#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A4GNT	51146	genome.wustl.edu	37	3	137849810	137849810	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:137849810G>A	ENST00000236709.3	-	2	490	c.289C>T	c.(289-291)Ccc>Tcc	p.P97S		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	97					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						GAGTTTGAGGGCATCGGTGTG	0.468																																																	0													115.0	117.0	116.0					3																	137849810		2203	4300	6503	SO:0001583	missense	0			AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.289C>T	3.37:g.137849810G>A	ENSP00000236709:p.Pro97Ser		Q0VDK1|Q0VDK2	Missense_Mutation	SNP	pfam_A1-4-GlycosylTfrase_dom,pfam_GlycoTrfase_DXD_sugar-bd_CS	p.P97S	ENST00000236709.3	37	c.289	CCDS3097.1	3	.	.	.	.	.	.	.	.	.	.	G	3.991	-0.004504	0.07773	.	.	ENSG00000118017	ENST00000236709	T	0.80123	-1.34	5.27	1.22	0.21188	Glycosyltransferase, DXD sugar-binding motif (1);	0.813367	0.10471	N	0.670757	T	0.73171	0.3553	M	0.71036	2.16	0.09310	N	1	P	0.35527	0.507	B	0.37550	0.253	T	0.56347	-0.7994	10	0.09590	T	0.72	-4.4364	2.4084	0.04418	0.2397:0.1551:0.4898:0.1154	.	97	Q9UNA3	A4GCT_HUMAN	S	97	ENSP00000236709:P97S	ENSP00000236709:P97S	P	-	1	0	A4GNT	139332500	0.006000	0.16342	0.000000	0.03702	0.304000	0.27724	0.464000	0.21988	-0.071000	0.12886	0.561000	0.74099	CCC	A4GNT	-	pfam_GlycoTrfase_DXD_sugar-bd_CS	ENSG00000118017		0.468	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A4GNT	HGNC	protein_coding	OTTHUMT00000357557.1	-	0.00	60	0	G	NM_016161		137849810	-1	tier1	-	no_errors	ENST00000236709	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.000	A
ACACA	31	genome.wustl.edu	37	17	35545292	35545292	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:35545292G>A	ENST00000394406.2	-	39	4780	c.4590C>T	c.(4588-4590)ctC>ctT	p.L1530L	ACACA_ENST00000335166.5_Silent_p.L1452L|ACACA_ENST00000360679.3_Silent_p.L1472L|ACACA_ENST00000353139.5_Silent_p.L1567L	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1530					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TTGTCAGGAAGAGGCGGATGG	0.498																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												0													178.0	157.0	164.0					17																	35545292		2203	4300	6503	SO:0001819	synonymous_variant	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.4590C>T	17.37:g.35545292G>A			B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Silent	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.L1567	ENST00000394406.2	37	c.4701	CCDS11317.1	17																																																																																			ACACA	-	pfam_AcCoA_COase_cen	ENSG00000132142		0.498	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	-	0.00	100	0	G	NM_198836		35545292	-1	tier1	-	no_errors	ENST00000353139	ensembl	human	known	74_37	silent	12.20	72	10	SNP	1.000	A
ADAMTS18	170692	genome.wustl.edu	37	16	77353746	77353746	+	Splice_Site	SNP	T	T	G	rs373640477		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:77353746T>G	ENST00000282849.5	-	16	2950	c.2532A>C	c.(2530-2532)gaA>gaC	p.E844D		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	844	Spacer.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						AGGGGCTTACTTCAAAGACCA	0.502																																																	0													64.0	64.0	64.0					16																	77353746		2198	4300	6498	SO:0001630	splice_region_variant	0			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2532+1A>C	16.37:g.77353746T>G			Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.E844D	ENST00000282849.5	37	c.2532	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	T	12.36	1.913301	0.33815	.	.	ENSG00000140873	ENST00000282849	T	0.53206	0.63	5.54	0.783	0.18572	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	M	0.75884	2.315	0.49582	D	0.999803	D;D	0.76494	0.963;0.999	P;D	0.79108	0.775;0.992	T	0.60198	-0.7310	9	.	.	.	.	10.5257	0.44948	0.0:0.2086:0.0:0.7914	.	844;844	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	D	844	ENSP00000282849:E844D	.	E	-	3	2	ADAMTS18	75911247	1.000000	0.71417	0.997000	0.53966	0.084000	0.17831	0.951000	0.29135	-0.132000	0.11557	-1.366000	0.01203	GAA	ADAMTS18	-	pfam_ADAM_spacer1	ENSG00000140873		0.502	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1		0.00	58	0	T		Missense_Mutation	77353746	-1			no_errors	ENST00000282849	ensembl	human	known	74_37	missense	6.67	27	2	SNP	1.000	G
ADHFE1	137872	genome.wustl.edu	37	8	67357611	67357611	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:67357611G>A	ENST00000396623.3	+	6	543	c.512G>A	c.(511-513)gGa>gAa	p.G171E	ADHFE1_ENST00000496501.1_3'UTR|ADHFE1_ENST00000415254.1_Missense_Mutation_p.G123E|ADHFE1_ENST00000379385.4_Missense_Mutation_p.G171E	NM_144650.2	NP_653251.2	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	171					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|molecular hydrogen transport (GO:0015993)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacid-oxoacid transhydrogenase activity (GO:0047988)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	29		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			ATTGGCAAGGGAAAGCCTGTG	0.433																																																	0													261.0	239.0	246.0					8																	67357611		2203	4300	6503	SO:0001583	missense	0			AK056992	CCDS6190.2	8q12.3	2013-05-21			ENSG00000147576	ENSG00000147576	1.1.99.24	"""Alcohol dehydrogenases"""	16354	protein-coding gene	gene with protein product	"""hydroxyacid-oxoacid transhydrogenase"""	611083				12592711	Standard	NM_144650		Approved	ADHFe1, FLJ32430	uc003xwb.4	Q8IWW8	OTTHUMG00000150215	ENST00000396623.3:c.512G>A	8.37:g.67357611G>A	ENSP00000379865:p.Gly171Glu		B4DTJ8|Q49A19|Q68CI7|Q6P2B6|Q96MF9	Missense_Mutation	SNP	pfam_ADH_Fe	p.G171E	ENST00000396623.3	37	c.512	CCDS6190.2	8	.	.	.	.	.	.	.	.	.	.	G	33	5.233116	0.95207	.	.	ENSG00000147576	ENST00000379385;ENST00000396623;ENST00000415254	T;T;T	0.40476	1.03;1.03;1.03	5.85	5.85	0.93711	Alcohol dehydrogenase, iron-type (1);	0.000000	0.85682	D	0.000000	T	0.66548	0.2800	M	0.80616	2.505	0.80722	D	1	D	0.61080	0.989	P	0.61940	0.896	T	0.66236	-0.5974	9	.	.	.	-0.6991	20.1731	0.98165	0.0:0.0:1.0:0.0	.	171	Q8IWW8	HOT_HUMAN	E	171;171;123	ENSP00000368695:G171E;ENSP00000379865:G171E;ENSP00000407115:G123E	.	G	+	2	0	ADHFE1	67520165	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.617000	0.83032	2.768000	0.95171	0.655000	0.94253	GGA	ADHFE1	-	pfam_ADH_Fe	ENSG00000147576		0.433	ADHFE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADHFE1	HGNC	protein_coding	OTTHUMT00000316867.3	-	0.00	47	0	G	NM_144650		67357611	+1	tier1	-	no_errors	ENST00000396623	ensembl	human	known	74_37	missense	42.00	29	21	SNP	1.000	A
AGAP6	414189	genome.wustl.edu	37	10	51769578	51769578	+	Missense_Mutation	SNP	C	C	T	rs527558369	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:51769578C>T	ENST00000374056.4	+	7	2022	c.1624C>T	c.(1624-1626)Cgg>Tgg	p.R542W	AGAP6_ENST00000412531.3_Missense_Mutation_p.R565W			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	542	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						AGAGAAGGAACGGTGGATCCG	0.557													.|||	2	0.000399361	0.0	0.0	5008	,	,		24462	0.0		0.0	False		,,,				2504	0.002																0																																										SO:0001583	missense	0				CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.1624C>T	10.37:g.51769578C>T	ENSP00000363168:p.Arg542Trp			Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.R542W	ENST00000374056.4	37	c.1624		10	.	.	.	.	.	.	.	.	.	.	.	9.574	1.121885	0.20877	.	.	ENSG00000204149	ENST00000374056;ENST00000412531	.	.	.	0.0465	0.0465	0.14256	.	0.299915	0.36854	N	0.002361	T	0.60856	0.2301	M	0.91196	3.185	0.54753	D	0.999989	B	0.30889	0.299	B	0.24269	0.052	T	0.56968	-0.7891	9	0.49607	T	0.09	.	5.9248	0.19104	0.0:0.9993:0.0:7.0E-4	.	565	C9IYN2	.	W	565;542	.	ENSP00000363168:R565W	R	+	1	2	AGAP6	51439584	1.000000	0.71417	0.104000	0.21259	0.105000	0.19272	1.974000	0.40559	0.132000	0.18615	0.134000	0.15878	CGG	AGAP6	-	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP	ENSG00000204149		0.557	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	AGAP6	HGNC	protein_coding		-	0.00	135	0	C	NM_001077665		51769578	+1	tier1	-	no_errors	ENST00000374056	ensembl	human	known	74_37	missense	13.28	111	17	SNP	1.000	T
AGBL1	123624	genome.wustl.edu	37	15	86838515	86838515	+	Silent	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:86838515C>A	ENST00000441037.2	+	16	2207	c.2112C>A	c.(2110-2112)gtC>gtA	p.V704V	AGBL1_ENST00000389298.3_Silent_p.V435V|AGBL1-AS1_ENST00000564487.1_RNA|AGBL1_ENST00000421325.2_Silent_p.V704V|AGBL1-AS1_ENST00000566878.1_RNA	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	704					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						AAAAGAGTGTCAACCTCAAAG	0.443																																																	0													60.0	60.0	60.0					15																	86838515		1915	4138	6053	SO:0001819	synonymous_variant	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2112C>A	15.37:g.86838515C>A			A1A4X5|A6NJH6|C9JHL5	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.V704	ENST00000441037.2	37	c.2112	CCDS58398.1	15																																																																																			AGBL1	-	NULL	ENSG00000166748		0.443	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	-	0.00	54	0	C	NM_152336		86838515	+1	tier1	-	no_errors	ENST00000441037	ensembl	human	known	74_37	silent	37.14	22	13	SNP	0.049	A
