protein-coding gene	gene with protein product		603131				9653160	Standard	XM_005250717		Approved	MPPB, MPPP52	uc003vbl.3	O75439	OTTHUMG00000157205	ENST00000249269.4:c.102A>T	7.37:g.102939017A>T			O60416|Q96FV4	Silent	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.S34	ENST00000249269.4	37	c.102	CCDS5730.1	7																																																																																			PMPCB	-	NULL	ENSG00000105819		0.353	PMPCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMPCB	HGNC	protein_coding	OTTHUMT00000347913.1	-	0.00	57	0	A	NM_004279		102939017	+1	tier1	-	no_errors	ENST00000249269	ensembl	human	known	74_37	silent	31.94	49	23	SNP	0.000	T
PPAP2B	8613	genome.wustl.edu	37	1	56962230	56962230	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:56962230A>G	ENST00000371250.3	-	6	1480	c.929T>C	c.(928-930)aTg>aCg	p.M310T	PPAP2B_ENST00000459962.1_5'UTR	NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	310					Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						CACCTACATCATGTTGTGGTG	0.483																																																	0													166.0	151.0	156.0					1																	56962230		2203	4300	6503	SO:0001583	missense	0			AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.929T>C	1.37:g.56962230A>G	ENSP00000360296:p.Met310Thr		B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.M310T	ENST00000371250.3	37	c.929	CCDS604.1	1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.178574	0.38511	.	.	ENSG00000162407	ENST00000371250	T	0.30714	1.52	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.20901	0.0503	L	0.27053	0.805	0.53005	D	0.999964	B	0.25105	0.118	B	0.21151	0.033	T	0.05419	-1.0886	10	0.18710	T	0.47	.	13.6099	0.62071	1.0:0.0:0.0:0.0	.	310	O14495	LPP3_HUMAN	T	310	ENSP00000360296:M310T	ENSP00000360296:M310T	M	-	2	0	PPAP2B	56734818	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.095000	0.89535	2.080000	0.62538	0.533000	0.62120	ATG	PPAP2B	-	NULL	ENSG00000162407		0.483	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2B	HGNC	protein_coding	OTTHUMT00000022334.2	-	0.00	44	0	A	NM_003713		56962230	-1	tier1	-	no_errors	ENST00000371250	ensembl	human	known	74_37	missense	31.58	39	18	SNP	1.000	G
PTEN	5728	genome.wustl.edu	37	10	89720799	89720802	+	Frame_Shift_Del	DEL	TACT	TACT	-	rs146650273		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	TACT	TACT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr10:89720799_89720802delTACT	ENST00000371953.3	+	8	2307_2310	c.950_953delTACT	c.(949-954)gtacttfs	p.VL317fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	317	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.L318fs*2(19)|p.T319fs*1(12)|p.R55fs*1(5)|p.V317fs*3(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.V317fs*6(2)|p.G165_*404del(1)|p.L316fs*1(1)|p.W274_F341del(1)|p.V317_K322del(1)|p.L318F(1)|p.T318fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAATATCTAGTACTTACTTTAACA	0.333	V317fs*3(EVSAT_BREAST)|V317fs*3(IGROV1_OVARY)|V317fs*3(ISHIKAWAHERAKLIO02ER_ENDOMETRIUM)|V317fs*3(SKUT1_SOFT_TISSUE)	31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	91	Deletion - Frameshift(48)|Whole gene deletion(37)|Deletion - In frame(3)|Unknown(2)|Substitution - Missense(1)	endometrium(23)|central_nervous_system(18)|prostate(17)|breast(8)|skin(7)|ovary(5)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|soft_tissue(2)|urinary_tract(2)|thyroid(1)|large_intestine(1)																																								SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.950_953delTACT	10.37:g.89720803_89720806delTACT	ENSP00000361021:p.Val317fs		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.T319fs	ENST00000371953.3	37	c.950_953	CCDS31238.1	10																																																																																			PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom	ENSG00000171862		0.333	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1		0.00	79	0	TACT	NM_000314		89720802	+1	tier1		no_errors	ENST00000371953	ensembl	human	known	74_37	frame_shift_del	31.88	47	22	DEL	1.000:1.000:1.000:1.000	-
PTK7	5754	genome.wustl.edu	37	6	43127622	43127622	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:43127622G>T	ENST00000230419.4	+	19	3191	c.2970G>T	c.(2968-2970)tgG>tgT	p.W990C	PTK7_ENST00000481273.1_Missense_Mutation_p.W998C|PTK7_ENST00000352931.2_Missense_Mutation_p.W934C|PTK7_ENST00000345201.2_Missense_Mutation_p.W950C|PTK7_ENST00000349241.2_Missense_Mutation_p.W860C	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	990	Interaction with CTNNB1.|Protein kinase; inactive. {ECO:0000255|PROSITE-ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.W990C(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			CTGATGTCTGGGCCTTCGGTG	0.592																																																	1	Substitution - Missense(1)	lung(1)											158.0	126.0	137.0					6																	43127622		2203	4300	6503	SO:0001583	missense	0			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.2970G>T	6.37:g.43127622G>T	ENSP00000230419:p.Trp990Cys		A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Immunoglobulin,pfam_Prot_kinase_dom,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.W990C	ENST00000230419.4	37	c.2970	CCDS4884.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.877959|4.877959	0.91664|0.91664	.|.	.|.	ENSG00000112655|ENSG00000112655	ENST00000489707|ENST00000230419;ENST00000325774;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273	.|D;D;D;D;D	.|0.94576	.|-3.46;-3.46;-3.46;-3.46;-3.46	5.59|5.59	5.59|5.59	0.84812|0.84812	.|Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98298|0.98298	0.9436|0.9436	H|H	0.95260|0.95260	3.645|3.645	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D	.|0.97110	.|0.999;0.999;1.0;0.999;1.0;0.999;0.999	D|D	0.98880|0.98880	1.0769|1.0769	5|10	.|0.87932	.|D	.|0	.|.	19.9407|19.9407	0.97162|0.97162	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|998;316;335;860;950;934;990	.|E9PFZ5;F8W9X8;B3KP36;Q13308-3;Q13308-2;Q13308-4;Q13308	.|.;.;.;.;.;.;PTK7_HUMAN	V|C	285|990;316;860;934;950;998	.|ENSP00000230419:W990C;ENSP00000325462:W860C;ENSP00000326029:W934C;ENSP00000325992:W950C;ENSP00000418754:W998C	.|ENSP00000230419:W990C	G|W	+|+	2|3	0|0	PTK7|PTK7	43235600|43235600	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.758000|9.758000	0.98927|0.98927	2.787000|2.787000	0.95880|0.95880	0.591000|0.591000	0.81541|0.81541	GGG|TGG	PTK7	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000112655		0.592	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK7	HGNC	protein_coding	OTTHUMT00000040580.2		0.00	35	0	G			43127622	+1			no_errors	ENST00000230419	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
RABL6	55684	genome.wustl.edu	37	9	139726379	139726379	+	Intron	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr9:139726379G>A	ENST00000311502.7	+	6	835				MIR4292_ENST00000585012.1_RNA|RABL6_ENST00000357466.2_Intron|RABL6_ENST00000371671.4_Intron|RABL6_ENST00000371663.4_Intron|RABL6_ENST00000432842.2_Intron|RABL6_ENST00000466096.1_3'UTR|RABL6_ENST00000371675.3_Intron|RP11-216L13.18_ENST00000471502.1_RNA			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6						small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										GGAGGGTGCTGAGGCAGAGGC	0.692																																																	0																																										SO:0001627	intron_variant	0			AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.599+66G>A	9.37:g.139726379G>A			A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	RNA	SNP	-	NULL	ENST00000311502.7	37	NULL	CCDS48058.1	9																																																																																			RABL6	-	-	ENSG00000196642		0.692	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL6	HGNC	protein_coding	OTTHUMT00000055141.4	-	0.00	32	0	G	NM_024718		139726379	+1	tier1	-	no_errors	ENST00000466096	ensembl	human	known	74_37	rna	55.17	13	16	SNP	0.000	A
RAPGEF5	9771	genome.wustl.edu	37	7	22355070	22355070	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr7:22355070G>T	ENST00000405243.1	-	3	391	c.308C>A	c.(307-309)gCa>gAa	p.A103E	RAPGEF5_ENST00000344041.6_5'UTR			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	0	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						TGCTCTTCCTGCACAAGAAGA	0.353																																																	0																																										SO:0001583	missense	0			D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000405243.1:c.308C>A	7.37:g.22355070G>T	ENSP00000384870:p.Ala103Glu		A4D140|Q8IXU5	Missense_Mutation	SNP	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.A103E	ENST00000405243.1	37	c.308		7	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985442	0.93044	.	.	ENSG00000136237	ENST00000405243	T	0.14640	2.49	5.57	5.57	0.84162	.	.	.	.	.	T	0.38188	0.1031	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.12400	-1.0549	6	0.87932	D	0	.	19.5456	0.95295	0.0:0.0:1.0:0.0	.	.	.	.	E	103	ENSP00000384870:A103E	ENSP00000384870:A103E	A	-	2	0	RAPGEF5	22321595	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.057000	0.76669	2.620000	0.88729	0.655000	0.94253	GCA	RAPGEF5	-	NULL	ENSG00000136237		0.353	RAPGEF5-002	PUTATIVE	basic	protein_coding	RAPGEF5	HGNC	protein_coding	OTTHUMT00000326591.1	-	0.00	45	0	G	NM_012294		22355070	-1	tier1	-	no_errors	ENST00000405243	ensembl	human	putative	74_37	missense	6.78	55	4	SNP	1.000	T
RARS2	57038	genome.wustl.edu	37	6	88226573	88226573	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:88226573A>C	ENST00000369536.5	-	18	1582	c.1537T>G	c.(1537-1539)Tct>Gct	p.S513A	RARS2_ENST00000497828.1_5'Flank	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	513					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		AAGTCCTGAGATGATTTATAA	0.368																																																	0													122.0	113.0	116.0					6																	88226573		2203	4300	6503	SO:0001583	missense	0			AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.1537T>G	6.37:g.88226573A>C	ENSP00000358549:p.Ser513Ala		B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	pfam_Arg-tRNA-synth_Ia_core,pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Arg-tRNA-synth_N,smart_DALR_anticod-bd,prints_Arg-tRNA-synth_Ia_core,tigrfam_Arg-tRNA-ligase_Ia	p.S513A	ENST00000369536.5	37	c.1537	CCDS5011.1	6	.	.	.	.	.	.	.	.	.	.	A	3.922	-0.017860	0.07681	.	.	ENSG00000146282	ENST00000369536	T	0.72282	-0.64	5.37	4.2	0.49525	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);DALR anticodon binding (2);	0.161766	0.56097	D	0.000024	T	0.20861	0.0502	N	0.03209	-0.39	0.36416	D	0.864042	B	0.12013	0.005	B	0.12156	0.007	T	0.15065	-1.0450	10	0.02654	T	1	.	11.6064	0.51035	0.8513:0.1487:0.0:0.0	.	513	Q5T160	SYRM_HUMAN	A	513	ENSP00000358549:S513A	ENSP00000358549:S513A	S	-	1	0	RARS2	88283292	0.998000	0.40836	0.950000	0.38849	0.226000	0.24999	2.944000	0.49034	0.970000	0.38263	0.528000	0.53228	TCT	RARS2	-	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd,tigrfam_Arg-tRNA-ligase_Ia	ENSG00000146282		0.368	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS2	HGNC	protein_coding	OTTHUMT00000041448.1	-	0.00	44	0	A	NM_020320		88226573	-1	tier1	-	no_errors	ENST00000369536	ensembl	human	known	74_37	missense	21.88	50	14	SNP	0.997	C
RASIP1	54922	genome.wustl.edu	37	19	49230042	49230042	+	Splice_Site	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:49230042C>T	ENST00000222145.4	-	8	2331	c.2127G>A	c.(2125-2127)aaG>aaA	p.K709K	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	709	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		AAGGGCCAACCTTGGTGAGGT	0.458																																																	0													164.0	111.0	129.0					19																	49230042		2203	4300	6503	SO:0001630	splice_region_variant	0			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2127+1G>A	19.37:g.49230042C>T			Q6U676	Silent	SNP	pfam_Dil_domain,pfam_Ras-assoc,superfamily_SMAD_FHA_domain,smart_Ras-assoc,pfscan_Dilute,pfscan_Ras-assoc	p.K709	ENST00000222145.4	37	c.2127	CCDS12731.1	19																																																																																			RASIP1	-	pfscan_Dilute	ENSG00000105538		0.458	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASIP1	HGNC	protein_coding	OTTHUMT00000466185.1		0.00	10	0	C	NM_017805	Silent	49230042	-1			no_errors	ENST00000222145	ensembl	human	known	74_37	silent	35.71	9	5	SNP	1.000	T