AGL	178	genome.wustl.edu	37	1	100382219	100382219	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:100382219G>A	ENST00000294724.4	+	33	4891	c.4413G>A	c.(4411-4413)ccG>ccA	p.P1471P	AGL_ENST00000361302.3_Silent_p.P1455P|AGL_ENST00000361915.3_Silent_p.P1471P|AGL_ENST00000370163.3_Silent_p.P1471P|AGL_ENST00000361522.4_Silent_p.P1454P|AGL_ENST00000370165.3_Silent_p.P1471P|AGL_ENST00000370161.2_Silent_p.P1455P	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1471					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TGATGGGCCCGGAGACTACTG	0.353																																																	0													83.0	88.0	86.0					1																	100382219		2203	4300	6503	SO:0001819	synonymous_variant	0			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.4413G>A	1.37:g.100382219G>A			A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Silent	SNP	pfam_AGL/Gdb1,superfamily_6-hairpin_glycosidase-like,superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	p.P1471	ENST00000294724.4	37	c.4413	CCDS759.1	1																																																																																			AGL	-	pfam_AGL/Gdb1,superfamily_6-hairpin_glycosidase-like,tigrfam_Glycogen_debranch_met	ENSG00000162688		0.353	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGL	HGNC	protein_coding	OTTHUMT00000029778.1	-	0.00	66	0	G	NM_000028		100382219	+1	tier1	-	no_errors	ENST00000294724	ensembl	human	known	74_37	silent	28.57	35	14	SNP	0.686	A
AGPAT6	137964	genome.wustl.edu	37	8	41469749	41469749	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:41469749C>T	ENST00000396987.3	+	7	1679	c.752C>T	c.(751-753)cCg>cTg	p.P251L	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	251					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			CATACCTCACCGATCGATGTG	0.458																																																	0													170.0	143.0	152.0					8																	41469749		2203	4300	6503	SO:0001583	missense	0			AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.752C>T	8.37:g.41469749C>T	ENSP00000380184:p.Pro251Leu		Q86V89	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.P251L	ENST00000396987.3	37	c.752	CCDS6117.1	8	.	.	.	.	.	.	.	.	.	.	C	20.8	4.053385	0.75960	.	.	ENSG00000158669	ENST00000396987	D	0.92299	-3.01	5.03	5.03	0.67393	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.95121	0.8419	M	0.80508	2.5	0.80722	D	1	D	0.56968	0.978	P	0.55871	0.786	D	0.95578	0.8644	10	0.72032	D	0.01	.	17.5492	0.87871	0.0:1.0:0.0:0.0	.	251	Q86UL3	GPAT4_HUMAN	L	251	ENSP00000380184:P251L	ENSP00000380184:P251L	P	+	2	0	AGPAT6	41588906	1.000000	0.71417	0.150000	0.22450	0.170000	0.22686	7.617000	0.83032	2.620000	0.88729	0.655000	0.94253	CCG	AGPAT6	-	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	ENSG00000158669		0.458	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT6	HGNC	protein_coding	OTTHUMT00000377158.1	-	0.00	60	0	C	NM_178819		41469749	+1	tier1	-	no_errors	ENST00000396987	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.999	T
AGT	183	genome.wustl.edu	37	1	230839072	230839072	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:230839072G>T	ENST00000366667.4	-	5	1487	c.1273C>A	c.(1273-1275)Ctg>Atg	p.L425M		NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	425					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATGCTGTTCAGCACCTGCAAA	0.572																																																	0													82.0	80.0	81.0					1																	230839072		2203	4300	6503	SO:0001583	missense	0			K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.1273C>A	1.37:g.230839072G>T	ENSP00000355627:p.Leu425Met		Q16358|Q16359|Q96F91	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom,prints_Angiotensinogen	p.L425M	ENST00000366667.4	37	c.1273	CCDS1585.1	1	.	.	.	.	.	.	.	.	.	.	g	6.572	0.473898	0.12521	.	.	ENSG00000135744	ENST00000366667;ENST00000430091	D	0.85773	-2.03	5.35	0.502	0.16932	Serpin domain (3);	0.514631	0.21712	N	0.070249	T	0.75265	0.3826	L	0.43757	1.38	0.33832	D	0.630323	P;P	0.37955	0.612;0.612	B;B	0.35510	0.204;0.204	T	0.73313	-0.4022	10	0.36615	T	0.2	.	7.7319	0.28791	0.0:0.1368:0.3152:0.548	.	425;425	B0ZBE2;P01019	.;ANGT_HUMAN	M	425;343	ENSP00000355627:L425M	ENSP00000355627:L425M	L	-	1	2	AGT	228905695	0.945000	0.32115	0.896000	0.35187	0.419000	0.31324	1.164000	0.31810	0.177000	0.19895	-0.301000	0.09380	CTG	AGT	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000135744		0.572	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGT	HGNC	protein_coding	OTTHUMT00000092102.1	-	0.00	61	0	G	NM_000029		230839072	-1	tier1	-	no_errors	ENST00000366667	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.969	T
AGXT	189	genome.wustl.edu	37	2	241818185	241818185	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:241818185G>A	ENST00000307503.3	+	11	1513	c.1126G>A	c.(1126-1128)Gtg>Atg	p.V376M		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	376					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	TGTGGACCGCGTGACGGAGGC	0.692																																																	0													27.0	30.0	29.0					2																	241818185		2199	4289	6488	SO:0001583	missense	0			D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.1126G>A	2.37:g.241818185G>A	ENSP00000302620:p.Val376Met		Q53QU6	Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase	p.V376M	ENST00000307503.3	37	c.1126	CCDS2543.1	2	.	.	.	.	.	.	.	.	.	.	G	10.13	1.265860	0.23136	.	.	ENSG00000172482	ENST00000307503	D	0.88124	-2.34	4.05	2.06	0.26882	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.383950	0.25258	N	0.031975	D	0.92163	0.7515	M	0.80982	2.52	0.18873	N	0.999983	D;D	0.71674	0.998;0.998	D;P	0.65773	0.938;0.893	D	0.85939	0.1457	10	0.72032	D	0.01	-20.463	12.6577	0.56795	0.0:0.4758:0.5242:0.0	.	254;376	Q9UJX1;P21549	.;SPYA_HUMAN	M	376	ENSP00000302620:V376M	ENSP00000302620:V376M	V	+	1	0	AGXT	241466858	0.615000	0.27026	0.004000	0.12327	0.019000	0.09904	1.624000	0.37018	0.222000	0.20900	0.467000	0.42956	GTG	AGXT	-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase	ENSG00000172482		0.692	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT	HGNC	protein_coding	OTTHUMT00000257186.1	-	0.00	111	0	G	NM_000030		241818185	+1	tier1	-	no_errors	ENST00000307503	ensembl	human	known	74_37	missense	32.14	57	27	SNP	0.012	A
AJAP1	55966	genome.wustl.edu	37	1	4772583	4772585	+	In_Frame_Del	DEL	CCA	CCA	-	rs141981296	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:4772583_4772585delCCA	ENST00000378191.4	+	2	1034_1036	c.653_655delCCA	c.(652-657)gccacc>gcc	p.T225del	AJAP1_ENST00000378190.3_In_Frame_Del_p.T225del	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	225	Thr-rich.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T225_A226insT(1)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		ACTGTGGccgccaccaccaccac	0.635																																																	1	Insertion - In frame(1)	large_intestine(1)																																								SO:0001651	inframe_deletion	0			AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.653_655delCCA	1.37:g.4772592_4772594delCCA	ENSP00000367433:p.Thr225del		Q9Y229	In_Frame_Del	DEL	NULL	p.T222in_frame_del	ENST00000378191.4	37	c.653_655	CCDS54.1	1																																																																																			AJAP1	-	NULL	ENSG00000196581		0.635	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	AJAP1	HGNC	protein_coding	OTTHUMT00000001542.3		0.00	109	0	CCA	NM_018836		4772585	+1	tier1		no_errors	ENST00000378190	ensembl	human	known	74_37	in_frame_del	8.11	34	3	DEL	0.919:0.855:0.873	-
AHDC1	27245	genome.wustl.edu	37	1	27874532	27874532	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:27874532G>A	ENST00000247087.5	-	5	4691	c.4095C>T	c.(4093-4095)tgC>tgT	p.C1365C	AHDC1_ENST00000374011.2_Silent_p.C1365C			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1365							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		TGGGCGAGTCGCAGTGGAAGC	0.632																																																	0													73.0	68.0	70.0					1																	27874532		2203	4300	6503	SO:0001819	synonymous_variant	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.4095C>T	1.37:g.27874532G>A			Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	NULL	p.C1365	ENST00000247087.5	37	c.4095	CCDS30652.1	1																																																																																			AHDC1	-	NULL	ENSG00000126705		0.632	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3		0.00	86	0	G			27874532	-1			no_errors	ENST00000247087	ensembl	human	known	74_37	silent	5.45	52	3	SNP	1.000	A
ALDH9A1	223	genome.wustl.edu	37	1	165638177	165638177	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:165638177C>T	ENST00000354775.4	-	8	1497	c.1193G>A	c.(1192-1194)aGa>aAa	p.R398K	ALDH9A1_ENST00000538148.1_Missense_Mutation_p.R304K	NM_000696.3	NP_000687.3	P49189	AL9A1_HUMAN	aldehyde dehydrogenase 9 family, member A1	374					carnitine biosynthetic process (GO:0045329)|cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|hormone metabolic process (GO:0042445)|kidney development (GO:0001822)|liver development (GO:0001889)|neurotransmitter biosynthetic process (GO:0042136)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	1-pyrroline dehydrogenase activity (GO:0033737)|3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|4-trimethylammoniobutyraldehyde dehydrogenase activity (GO:0047105)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|amine binding (GO:0043176)|aminobutyraldehyde dehydrogenase activity (GO:0019145)|NAD binding (GO:0051287)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	21	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					TACACAAGGTCTCATGTAATA	0.303																																					Ovarian(179;1583 2014 18106 33801 42447)												0													109.0	114.0	112.0					1																	165638177		2203	4300	6503	SO:0001583	missense	0			U34252	CCDS1250.2	1q22-q23	2008-02-05			ENSG00000143149	ENSG00000143149		"""Aldehyde dehydrogenases"""	412	protein-coding gene	gene with protein product		602733		ALDH7, ALDH4, ALDH9		8112751, 8786138	Standard	NM_000696		Approved	E3	uc001gdh.1	P49189	OTTHUMG00000034677	ENST00000354775.4:c.1193G>A	1.37:g.165638177C>T	ENSP00000346827:p.Arg398Lys		B2R6X1|B4DXY7|Q5VV90|Q6LCL1|Q9NZT7	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.R398K	ENST00000354775.4	37	c.1193	CCDS1250.2	1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546104	0.45383	.	.	ENSG00000143149	ENST00000354775;ENST00000538148	T;T	0.75154	-0.91;-0.91	4.78	-2.54	0.06307	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.502277	0.22531	N	0.058849	T	0.34832	0.0911	N	0.25245	0.725	0.09310	N	0.999991	B;B;B;B	0.17852	0.004;0.024;0.017;0.024	B;B;B;B	0.25987	0.026;0.065;0.05;0.05	T	0.04693	-1.0933	9	0.39692	T	0.17	.	5.891	0.18913	0.0:0.3255:0.4136:0.2609	.	304;388;374;398	B4DYY1;B4DX14;P49189;B9EKV4	.;.;AL9A1_HUMAN;.	K	398;304	ENSP00000346827:R398K;ENSP00000440026:R304K	ENSP00000346827:R398K	R	-	2	0	ALDH9A1	163904801	0.001000	0.12720	0.975000	0.42487	0.963000	0.63663	0.072000	0.14617	-0.502000	0.06596	-0.233000	0.12211	AGA	ALDH9A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000143149		0.303	ALDH9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH9A1	HGNC	protein_coding	OTTHUMT00000083899.1	-	0.00	42	0	C			165638177	-1	tier1	-	no_errors	ENST00000354775	ensembl	human	known	74_37	missense	18.75	26	6	SNP	0.888	T
ANGPT1	284	genome.wustl.edu	37	8	108334253	108334253	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:108334253T>G	ENST00000520734.1	-	3	364	c.79A>C	c.(79-81)Aca>Cca	p.T27P	ANGPT1_ENST00000518386.1_5'Flank|ANGPT1_ENST00000520052.1_Missense_Mutation_p.T27P			Q15389	ANGP1_HUMAN	angiopoietin 1	227					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			ATTATATATGTTTGACGAGTA	0.408																																																	0													197.0	180.0	186.0					8																	108334253		2203	4300	6503	SO:0001583	missense	0			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.79A>C	8.37:g.108334253T>G	ENSP00000430750:p.Thr27Pro		Q5HYA0	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.T227P	ENST00000520734.1	37	c.679		8	.	.	.	.	.	.	.	.	.	.	T	14.59	2.580368	0.46006	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000395820;ENST00000520734;ENST00000520052	T;T;T;T	0.54479	0.92;0.92;0.58;0.57	5.35	2.91	0.33838	.	0.188455	0.53938	D	0.000047	T	0.40791	0.1131	L	0.43152	1.355	0.33359	D	0.572057	B;B;B	0.32010	0.351;0.136;0.136	B;B;B	0.34180	0.177;0.102;0.102	T	0.45775	-0.9238	10	0.25751	T	0.34	.	7.1372	0.25535	0.131:0.0713:0.0:0.7977	.	27;227;227	E7ERK4;Q5HYA0;Q15389	.;.;ANGP1_HUMAN	P	227;227;39;27;27	ENSP00000428340:T227P;ENSP00000297450:T227P;ENSP00000430750:T27P;ENSP00000429349:T27P	ENSP00000297450:T227P	T	-	1	0	ANGPT1	108403429	1.000000	0.71417	0.310000	0.25168	0.962000	0.63368	5.692000	0.68256	0.323000	0.23307	-0.256000	0.11100	ACA	ANGPT1	-	NULL	ENSG00000154188		0.408	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	ANGPT1	HGNC	protein_coding	OTTHUMT00000380428.2	-	0.00	50	0	T	NM_001146, NM_139290		108334253	-1	tier1	-	no_errors	ENST00000517746	ensembl	human	known	74_37	missense	13.41	71	11	SNP	0.951	G
ANK1	286	genome.wustl.edu	37	8	41580706	41580706	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:41580706A>T	ENST00000347528.4	-	9	929	c.846T>A	c.(844-846)aaT>aaA	p.N282K	ANK1_ENST00000289734.7_Missense_Mutation_p.N282K|ANK1_ENST00000352337.4_Missense_Mutation_p.N282K|ANK1_ENST00000396942.1_Missense_Mutation_p.N282K|ANK1_ENST00000396945.1_Missense_Mutation_p.N282K|ANK1_ENST00000265709.8_Missense_Mutation_p.N315K|ANK1_ENST00000379758.2_Missense_Mutation_p.N282K	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	282	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCACGTGCCCATTTCGAGCTG	0.498																																																	0													157.0	137.0	144.0					8																	41580706		2203	4300	6503	SO:0001583	missense	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.846T>A	8.37:g.41580706A>T	ENSP00000339620:p.Asn282Lys		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.N282K	ENST00000347528.4	37	c.846	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	A	20.5	3.998847	0.74818	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.41	0.255	0.15561	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	N	0.17838	0.53	0.58432	D	0.999997	D;D;P;D;D	0.89917	1.0;1.0;0.949;0.988;1.0	D;D;P;P;D	0.97110	1.0;1.0;0.569;0.799;1.0	T	0.56486	-0.7971	10	0.46703	T	0.11	.	8.9781	0.35948	0.7004:0.0:0.2996:0.0	.	315;282;282;282;282	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	K	282;282;282;282;282;282;315;282	ENSP00000339620:N282K;ENSP00000289734:N282K;ENSP00000369082:N282K;ENSP00000380149:N282K;ENSP00000380147:N282K;ENSP00000309131:N282K;ENSP00000265709:N315K	ENSP00000265709:N315K	N	-	3	2	ANK1	41699863	0.989000	0.36119	0.997000	0.53966	0.985000	0.73830	0.384000	0.20668	-0.176000	0.10707	-0.290000	0.09829	AAT	ANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.498	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	-	0.00	69	0	A	NM_020475		41580706	-1	tier1	-	no_errors	ENST00000396942	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
ANGPT1	284	genome.wustl.edu	37	8	108359297	108359297	+	IGR	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:108359297T>G								ANGPT1 (10547 upstream) : RNA5SP275 (537424 downstream)																							CATCTCCGACTTCATGTTTTC	0.453																																																	0													142.0	131.0	135.0					8																	108359297		2203	4300	6503	SO:0001628	intergenic_variant	0																															8.37:g.108359297T>G				Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.K109T		37	c.326		8	.	.	.	.	.	.	.	.	.	.	T	15.93	2.978560	0.53720	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520033	D;D	0.85013	-1.93;-1.93	5.94	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.87481	0.6188	M	0.69823	2.125	0.80722	D	1	P;P	0.42556	0.783;0.783	P;P	0.48189	0.57;0.57	D	0.87494	0.2429	10	0.72032	D	0.01	.	12.1291	0.53932	0.0:0.0669:0.0:0.9331	.	109;109	Q5HYA0;Q15389	.;ANGP1_HUMAN	T	109;109;2	ENSP00000428340:K109T;ENSP00000297450:K109T	ENSP00000297450:K109T	K	-	2	0	ANGPT1	108428473	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.085000	0.57657	1.061000	0.40601	-0.280000	0.10049	AAG	ANGPT1	-	NULL	ENSG00000154188	0	0.453					ANGPT1	HGNC			-	0.00	65	0	T			108359297	-1	tier1	-	no_errors	ENST00000517746	ensembl	human	known	74_37	missense	12.73	48	7	SNP	1.000	G
ANKIB1	54467	genome.wustl.edu	37	7	91974350	91974350	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:91974350G>T	ENST00000265742.3	+	7	1431	c.1055G>T	c.(1054-1056)gGa>gTa	p.G352V		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	352							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATGCCCTGTGGACATGACTTT	0.383																																																	0													355.0	325.0	334.0					7																	91974350		1902	4136	6038	SO:0001583	missense	0			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.1055G>T	7.37:g.91974350G>T	ENSP00000265742:p.Gly352Val		Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	pfam_Znf_C6HC,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Znf_RING,smart_Znf_C6HC,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif,pfscan_Znf_RING	p.G352V	ENST00000265742.3	37	c.1055	CCDS47639.1	7	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781460	0.70222	.	.	ENSG00000001629	ENST00000265742	T	0.14516	2.5	5.4	5.4	0.78164	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.054806	0.64402	D	0.000001	T	0.28333	0.0700	M	0.90369	3.11	0.80722	D	1	P	0.40144	0.704	B	0.38428	0.273	T	0.33085	-0.9882	10	0.87932	D	0	.	17.3463	0.87310	0.0:0.0:1.0:0.0	.	352	Q9P2G1	AKIB1_HUMAN	V	352	ENSP00000265742:G352V	ENSP00000265742:G352V	G	+	2	0	ANKIB1	91812286	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.398000	0.97281	2.534000	0.85438	0.467000	0.42956	GGA	ANKIB1	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000001629		0.383	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKIB1	HGNC	protein_coding	OTTHUMT00000342018.1		0.00	32	0	G			91974350	+1			no_errors	ENST00000265742	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
AP4B1	10717	genome.wustl.edu	37	1	114438762	114438762	+	Intron	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:114438762C>T	ENST00000369569.1	-	9	1791				AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000462591.1_Intron|AP4B1_ENST00000369567.1_Intron|AP4B1_ENST00000256658.4_Intron	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGAGGAAAACCTAGGAAGCA	0.373																																																	0																																										SO:0001627	intron_variant	0			AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1511-102G>A	1.37:g.114438762C>T			B7Z4X3|Q59EJ4|Q96CL6	RNA	SNP	-	NULL	ENST00000369569.1	37	NULL	CCDS865.1	1																																																																																			AP4B1	-	-	ENSG00000134262		0.373	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP4B1	HGNC	protein_coding	OTTHUMT00000033037.1	-	0.00	23	0	C	NM_006594		114438762	-1	tier1	-	no_errors	ENST00000479285	ensembl	human	known	74_37	rna	40.00	12	8	SNP	0.000	T
LVRN	206338	genome.wustl.edu	37	5	115327967	115327967	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:115327967G>T	ENST00000357872.4	+	5	1377	c.1253G>T	c.(1252-1254)gGa>gTa	p.G418V	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		418						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										CACGAGATTGGACACCAGGCA	0.393																																																	0													122.0	127.0	126.0					5																	115327967		2202	4300	6502	SO:0001583	missense	0																														ENST00000357872.4:c.1253G>T	5.37:g.115327967G>T	ENSP00000350541:p.Gly418Val		A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.G418V	ENST00000357872.4	37	c.1253	CCDS4124.1	5	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129077	0.37533	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.04502	3.61	5.81	2.83	0.33086	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.303270	0.26654	N	0.023199	T	0.05593	0.0147	N	0.25286	0.73	0.80722	D	1	P	0.38223	0.623	B	0.43838	0.433	T	0.50389	-0.8834	10	0.38643	T	0.18	.	12.551	0.56225	0.0:0.3247:0.568:0.1073	.	418	Q6Q4G3	AMPQ_HUMAN	V	418;407	ENSP00000350541:G418V	ENSP00000350541:G418V	G	+	2	0	AC010282.1	115355866	1.000000	0.71417	0.984000	0.44739	0.963000	0.63663	1.159000	0.31749	0.767000	0.33267	-0.150000	0.13652	GGA	AQPEP	-	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	ENSG00000172901		0.393	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Uniprot_gn	protein_coding	OTTHUMT00000250852.1		0.00	101	0	G			115327967	+1			no_errors	ENST00000357872	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.972	T