RB1	5925	genome.wustl.edu	37	13	48947603	48947603	+	Nonsense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr13:48947603C>G	ENST00000267163.4	+	12	1328	c.1190C>G	c.(1189-1191)tCa>tGa	p.S397*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	397	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.S397fs*1(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GATCAACCTTCAGAAAATCTG	0.289		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	25	Whole gene deletion(15)|Unknown(8)|Deletion - Frameshift(2)	bone(11)|breast(5)|central_nervous_system(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	GRCh37	CM961227	RB1	M							100.0	107.0	105.0					13																	48947603		2203	4289	6492	SO:0001587	stop_gained	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1190C>G	13.37:g.48947603C>G	ENSP00000267163:p.Ser397*		A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.S397*	ENST00000267163.4	37	c.1190	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	38	6.895619	0.97916	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4822	0.95014	0.0:1.0:0.0:0.0	.	.	.	.	X	376;397	.	ENSP00000267163:S397X	S	+	2	0	RB1	47845604	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.779000	0.68948	2.612000	0.88384	0.563000	0.77884	TCA	RB1	-	pfam_RB_A,superfamily_Cyclin-like	ENSG00000139687		0.289	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	-	0.00	36	0	C			48947603	+1	tier1	-	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	37.50	30	18	SNP	1.000	G
RDH13	112724	genome.wustl.edu	37	19	55570631	55570631	+	Silent	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:55570631G>T	ENST00000415061.3	-	2	221	c.78C>A	c.(76-78)acC>acA	p.T26T	RDH13_ENST00000396247.3_5'UTR	NM_001145971.1	NP_001139443.1	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 (all-trans/9-cis)	26					eye photoreceptor cell development (GO:0042462)|response to high light intensity (GO:0009644)|retina layer formation (GO:0010842)	mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	AAGCCCCACCGGTGACATAGT	0.627																																																	0													25.0	24.0	24.0					19																	55570631		1567	3581	5148	SO:0001819	synonymous_variant	0				CCDS42627.1, CCDS54320.1	19q13.42	2011-09-14	2006-05-09			ENSG00000160439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19978	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 3"""		"""retinol dehydrogenase 13 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_138412		Approved	SDR7C3	uc002qio.3	Q8NBN7		ENST00000415061.3:c.78C>A	19.37:g.55570631G>T			Q6UX79|Q96G88	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.T26	ENST00000415061.3	37	c.78	CCDS54320.1	19																																																																																			RDH13	-	NULL	ENSG00000160439		0.627	RDH13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH13	HGNC	protein_coding	OTTHUMT00000451470.1		0.00	31	0	G	NM_138412		55570631	-1			no_errors	ENST00000415061	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.000	T
RIMBP2	23504	genome.wustl.edu	37	12	130921701	130921701	+	Missense_Mutation	SNP	C	C	T	rs139344487		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:130921701C>T	ENST00000261655.4	-	10	1904	c.1741G>A	c.(1741-1743)Gtt>Att	p.V581I	RIMBP2_ENST00000536002.1_Missense_Mutation_p.V489I|RIMBP2_ENST00000535703.1_Missense_Mutation_p.V489I	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	581	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.V581I(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCGGGGGGAACGGCAGCAACT	0.662													C|||	1	0.000199681	0.0	0.0014	5008	,	,		12608	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	central_nervous_system(1)						C	ILE/VAL	0,4396		0,0,2198	32.0	27.0	29.0		1741	-0.4	0.4	12	dbSNP_134	29	12,8580		0,12,4284	yes	missense	RIMBP2	NM_015347.4	29	0,12,6482	TT,TC,CC		0.1397,0.0,0.0924	benign	581/1053	130921701	12,12976	2198	4296	6494	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1741G>A	12.37:g.130921701C>T	ENSP00000261655:p.Val581Ile		Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.V581I	ENST00000261655.4	37	c.1741	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.791940	0.00623	0.0	0.001397	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.30981	1.51;1.51;1.51	4.63	-0.405	0.12392	Fibronectin, type III (2);	0.055124	0.64402	N	0.000001	T	0.05090	0.0136	N	0.00224	-1.81	0.21878	N	0.999499	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.41980	-0.9478	10	0.02654	T	1	-12.8031	8.6509	0.34033	0.0:0.288:0.0:0.712	.	489;489;581	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	I	581;489;489;489	ENSP00000261655:V581I;ENSP00000440347:V489I;ENSP00000439159:V489I	ENSP00000261655:V581I	V	-	1	0	RIMBP2	129487654	1.000000	0.71417	0.405000	0.26409	0.009000	0.06853	1.767000	0.38501	-0.353000	0.08224	-0.367000	0.07326	GTT	RIMBP2	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000060709		0.662	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	-	0.00	21	0	C	NM_015347		130921701	-1	tier1	rs139344487	no_errors	ENST00000261655	ensembl	human	known	74_37	missense	22.86	27	8	SNP	0.959	T
RIMS2	9699	genome.wustl.edu	37	8	104898082	104898082	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr8:104898082C>T	ENST00000436393.2	+	2	830	c.589C>T	c.(589-591)Cag>Tag	p.Q197*	RIMS2_ENST00000406091.3_Nonsense_Mutation_p.Q419*|RIMS2_ENST00000507740.1_Nonsense_Mutation_p.Q227*|RIMS2_ENST00000262231.10_Nonsense_Mutation_p.Q227*			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	450					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.Q227K(2)|p.Q197K(1)|p.Q455K(1)|p.Q419K(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCGAGAGGCTCAGGGACCAAG	0.478										HNSCC(12;0.0054)																																							5	Substitution - Missense(5)	kidney(5)											77.0	73.0	74.0					8																	104898082		1928	4139	6067	SO:0001587	stop_gained	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.589C>T	8.37:g.104898082C>T	ENSP00000390665:p.Gln197*		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Nonsense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.Q419*	ENST00000436393.2	37	c.1255		8	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617226	0.87359	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	19.7233	0.96151	0.0:1.0:0.0:0.0	.	.	.	.	X	419;450;419;450;227;227;227;227;197	.	ENSP00000262231:Q227X	Q	+	1	0	RIMS2	104967258	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.060000	0.64312	2.653000	0.90120	0.563000	0.77884	CAG	RIMS2	-	NULL	ENSG00000176406		0.478	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1		0.00	15	0	C	NM_001100117		104898082	+1			no_errors	ENST00000406091	ensembl	human	known	74_37	nonsense	8.33	22	2	SNP	1.000	T
RLTPR	146206	genome.wustl.edu	37	16	67690174	67690174	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr16:67690174C>G	ENST00000334583.6	+	34	4114	c.3786C>G	c.(3784-3786)atC>atG	p.I1262M	RLTPR_ENST00000545661.1_Missense_Mutation_p.I1226M	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	1262					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		CCATCTCGATCAAGTCCCGCA	0.577																																																	0													138.0	137.0	137.0					16																	67690174		2042	4188	6230	SO:0001583	missense	0			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.3786C>G	16.37:g.67690174C>G	ENSP00000334958:p.Ile1262Met		B8X2Z3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.I1262M	ENST00000334583.6	37	c.3786	CCDS45513.1	16	.	.	.	.	.	.	.	.	.	.	C	7.241	0.601212	0.13939	.	.	ENSG00000159753	ENST00000334583;ENST00000398282;ENST00000545661	T;T	0.13657	2.57;2.57	5.1	0.395	0.16304	.	0.248699	0.28815	N	0.014052	T	0.05318	0.0141	N	0.08118	0	0.27785	N	0.943016	B;P	0.34546	0.001;0.456	B;B	0.28553	0.002;0.091	T	0.29671	-1.0004	10	0.45353	T	0.12	-21.2948	7.6859	0.28540	0.0:0.3867:0.4451:0.1682	.	1226;1262	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	M	1262;359;1226	ENSP00000334958:I1262M;ENSP00000441481:I1226M	ENSP00000334958:I1262M	I	+	3	3	RLTPR	66247675	0.999000	0.42202	0.892000	0.35008	0.569000	0.35902	0.392000	0.20801	-0.063000	0.13065	-0.440000	0.05779	ATC	RLTPR	-	NULL	ENSG00000159753		0.577	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1	-	0.00	31	0	C	NM_001013838		67690174	+1	tier1	-	no_errors	ENST00000334583	ensembl	human	known	74_37	missense	32.35	23	11	SNP	0.943	G
RNF111	54778	genome.wustl.edu	37	15	59359099	59359099	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr15:59359099T>G	ENST00000557998.1	+	6	1790	c.1503T>G	c.(1501-1503)caT>caG	p.H501Q	RNF111_ENST00000348370.4_Missense_Mutation_p.H501Q|RNF111_ENST00000559209.1_Missense_Mutation_p.H501Q|RNF111_ENST00000561186.1_Missense_Mutation_p.H501Q|RNF111_ENST00000434298.1_Missense_Mutation_p.H501Q	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	501	His-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		GACATCCTCATACAAGTTGCT	0.517																																					NSCLC(72;983 1365 10746 34387 47081)												0													268.0	186.0	214.0					15																	59359099		2192	4291	6483	SO:0001583	missense	0			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1503T>G	15.37:g.59359099T>G	ENSP00000452732:p.His501Gln		C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H501Q	ENST00000557998.1	37	c.1503	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	T	14.67	2.606223	0.46527	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.26660	1.72;1.73	5.59	-3.81	0.04294	.	0.000000	0.85682	D	0.000000	T	0.34542	0.0901	L	0.32530	0.975	0.29777	N	0.834307	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.991;0.996	T	0.33007	-0.9885	10	0.72032	D	0.01	-11.9885	14.5675	0.68188	0.0:0.2733:0.0:0.7267	.	501;501;501	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	Q	501	ENSP00000288199:H501Q;ENSP00000393641:H501Q	ENSP00000288199:H501Q	H	+	3	2	RNF111	57146391	0.004000	0.15560	0.028000	0.17463	0.498000	0.33706	-0.086000	0.11233	-1.197000	0.02673	0.374000	0.22700	CAT	RNF111	-	NULL	ENSG00000157450		0.517	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	HGNC	protein_coding	OTTHUMT00000416012.1	-	0.00	33	0	T	NM_017610		59359099	+1	tier1	-	no_errors	ENST00000434298	ensembl	human	known	74_37	missense	31.25	21	10	SNP	0.032	G
ROBO1	6091	genome.wustl.edu	37	3	78680436	78680436	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:78680436delT	ENST00000464233.1	-	25	3614	c.3501delA	c.(3499-3501)aaafs	p.K1167fs	ROBO1_ENST00000495273.1_Frame_Shift_Del_p.K1122fs|ROBO1_ENST00000436010.2_Frame_Shift_Del_p.K1128fs|ROBO1_ENST00000467549.1_Frame_Shift_Del_p.K1067fs	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1167					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TTCTTGCCCCTTTCTTGTGCC	0.458																																																	0													146.0	144.0	145.0					3																	78680436		2044	4182	6226	SO:0001589	frameshift_variant	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3501delA	3.37:g.78680436delT	ENSP00000420321:p.Lys1167fs		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A1169fs	ENST00000464233.1	37	c.3501	CCDS54611.1	3																																																																																			ROBO1	-	NULL	ENSG00000169855		0.458	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1		0.00	59	0	T	NM_002941		78680436	-1	tier1		no_errors	ENST00000464233	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	1.000	-