ARG2	384	genome.wustl.edu	37	14	68086728	68086728	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:68086728C>T	ENST00000261783.3	+	1	214	c.34C>T	c.(34-36)Cag>Tag	p.Q12*	ARG2_ENST00000556491.1_3'UTR|Y_RNA_ENST00000364659.1_RNA	NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	12					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	GCGTCTCCTCCAGACGCGAGT	0.617																																																	0													29.0	29.0	29.0					14																	68086728		2200	4295	6495	SO:0001587	stop_gained	0			D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.34C>T	14.37:g.68086728C>T	ENSP00000261783:p.Gln12*		B2R690|Q6FHY8	Nonsense_Mutation	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase	p.Q12*	ENST00000261783.3	37	c.34	CCDS9785.1	14	.	.	.	.	.	.	.	.	.	.	C	22.5	4.293163	0.80914	.	.	ENSG00000081181	ENST00000261783	.	.	.	4.48	4.48	0.54585	.	0.347092	0.25416	N	0.030835	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	9.8339	0.40958	0.2045:0.7954:0.0:0.0	.	.	.	.	X	12	.	ENSP00000261783:Q12X	Q	+	1	0	ARG2	67156481	0.079000	0.21365	0.013000	0.15412	0.036000	0.12997	2.570000	0.45981	2.321000	0.78463	0.561000	0.74099	CAG	ARG2	-	NULL	ENSG00000081181		0.617	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARG2	HGNC	protein_coding	OTTHUMT00000415190.2	-	0.00	83	0	C	NM_001172		68086728	+1	tier1	-	no_errors	ENST00000261783	ensembl	human	known	74_37	nonsense	40.38	31	21	SNP	0.007	T
ARHGAP32	9743	genome.wustl.edu	37	11	128840140	128840140	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:128840140C>T	ENST00000310343.9	-	22	4925	c.4926G>A	c.(4924-4926)gaG>gaA	p.E1642E	ARHGAP32_ENST00000392657.3_Silent_p.E1293E|ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000527272.1_Silent_p.E1293E	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1642	Interaction with GAB2.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CCCGGCCATTCTCAAAGTAAG	0.507																																																	0													89.0	85.0	86.0					11																	128840140		2201	4297	6498	SO:0001819	synonymous_variant	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.4926G>A	11.37:g.128840140C>T			I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E1642	ENST00000310343.9	37	c.4926	CCDS44769.1	11																																																																																			ARHGAP32	-	NULL	ENSG00000134909		0.507	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	-	0.00	66	0	C	NM_014715		128840140	-1	tier1	-	no_errors	ENST00000310343	ensembl	human	known	74_37	silent	18.75	26	6	SNP	1.000	T
ARHGEF16	27237	genome.wustl.edu	37	1	3382716	3382716	+	Missense_Mutation	SNP	C	C	T	rs562450072		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:3382716C>T	ENST00000378378.4	+	3	998	c.593C>T	c.(592-594)aCg>aTg	p.T198M	ARHGEF16_ENST00000378373.1_5'UTR|ARHGEF16_ENST00000378371.2_5'Flank	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	198					activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GTGCAGAAGACGCTGGGGAGG	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		17938	0.001		0.0	False		,,,				2504	0.0																0													108.0	104.0	105.0					1																	3382716		692	1591	2283	SO:0001583	missense	0			D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.593C>T	1.37:g.3382716C>T	ENSP00000367629:p.Thr198Met		Q86TF0|Q99434	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.T198M	ENST00000378378.4	37	c.593	CCDS46.2	1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.192592	0.38707	.	.	ENSG00000130762	ENST00000378378	T	0.64260	-0.09	3.5	3.5	0.40072	.	0.710264	0.12879	N	0.431573	T	0.72977	0.3528	M	0.67953	2.075	0.80722	D	1	D	0.71674	0.998	P	0.56474	0.799	T	0.74197	-0.3743	10	0.45353	T	0.12	-30.8722	15.885	0.79241	0.0:1.0:0.0:0.0	.	198	Q5VV41	ARHGG_HUMAN	M	198	ENSP00000367629:T198M	ENSP00000367629:T198M	T	+	2	0	ARHGEF16	3372576	0.016000	0.18221	0.893000	0.35052	0.743000	0.42351	1.304000	0.33482	2.242000	0.73789	0.655000	0.94253	ACG	ARHGEF16	-	NULL	ENSG00000130762		0.627	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF16	HGNC	protein_coding	OTTHUMT00000001515.1	-	0.00	63	0	C	NM_014448		3382716	+1	tier1	-	no_errors	ENST00000378378	ensembl	human	known	74_37	missense	40.62	38	26	SNP	0.997	T
ARID3B	10620	genome.wustl.edu	37	15	74836313	74836313	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:74836313G>A	ENST00000346246.5	+	2	267	c.36G>A	c.(34-36)caG>caA	p.Q12Q		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	12	Gln-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						agcagcagcagcaacaacaga	0.567																																																	0													17.0	21.0	20.0					15																	74836313		2194	4294	6488	SO:0001819	synonymous_variant	0				CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.36G>A	15.37:g.74836313G>A			O95443|Q59HC9|Q6P9C9	Silent	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q12	ENST00000346246.5	37	c.36	CCDS10264.1	15																																																																																			ARID3B	-	NULL	ENSG00000179361		0.567	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3B	HGNC	protein_coding	OTTHUMT00000280688.2		0.00	24	0	G	NM_006465		74836313	+1			no_errors	ENST00000346246	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.998	A
ARSB	411	genome.wustl.edu	37	5	78181610	78181610	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:78181610G>T	ENST00000264914.4	-	5	1475	c.939C>A	c.(937-939)ccC>ccA	p.P313P	ARSB_ENST00000521800.1_5'UTR|ARSB_ENST00000396151.3_Silent_p.P313P|ARSB_ENST00000565165.1_Silent_p.P313P	NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	313					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		TTCCTCGAAGGGGCCAGTTAT	0.522																																					Melanoma(169;563 1968 25780 26156 52266)												0													98.0	103.0	101.0					5																	78181610		2203	4300	6503	SO:0001819	synonymous_variant	0			M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.939C>A	5.37:g.78181610G>T			B2RC20|Q8N322|Q9UDI9	Silent	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.P313	ENST00000264914.4	37	c.939	CCDS4043.1	5																																																																																			ARSB	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000113273		0.522	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSB	HGNC	protein_coding	OTTHUMT00000226932.2	-	0.00	81	0	G	NM_000046		78181610	-1	tier1	-	no_errors	ENST00000264914	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.950	T
ASPDH	554235	genome.wustl.edu	37	19	51016201	51016201	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:51016201G>A	ENST00000389208.4	-	3	326	c.265C>T	c.(265-267)Cgc>Tgc	p.R89C	JOSD2_ENST00000391815.3_5'Flank|ASPDH_ENST00000597030.1_Intron|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.R34C|JOSD2_ENST00000595669.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	89					NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						TTGGCATGGCGCAGGATTTGT	0.577																																																	0													111.0	107.0	108.0					19																	51016201		2203	4300	6503	SO:0001583	missense	0				CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.265C>T	19.37:g.51016201G>A	ENSP00000373860:p.Arg89Cys		Q6NZ37	Missense_Mutation	SNP	pfam_Asp_DH,pfam_Asp/hSer_DH_NAD-bd	p.R89C	ENST00000389208.4	37	c.265	CCDS46153.1	19	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156417	0.57259	.	.	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.48201	0.87;0.82	3.82	1.28	0.21552	Aspartate/homoserine dehydrogenase, NAD-binding (1);NAD(P)-binding domain (1);	0.278453	0.30704	N	0.009057	T	0.50786	0.1636	L	0.59436	1.845	0.37387	D	0.912279	D;D	0.65815	0.995;0.994	P;P	0.54965	0.765;0.656	T	0.56019	-0.8048	10	0.59425	D	0.04	-6.6757	6.576	0.22567	0.0:0.1961:0.6036:0.2002	.	89;34	A6ND91;A6ND91-2	ASPD_HUMAN;.	C	34;89	ENSP00000366114:R34C;ENSP00000373860:R89C	ENSP00000366114:R34C	R	-	1	0	ASPDH	55708013	0.000000	0.05858	0.452000	0.26994	0.972000	0.66771	0.165000	0.16564	0.668000	0.31126	0.555000	0.69702	CGC	ASPDH	-	pfam_Asp/hSer_DH_NAD-bd	ENSG00000204653		0.577	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPDH	HGNC	protein_coding	OTTHUMT00000464861.1		0.00	29	0	G	NM_001024656		51016201	-1			no_errors	ENST00000389208	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.633	A
ATG2A	23130	genome.wustl.edu	37	11	64681916	64681916	+	Missense_Mutation	SNP	G	G	T	rs368301169		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:64681916G>T	ENST00000377264.3	-	2	340	c.228C>A	c.(226-228)ttC>ttA	p.F76L	ATG2A_ENST00000421419.2_Missense_Mutation_p.F76L	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	76					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						TGGAGCCCACGAAGCCTTCCA	0.637																																																	0													51.0	52.0	51.0					11																	64681916		2201	4297	6498	SO:0001583	missense	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.228C>A	11.37:g.64681916G>T	ENSP00000366475:p.Phe76Leu		O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.F76L	ENST00000377264.3	37	c.228	CCDS31602.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	19.48|19.48	3.835794|3.835794	0.71373|0.71373	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000421419;ENST00000377264;ENST00000227459|ENST00000377262	T;T|.	0.47177|.	0.85;0.85|.	3.91|3.91	-3.72|-3.72	0.04411|0.04411	.|.	0.141268|.	0.46758|.	D|.	0.000266|.	T|T	0.64583|0.64583	0.2611|0.2611	M|M	0.66939|0.66939	2.045|2.045	0.45554|0.45554	D|D	0.998502|0.998502	P|.	0.52170|.	0.951|.	P|.	0.53313|.	0.723|.	T|T	0.62854|0.62854	-0.6766|-0.6766	10|6	0.54805|0.34782	T|T	0.06|0.22	.|.	10.9106|10.9106	0.47106|0.47106	0.6866:0.0:0.3134:0.0|0.6866:0.0:0.3134:0.0	.|.	76|.	Q2TAZ0|.	ATG2A_HUMAN|.	L|S	76|74	ENSP00000410522:F76L;ENSP00000366475:F76L|.	ENSP00000227459:F76L|ENSP00000366473:R74S	F|R	-|-	3|1	2|0	ATG2A|ATG2A	64438492|64438492	0.993000|0.993000	0.37304|0.37304	0.947000|0.947000	0.38551|0.38551	0.923000|0.923000	0.55619|0.55619	0.314000|0.314000	0.19432|0.19432	-0.939000|-0.939000	0.03709|0.03709	-0.461000|-0.461000	0.05368|0.05368	TTC|CGT	ATG2A	-	NULL	ENSG00000110046		0.637	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1		0.00	81	0	G	NM_015104		64681916	-1			no_errors	ENST00000421419	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.987	T