ROPN1L	83853	genome.wustl.edu	37	5	10448476	10448476	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:10448476T>C	ENST00000503804.1	+	3	757	c.236T>C	c.(235-237)cTg>cCg	p.L79P	ROPN1L_ENST00000274134.4_Missense_Mutation_p.L79P|ROPN1L_ENST00000510520.1_3'UTR			Q96C74	ROP1L_HUMAN	rhophilin associated tail protein 1-like	79					epithelial cilium movement (GO:0003351)|regulation of protein phosphorylation (GO:0001932)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)	14						CAAGGACTCCTGAAAGTTTTG	0.532																																																	0													60.0	60.0	60.0					5																	10448476		2203	4300	6503	SO:0001583	missense	0			AF239723	CCDS3879.1	5p15	2011-01-20	2011-01-20		ENSG00000145491	ENSG00000145491			24060	protein-coding gene	gene with protein product	"""radial spoke head 11 homolog (Chlamydomonas)"""	611756	"""ropporin 1-like"""			11278869	Standard	NM_031916		Approved	ASP, FLJ25776, RSPH11	uc021xwo.1	Q96C74	OTTHUMG00000090507	ENST00000503804.1:c.236T>C	5.37:g.10448476T>C	ENSP00000421405:p.Leu79Pro		D3DTC9|Q9BZX0	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.L79P	ENST00000503804.1	37	c.236	CCDS3879.1	5	.	.	.	.	.	.	.	.	.	.	T	17.71	3.457360	0.63401	.	.	ENSG00000145491	ENST00000503804;ENST00000274134	T;T	0.21734	1.99;1.99	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000001	T	0.52240	0.1722	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.60915	-0.7168	10	0.87932	D	0	-13.2929	14.575	0.68240	0.0:0.0:0.0:1.0	.	79	Q96C74	ROP1L_HUMAN	P	79	ENSP00000421405:L79P;ENSP00000274134:L79P	ENSP00000274134:L79P	L	+	2	0	ROPN1L	10501476	1.000000	0.71417	0.204000	0.23530	0.659000	0.38960	6.727000	0.74764	2.084000	0.62774	0.533000	0.62120	CTG	ROPN1L	-	NULL	ENSG00000145491		0.532	ROPN1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ROPN1L	HGNC	protein_coding	OTTHUMT00000367033.1	-	0.00	39	0	T	NM_031916		10448476	+1	tier1	-	no_errors	ENST00000274134	ensembl	human	known	74_37	missense	23.33	46	14	SNP	0.996	C
RSPH6A	81492	genome.wustl.edu	37	19	46299149	46299149	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:46299149T>C	ENST00000221538.3	-	6	2274	c.2132A>G	c.(2131-2133)gAg>gGg	p.E711G	RSPH6A_ENST00000600188.1_Missense_Mutation_p.E447G|RSPH6A_ENST00000597055.1_3'UTR	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	711	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						ctcctcgccctcctcctcctc	0.557																																																	0													71.0	74.0	73.0					19																	46299149		2202	4300	6502	SO:0001583	missense	0			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.2132A>G	19.37:g.46299149T>C	ENSP00000221538:p.Glu711Gly		Q53FE2|Q6PEZ9	Missense_Mutation	SNP	pfam_Radial_spoke	p.E711G	ENST00000221538.3	37	c.2132	CCDS12675.1	19	.	.	.	.	.	.	.	.	.	.	t	13.10	2.135003	0.37728	.	.	ENSG00000104941	ENST00000221538	T	0.17528	2.27	4.16	4.16	0.48862	.	0.118988	0.56097	D	0.000036	T	0.37758	0.1015	M	0.67953	2.075	0.40521	D	0.980837	D	0.89917	1.0	D	0.83275	0.996	T	0.23655	-1.0182	10	0.62326	D	0.03	-8.1457	11.5188	0.50539	0.0:0.0:0.0:1.0	.	711	Q9H0K4	RSH6A_HUMAN	G	711	ENSP00000221538:E711G	ENSP00000221538:E711G	E	-	2	0	RSPH6A	50990989	1.000000	0.71417	0.719000	0.30619	0.052000	0.14988	5.577000	0.67444	1.891000	0.54761	0.451000	0.29950	GAG	RSPH6A	-	NULL	ENSG00000104941		0.557	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1	-	0.00	27	0	T			46299149	-1	tier1	-	no_errors	ENST00000221538	ensembl	human	known	74_37	missense	9.09	50	5	SNP	1.000	C
SAMD3	154075	genome.wustl.edu	37	6	130496985	130496985	+	Splice_Site	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:130496985C>G	ENST00000368134.2	-	10	1431		c.e10+1		SAMD3_ENST00000437477.2_Splice_Site|SAMD3_ENST00000457563.2_Splice_Site|SAMD3_ENST00000439090.2_Splice_Site|SAMD3_ENST00000532763.1_Splice_Site|SAMD3_ENST00000533296.1_5'Flank	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3											breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		TTCAATCTTACTTTTATCTGG	0.269																																																	0													73.0	78.0	76.0					6																	130496985		2202	4300	6502	SO:0001630	splice_region_variant	0			AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.822+1G>C	6.37:g.130496985C>G			B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Splice_Site	SNP	-	e6+1	ENST00000368134.2	37	c.822+1	CCDS34539.1	6	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680801	0.68042	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477;ENST00000532763	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9821	0.89145	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SAMD3	130538678	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.019000	0.64060	2.677000	0.91161	0.655000	0.94253	.	SAMD3	-	-	ENSG00000164483		0.269	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD3	HGNC	protein_coding	OTTHUMT00000042197.3	-	0.00	51	0	C	NM_152552	Intron	130496985	-1	tier1	-	no_errors	ENST00000368134	ensembl	human	known	74_37	splice_site	38.89	33	21	SNP	1.000	G
SCAMP4	113178	genome.wustl.edu	37	19	1924143	1924143	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:1924143C>T	ENST00000316097.8	+	7	817	c.550C>T	c.(550-552)Cag>Tag	p.Q184*	SCAMP4_ENST00000414057.2_3'UTR|SCAMP4_ENST00000409472.1_Nonsense_Mutation_p.Q150*	NM_079834.2	NP_524558.1	Q969E2	SCAM4_HUMAN	secretory carrier membrane protein 4	184					protein transport (GO:0015031)	integral component of membrane (GO:0016021)							Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGAAGCTTCCAGAAGGCACA	0.627																																																	0													37.0	44.0	42.0					19																	1924143		2019	4170	6189	SO:0001587	stop_gained	0			AK091166	CCDS45903.1	19p13.3	2013-02-21			ENSG00000227500	ENSG00000227500		"""Secretory carrier membrane proteins"""	30385	protein-coding gene	gene with protein product		613764					Standard	NM_079834		Approved	FLJ33847	uc002luj.4	Q969E2	OTTHUMG00000154590	ENST00000316097.8:c.550C>T	19.37:g.1924143C>T	ENSP00000316007:p.Gln184*		Q8N2N1|Q8NAV0	Nonsense_Mutation	SNP	pfam_SCAMP	p.Q184*	ENST00000316097.8	37	c.550	CCDS45903.1	19	.	.	.	.	.	.	.	.	.	.	c	34	5.363309	0.95877	.	.	ENSG00000227500	ENST00000316097;ENST00000409472	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-7.9929	12.3375	0.55075	0.1689:0.8311:0.0:0.0	.	.	.	.	X	184;150	.	ENSP00000316007:Q184X	Q	+	1	0	SCAMP4	1875143	0.999000	0.42202	1.000000	0.80357	0.863000	0.49368	1.078000	0.30754	2.301000	0.77427	0.462000	0.41574	CAG	SCAMP4	-	NULL	ENSG00000227500		0.627	SCAMP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP4	HGNC	protein_coding	OTTHUMT00000336210.3	-	0.00	44	0	C	NM_079834		1924143	+1	tier1	-	no_errors	ENST00000316097	ensembl	human	known	74_37	nonsense	6.67	70	5	SNP	1.000	T
SCARNA2	677766	genome.wustl.edu	37	1	109643003	109643003	+	lincRNA	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:109643003G>C	ENST00000458748.1	+	0	189					NR_003023.1				small Cajal body-specific RNA 2																		GATCTTATTTGATCGGATCGT	0.657																																																	0													46.0	47.0	47.0					1																	109643003		876	1991	2867			0			BK005568		1q13.1	2013-09-05			ENSG00000238881	ENSG00000270066		"""ncRNAs / Small nucleolar RNAs : Small cajal body-specific"""	32558	non-coding RNA	RNA, small nucleolar						15556860	Standard	NR_003023		Approved	mgU2-25/61, HBII-382	uc001dwo.1				1.37:g.109643003G>C				RNA	SNP	-	NULL	ENST00000458748.1	37	NULL		1																																																																																			SCARNA2	-	-	ENSG00000270066		0.657	SCARNA2-201	KNOWN	basic	snoRNA	SCARNA2	HGNC	lincRNA		-	0.00	24	0	G	NR_003023		109643003	+1	tier1	-	no_errors	ENST00000458748	ensembl	human	known	74_37	rna	30.43	16	7	SNP	1.000	C
SCN8A	6334	genome.wustl.edu	37	12	52200368	52200368	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:52200368C>G	ENST00000354534.6	+	27	5276	c.5098C>G	c.(5098-5100)Caa>Gaa	p.Q1700E	SCN8A_ENST00000545061.1_Missense_Mutation_p.Q1659E	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1700					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CTGCCTGTTTCAAATCACAAC	0.493																																																	0													103.0	104.0	103.0					12																	52200368		2203	4300	6503	SO:0001583	missense	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5098C>G	12.37:g.52200368C>G	ENSP00000346534:p.Gln1700Glu		B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.Q1700E	ENST00000354534.6	37	c.5098	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	C	9.971	1.225418	0.22457	.	.	ENSG00000196876	ENST00000354534;ENST00000545061	D;D	0.97529	-4.42;-4.42	5.31	5.31	0.75309	Ion transport (1);	0.090446	0.85682	D	0.000000	D	0.97219	0.9091	L	0.55213	1.73	0.48452	D	0.999651	P	0.51351	0.944	P	0.53224	0.721	D	0.97365	0.9972	10	0.66056	D	0.02	.	19.5591	0.95366	0.0:1.0:0.0:0.0	.	1700	Q9UQD0	SCN8A_HUMAN	E	1700;1659	ENSP00000346534:Q1700E;ENSP00000440360:Q1659E	ENSP00000346534:Q1700E	Q	+	1	0	SCN8A	50486635	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.844000	0.69430	2.937000	0.99478	0.650000	0.86243	CAA	SCN8A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000196876		0.493	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	-	0.00	47	0	C	NM_014191		52200368	+1	tier1	-	no_errors	ENST00000354534	ensembl	human	known	74_37	missense	23.53	39	12	SNP	1.000	G
SCYL1	57410	genome.wustl.edu	37	11	65300209	65300209	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr11:65300209A>T	ENST00000270176.5	+	9	1240	c.1163A>T	c.(1162-1164)cAg>cTg	p.Q388L	SCYL1_ENST00000279270.6_Missense_Mutation_p.Q388L|SCYL1_ENST00000420247.2_Missense_Mutation_p.Q388L|SCYL1_ENST00000525364.1_Missense_Mutation_p.Q388L|SCYL1_ENST00000524944.1_Missense_Mutation_p.Q388L|SCYL1_ENST00000533862.1_Missense_Mutation_p.Q388L|SCYL1_ENST00000527009.1_Missense_Mutation_p.Q245L	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	388					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						GTCAACACCCAGATCTTCCCC	0.602																																																	0													114.0	130.0	125.0					11																	65300209		2162	4249	6411	SO:0001583	missense	0			AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.1163A>T	11.37:g.65300209A>T	ENSP00000270176:p.Gln388Leu		A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.Q388L	ENST00000270176.5	37	c.1163	CCDS41672.1	11	.	.	.	.	.	.	.	.	.	.	A	18.70	3.681087	0.68042	.	.	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000527009	T;T;T;T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35	4.18	4.18	0.49190	Armadillo-like helical (1);Armadillo-type fold (1);	0.200358	0.44285	D	0.000474	T	0.27063	0.0663	M	0.82517	2.595	0.80722	D	1	B;P;P;B;B	0.40553	0.241;0.721;0.534;0.228;0.446	B;B;B;B;B	0.41571	0.104;0.36;0.283;0.211;0.197	T	0.13361	-1.0512	10	0.72032	D	0.01	-11.8788	11.4726	0.50278	1.0:0.0:0.0:0.0	.	388;388;388;388;388	E9PS17;Q96KG9-4;Q96KG9-6;Q96KG9-2;Q96KG9	.;.;.;.;NTKL_HUMAN	L	388;388;388;388;388;388;388;388;245	ENSP00000270176:Q388L;ENSP00000431635:Q388L;ENSP00000408192:Q388L;ENSP00000437254:Q388L;ENSP00000433450:Q388L;ENSP00000279270:Q388L;ENSP00000432175:Q388L;ENSP00000436993:Q245L	ENSP00000270176:Q388L	Q	+	2	0	SCYL1	65056785	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.320000	0.72876	1.684000	0.51022	0.379000	0.24179	CAG	SCYL1	-	superfamily_ARM-type_fold	ENSG00000142186		0.602	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL1	HGNC	protein_coding	OTTHUMT00000389159.2	-	0.00	35	0	A	NM_020680		65300209	+1	tier1	-	no_errors	ENST00000270176	ensembl	human	known	74_37	missense	15.22	39	7	SNP	1.000	T