ATP5SL	55101	genome.wustl.edu	37	19	41942337	41942337	+	Missense_Mutation	SNP	C	C	T	rs373307297		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:41942337C>T	ENST00000221943.9	-	3	261	c.256G>A	c.(256-258)Gca>Aca	p.A86T	ATP5SL_ENST00000589970.1_Missense_Mutation_p.A86T|ATP5SL_ENST00000301183.11_Missense_Mutation_p.A92T|ATP5SL_ENST00000597457.1_Intron|ATP5SL_ENST00000417807.3_Missense_Mutation_p.A92T|ATP5SL_ENST00000590641.2_Intron|ATP5SL_ENST00000438807.3_Intron|ATP5SL_ENST00000595425.1_Intron|ATP5SL_ENST00000592922.2_Intron	NM_018035.2	NP_060505.2	Q9NW81	AT5SL_HUMAN	ATP5S-like	86						mitochondrion (GO:0005739)				breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	11						AAGGCACCTGCGCCGTATGGA	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		20004	0.0		0.0	False		,,,				2504	0.001																0								C	THR/ALA,THR/ALA,THR/ALA,,,THR/ALA	0,4406		0,0,2203	154.0	128.0	137.0		274,274,256,,,256	0.7	0.0	19		137	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,intron,intron,missense	ATP5SL	NM_001167867.1,NM_001167868.1,NM_001167869.1,NM_001167870.1,NM_001167871.1,NM_018035.2	58,58,58,,,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,,,benign	92/264,92/192,86/186,,,86/258	41942337	1,13005	2203	4300	6503	SO:0001583	missense	0			AK001103	CCDS33032.1, CCDS54269.1, CCDS54270.1, CCDS54271.1, CCDS59389.1, CCDS59390.1	19q13.2	2007-12-13				ENSG00000105341			25496	protein-coding gene	gene with protein product						12477932	Standard	NM_001167867		Approved	FLJ10241	uc002oqv.3	Q9NW81		ENST00000221943.9:c.256G>A	19.37:g.41942337C>T	ENSP00000221943:p.Ala86Thr		B4DDC0|B4DMZ4|B4DP55|B4DXE8|F5H4W7|K7EMF6|Q96D43	Missense_Mutation	SNP	NULL	p.A92T	ENST00000221943.9	37	c.274	CCDS33032.1	19	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883307	0.51908	0.0	1.16E-4	ENSG00000105341	ENST00000221943;ENST00000417807;ENST00000301183;ENST00000507129	D;D;T	0.81908	-1.55;-1.55;0.9	4.11	0.727	0.18254	.	0.145956	0.43110	N	0.000614	T	0.73055	0.3538	M	0.75085	2.285	0.09310	N	0.999999	P;P;P;P	0.51351	0.74;0.74;0.855;0.944	B;B;B;B	0.29942	0.061;0.051;0.109;0.109	T	0.67534	-0.5646	10	0.56958	D	0.05	-27.9263	6.7322	0.23388	0.0:0.7016:0.0:0.2984	.	92;86;86;92	B4DDC0;B4DMZ4;Q9NW81;F5H4W7	.;.;AT5SL_HUMAN;.	T	86;92;92;162	ENSP00000221943:A86T;ENSP00000403910:A92T;ENSP00000301183:A92T	ENSP00000221943:A86T	A	-	1	0	ATP5SL	46634177	0.007000	0.16637	0.010000	0.14722	0.060000	0.15804	0.076000	0.14712	0.257000	0.21650	0.557000	0.71058	GCA	ATP5SL	-	NULL	ENSG00000105341		0.562	ATP5SL-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5SL	HGNC	protein_coding	OTTHUMT00000460602.1	-	0.00	43	0	C	NM_018035		41942337	-1	tier1	-	no_errors	ENST00000417807	ensembl	human	known	74_37	missense	50.00	8	8	SNP	0.014	T
ATXN7L2	127002	genome.wustl.edu	37	1	110033883	110033883	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:110033883G>T	ENST00000369870.3	+	10	1713	c.1698G>T	c.(1696-1698)gaG>gaT	p.E566D	CYB561D1_ENST00000369868.3_5'Flank|CYB561D1_ENST00000430195.2_5'Flank|CYB561D1_ENST00000527072.1_5'Flank|CYB561D1_ENST00000528785.1_5'Flank|ATXN7L2_ENST00000459635.1_3'UTR|CYB561D1_ENST00000420578.2_5'Flank|CYB561D1_ENST00000310611.4_5'Flank|CYB561D1_ENST00000496961.1_5'Flank|CYB561D1_ENST00000393709.3_5'Flank|CYB561D1_ENST00000533024.1_5'Flank	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	566										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		TGGAGGTGGAGGCCCCTTCTC	0.607																																																	0													61.0	67.0	65.0					1																	110033883		2203	4300	6503	SO:0001583	missense	0			BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1698G>T	1.37:g.110033883G>T	ENSP00000358886:p.Glu566Asp			Missense_Mutation	SNP	pfam_SCA7_dom	p.E566D	ENST00000369870.3	37	c.1698	CCDS30794.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.12|14.12	2.440705|2.440705	0.43326|0.43326	.|.	.|.	ENSG00000162650|ENSG00000162650	ENST00000369870;ENST00000369869|ENST00000541125	T|.	0.34859|.	1.34|.	5.23|5.23	2.38|2.38	0.29361|0.29361	.|.	0.000000|.	0.51477|.	D|.	0.000097|.	T|T	0.15219|0.15219	0.0367|0.0367	N|N	0.19112|0.19112	0.55|0.55	0.28359|0.28359	N|N	0.920553|0.920553	D;D|.	0.61697|.	0.99;0.984|.	D;D|.	0.72982|.	0.979;0.956|.	T|T	0.12426|0.12426	-1.0548|-1.0548	10|6	0.87932|0.87932	D|D	0|0	-18.6319|-18.6319	8.0546|8.0546	0.30598|0.30598	0.2551:0.0:0.7449:0.0|0.2551:0.0:0.7449:0.0	.|.	193;566|.	Q5T6C4;Q5T6C5|.	.;AT7L2_HUMAN|.	D|C	566;193|566	ENSP00000358886:E566D|.	ENSP00000358885:E193D|ENSP00000442752:G566C	E|G	+|+	3|1	2|0	ATXN7L2|ATXN7L2	109835406|109835406	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.807000|0.807000	0.45602|0.45602	1.199000|1.199000	0.32235|0.32235	0.375000|0.375000	0.24679|0.24679	-0.379000|-0.379000	0.06801|0.06801	GAG|GGC	ATXN7L2	-	NULL	ENSG00000162650		0.607	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L2	HGNC	protein_coding	OTTHUMT00000030331.1	-	0.00	72	0	G	NM_153340		110033883	+1	tier1	-	no_errors	ENST00000369870	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
B4GALT6	9331	genome.wustl.edu	37	18	29264294	29264294	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr18:29264294G>A	ENST00000306851.5	-	1	392	c.96C>T	c.(94-96)atC>atT	p.I32I	B4GALT6_ENST00000383131.3_Silent_p.I32I|RP11-549B18.1_ENST00000565978.1_RNA|B4GALT6_ENST00000237019.7_Silent_p.I32I	NM_004775.3	NP_004766.2	Q9UBX8	B4GT6_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6	32					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(6)|pancreas(1)	20			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			GGGCCACATAGATGAAGTACA	0.552																																																	0													175.0	147.0	157.0					18																	29264294		2203	4300	6503	SO:0001819	synonymous_variant	0			AF038664	CCDS11900.1	18q11	2013-02-19			ENSG00000118276	ENSG00000118276		"""Beta 4-glycosyltransferases"""	929	protein-coding gene	gene with protein product	"""UDP-Gal:glucosylceramide beta-1,4-galactosyltransferase"""	604017				9597550, 12180132	Standard	NM_004775		Approved	beta4GalT-VI	uc002kwz.4	Q9UBX8	OTTHUMG00000131980	ENST00000306851.5:c.96C>T	18.37:g.29264294G>A			O60514|Q6NT09	Silent	SNP	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.I32	ENST00000306851.5	37	c.96	CCDS11900.1	18																																																																																			B4GALT6	-	NULL	ENSG00000118276		0.552	B4GALT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT6	HGNC	protein_coding	OTTHUMT00000254942.2	-	0.00	66	0	G	NM_004775		29264294	-1	tier1	-	no_errors	ENST00000306851	ensembl	human	known	74_37	silent	6.15	183	12	SNP	1.000	A
BCHE	590	genome.wustl.edu	37	3	165548603	165548604	+	Frame_Shift_Ins	INS	-	-	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:165548603_165548604insT	ENST00000264381.3	-	2	384_385	c.218_219insA	c.(217-219)aagfs	p.K73fs	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	73					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	GAGACTGTGGCTTTTTGAATCG	0.431																																																	0																																										SO:0001589	frameshift_variant	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.219dupA	3.37:g.165548608_165548608dupT	ENSP00000264381:p.Lys73fs		A8K7P8	Frame_Shift_Ins	INS	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.P74fs	ENST00000264381.3	37	c.219_218	CCDS3198.1	3																																																																																			BCHE	-	pfam_CarbesteraseB	ENSG00000114200		0.431	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1		0.00	67	0	-			165548604	-1	tier1		no_errors	ENST00000264381	ensembl	human	known	74_37	frame_shift_ins	15.62	54	10	INS	1.000:1.000	T
BGN	633	genome.wustl.edu	37	X	152773854	152773854	+	Missense_Mutation	SNP	G	G	A	rs368783683		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:152773854G>A	ENST00000331595.4	+	8	1244	c.1058G>A	c.(1057-1059)cGc>cAc	p.R353H	BGN_ENST00000480756.1_3'UTR	NM_001711.4	NP_001702.1	P21810	PGS1_HUMAN	biglycan	353					blood vessel remodeling (GO:0001974)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|transport vesicle (GO:0030133)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|glycosaminoglycan binding (GO:0005539)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCACTTTCCGCTGCGTCACT	0.622																																																	0									HIS/ARG	0,3835		0,0,1632,571	83.0	69.0	74.0		1058	4.1	1.0	X		74	1,6727		0,1,2427,1872	no	missense	BGN	NM_001711.4	29	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	probably-damaging	353/369	152773854	1,10562	2203	4300	6503	SO:0001583	missense	0			AK092954	CCDS14721.1	Xq28	2008-02-05			ENSG00000182492	ENSG00000182492		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1044	protein-coding gene	gene with protein product	"""biglycan proteoglycan"""	301870				1612609	Standard	NM_001711		Approved	DSPG1, SLRR1A	uc004fhr.2	P21810	OTTHUMG00000024205	ENST00000331595.4:c.1058G>A	X.37:g.152773854G>A	ENSP00000327336:p.Arg353His		D3DWU3|P13247	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pirsf_SLRP_I_decor/aspor/byglycan	p.R353H	ENST00000331595.4	37	c.1058	CCDS14721.1	X	.	.	.	.	.	.	.	.	.	.	g	28.4	4.914429	0.92178	0.0	1.49E-4	ENSG00000182492	ENST00000331595;ENST00000370204;ENST00000430380	T;T	0.56444	0.48;0.46	4.94	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.70894	0.3276	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73490	-0.3966	10	0.66056	D	0.02	-25.5409	11.675	0.51424	0.091:0.0:0.909:0.0	.	353	P21810	PGS1_HUMAN	H	353;292;292	ENSP00000327336:R353H;ENSP00000359223:R292H	ENSP00000327336:R353H	R	+	2	0	BGN	152427048	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.525000	0.81892	1.006000	0.39211	0.519000	0.50382	CGC	BGN	-	pirsf_SLRP_I_decor/aspor/byglycan	ENSG00000182492		0.622	BGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BGN	HGNC	protein_coding	OTTHUMT00000060981.1	-	0.00	28	0	G	NM_001711		152773854	+1	tier1	-	no_errors	ENST00000331595	ensembl	human	known	74_37	missense	57.14	9	12	SNP	1.000	A