SOX7	83595	genome.wustl.edu	37	8	10584082	10584082	+	Silent	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr8:10584082G>A	ENST00000304501.1	-	2	411	c.333C>T	c.(331-333)aaC>aaT	p.N111N	SOX7_ENST00000553390.1_Silent_p.N163N|CTD-2135J3.3_ENST00000506149.2_RNA|SOX7_ENST00000554914.1_Silent_p.N163N	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	111					endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		GGTACTTGTAGTTGGGGTAGT	0.662																																																	0													45.0	49.0	48.0					8																	10584082		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.333C>T	8.37:g.10584082G>A			B4DKV0|Q53YD0	Silent	SNP	pfam_Sox_C_TAD,pfam_G_patch_dom,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_HMG_box_dom	p.N163	ENST00000304501.1	37	c.489	CCDS5977.1	8																																																																																			SOX7	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000171056		0.662	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX7	HGNC	protein_coding	OTTHUMT00000207131.1	-	0.00	35	0	G			10584082	-1	tier1	-	no_errors	ENST00000553390	ensembl	human	known	74_37	silent	32.26	21	10	SNP	1.000	A
SPRY4	81848	genome.wustl.edu	37	5	141693968	141693968	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr5:141693968A>G	ENST00000434127.2	-	2	949	c.706T>C	c.(706-708)Tcc>Ccc	p.S236P	SPRY4_ENST00000503582.1_5'Flank|SPRY4_ENST00000344120.4_Missense_Mutation_p.S259P	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	236	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCATGAAGGACCAGCGGGCG	0.667									Testicular Cancer, Familial Clustering of																																								0													67.0	66.0	66.0					5																	141693968		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.706T>C	5.37:g.141693968A>G	ENSP00000399468:p.Ser236Pro		A4FVB2|A4FVB3|Q6QIX2|Q9C003	Missense_Mutation	SNP	pfam_Sprouty	p.S259P	ENST00000434127.2	37	c.775	CCDS47296.1	5	.	.	.	.	.	.	.	.	.	.	A	16.55	3.154958	0.57259	.	.	ENSG00000187678	ENST00000344120;ENST00000434127	T;T	0.64438	-0.1;-0.1	4.92	4.92	0.64577	.	0.061176	0.64402	D	0.000002	T	0.67822	0.2934	L	0.53249	1.67	0.51233	D	0.999917	D	0.53462	0.96	P	0.56514	0.8	T	0.65463	-0.6162	10	0.30078	T	0.28	-30.4589	11.9781	0.53105	0.8559:0.1441:0.0:0.0	.	236	Q9C004	SPY4_HUMAN	P	259;236	ENSP00000344967:S259P;ENSP00000399468:S236P	ENSP00000344967:S259P	S	-	1	0	SPRY4	141674152	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.755000	0.68750	2.051000	0.60960	0.459000	0.35465	TCC	SPRY4	-	pfam_Sprouty	ENSG00000187678		0.667	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY4	HGNC	protein_coding	OTTHUMT00000370652.1	-	0.00	21	0	A			141693968	-1	tier1	-	no_errors	ENST00000344120	ensembl	human	known	74_37	missense	57.58	14	19	SNP	1.000	G
SPTLC3	55304	genome.wustl.edu	37	20	13029863	13029863	+	Intron	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr20:13029863C>T	ENST00000399002.2	+	2	577				SPTLC3_ENST00000476791.1_3'UTR|SPTLC3_ENST00000378194.4_Intron	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3						small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						GGTGCAGATCCTAGAAAGCAT	0.443																																																	0													138.0	116.0	123.0					20																	13029863		692	1591	2283	SO:0001627	intron_variant	0			AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.303+85C>T	20.37:g.13029863C>T			A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	RNA	SNP	-	NULL	ENST00000399002.2	37	NULL	CCDS13115.2	20																																																																																			SPTLC3	-	-	ENSG00000172296		0.443	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC3	HGNC	protein_coding	OTTHUMT00000254544.1	-	0.00	38	0	C	NM_018327		13029863	+1	tier1	-	no_errors	ENST00000476791	ensembl	human	known	74_37	rna	13.95	37	6	SNP	0.000	T
SUV420H2	84787	genome.wustl.edu	37	19	55853280	55853280	+	5'UTR	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:55853280G>C	ENST00000255613.3	+	0	224				AC020922.1_ENST00000539076.1_5'UTR|SUV420H2_ENST00000402499.4_3'UTR	NM_032701.3	NP_116090.2	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2 (Drosophila)						histone H4-K20 trimethylation (GO:0034773)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	4	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CTCTCTGCCAGAGGCAGCATG	0.667																																																	0													56.0	52.0	53.0					19																	55853280		2203	4298	6501	SO:0001623	5_prime_UTR_variant	0			BC005842	CCDS12922.1	19q13.42	2011-07-01			ENSG00000133247	ENSG00000133247		"""Chromatin-modifying enzymes / K-methyltransferases"""	28405	protein-coding gene	gene with protein product		613198				12477932	Standard	NM_032701		Approved	MGC2705, KMT5C	uc002qkj.4	Q86Y97	OTTHUMG00000150483	ENST00000255613.3:c.-25G>C	19.37:g.55853280G>C			Q8WZ10|Q9BRZ6	RNA	SNP	-	NULL	ENST00000255613.3	37	NULL	CCDS12922.1	19																																																																																			SUV420H2	-	-	ENSG00000133247		0.667	SUV420H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H2	HGNC	protein_coding	OTTHUMT00000318309.2	-	0.00	39	0	G	NM_032701		55853280	+1	tier1	-	no_errors	ENST00000402499	ensembl	human	known	74_37	rna	16.39	51	10	SNP	0.228	C
TBC1D22A	25771	genome.wustl.edu	37	22	47290699	47290699	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr22:47290699G>T	ENST00000337137.4	+	7	1023	c.857G>T	c.(856-858)cGc>cTc	p.R286L	TBC1D22A_ENST00000407381.3_Missense_Mutation_p.R227L|TBC1D22A_ENST00000380995.1_Missense_Mutation_p.R239L|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.R239L|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.R208L	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	286	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		GACATCCCTCGCATGAGCCCT	0.502																																																	0													215.0	159.0	178.0					22																	47290699		2203	4300	6503	SO:0001583	missense	0			AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.857G>T	22.37:g.47290699G>T	ENSP00000336724:p.Arg286Leu		B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R286L	ENST00000337137.4	37	c.857	CCDS14078.1	22	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818028	0.90790	.	.	ENSG00000054611	ENST00000337137;ENST00000380995;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	5.06	5.06	0.68205	Rab-GAP/TBC domain (4);	0.056069	0.64402	D	0.000001	T	0.70535	0.3235	H	0.98068	4.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.72982	0.979;0.974;0.972;0.979	T	0.82890	-0.0233	10	0.87932	D	0	.	15.9266	0.79621	0.0:0.0:1.0:0.0	.	286;208;227;286	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	L	286;239;227;208;239	ENSP00000336724:R286L;ENSP00000370383:R239L;ENSP00000384036:R227L;ENSP00000347932:R208L;ENSP00000385634:R239L	ENSP00000336724:R286L	R	+	2	0	TBC1D22A	45669363	1.000000	0.71417	0.987000	0.45799	0.964000	0.63967	7.788000	0.85771	2.355000	0.79922	0.655000	0.94253	CGC	TBC1D22A	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000054611		0.502	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22A	HGNC	protein_coding	OTTHUMT00000317600.3		0.00	45	0	G	NM_014346		47290699	+1			no_errors	ENST00000337137	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
TCHH	7062	genome.wustl.edu	37	1	152084666	152084666	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:152084666G>C	ENST00000368804.1	-	2	1026	c.1027C>G	c.(1027-1029)Cag>Gag	p.Q343E		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	343	5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ctctcctcctgctcgcgcctc	0.716																																																	0													11.0	15.0	14.0					1																	152084666		1927	3989	5916	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1027C>G	1.37:g.152084666G>C	ENSP00000357794:p.Gln343Glu		Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.Q343E	ENST00000368804.1	37	c.1027	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	N	6.893	0.534184	0.13188	.	.	ENSG00000159450	ENST00000368804	T	0.05649	3.41	4.0	-5.61	0.02489	.	.	.	.	.	T	0.00724	0.0024	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.49113	-0.8973	9	0.02654	T	1	.	13.7826	0.63091	0.0:0.6395:0.2464:0.1142	.	343	Q07283	TRHY_HUMAN	E	343	ENSP00000357794:Q343E	ENSP00000357794:Q343E	Q	-	1	0	TCHH	150351290	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.355000	0.07671	-0.723000	0.04915	-2.716000	0.00133	CAG	TCHH	-	NULL	ENSG00000159450		0.716	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	-	0.00	46	0	G	NM_007113		152084666	-1	tier1	-	no_errors	ENST00000368804	ensembl	human	known	74_37	missense	10.77	58	7	SNP	0.000	C
TFAP2B	7021	genome.wustl.edu	37	6	50803934	50803934	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:50803934G>C	ENST00000393655.3	+	4	931	c.762G>C	c.(760-762)caG>caC	p.Q254H	TFAP2B_ENST00000263046.4_Missense_Mutation_p.Q263H	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	254					aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					GAGAAGTTCAGAGACGGCTGT	0.502																																					Pancreas(116;1373 2332 5475 10752)												0													57.0	55.0	55.0					6																	50803934		2203	4300	6503	SO:0001583	missense	0			X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.762G>C	6.37:g.50803934G>C	ENSP00000377265:p.Gln254His		Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_beta,prints_TF_AP2_C	p.Q263H	ENST00000393655.3	37	c.789	CCDS4934.2	6	.	.	.	.	.	.	.	.	.	.	G	13.72	2.322457	0.41096	.	.	ENSG00000008196	ENST00000393655;ENST00000263046	D;D	0.97455	-4.39;-4.39	5.44	2.26	0.28386	Transcription factor AP-2, C-terminal (1);	0.062767	0.64402	D	0.000003	D	0.97511	0.9185	M	0.79926	2.475	0.58432	D	0.999994	D	0.67145	0.996	D	0.79108	0.992	D	0.97001	0.9729	10	0.54805	T	0.06	-15.5168	10.9808	0.47492	0.3248:0.0:0.6752:0.0	.	254	Q92481	AP2B_HUMAN	H	254;263	ENSP00000377265:Q254H;ENSP00000263046:Q263H	ENSP00000263046:Q263H	Q	+	3	2	TFAP2B	50911893	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	2.466000	0.45084	0.674000	0.31244	0.650000	0.86243	CAG	TFAP2B	-	pfam_TF_AP2_C	ENSG00000008196		0.502	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2B	HGNC	protein_coding	OTTHUMT00000040886.3	-	0.00	25	0	G	NM_003221		50803934	+1	tier1	-	no_errors	ENST00000263046	ensembl	human	known	74_37	missense	50.00	13	13	SNP	1.000	C
TIMM17A	10440	genome.wustl.edu	37	1	201926928	201926929	+	Intron	INS	-	-	T	rs397786423|rs11480520	byFrequency	TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:201926928_201926929insT	ENST00000367287.4	+	3	226					NM_006335.2	NP_006326.1	Q99595	TI17A_HUMAN	translocase of inner mitochondrial membrane 17 homolog A (yeast)						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			kidney(1)|lung(3)|stomach(1)	5						ACACTCGGTGATTTTTTTTTTT	0.406													|||unknown(HR)	3499	0.698682	0.5461	0.7622	5008	,	,		16216	0.7391		0.7565	False		,,,				2504	0.7587																0																																										SO:0001627	intron_variant	0			AF106622	CCDS1417.1	1q32.1	2008-05-23			ENSG00000134375	ENSG00000134375			17315	protein-coding gene	gene with protein product		605057				8893850, 10339406	Standard	NM_006335		Approved	TIM17, TIM17A	uc001gxc.3	Q99595	OTTHUMG00000035806	ENST00000367287.4:c.190+226->T	1.37:g.201926939_201926939dupT			B2RDM5|Q9BWF5	RNA	INS	-	NULL	ENST00000367287.4	37	NULL	CCDS1417.1	1																																																																																			TIMM17A	-	-	ENSG00000134375		0.406	TIMM17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM17A	HGNC	protein_coding	OTTHUMT00000087092.1		0.00	8	0	-	NM_006335		201926929	+1	tier1		no_errors	ENST00000484647	ensembl	human	known	74_37	rna	54.55	5	6	INS	0.000:0.000	T