BLVRA	644	genome.wustl.edu	37	7	43832405	43832405	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:43832405C>T	ENST00000402924.1	+	6	509	c.346C>T	c.(346-348)Cag>Tag	p.Q116*	BLVRA_ENST00000265523.4_Nonsense_Mutation_p.Q116*	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	116					heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						GCTGGCTGAGCAGAAAGGTAA	0.463																																																	0													70.0	64.0	66.0					7																	43832405		2203	4300	6503	SO:0001587	stop_gained	0			BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.346C>T	7.37:g.43832405C>T	ENSP00000385757:p.Gln116*		A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Nonsense_Mutation	SNP	pfam_Biliverdin_Rdtase_cat,pfam_Oxidoreductase_N,pirsf_Biliverdin_Rdtase_A	p.Q116*	ENST00000402924.1	37	c.346	CCDS5472.1	7	.	.	.	.	.	.	.	.	.	.	C	9.107	1.005602	0.19199	.	.	ENSG00000106605	ENST00000265523;ENST00000402924	.	.	.	4.16	0.803	0.18691	.	0.302345	0.36200	N	0.002728	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	8.7228	0.34452	0.153:0.5476:0.2995:0.0	.	.	.	.	X	116	.	ENSP00000265523:Q116X	Q	+	1	0	BLVRA	43798930	1.000000	0.71417	0.974000	0.42286	0.033000	0.12548	0.878000	0.28126	0.266000	0.21894	0.484000	0.47621	CAG	BLVRA	-	pfam_Oxidoreductase_N,pirsf_Biliverdin_Rdtase_A	ENSG00000106605		0.463	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BLVRA	HGNC	protein_coding	OTTHUMT00000339006.1	-	0.00	26	0	C	NM_000712		43832405	+1	tier1	-	no_errors	ENST00000265523	ensembl	human	known	74_37	nonsense	24.14	22	7	SNP	0.998	T
BMP3	651	genome.wustl.edu	37	4	81952745	81952745	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:81952745G>T	ENST00000282701.2	+	1	627	c.307G>T	c.(307-309)Gca>Tca	p.A103S		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	103					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						CTTTCGGGCGGCAGCAGCAGG	0.716																																																	0													8.0	9.0	9.0					4																	81952745		2181	4255	6436	SO:0001583	missense	0			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.307G>T	4.37:g.81952745G>T	ENSP00000282701:p.Ala103Ser		Q4VAS5	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,pirsf_BMP3/GDF10	p.A103S	ENST00000282701.2	37	c.307	CCDS3588.1	4	.	.	.	.	.	.	.	.	.	.	G	0.039	-1.292054	0.01375	.	.	ENSG00000152785	ENST00000282701	T	0.64085	-0.08	5.04	0.0995	0.14503	Transforming growth factor-beta, N-terminal (1);	0.663949	0.13982	N	0.349403	T	0.39655	0.1086	N	0.25647	0.755	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.21280	-1.0250	10	0.10111	T	0.7	.	5.677	0.17753	0.3034:0.3643:0.3322:0.0	.	103	P12645	BMP3_HUMAN	S	103	ENSP00000282701:A103S	ENSP00000282701:A103S	A	+	1	0	BMP3	82171769	0.000000	0.05858	0.014000	0.15608	0.015000	0.08874	-0.008000	0.12788	0.050000	0.15949	-0.150000	0.13652	GCA	BMP3	-	pfam_TGF-b_N,pirsf_BMP3/GDF10	ENSG00000152785		0.716	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP3	HGNC	protein_coding	OTTHUMT00000252634.1	-	0.00	19	0	G			81952745	+1	tier1	-	no_errors	ENST00000282701	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.000	T
BSND	7809	genome.wustl.edu	37	1	55474127	55474127	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:55474127G>T	ENST00000371265.4	+	4	1043	c.789G>T	c.(787-789)ctG>ctT	p.L263L		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	263					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						AAATAGCCCTGCCCAACAACT	0.592																																					Ovarian(191;1657 2078 22894 42033 48899)												0													60.0	59.0	60.0					1																	55474127		2203	4300	6503	SO:0001819	synonymous_variant	0			AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.789G>T	1.37:g.55474127G>T			Q6NT28	Silent	SNP	NULL	p.L263	ENST00000371265.4	37	c.789	CCDS602.1	1																																																																																			BSND	-	NULL	ENSG00000162399		0.592	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSND	HGNC	protein_coding	OTTHUMT00000022213.4		0.00	94	0	G	NM_057176		55474127	+1			no_errors	ENST00000371265	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.402	T
CFAP54	144535	genome.wustl.edu	37	12	97038008	97038008	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:97038008T>G	ENST00000524981.4	+	33	4392	c.4369T>G	c.(4369-4371)Ttg>Gtg	p.L1457V				Q96N23	CL055_HUMAN		0																	GATGGATTACTTGAATCCTCT	0.393																																																	0																																										SO:0001583	missense	0																														ENST00000524981.4:c.4369T>G	12.37:g.97038008T>G	ENSP00000431759:p.Leu1457Val			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.L1457V	ENST00000524981.4	37	c.4369		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.36|16.36	3.102292|3.102292	0.56183|0.56183	.|.	.|.	ENSG00000188596|ENSG00000188596	ENST00000550977|ENST00000524981	.|.	.|.	.|.	5.68|5.68	0.191|0.191	0.15130|0.15130	.|.	.|.	.|.	.|.	.|.	T|T	0.21022|0.21022	0.0506|0.0506	L|L	0.34521|0.34521	1.04|1.04	0.25572|0.25572	N|N	0.986889|0.986889	.|P	.|0.35628	.|0.513	.|B	.|0.32533	.|0.147	T|T	0.21143|0.21143	-1.0254|-1.0254	5|8	.|0.66056	.|D	.|0.02	.|.	1.1415|1.1415	0.01766|0.01766	0.1493:0.2347:0.1311:0.4848|0.1493:0.2347:0.1311:0.4848	.|.	.|1457	.|E9PJL5	.|.	R|V	203|1457	.|.	.|ENSP00000431759:L1457V	L|L	+|+	2|1	0|2	C12orf63|C12orf63	95562139|95562139	0.075000|0.075000	0.21258|0.21258	0.227000|0.227000	0.23927|0.23927	0.007000|0.007000	0.05969|0.05969	-0.034000|-0.034000	0.12225|0.12225	-0.169000|-0.169000	0.10834|0.10834	-0.250000|-0.250000	0.11733|0.11733	CTT|TTG	C12orf55	-	NULL	ENSG00000188596		0.393	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	65	0	T			97038008	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	31.25	22	10	SNP	0.058	G
CFAP54	144535	genome.wustl.edu	37	12	97178582	97178583	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:97178582_97178583delCT	ENST00000524981.4	+	61	8392_8393	c.8369_8370delCT	c.(8368-8370)actfs	p.T2790fs				Q96N23	CL055_HUMAN		0																	AGAAAAAAGACTCAGACCAAAG	0.391																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000524981.4:c.8369_8370delCT	12.37:g.97178582_97178583delCT	ENSP00000431759:p.Thr2790fs			Frame_Shift_Del	DEL	superfamily_Fibronectin_type3	p.Q2791fs	ENST00000524981.4	37	c.8369_8370		12																																																																																			C12orf55	-	NULL	ENSG00000188596		0.391	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4		0.00	72	0	CT			97178583	+1	tier1		no_errors	ENST00000524981	ensembl	human	putative	74_37	frame_shift_del	21.57	40	11	DEL	0.000:0.000	-
ERICH3	127254	genome.wustl.edu	37	1	75086495	75086495	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:75086495C>T	ENST00000326665.5	-	8	1141	c.923G>A	c.(922-924)cGg>cAg	p.R308Q	C1orf173_ENST00000420661.2_Missense_Mutation_p.R111Q|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		308										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AATTTCATCCCGGAAGTCAGG	0.358																																																	0													119.0	116.0	117.0					1																	75086495		2203	4300	6503	SO:0001583	missense	0																														ENST00000326665.5:c.923G>A	1.37:g.75086495C>T	ENSP00000322609:p.Arg308Gln		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.R308Q	ENST00000326665.5	37	c.923	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531681	0.64972	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.25414	2.22;1.8	6.07	2.07	0.26955	.	.	.	.	.	T	0.15089	0.0364	L	0.61036	1.89	0.34661	D	0.722719	P;D	0.62365	0.681;0.991	B;P	0.45753	0.102;0.492	T	0.04017	-1.0984	9	0.62326	D	0.03	-0.7901	8.098	0.30840	0.0:0.6932:0.1146:0.1922	.	111;308	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	Q	308;111	ENSP00000322609:R308Q;ENSP00000398581:R111Q	ENSP00000322609:R308Q	R	-	2	0	C1orf173	74859083	0.056000	0.20664	0.609000	0.28983	0.988000	0.76386	0.793000	0.26944	0.133000	0.18654	0.655000	0.94253	CGG	C1orf173	-	NULL	ENSG00000178965		0.358	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	-	0.00	57	0	C			75086495	-1	tier1	-	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	34.15	27	14	SNP	0.982	T
C3	718	genome.wustl.edu	37	19	6684428	6684428	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:6684428C>T	ENST00000245907.6	-	33	4235	c.4143G>A	c.(4141-4143)aaG>aaA	p.K1381K		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1381					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TCATAGTGTTCTTGGCATCCT	0.453																																																	0													138.0	138.0	138.0					19																	6684428		2203	4300	6503	SO:0001819	synonymous_variant	0			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4143G>A	19.37:g.6684428C>T			A7E236	Silent	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.K1381	ENST00000245907.6	37	c.4143	CCDS32883.1	19																																																																																			C3	-	superfamily_A-macroglobulin_rcpt-bd	ENSG00000125730		0.453	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2		0.00	71	0	C	NM_000064		6684428	-1			no_errors	ENST00000245907	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.294	T
CA2	760	genome.wustl.edu	37	8	86389489	86389489	+	Silent	SNP	C	C	T	rs376387073	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:86389489C>T	ENST00000285379.5	+	6	878	c.648C>T	c.(646-648)agC>agT	p.S216S		NM_000067.2	NP_000058.1	P00918	CAH2_HUMAN	carbonic anhydrase II	216					angiotensin-activated signaling pathway (GO:0038166)|bicarbonate transport (GO:0015701)|kidney development (GO:0001822)|morphogenesis of an epithelium (GO:0002009)|odontogenesis of dentin-containing tooth (GO:0042475)|one-carbon metabolic process (GO:0006730)|positive regulation of bone resorption (GO:0045780)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of dipeptide transmembrane transport (GO:2001150)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of anion transport (GO:0044070)|regulation of chloride transport (GO:2001225)|regulation of intracellular pH (GO:0051453)|response to estrogen (GO:0043627)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|large_intestine(2)|lung(5)|prostate(1)	11					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Furosemide(DB00695)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	AACCCATCAGCGTCAGCAGCG	0.517													C|||	15	0.00299521	0.0	0.0	5008	,	,		18213	0.0		0.0	False		,,,				2504	0.0153																0								C		0,4406		0,0,2203	243.0	235.0	237.0		648	-9.1	0.0	8		237	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CA2	NM_000067.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		216/261	86389489	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			J03037	CCDS6239.1	8q21.2	2012-10-02			ENSG00000104267	ENSG00000104267	4.2.1.1	"""Carbonic anhydrases"""	1373	protein-coding gene	gene with protein product		611492				3107918	Standard	NM_000067		Approved	Car2, CA-II, CAII	uc003ydk.2	P00918	OTTHUMG00000164944	ENST00000285379.5:c.648C>T	8.37:g.86389489C>T			B2R7G8|Q6FI12|Q96ET9	Silent	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.S216	ENST00000285379.5	37	c.648	CCDS6239.1	8																																																																																			CA2	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000104267		0.517	CA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA2	HGNC	protein_coding	OTTHUMT00000381097.2	-	0.00	92	0	C	NM_000067		86389489	+1	tier1	-	no_errors	ENST00000285379	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.009	T
CACNA1D	776	genome.wustl.edu	37	3	53835354	53835354	+	Frame_Shift_Del	DEL	G	G	-	rs142471385		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:53835354delG	ENST00000350061.5	+	42	5821	c.5310delG	c.(5308-5310)aagfs	p.K1770fs	CACNA1D_ENST00000422281.2_Frame_Shift_Del_p.K1755fs|CACNA1D_ENST00000544977.1_Frame_Shift_Del_p.K149fs|CACNA1D_ENST00000288139.4_Frame_Shift_Del_p.K1790fs	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1770					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCATGGAAAGCGGCCCAGCA	0.468																																																	0													79.0	73.0	75.0					3																	53835354		2203	4300	6503	SO:0001589	frameshift_variant	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5310delG	3.37:g.53835354delG	ENSP00000288133:p.Lys1770fs		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.K1790fs	ENST00000350061.5	37	c.5370	CCDS46848.1	3																																																																																			CACNA1D	-	NULL	ENSG00000157388		0.468	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1		0.00	62	0	G	NM_000720		53835354	+1	tier1		no_errors	ENST00000288139	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	0.997	-
CAD	790	genome.wustl.edu	37	2	27465570	27465570	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:27465570G>A	ENST00000403525.1	+	40	6260	c.6116G>A	c.(6115-6117)cGc>cAc	p.R2039H	CAD_ENST00000264705.4_Missense_Mutation_p.R2102H			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.R2102L(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCAGCCTGCGCTACGTGGCA	0.637																																																	1	Substitution - Missense(1)	lung(1)											88.0	79.0	82.0					2																	27465570		2203	4300	6503	SO:0001583	missense	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.6116G>A	2.37:g.27465570G>A	ENSP00000384510:p.Arg2039His		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf	p.R2102H	ENST00000403525.1	37	c.6305		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.12|15.12	2.737930|2.737930	0.49045|0.49045	.|.	.|.	ENSG00000084774|ENSG00000084774	ENST00000428460|ENST00000264705;ENST00000403525	.|D;D	.|0.99070	.|-5.39;-5.39	5.21|5.21	4.33|4.33	0.51752|0.51752	.|Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95671|0.95671	0.8592|0.8592	N|N	0.25286|0.25286	0.73|0.73	0.58432|0.58432	D|D	0.999995|0.999995	.|B;B	.|0.32653	.|0.379;0.027	.|B;B	.|0.20384	.|0.029;0.019	D|D	0.94548|0.94548	0.7751|0.7751	5|10	.|0.29301	.|T	.|0.29	-15.8494|-15.8494	12.4963|12.4963	0.55929|0.55929	0.0819:0.0:0.9181:0.0|0.0819:0.0:0.9181:0.0	.|.	.|2039;2102	.|F8VPD4;P27708	.|.;PYR1_HUMAN	T|H	138|2102;2039	.|ENSP00000264705:R2102H;ENSP00000384510:R2039H	.|ENSP00000264705:R2102H	A|R	+|+	1|2	0|0	CAD|CAD	27319074|27319074	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.795000|0.795000	0.44927|0.44927	9.160000|9.160000	0.94734|0.94734	1.192000|1.192000	0.43071|0.43071	0.462000|0.462000	0.41574|0.41574	GCT|CGC	CAD	-	pfam_Asp_carbamoyltransf_Asp/Orn-bd,superfamily_Asp/Orn_carbamoylTrfase,tigrfam_Asp_carbamoyltransf	ENSG00000084774		0.637	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1		0.00	39	0	G			27465570	+1			no_errors	ENST00000264705	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	A
CADM3	57863	genome.wustl.edu	37	1	159162383	159162383	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:159162383G>T	ENST00000368125.4	+	3	402	c.245G>T	c.(244-246)cGa>cTa	p.R82L	CADM3_ENST00000368124.4_Missense_Mutation_p.R116L	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	82	Ig-like V-type.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CGAGATAATCGAATTCAGCTG	0.512																																																	0													121.0	107.0	112.0					1																	159162383		2203	4300	6503	SO:0001583	missense	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.245G>T	1.37:g.159162383G>T	ENSP00000357107:p.Arg82Leu		Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.R116L	ENST00000368125.4	37	c.347	CCDS44251.1	1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957550	0.92726	.	.	ENSG00000162706	ENST00000368124;ENST00000368125;ENST00000416746	D;D;D	0.88046	-2.33;-2.33;-2.33	5.22	5.22	0.72569	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	D	0.94324	0.8176	M	0.91038	3.17	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.997	D	0.95003	0.8145	10	0.87932	D	0	.	16.3396	0.83078	0.0:0.0:1.0:0.0	.	82;82;116	Q8N126-3;Q8N126;Q8N126-2	.;CADM3_HUMAN;.	L	116;82;82	ENSP00000357106:R116L;ENSP00000357107:R82L;ENSP00000387802:R82L	ENSP00000357106:R116L	R	+	2	0	CADM3	157429007	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.043000	0.93799	2.708000	0.92522	0.650000	0.86243	CGA	CADM3	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000162706		0.512	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CADM3	HGNC	protein_coding	OTTHUMT00000090330.1		0.00	48	0	G	NM_021189		159162383	+1			no_errors	ENST00000368124	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
CAMK4	814	genome.wustl.edu	37	5	110730420	110730420	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:110730420G>A	ENST00000282356.4	+	5	797	c.399G>A	c.(397-399)aaG>aaA	p.K133K	CAMK4_ENST00000512453.1_Silent_p.K133K	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	133	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TTGTGGAAAAGGGATATTACA	0.368																																																	0													153.0	153.0	153.0					5																	110730420		2202	4300	6502	SO:0001819	synonymous_variant	0			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.399G>A	5.37:g.110730420G>A			D3DSZ7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.G106R	ENST00000282356.4	37	c.316	CCDS4103.1	5																																																																																			CAMK4	-	pfscan_Prot_kinase_dom	ENSG00000152495		0.368	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK4	HGNC	protein_coding	OTTHUMT00000250719.2	-	0.00	72	0	G	NM_001744		110730420	+1	tier1	-	no_errors	ENST00000514007	ensembl	human	known	74_37	missense	23.81	31	10	SNP	0.967	A
CAPN15	6650	genome.wustl.edu	37	16	597668	597668	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:597668G>C	ENST00000219611.2	+	4	1193	c.830G>C	c.(829-831)gGc>gCc	p.G277A	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	277					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GCCCCCCAGGGCTCGGGCTGG	0.731																																																	0													5.0	8.0	7.0					16																	597668		2016	4079	6095	SO:0001583	missense	0			U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.830G>C	16.37:g.597668G>C	ENSP00000219611:p.Gly277Ala		B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Znf_RanBP2,smart_Znf_RanBP2,smart_Peptidase_C2_calpain_cat,pfscan_Znf_RanBP2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.G277A	ENST00000219611.2	37	c.830	CCDS10410.1	16	.	.	.	.	.	.	.	.	.	.	g	0.159	-1.083285	0.01888	.	.	ENSG00000103326	ENST00000219611;ENST00000397687	D	0.87887	-2.31	4.69	3.69	0.42338	.	2.093170	0.02066	N	0.051139	T	0.80385	0.4613	L	0.32530	0.975	0.26392	N	0.976553	B	0.28055	0.199	B	0.21917	0.037	T	0.63166	-0.6698	10	0.05436	T	0.98	.	10.4473	0.44501	0.0:0.1988:0.8012:0.0	.	277	O75808	CAN15_HUMAN	A	277	ENSP00000219611:G277A	ENSP00000219611:G277A	G	+	2	0	SOLH	537669	1.000000	0.71417	0.943000	0.38184	0.059000	0.15707	4.198000	0.58419	0.904000	0.36572	0.556000	0.70494	GGC	CAPN15	-	NULL	ENSG00000103326		0.731	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN15	HGNC	protein_coding	OTTHUMT00000239271.1		0.00	30	0	G	NM_005632		597668	+1			no_errors	ENST00000219611	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.981	C