TLL1	7092	genome.wustl.edu	37	4	166981293	166981293	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr4:166981293T>C	ENST00000061240.2	+	15	2607	c.1960T>C	c.(1960-1962)Tac>Cac	p.Y654H	TLL1_ENST00000507499.1_Missense_Mutation_p.Y677H	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	654	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		ACCAACCCAGTACAGAATTTC	0.413																																																	0													95.0	97.0	96.0					4																	166981293		2203	4300	6503	SO:0001583	missense	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1960T>C	4.37:g.166981293T>C	ENSP00000061240:p.Tyr654His		B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.Y654H	ENST00000061240.2	37	c.1960	CCDS3811.1	4	.	.	.	.	.	.	.	.	.	.	T	14.69	2.609226	0.46527	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.28895	1.59;1.59	6.08	4.91	0.64330	CUB (5);	0.000000	0.64402	U	0.000001	T	0.42086	0.1187	L	0.41356	1.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.17319	-1.0373	10	0.13470	T	0.59	.	11.958	0.52993	0.0:0.067:0.0:0.933	.	677;654	E9PD25;O43897	.;TLL1_HUMAN	H	654;677	ENSP00000061240:Y654H;ENSP00000426082:Y677H	ENSP00000061240:Y654H	Y	+	1	0	TLL1	167200743	1.000000	0.71417	0.997000	0.53966	0.250000	0.25880	6.214000	0.72200	1.134000	0.42165	0.482000	0.46254	TAC	TLL1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom	ENSG00000038295		0.413	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1	-	0.00	57	0	T			166981293	+1	tier1	-	no_errors	ENST00000061240	ensembl	human	known	74_37	missense	41.94	36	26	SNP	1.000	C
TMEM217	221468	genome.wustl.edu	37	6	37180243	37180243	+	3'UTR	SNP	A	A	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:37180243A>G	ENST00000336655.2	-	0	1259				TMEM217_ENST00000356757.2_3'UTR|TMEM217_ENST00000497775.1_5'UTR	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217							integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						TCATGAGTTCACTGCAATGGT	0.517																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.*530T>C	6.37:g.37180243A>G			Q8TC54	RNA	SNP	-	NULL	ENST00000336655.2	37	NULL	CCDS4831.1	6																																																																																			TMEM217	-	-	ENSG00000172738		0.517	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM217	HGNC	protein_coding	OTTHUMT00000357542.1	-	0.00	14	0	A	NM_145316		37180243	-1	tier1	-	no_errors	ENST00000497775	ensembl	human	known	74_37	rna	21.74	18	5	SNP	0.000	G
TMEM200A	114801	genome.wustl.edu	37	6	130763018	130763018	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr6:130763018G>T	ENST00000296978.3	+	3	2322	c.1451G>T	c.(1450-1452)aGg>aTg	p.R484M	TMEM200A_ENST00000545622.1_Missense_Mutation_p.R484M|TMEM200A_ENST00000392429.1_Missense_Mutation_p.R484M	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	484						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		AACCTAAAGAGGGGAACTTCT	0.289																																																	0													41.0	42.0	42.0					6																	130763018		2203	4300	6503	SO:0001583	missense	0			AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.1451G>T	6.37:g.130763018G>T	ENSP00000296978:p.Arg484Met		Q96PX5	Missense_Mutation	SNP	pfam_DUF2371_TMEM200	p.R484M	ENST00000296978.3	37	c.1451	CCDS5140.1	6	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246381	0.80024	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.75	5.75	0.90469	.	0.052320	0.64402	D	0.000001	T	0.60457	0.2270	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.66031	-0.6024	9	0.87932	D	0	-11.3326	19.9405	0.97159	0.0:0.0:1.0:0.0	.	484	Q86VY9	T200A_HUMAN	M	484	.	ENSP00000296978:R484M	R	+	2	0	TMEM200A	130804711	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	9.230000	0.95299	2.716000	0.92895	0.650000	0.86243	AGG	TMEM200A	-	NULL	ENSG00000164484		0.289	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200A	HGNC	protein_coding	OTTHUMT00000042201.1	-	0.00	40	0	G	NM_052913		130763018	+1	tier1	-	no_errors	ENST00000296978	ensembl	human	known	74_37	missense	18.60	35	8	SNP	1.000	T
TMEM221	100130519	genome.wustl.edu	37	19	17547462	17547462	+	Silent	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:17547462C>A	ENST00000341130.5	-	3	785	c.681G>T	c.(679-681)ggG>ggT	p.G227G	CTD-2521M24.10_ENST00000594663.1_Silent_p.G212G	NM_001190844.1	NP_001177773.1	A6NGB7	TM221_HUMAN	transmembrane protein 221	227						integral component of membrane (GO:0016021)											CAAAGGGGTCCCCAGGCTCTG	0.657																																																	0																																										SO:0001819	synonymous_variant	0				CCDS54230.1	19p13.11	2014-08-12			ENSG00000188051	ENSG00000188051			21943	protein-coding gene	gene with protein product							Standard	NM_001190844		Approved		uc021uqh.1	A6NGB7	OTTHUMG00000182858	ENST00000341130.5:c.681G>T	19.37:g.17547462C>A				Silent	SNP	NULL	p.G227	ENST00000341130.5	37	c.681	CCDS54230.1	19																																																																																			TMEM221	-	NULL	ENSG00000188051		0.657	TMEM221-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM221	HGNC	protein_coding	OTTHUMT00000464013.1	-	0.00	75	0	C			17547462	-1	tier1	-	no_errors	ENST00000341130	ensembl	human	known	74_37	silent	37.65	100	61	SNP	0.184	A
TP53	7157	genome.wustl.edu	37	17	7578526	7578526	+	Missense_Mutation	SNP	C	C	T	rs587781991		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr17:7578526C>T	ENST00000269305.4	-	5	593	c.404G>A	c.(403-405)tGc>tAc	p.C135Y	TP53_ENST00000445888.2_Missense_Mutation_p.C135Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.C135Y|TP53_ENST00000413465.2_Missense_Mutation_p.C135Y|TP53_ENST00000420246.2_Missense_Mutation_p.C135Y|TP53_ENST00000455263.2_Missense_Mutation_p.C135Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135Y(60)|p.C135F(43)|p.C135S(8)|p.0?(8)|p.C42Y(4)|p.C3Y(4)|p.C135fs*9(3)|p.N131fs*27(2)|p.C3F(2)|p.C42F(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*15(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.C42S(1)|p.M133fs*13(1)|p.C3S(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCAGTTGGCAAAACATCTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	152	Substitution - Missense(126)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(1)	large_intestine(19)|breast(17)|oesophagus(16)|haematopoietic_and_lymphoid_tissue(13)|urinary_tract(13)|upper_aerodigestive_tract(12)|prostate(11)|lung(9)|ovary(9)|liver(7)|bone(6)|stomach(5)|central_nervous_system(5)|soft_tissue(2)|autonomic_ganglia(2)|eye(1)|kidney(1)|pancreas(1)|skin(1)|NS(1)|pituitary(1)											50.0	50.0	50.0					17																	7578526		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.404G>A	17.37:g.7578526C>T	ENSP00000269305:p.Cys135Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C135Y	ENST00000269305.4	37	c.404	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	25.4	4.639320	0.87760	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99771	0.9906	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;0.929;1.0;1.0;1.0;1.0	D	0.97312	0.9938	10	0.87932	D	0	-26.815	17.2272	0.86973	0.0:1.0:0.0:0.0	.	96;135;135;42;135;135;135	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	135;135;135;135;135;135;124;42;3;42;3;135	ENSP00000410739:C135Y;ENSP00000352610:C135Y;ENSP00000269305:C135Y;ENSP00000398846:C135Y;ENSP00000391127:C135Y;ENSP00000391478:C135Y;ENSP00000425104:C3Y;ENSP00000423862:C42Y;ENSP00000424104:C135Y	ENSP00000269305:C135Y	C	-	2	0	TP53	7519251	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.772000	0.85439	2.733000	0.93635	0.655000	0.94253	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	12	0	C	NM_000546		7578526	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	41.67	7	5	SNP	1.000	T
TPRXL	348825	genome.wustl.edu	37	3	14106354	14106354	+	Silent	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:14106354C>T	ENST00000424053.1	+	3	1225	c.678C>T	c.(676-678)agC>agT	p.S226S	TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_Silent_p.S226S|TPRXL_ENST00000429201.1_Silent_p.S226S			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						gcagcagcagccccagcagca	0.701																																																	0																																										SO:0001819	synonymous_variant	0			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.678C>T	3.37:g.14106354C>T			Q8NAM5	Silent	SNP	NULL	p.S226	ENST00000424053.1	37	c.678		3																																																																																			TPRXL	-	NULL	ENSG00000180438		0.701	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	HGNC	protein_coding	OTTHUMT00000340436.1	-	0.00	34	0	C	NR_002223		14106354	+1	tier1	-	no_errors	ENST00000326972	ensembl	human	known	74_37	silent	32.14	19	9	SNP	0.580	T
TPRXL	348825	genome.wustl.edu	37	3	14106367	14106367	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr3:14106367T>A	ENST00000424053.1	+	3	1238	c.691T>A	c.(691-693)Tgc>Agc	p.C231S	TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_Missense_Mutation_p.C231S|TPRXL_ENST00000429201.1_Missense_Mutation_p.C231S			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						cagcagcagcTGCCCCAGTGC	0.706																																																	0																																										SO:0001583	missense	0			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.691T>A	3.37:g.14106367T>A	ENSP00000400448:p.Cys231Ser		Q8NAM5	Missense_Mutation	SNP	NULL	p.C231S	ENST00000424053.1	37	c.691		3	.	.	.	.	.	.	.	.	.	.	t	2.221	-0.378393	0.05000	.	.	ENSG00000180438	ENST00000326972;ENST00000424053;ENST00000429201	.	.	.	0.294	0.294	0.15747	.	.	.	.	.	T	0.17746	0.0426	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27262	-1.0079	5	.	.	.	.	.	.	.	.	237	Q17RH7	TPRXL_HUMAN	S	231	.	.	C	+	1	0	TPRXL	14081368	0.921000	0.31238	0.000000	0.03702	0.000000	0.00434	-2.842000	0.00737	-1.117000	0.02965	-1.141000	0.01876	TGC	TPRXL	-	NULL	ENSG00000180438		0.706	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	HGNC	protein_coding	OTTHUMT00000340436.1	-	0.00	35	0	T	NR_002223		14106367	+1	tier1	-	no_errors	ENST00000326972	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.007	A
TRIM13	10206	genome.wustl.edu	37	13	50586798	50586798	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr13:50586798A>T	ENST00000378182.3	+	2	1460	c.722A>T	c.(721-723)gAt>gTt	p.D241V	TRIM13_ENST00000420995.2_Missense_Mutation_p.D241V|TRIM13_ENST00000356017.4_Missense_Mutation_p.D244V|TRIM13_ENST00000298772.5_Missense_Mutation_p.D244V|TRIM13_ENST00000457662.2_Missense_Mutation_p.D241V|TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000312942.1_5'Flank|KCNRG_ENST00000360473.4_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	241					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		GCTTTCAAAGATGTGTCAGAA	0.418																																																	0													79.0	75.0	76.0					13																	50586798		2203	4300	6503	SO:0001583	missense	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.722A>T	13.37:g.50586798A>T	ENSP00000367424:p.Asp241Val		B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.D244V	ENST00000378182.3	37	c.731	CCDS9423.1	13	.	.	.	.	.	.	.	.	.	.	A	12.93	2.084401	0.36758	.	.	ENSG00000204977	ENST00000378183;ENST00000420995;ENST00000378182;ENST00000356017;ENST00000457662;ENST00000298772	T;T;T;T;T;T	0.27104	2.2;1.69;1.69;2.21;1.69;2.21	5.61	5.61	0.85477	.	0.286266	0.39083	N	0.001476	T	0.28001	0.0690	N	0.24115	0.695	0.53005	D	0.999962	D;D	0.59357	0.974;0.985	P;P	0.52217	0.497;0.693	T	0.02161	-1.1203	9	.	.	.	-6.2974	15.7868	0.78310	1.0:0.0:0.0:0.0	.	241;244	O60858;O60858-3	TRI13_HUMAN;.	V	241;241;241;244;241;244	ENSP00000367425:D241V;ENSP00000412943:D241V;ENSP00000367424:D241V;ENSP00000348299:D244V;ENSP00000399206:D241V;ENSP00000298772:D244V	.	D	+	2	0	TRIM13	49484799	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	5.399000	0.66314	2.119000	0.64992	0.533000	0.62120	GAT	TRIM13	-	NULL	ENSG00000204977		0.418	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TRIM13	HGNC	protein_coding	OTTHUMT00000354875.1		0.00	28	0	A	NM_001007278		50586798	+1			no_errors	ENST00000298772	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	T
TRIM49	57093	genome.wustl.edu	37	11	89537421	89537423	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	TCT	TCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr11:89537421_89537423delTCT	ENST00000329758.1	-	3	543_545	c.215_217delAGA	c.(214-219)aagatg>atg	p.K72del	TRIM49_ENST00000532501.2_In_Frame_Del_p.K72del	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	72						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AGAGAAGCCATCTTCTTCAAATG	0.443																																																	0																																										SO:0001651	inframe_deletion	0			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.215_217delAGA	11.37:g.89537424_89537426delTCT	ENSP00000327604:p.Lys72del		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	In_Frame_Del	DEL	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.K72in_frame_del	ENST00000329758.1	37	c.217_215	CCDS8287.1	11																																																																																			TRIM49	-	NULL	ENSG00000168930		0.443	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1		0.00	76	0	TCT	NM_020358		89537423	-1	tier1		no_errors	ENST00000329758	ensembl	human	known	74_37	in_frame_del	26.21	76	27	DEL	0.000:0.000:0.001	-
TSPAN9	10867	genome.wustl.edu	37	12	3387724	3387724	+	Silent	SNP	G	G	A	rs147946820		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr12:3387724G>A	ENST00000011898.5	+	4	362	c.201G>A	c.(199-201)acG>acA	p.T67T	TSPAN9_ENST00000407263.1_Silent_p.T67T|TSPAN9_ENST00000492305.1_3'UTR|TSPAN9_ENST00000537971.1_Silent_p.T67T	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9	67						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)				endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			TCATGGTGACGGGCTTCCTCG	0.572																																																	0								G	,	0,4406		0,0,2203	124.0	112.0	116.0		201,201	-5.4	1.0	12	dbSNP_134	116	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TSPAN9	NM_001168320.1,NM_006675.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	67/240,67/240	3387724	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.201G>A	12.37:g.3387724G>A			D3DUQ7|Q53FV2|Q6FGJ8	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T67	ENST00000011898.5	37	c.201	CCDS8520.1	12																																																																																			TSPAN9	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000011105		0.572	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN9	HGNC	protein_coding	OTTHUMT00000317606.2		0.00	25	0	G	NM_006675		3387724	+1			no_errors	ENST00000011898	ensembl	human	known	74_37	silent	9.09	30	3	SNP	0.770	A
TSPYL2	64061	genome.wustl.edu	37	X	53114916	53114916	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chrX:53114916C>G	ENST00000375442.4	+	6	1474	c.1342C>G	c.(1342-1344)Cat>Gat	p.H448D		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	448					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						TGAGACAATTCATGACATCAA	0.463																																																	0													164.0	135.0	145.0					X																	53114916		2203	4300	6503	SO:0001583	missense	0			AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1342C>G	X.37:g.53114916C>G	ENSP00000364591:p.His448Asp		O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	pfam_NAP_family	p.H448D	ENST00000375442.4	37	c.1342	CCDS14350.1	X	.	.	.	.	.	.	.	.	.	.	C	9.028	0.986597	0.18889	.	.	ENSG00000184205	ENST00000375442	T	0.30714	1.52	2.91	1.94	0.25998	.	0.456642	0.16288	N	0.221029	T	0.18130	0.0435	L	0.29908	0.895	0.21841	N	0.999517	P;P	0.49783	0.782;0.928	B;B	0.39738	0.308;0.221	T	0.14587	-1.0467	10	0.87932	D	0	-4.2041	4.1247	0.10121	0.0:0.7605:0.0:0.2395	.	88;448	Q59GC7;Q9H2G4	.;TSYL2_HUMAN	D	448	ENSP00000364591:H448D	ENSP00000364591:H448D	H	+	1	0	TSPYL2	53131641	1.000000	0.71417	0.475000	0.27278	0.800000	0.45204	0.881000	0.28173	0.544000	0.28883	0.279000	0.19357	CAT	TSPYL2	-	NULL	ENSG00000184205		0.463	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL2	HGNC	protein_coding	OTTHUMT00000056718.1	-	0.00	16	0	C	NM_022117		53114916	+1	tier1	-	no_errors	ENST00000375442	ensembl	human	known	74_37	missense	62.07	11	18	SNP	0.490	G
TUBA3C	7278	genome.wustl.edu	37	13	19751582	19751582	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr13:19751582C>T	ENST00000400113.3	-	4	645	c.541G>A	c.(541-543)Gtg>Atg	p.V181M		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	181					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GGCTCCACCACGGCCGTGGAG	0.547																																																	0													153.0	155.0	154.0					13																	19751582		2203	4300	6503	SO:0001583	missense	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.541G>A	13.37:g.19751582C>T	ENSP00000382982:p.Val181Met		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.V181M	ENST00000400113.3	37	c.541	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	c	9.281	1.048161	0.19827	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.71222	-0.55	1.19	0.277	0.15668	.	0.000000	0.42294	U	0.000740	T	0.70316	0.3210	.	.	.	0.36377	D	0.861662	.	.	.	.	.	.	T	0.71148	-0.4677	7	0.87932	D	0	.	5.6682	0.17707	0.0:0.7911:0.0:0.2089	.	.	.	.	M	181	ENSP00000382982:V181M	ENSP00000354037:V181M	V	-	1	0	TUBA3C	18649582	0.999000	0.42202	0.988000	0.46212	0.511000	0.34104	4.622000	0.61240	0.069000	0.16605	0.162000	0.16502	GTG	TUBA3C	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Epsilon_tubulin	ENSG00000198033		0.547	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	-	0.00	54	0	C	NM_006001		19751582	-1	tier1	-	no_errors	ENST00000400113	ensembl	human	known	74_37	missense	20.51	31	8	SNP	1.000	T
TYW5	129450	genome.wustl.edu	37	2	200820127	200820127	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:200820127G>T	ENST00000354611.4	-	1	332	c.67C>A	c.(67-69)Ctc>Atc	p.L23I	C2orf47_ENST00000392290.1_5'Flank|C2orf69_ENST00000491721.1_3'UTR|TYW5_ENST00000452512.2_5'UTR|C2orf47_ENST00000295079.2_Intron	NM_001039693.2	NP_001034782.1	A2RUC4	TYW5_HUMAN	tRNA-yW synthesizing protein 5	23					wybutosine biosynthetic process (GO:0031591)		iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(1)	8						TGTGGGTAGAGGTGCTGCATG	0.622																																																	0													28.0	32.0	31.0					2																	200820127		1946	4140	6086	SO:0001583	missense	0			AK095272	CCDS42795.1	2q33.1	2011-05-09	2011-05-09	2011-05-09	ENSG00000162971	ENSG00000162971			26754	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 60"""	C2orf60		20739293	Standard	NM_001039693		Approved	FLJ37953	uc002uvi.4	A2RUC4	OTTHUMG00000132770	ENST00000354611.4:c.67C>A	2.37:g.200820127G>T	ENSP00000346627:p.Leu23Ile		B2RNE3|Q8N1R2	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.L23I	ENST00000354611.4	37	c.67	CCDS42795.1	2	.	.	.	.	.	.	.	.	.	.	G	7.609	0.674356	0.14841	.	.	ENSG00000162971	ENST00000354611	T	0.70631	-0.5	5.35	2.44	0.29823	.	0.207947	0.30676	U	0.009106	T	0.28067	0.0692	N	0.00368	-1.59	0.80722	D	1	B;B	0.20261	0.043;0.0	B;B	0.20184	0.028;0.002	T	0.05852	-1.0860	10	0.12430	T	0.62	-8.085	4.8758	0.13655	0.1735:0.0:0.5965:0.2301	.	23;23	A8KAJ9;A2RUC4	.;TYW5_HUMAN	I	23	ENSP00000346627:L23I	ENSP00000346627:L23I	L	-	1	0	TYW5	200528372	0.857000	0.29778	0.199000	0.23439	0.149000	0.21700	1.168000	0.31859	0.955000	0.37878	-0.137000	0.14449	CTC	TYW5	-	NULL	ENSG00000162971		0.622	TYW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYW5	HGNC	protein_coding	OTTHUMT00000256144.3	-	0.00	44	0	G	NM_001039693		200820127	-1	tier1	-	no_errors	ENST00000354611	ensembl	human	known	74_37	missense	5.88	80	5	SNP	0.725	T
UNC13C	440279	genome.wustl.edu	37	15	54825247	54825247	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr15:54825247G>T	ENST00000260323.11	+	25	5679	c.5679G>T	c.(5677-5679)atG>atT	p.M1893I	UNC13C_ENST00000537900.1_Missense_Mutation_p.M1891I|UNC13C_ENST00000545554.1_Missense_Mutation_p.M1893I	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1893	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GATCTCTTATGGATTTTTTGG	0.338																																																	0													75.0	75.0	75.0					15																	54825247		1811	4076	5887	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5679G>T	15.37:g.54825247G>T	ENSP00000260323:p.Met1893Ile		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.M1893I	ENST00000260323.11	37	c.5679	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231063	0.79688	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.78595	-1.19;-1.19;-1.19	5.83	5.83	0.93111	Mammalian uncoordinated homology 13, domain 2 (1);Mammalian uncoordinated homology 13, subgroup, domain 2 (1);	0.080271	0.85682	D	0.000000	D	0.89319	0.6681	M	0.84326	2.69	0.58432	D	0.999991	D	0.54964	0.969	D	0.70227	0.968	D	0.89966	0.4090	10	0.87932	D	0	.	19.1044	0.93287	0.0:0.0:1.0:0.0	.	1893	Q8NB66	UN13C_HUMAN	I	1893;1893;1891	ENSP00000260323:M1893I;ENSP00000438156:M1893I;ENSP00000442569:M1891I	ENSP00000260323:M1893I	M	+	3	0	UNC13C	52612539	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.363000	0.90103	2.756000	0.94617	0.655000	0.94253	ATG	UNC13C	-	pfam_Munc13_subgr_dom-2	ENSG00000137766		0.338	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	86	0	G	NM_173166		54825247	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	23.33	92	28	SNP	1.000	T
UNC80	285175	genome.wustl.edu	37	2	210636730	210636732	+	5'UTR	DEL	GGC	GGC	-			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:210636730_210636732delGGC	ENST00000439458.1	+	0	14_16				UNC80_ENST00000478701.1_3'UTR|UNC80_ENST00000272845.6_5'Flank	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGCGGGAGGAGGCGGCGGCGGCG	0.695																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.-65GGC>-	2.37:g.210636739_210636741delGGC			B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	RNA	DEL	-	NULL	ENST00000439458.1	37	NULL	CCDS46504.1	2																																																																																			UNC80	-	-	ENSG00000144406		0.695	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding			0.00	13	0	GGC	NM_182587		210636732	+1	tier1		no_errors	ENST00000478701	ensembl	human	known	74_37	rna	12.50	14	2	DEL	0.872:0.440:0.097	-
URGCP	55665	genome.wustl.edu	37	7	43918191	43918191	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr7:43918191C>T	ENST00000453200.1	-	6	1364	c.871G>A	c.(871-873)Gac>Aac	p.D291N	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000402306.3_Missense_Mutation_p.D282N|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000443736.1_Missense_Mutation_p.D248N|URGCP_ENST00000223341.7_Missense_Mutation_p.D248N|URGCP_ENST00000336086.6_Missense_Mutation_p.D248N|URGCP_ENST00000447717.3_Missense_Mutation_p.D248N			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	291					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CAGAAGCAGTCCCACTGCCTG	0.607																																																	0													43.0	47.0	45.0					7																	43918191		1991	4153	6144	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.871G>A	7.37:g.43918191C>T	ENSP00000396918:p.Asp291Asn		E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.D291N	ENST00000453200.1	37	c.871	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	C	18.64	3.668154	0.67814	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.12465	2.71;2.71;2.69;2.71;2.68;2.71	5.52	4.64	0.57946	.	0.049835	0.85682	D	0.000000	T	0.11495	0.0280	L	0.39898	1.24	0.37764	D	0.926439	P;P	0.41524	0.753;0.753	B;B	0.34093	0.175;0.175	T	0.12116	-1.0560	10	0.38643	T	0.18	-32.4988	14.1815	0.65577	0.0:0.849:0.151:0.0	.	282;291	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	N	248;248;282;248;291;248	ENSP00000223341:D248N;ENSP00000336872:D248N;ENSP00000384955:D282N;ENSP00000392136:D248N;ENSP00000396918:D291N;ENSP00000402803:D248N	ENSP00000223341:D248N	D	-	1	0	URGCP	43884716	0.158000	0.22850	0.994000	0.49952	0.996000	0.88848	0.640000	0.24705	1.315000	0.45114	0.491000	0.48974	GAC	URGCP	-	NULL	ENSG00000106608		0.607	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	-	0.00	29	0	C	NM_001077664		43918191	-1	tier1	-	no_errors	ENST00000453200	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	T
USP27X	389856	genome.wustl.edu	37	X	49643121	49643121	+	5'Flank	SNP	A	A	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chrX:49643121A>G	ENST00000508866.2	+	0	0				USP27X-AS1_ENST00000437322.2_lincRNA	NM_001145073.1	NP_001138545.1	A6NNY8	UBP27_HUMAN	ubiquitin specific peptidase 27, X-linked						ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(7)	7						CGGGCTGCTCAGCGTCTGCTG	0.657																																																	0																																										SO:0001631	upstream_gene_variant	0			AW851065	CCDS65260.1	Xp11.23	2007-10-05	2005-08-08			ENSG00000273820		"""Ubiquitin-specific peptidases"""	13486	protein-coding gene	gene with protein product			"""ubiquitin specific protease 27, X chromosome"", ""ubiquitin specific protease 27, X-linked"""			12838346	Standard	NM_001145073		Approved	USP27	uc004dop.3	A6NNY8			X.37:g.49643121A>G	Exception_encountered			RNA	SNP	-	NULL	ENST00000508866.2	37	NULL		X																																																																																			USP27X-AS1	-	-	ENSG00000234390		0.657	USP27X-001	KNOWN	basic|appris_principal	protein_coding	USP27X-AS1	HGNC	protein_coding	OTTHUMT00000060837.3	-	0.00	32	0	A	XM_372213		49643121	-1	tier1	-	no_errors	ENST00000437322	ensembl	human	known	74_37	rna	64.00	18	32	SNP	0.028	G
USP40	55230	genome.wustl.edu	37	2	234405457	234405457	+	Silent	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr2:234405457G>A	ENST00000427112.2	-	23	2769	c.2734C>T	c.(2734-2736)Ctg>Ttg	p.L912L	USP40_ENST00000251722.6_Silent_p.L912L|USP40_ENST00000450966.1_Silent_p.L924L|USP40_ENST00000409945.1_Silent_p.L88L			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	912					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GAACATATCAGAAGTTCTTTC	0.348																																																	0													122.0	114.0	116.0					2																	234405457		1831	4085	5916	SO:0001819	synonymous_variant	0			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.2734C>T	2.37:g.234405457G>A			Q6NX38|Q70EL0	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.L924	ENST00000427112.2	37	c.2770	CCDS46547.1	2																																																																																			USP40	-	NULL	ENSG00000085982		0.348	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	USP40	HGNC	protein_coding	OTTHUMT00000397235.1	-	0.00	46	0	G	XM_114294		234405457	-1	tier1	-	no_errors	ENST00000450966	ensembl	human	known	74_37	silent	30.30	23	10	SNP	0.048	A
USP6NL	9712	genome.wustl.edu	37	10	11505195	11505195	+	Missense_Mutation	SNP	G	G	A	rs369822185		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr10:11505195G>A	ENST00000609104.1	-	15	2126	c.1732C>T	c.(1732-1734)Cgg>Tgg	p.R578W	USP6NL_ENST00000277575.5_Missense_Mutation_p.R595W|USP6NL_ENST00000379237.2_Missense_Mutation_p.R601W	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	578					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						AGGGCATGCCGGGGGCTCTGG	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17470	0.0		0.0	False		,,,				2504	0.0																0								G	TRP/ARG,TRP/ARG	1,3935		0,1,1967	42.0	45.0	44.0		1783,1732	-1.4	0.0	10		44	0,8306		0,0,4153	no	missense,missense	USP6NL	NM_001080491.2,NM_014688.2	101,101	0,1,6120	AA,AG,GG		0.0,0.0254,0.0082	probably-damaging,probably-damaging	595/846,578/829	11505195	1,12241	1968	4153	6121	SO:0001583	missense	0			BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1732C>T	10.37:g.11505195G>A	ENSP00000476462:p.Arg578Trp		A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R601W	ENST00000609104.1	37	c.1801	CCDS53492.1	10	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553121	0.65425	2.54E-4	0.0	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.05717	3.4;3.41	5.58	-1.36	0.09085	.	0.177074	0.39909	N	0.001226	T	0.15696	0.0378	M	0.61703	1.905	0.09310	N	1	D;D	0.76494	0.999;0.999	P;D	0.65140	0.857;0.932	T	0.02378	-1.1168	10	0.72032	D	0.01	.	10.5481	0.45072	0.0:0.0638:0.5012:0.435	.	578;595	Q92738;Q92738-2	US6NL_HUMAN;.	W	578;595;578	ENSP00000277575:R595W;ENSP00000368539:R578W	ENSP00000277575:R595W	R	-	1	2	USP6NL	11545201	0.005000	0.15991	0.007000	0.13788	0.005000	0.04900	0.287000	0.18920	-0.188000	0.10499	-0.457000	0.05445	CGG	USP6NL	-	NULL	ENSG00000148429		0.577	USP6NL-001	KNOWN	basic|CCDS	protein_coding	USP6NL	HGNC	protein_coding	OTTHUMT00000046764.3		0.00	58	0	G	NM_014688		11505195	-1			no_errors	ENST00000379237	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.001	A
VSTM2A	222008	genome.wustl.edu	37	7	54617761	54617761	+	Missense_Mutation	SNP	G	G	A	rs202226834		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr7:54617761G>A	ENST00000407838.3	+	4	938	c.532G>A	c.(532-534)Gca>Aca	p.A178T	VSTM2A_ENST00000402026.2_Missense_Mutation_p.A177T|VSTM2A_ENST00000302287.3_Missense_Mutation_p.A178T|VSTM2A_ENST00000402613.3_Missense_Mutation_p.A178T|VSTM2A_ENST00000404951.1_Missense_Mutation_p.A178T|VSTM2A_ENST00000498834.1_3'UTR	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	178						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			GAACGTCTCCGCAGCCATCCC	0.567																																																	0								G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	70.0	58.0	62.0		532	3.1	0.0	7		62	0,8600		0,0,4300	yes	missense	VSTM2A	NM_182546.2	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	178/237	54617761	1,13005	2203	4300	6503	SO:0001583	missense	0			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.532G>A	7.37:g.54617761G>A	ENSP00000384967:p.Ala178Thr		A4D2E9|B5MC94	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.A177T	ENST00000407838.3	37	c.529	CCDS5512.2	7	.	.	.	.	.	.	.	.	.	.	G	2.054	-0.417110	0.04766	2.27E-4	0.0	ENSG00000170419	ENST00000302287;ENST00000407838;ENST00000404951;ENST00000402026;ENST00000402613	T;T;T;T;T	0.51574	0.7;0.8;0.72;0.7;0.77	5.06	3.12	0.35913	.	0.507797	0.22729	N	0.056352	T	0.34832	0.0911	L	0.46157	1.445	0.09310	N	1	B;P;P	0.48589	0.269;0.912;0.861	B;B;B	0.37144	0.048;0.242;0.146	T	0.13495	-1.0507	10	0.27785	T	0.31	-1.0664	10.2531	0.43381	0.0:0.0:0.5814:0.4186	.	178;178;178	Q8TAG5;Q8TAG5-2;B5MCX6	VTM2A_HUMAN;.;.	T	178;178;178;177;178	ENSP00000303108:A178T;ENSP00000384967:A178T;ENSP00000384701:A178T;ENSP00000385933:A177T;ENSP00000384103:A178T	ENSP00000303108:A178T	A	+	1	0	VSTM2A	54585255	0.883000	0.30277	0.000000	0.03702	0.002000	0.02628	2.246000	0.43142	0.536000	0.28733	0.655000	0.94253	GCA	VSTM2A	-	NULL	ENSG00000170419		0.567	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	HGNC	protein_coding	OTTHUMT00000318694.1	-	0.00	29	0	G	NM_182546		54617761	+1	tier1	rs202226834	no_errors	ENST00000402026	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.004	A
WASH3P	374666	genome.wustl.edu	37	15	102506815	102506816	+	RNA	DEL	CC	CC	-	rs151176585		TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr15:102506815_102506816delCC	ENST00000557932.1	+	0	172							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						tacctctccacctggagcgcac	0.421																																																	0																																												0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102506815_102506816delCC				RNA	DEL	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			WASH3P	-	-	ENSG00000185596		0.421	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1		0.00	8	0	CC	NM_199163		102506816	+1			no_errors	ENST00000559884	ensembl	human	known	74_37	rna	46.15	7	6	DEL	0.000:0.000	0
YES1	7525	genome.wustl.edu	37	18	746023	746023	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr18:746023C>G	ENST00000584307.1	-	5	669	c.499G>C	c.(499-501)Gat>Cat	p.D167H	YES1_ENST00000577961.1_Missense_Mutation_p.D172H|YES1_ENST00000314574.4_Missense_Mutation_p.D167H			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	167	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	CTTTCAGCATCTTTTCTCCCC	0.299																																																	0													46.0	47.0	47.0					18																	746023		2201	4292	6493	SO:0001583	missense	0			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.499G>C	18.37:g.746023C>G	ENSP00000462468:p.Asp167His		A6NLB3|D3DUH1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.D167H	ENST00000584307.1	37	c.499	CCDS11824.1	18	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884147	0.51908	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	D	0.89270	-2.49	5.7	4.83	0.62350	SH2 motif (5);	0.044219	0.85682	D	0.000000	D	0.94440	0.8211	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95082	0.8214	10	0.87932	D	0	.	14.6322	0.68663	0.0:0.9303:0.0:0.0697	.	167	P07947	YES_HUMAN	H	167	ENSP00000324740:D167H	ENSP00000324740:D167H	D	-	1	0	YES1	736023	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.717000	0.84732	1.421000	0.47157	0.591000	0.81541	GAT	YES1	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000176105		0.299	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YES1	HGNC	protein_coding	OTTHUMT00000440827.2	-	0.00	49	0	C	NM_005433		746023	-1	tier1	-	no_errors	ENST00000314574	ensembl	human	known	74_37	missense	47.76	35	32	SNP	1.000	G
ZC3H11A	9877	genome.wustl.edu	37	1	203765608	203765608	+	5'UTR	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr1:203765608C>T	ENST00000332127.4	+	0	277				ZBED6_ENST00000550078.1_5'UTR|ZC3H11A_ENST00000545588.1_5'Flank|ZC3H11A_ENST00000367212.3_5'UTR|ZC3H11A_ENST00000367214.1_5'UTR|ZC3H11A_ENST00000466470.1_3'UTR			O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A						poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AAGAACACCCCTAAACTCCCA	0.517																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000332127.4:c.-581C>T	1.37:g.203765608C>T			Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	RNA	SNP	-	NULL	ENST00000332127.4	37	NULL	CCDS30978.1	1																																																																																			ZC3H11A	-	-	ENSG00000058673		0.517	ZC3H11A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H11A	HGNC	protein_coding	OTTHUMT00000087691.1	-	0.00	67	0	C	NM_014827		203765608	+1	tier1	-	no_errors	ENST00000466470	ensembl	human	known	74_37	rna	38.03	44	27	SNP	0.998	T
ZNF423	23090	genome.wustl.edu	37	16	49856581	49856581	+	Splice_Site	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr16:49856581C>T	ENST00000561648.1	-	1	69	c.16G>A	c.(16-18)Gtt>Att	p.V6I	ZNF423_ENST00000562520.1_Intron|ZNF423_ENST00000563137.2_Intron|ZNF423_ENST00000262383.2_Splice_Site_p.V6I	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	6					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CCCTGCTCACCCCTCTTCTTA	0.478																																																	0													164.0	150.0	154.0					16																	49856581		2198	4300	6498	SO:0001630	splice_region_variant	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.16+1G>A	16.37:g.49856581C>T			O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V6I	ENST00000561648.1	37	c.16	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	C	13.28	2.191200	0.38707	.	.	ENSG00000102935	ENST00000262383	T	0.10099	2.91	2.16	-0.198	0.13224	.	0.302443	0.20527	N	0.090584	T	0.03263	0.0095	N	0.08118	0	0.09310	N	1	P	0.38677	0.642	B	0.24394	0.053	T	0.47471	-0.9115	9	.	.	.	.	7.5604	0.27847	0.0:0.4688:0.5312:0.0	.	6	Q2M1K9	ZN423_HUMAN	I	6	ENSP00000262383:V6I	.	V	-	1	0	ZNF423	48414082	0.000000	0.05858	0.000000	0.03702	0.201000	0.24016	-0.102000	0.10956	-0.020000	0.14032	0.561000	0.74099	GTT	ZNF423	-	NULL	ENSG00000102935		0.478	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	-	0.00	21	0	C	NM_015069	Missense_Mutation	49856581	-1	tier1	-	no_errors	ENST00000262383	ensembl	human	known	74_37	missense	60.00	12	18	SNP	0.000	T
ZNF439	90594	genome.wustl.edu	37	19	11979010	11979010	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:11979010C>T	ENST00000304030.2	+	3	1326	c.1126C>T	c.(1126-1128)Cac>Tac	p.H376Y	ZNF439_ENST00000455282.1_Missense_Mutation_p.H240Y|ZNF439_ENST00000592534.1_Intron	NM_152262.2	NP_689475.1	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						TGAAAAAACTCACAGTGGAGA	0.408																																																	0													57.0	58.0	58.0					19																	11979010		2203	4300	6503	SO:0001583	missense	0			AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000304030.2:c.1126C>T	19.37:g.11979010C>T	ENSP00000305077:p.His376Tyr		Q8IYZ7|Q96SU1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H376Y	ENST00000304030.2	37	c.1126	CCDS12268.1	19	.	.	.	.	.	.	.	.	.	.	c	14.35	2.509073	0.44660	.	.	ENSG00000171291	ENST00000455282;ENST00000304030	T;T	0.67523	-0.27;-0.27	0.575	0.575	0.17374	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.83663	0.5303	H	0.94582	3.555	0.34124	D	0.664497	D	0.89917	1.0	D	0.97110	1.0	D	0.85916	0.1443	9	0.72032	D	0.01	.	8.6675	0.34130	0.0:1.0:0.0:0.0	.	376	Q8NDP4	ZN439_HUMAN	Y	240;376	ENSP00000395632:H240Y;ENSP00000305077:H376Y	ENSP00000305077:H376Y	H	+	1	0	ZNF439	11840010	0.726000	0.28059	0.031000	0.17742	0.071000	0.16799	3.271000	0.51608	0.577000	0.29470	0.194000	0.17425	CAC	ZNF439	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171291		0.408	ZNF439-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF439	HGNC	protein_coding	OTTHUMT00000344513.1	-	0.00	68	0	C			11979010	+1	tier1	-	no_errors	ENST00000304030	ensembl	human	known	74_37	missense	29.73	77	33	SNP	0.990	T
ZNF518A	9849	genome.wustl.edu	37	10	97916723	97916723	+	RNA	SNP	C	C	G			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr10:97916723C>G	ENST00000534948.1	+	0	1501							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TGTAAGTTCTCCACCCAGGAT	0.338																																																	0													168.0	165.0	166.0					10																	97916723		1903	4121	6024			0			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97916723C>G			A0PJI5|O15044|Q32MP4	RNA	SNP	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			ZNF518A	-	-	ENSG00000177853		0.338	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	HGNC	processed_transcript		-	0.00	31	0	C	NM_014803		97916723	+1	tier1	-	no_errors	ENST00000478086	ensembl	human	known	74_37	rna	21.43	22	6	SNP	0.999	G
ZNF521	25925	genome.wustl.edu	37	18	22804854	22804854	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr18:22804854G>T	ENST00000361524.3	-	4	3176	c.3028C>A	c.(3028-3030)Cac>Aac	p.H1010N	ZNF521_ENST00000538137.2_Missense_Mutation_p.H1010N|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.H790N	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1010					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AAGTCAGGGTGCATTTGGCAA	0.488			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													73.0	66.0	68.0					18																	22804854		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3028C>A	18.37:g.22804854G>T	ENSP00000354794:p.His1010Asn		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H1010N	ENST00000361524.3	37	c.3028	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122616	0.37436	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.14144	2.53;2.54	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.046625	0.85682	D	0.000000	T	0.30198	0.0757	L	0.29908	0.895	0.50813	D	0.99989	D	0.71674	0.998	D	0.79784	0.993	T	0.00749	-1.1582	10	0.87932	D	0	-32.9011	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1010	Q96K83	ZN521_HUMAN	N	1010;1044;1010	ENSP00000354794:H1010N;ENSP00000382352:H1010N	ENSP00000354794:H1010N	H	-	1	0	ZNF521	21058852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CAC	ZNF521	-	smart_Znf_C2H2-like	ENSG00000198795		0.488	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	24	0	G	NM_015461		22804854	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	T
ZNF700	90592	genome.wustl.edu	37	19	12060792	12060792	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:12060792G>T	ENST00000254321.5	+	4	2096	c.1953G>T	c.(1951-1953)aaG>aaT	p.K651N	ZNF700_ENST00000482090.1_Missense_Mutation_p.K633N|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000538752.1_Intron|ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000591944.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	651					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						ATGAATGTAAGGAATGCGAAA	0.413																																																	0													64.0	64.0	64.0					19																	12060792		2203	4300	6503	SO:0001583	missense	0			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1953G>T	19.37:g.12060792G>T	ENSP00000254321:p.Lys651Asn		B9EGU4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K651N	ENST00000254321.5	37	c.1953	CCDS32915.1	19	.	.	.	.	.	.	.	.	.	.	g	6.088	0.384558	0.11524	.	.	ENSG00000196757	ENST00000254321	T	0.08546	3.08	0.681	-0.622	0.11560	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06917	0.0176	N	0.04508	-0.205	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.16660	-1.0395	9	0.06625	T	0.88	.	4.8412	0.13491	0.5122:0.0:0.4878:0.0	.	651	Q9H0M5	ZN700_HUMAN	N	651	ENSP00000254321:K651N	ENSP00000254321:K651N	K	+	3	2	ZNF700	11921792	0.000000	0.05858	0.001000	0.08648	0.033000	0.12548	-7.117000	0.00044	-0.283000	0.09115	0.313000	0.20887	AAG	ZNF700	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196757		0.413	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	-	0.00	51	0	G	NM_144566		12060792	+1	tier1	-	no_errors	ENST00000254321	ensembl	human	known	74_37	missense	5.26	90	5	SNP	0.000	T
ZNF540	163255	genome.wustl.edu	37	19	38103432	38103432	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:38103432G>C	ENST00000592533.1	+	5	1583	c.1251G>C	c.(1249-1251)gaG>gaC	p.E417D	ZNF540_ENST00000316433.4_Missense_Mutation_p.E417D|ZNF540_ENST00000343599.5_Missense_Mutation_p.E417D|ZNF540_ENST00000589117.1_Missense_Mutation_p.E385D	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	417					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGGTGTGTGAGAAGGCTTTTA	0.388																																																	0													117.0	111.0	113.0					19																	38103432		2203	4300	6503	SO:0001583	missense	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1251G>C	19.37:g.38103432G>C	ENSP00000466274:p.Glu417Asp		A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E417D	ENST00000592533.1	37	c.1251	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592316	0.46214	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.35973	1.28	2.26	-1.4	0.08968	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15219	0.0367	N	0.03084	-0.415	0.22156	N	0.999321	B;B	0.06786	0.001;0.001	B;B	0.14023	0.006;0.01	T	0.21552	-1.0242	9	0.87932	D	0	.	6.0312	0.19681	0.4125:0.0:0.5875:0.0	.	385;417	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	D	417;385	ENSP00000324598:E417D	ENSP00000324598:E417D	E	+	3	2	ZNF540	42795272	0.000000	0.05858	0.025000	0.17156	0.854000	0.48673	-1.029000	0.03585	-0.426000	0.07360	0.305000	0.20034	GAG	ZNF540	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171817		0.388	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	-	0.00	48	0	G	NM_152606		38103432	+1	tier1	-	no_errors	ENST00000316433	ensembl	human	known	74_37	missense	49.23	33	32	SNP	0.888	C
ALG1L9P	285407	genome.wustl.edu	37	11	71526966	71526966	+	RNA	SNP	C	C	T			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr11:71526966C>T	ENST00000508969.2	-	0	0				ZNF705E_ENST00000525199.1_RNA	NR_073387.1																						GAACATCAGGCCTGGTGCTTG	0.328																																																	0																																												0																															11.37:g.71526966C>T				RNA	SNP	-	NULL	ENST00000508969.2	37	NULL		11																																																																																			ZNF705E	-	-	ENSG00000214534		0.328	CTD-2313N18.5-002	KNOWN	basic	processed_transcript	ZNF705E	HGNC	processed_transcript	OTTHUMT00000394764.1	-	0.00	95	0	C			71526966	-1	tier1	-	no_errors	ENST00000525199	ensembl	human	known	74_37	rna	31.73	71	33	SNP	0.001	T
ZNF729	100287226	genome.wustl.edu	37	19	22496884	22496884	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:22496884C>A	ENST00000601693.1	+	4	783	c.665C>A	c.(664-666)aCc>aAc	p.T222N	ZNF729_ENST00000357491.6_Missense_Mutation_p.T222N			A6NN14	ZN729_HUMAN	zinc finger protein 729	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TCGTTCTCAACCCTTACTAAA	0.308																																																	0																																										SO:0001583	missense	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.665C>A	19.37:g.22496884C>A	ENSP00000469582:p.Thr222Asn		M0QY45	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T222N	ENST00000601693.1	37	c.665	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.513858	0.00151	.	.	ENSG00000196350	ENST00000357491	T	0.14391	2.51	0.458	-0.916	0.10489	.	.	.	.	.	T	0.06416	0.0165	N	0.20483	0.58	.	.	.	.	.	.	.	.	.	T	0.42327	-0.9458	6	0.16896	T	0.51	.	2.3177	0.04202	0.39:0.2103:0.0:0.3997	.	.	.	.	N	222	ENSP00000350085:T222N	ENSP00000350085:T222N	T	+	2	0	ZNF729	22288724	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.366000	0.00128	-1.476000	0.01874	-1.512000	0.00943	ACC	ZNF729	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196350		0.308	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	-	0.00	66	0	C	XM_496301		22496884	+1	tier1	-	no_errors	ENST00000601693	ensembl	human	novel	74_37	missense	32.00	68	32	SNP	0.000	A
ZNF793	390927	genome.wustl.edu	37	19	38028524	38028524	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EP-01A-31D-A403-09	TCGA-VR-A8EP-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	57e88cb7-3eac-489b-9bbc-c7caf1f053d1	e61500b2-f617-4c8c-bbf4-0dba18979ba0	g.chr19:38028524G>A	ENST00000587143.1	+	6	1199	c.964G>A	c.(964-966)Gag>Aag	p.E322K	ZNF793_ENST00000588578.1_3'UTR|ZNF793_ENST00000589319.1_Intron|ZNF793_ENST00000542455.1_Missense_Mutation_p.E322K|ZNF793_ENST00000445217.1_Missense_Mutation_p.E322K			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E322K(1)		kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATCGTTTGGTGAGAAGTCATA	0.468																																					Melanoma(44;400 1431 1499 19093)												1	Substitution - Missense(1)	lung(1)											89.0	98.0	95.0					19																	38028524		2175	4285	6460	SO:0001583	missense	0			AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.964G>A	19.37:g.38028524G>A	ENSP00000468605:p.Glu322Lys		E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E322K	ENST00000587143.1	37	c.964	CCDS46062.1	19	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105512	0.77096	.	.	ENSG00000188227	ENST00000542455;ENST00000418827;ENST00000445217;ENST00000322299	T;T	0.35789	1.29;1.29	4.11	2.98	0.34508	.	0.000000	0.37955	N	0.001869	T	0.20210	0.0486	N	0.11131	0.1	0.23449	N	0.997653	P	0.46784	0.884	P	0.45474	0.482	T	0.04607	-1.0939	10	0.44086	T	0.13	.	5.8694	0.18795	0.1104:0.2829:0.6067:0.0	.	322	E9PGN4	.	K	322;322;322;321	ENSP00000444355:E322K;ENSP00000396402:E322K	ENSP00000318811:E321K	E	+	1	0	ZNF793	42720364	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-1.597000	0.02089	2.267000	0.75376	0.637000	0.83480	GAG	ZNF793	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188227		0.468	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF793	HGNC	protein_coding	OTTHUMT00000458621.1	-	0.00	78	0	G	NM_001013659		38028524	+1	tier1	-	no_errors	ENST00000445217	ensembl	human	known	74_37	missense	34.29	68	36	SNP	0.790	A