CASP5	838	genome.wustl.edu	37	11	104878040	104878041	+	Frame_Shift_Ins	INS	-	-	T	rs112680102|rs144697764		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:104878040_104878041insT	ENST00000260315.3	-	3	201_202	c.202_203insA	c.(202-204)acafs	p.T68fs	CASP5_ENST00000393141.2_Frame_Shift_Ins_p.T81fs|CASP5_ENST00000531367.1_Intron|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000526056.1_Frame_Shift_Ins_p.T81fs|CASP5_ENST00000444749.2_Frame_Shift_Ins_p.T10fs|CASP5_ENST00000393139.2_Frame_Shift_Ins_p.T35fs			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	68	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.T52fs*26(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CATCTTAACTGTTTTTTTTTTG	0.356																																																	1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0				CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.203dupA	11.37:g.104878050_104878050dupT	ENSP00000260315:p.Thr68fs		B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Frame_Shift_Ins	INS	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.T81fs	ENST00000260315.3	37	c.242_241	CCDS8328.2	11																																																																																			CASP5	-	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pirsf_Caspase_IL-1_beta,pfscan_CARD	ENSG00000137757		0.356	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	HGNC	protein_coding	OTTHUMT00000109397.2		0.00	46	0	-	NM_004347		104878041	-1	tier1		no_errors	ENST00000393141	ensembl	human	known	74_37	frame_shift_ins	10.20	44	5	INS	0.000:0.000	T
CC2D2A	57545	genome.wustl.edu	37	4	15477593	15477593	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:15477593G>T	ENST00000503292.1	+	3	217	c.37G>T	c.(37-39)Gag>Tag	p.E13*	CC2D2A_ENST00000507954.1_Nonsense_Mutation_p.E13*|CC2D2A_ENST00000511544.1_Nonsense_Mutation_p.E13*|CC2D2A_ENST00000503658.1_Nonsense_Mutation_p.E13*|CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000438599.2_Nonsense_Mutation_p.E13*|CC2D2A_ENST00000424120.1_Nonsense_Mutation_p.E13*|CC2D2A_ENST00000515124.1_Nonsense_Mutation_p.E13*|CC2D2A_ENST00000413206.1_Nonsense_Mutation_p.E13*	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	13					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						AATAATTACAGAGGTAAGTGG	0.408																																																	0													64.0	62.0	63.0					4																	15477593		1888	4114	6002	SO:0001587	stop_gained	0			AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.37G>T	4.37:g.15477593G>T	ENSP00000421809:p.Glu13*		A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Nonsense_Mutation	SNP	superfamily_C2_dom,smart_C2_dom	p.E13*	ENST00000503292.1	37	c.37	CCDS47026.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.537591	0.96460	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000438599;ENST00000511544;ENST00000512702;ENST00000507954;ENST00000515124;ENST00000503292;ENST00000503658	.	.	.	3.59	3.59	0.41128	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	11.0425	0.47840	0.0:0.0:1.0:0.0	.	.	.	.	X	13	.	ENSP00000398391:E13X	E	+	1	0	CC2D2A	15086691	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.817000	0.55668	2.304000	0.77564	0.650000	0.86243	GAG	CC2D2A	-	NULL	ENSG00000048342		0.408	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CC2D2A	HGNC	protein_coding	OTTHUMT00000359906.2		0.00	73	0	G	NM_001080522		15477593	+1			no_errors	ENST00000413206	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	T
CCDC175	729665	genome.wustl.edu	37	14	59977428	59977428	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:59977428C>T	ENST00000537690.2	-	19	2296	c.2241G>A	c.(2239-2241)tgG>tgA	p.W747*	RP11-701B16.2_ENST00000554253.1_RNA|CCDC175_ENST00000281581.4_Nonsense_Mutation_p.W747*	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	747																	TCCCTCGTAGCCATGTACTGA	0.448																																																	0													292.0	216.0	239.0					14																	59977428		692	1591	2283	SO:0001587	stop_gained	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.2241G>A	14.37:g.59977428C>T	ENSP00000453940:p.Trp747*		G3V5J7	Nonsense_Mutation	SNP	superfamily_Prefoldin	p.W747*	ENST00000537690.2	37	c.2241	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	C	37	6.102048	0.97286	.	.	ENSG00000151838	ENST00000555041	.	.	.	4.75	3.83	0.44106	.	0.518379	0.16395	N	0.216295	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-1.6353	10.1393	0.42725	0.1995:0.8005:0.0:0.0	.	.	.	.	X	747	.	ENSP00000281581:W747X	W	-	3	0	C14orf38	59047181	0.991000	0.36638	0.248000	0.24265	0.042000	0.13812	2.266000	0.43320	1.289000	0.44618	0.655000	0.94253	TGG	CCDC175	-	NULL	ENSG00000151838		0.448	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC175	HGNC	protein_coding	OTTHUMT00000471273.1	-	0.00	55	0	C	NM_001164399		59977428	-1	tier1	-	no_errors	ENST00000281581	ensembl	human	known	74_37	nonsense	11.43	31	4	SNP	0.669	T
CCDC178	374864	genome.wustl.edu	37	18	30846889	30846889	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr18:30846889G>T	ENST00000383096.3	-	14	1582	c.1400C>A	c.(1399-1401)aCc>aAc	p.T467N	CCDC178_ENST00000579947.1_Missense_Mutation_p.T467N|CCDC178_ENST00000406524.2_Missense_Mutation_p.T467N|CCDC178_ENST00000300227.8_Missense_Mutation_p.T467N|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Missense_Mutation_p.T467N|CCDC178_ENST00000402325.1_Missense_Mutation_p.T467N|CCDC178_ENST00000583930.1_Missense_Mutation_p.T467N			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	467																	CCTTTCATTGGTTTTTACTGT	0.294																																																	0													50.0	48.0	49.0					18																	30846889		2198	4289	6487	SO:0001583	missense	0			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1400C>A	18.37:g.30846889G>T	ENSP00000372576:p.Thr467Asn		A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	NULL	p.T467N	ENST00000383096.3	37	c.1400	CCDS42424.1	18	.	.	.	.	.	.	.	.	.	.	G	3.173	-0.169480	0.06461	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	4.05	2.89	0.33648	.	.	.	.	.	T	0.15478	0.0373	N	0.08118	0	0.09310	N	1	B;B;B;B	0.24317	0.101;0.009;0.009;0.009	B;B;B;B	0.27796	0.083;0.004;0.004;0.004	T	0.23868	-1.0176	9	0.33940	T	0.23	-3.9145	6.5402	0.22377	0.891:0.0:0.109:0.0	.	467;467;467;467	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	N	467	ENSP00000385591:T467N;ENSP00000372576:T467N;ENSP00000300227:T467N;ENSP00000385867:T467N;ENSP00000385234:T467N	ENSP00000300227:T467N	T	-	2	0	C18orf34	29100887	0.006000	0.16342	0.092000	0.20876	0.007000	0.05969	1.357000	0.34090	0.884000	0.36064	-0.606000	0.04082	ACC	CCDC178	-	NULL	ENSG00000166960		0.294	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC178	HGNC	protein_coding	OTTHUMT00000255373.2	-	0.00	47	0	G	NM_198995		30846889	-1	tier1	-	no_errors	ENST00000406524	ensembl	human	known	74_37	missense	26.47	25	9	SNP	0.126	T
CCDC88B	283234	genome.wustl.edu	37	11	64119645	64119645	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:64119645G>A	ENST00000356786.5	+	19	3187	c.3143G>A	c.(3142-3144)cGg>cAg	p.R1048Q	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000359902.2_Missense_Mutation_p.R200Q|CCDC88B_ENST00000301897.4_5'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	1048						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GAGCTGCACCGGAAGCTGGAG	0.677																																																	0													31.0	34.0	33.0					11																	64119645		2201	4296	6497	SO:0001583	missense	0			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.3143G>A	11.37:g.64119645G>A	ENSP00000349238:p.Arg1048Gln		A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	pfam_Hook-related_fam	p.R1048Q	ENST00000356786.5	37	c.3143	CCDS8072.2	11	.	.	.	.	.	.	.	.	.	.	g	7.979	0.750688	0.15778	.	.	ENSG00000168071	ENST00000356786;ENST00000359902	T;T	0.43294	1.97;0.95	4.87	1.36	0.22044	.	.	.	.	.	T	0.30541	0.0768	L	0.54323	1.7	0.42587	D	0.993235	B;B;B	0.30236	0.013;0.274;0.013	B;B;B	0.12156	0.002;0.007;0.002	T	0.07233	-1.0783	9	0.27082	T	0.32	.	7.7306	0.28786	0.3211:0.0:0.6789:0.0	.	1048;184;1048	B2RTU8;A6NC98-5;A6NC98	.;.;CC88B_HUMAN	Q	1048;200	ENSP00000349238:R1048Q;ENSP00000352974:R200Q	ENSP00000349238:R1048Q	R	+	2	0	CCDC88B	63876221	0.526000	0.26298	0.122000	0.21767	0.443000	0.32047	0.928000	0.28831	0.457000	0.26962	0.457000	0.33378	CGG	CCDC88B	-	NULL	ENSG00000168071		0.677	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	HGNC	protein_coding	OTTHUMT00000104845.1		0.00	43	0	G	NM_032251		64119645	+1			no_errors	ENST00000356786	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.051	A
CCDC82	79780	genome.wustl.edu	37	11	96098237	96098237	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:96098237C>T	ENST00000278520.5	-	7	1715	c.1287G>A	c.(1285-1287)ctG>ctA	p.L429L	CCDC82_ENST00000542662.1_Silent_p.L429L|CCDC82_ENST00000423339.2_Silent_p.L429L			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	429										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		AGTAGCGATGCAGTCCACAAG	0.333																																																	0													87.0	85.0	86.0					11																	96098237		2201	4298	6499	SO:0001819	synonymous_variant	0			AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.1287G>A	11.37:g.96098237C>T			B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Silent	SNP	NULL	p.L429	ENST00000278520.5	37	c.1287	CCDS8307.1	11																																																																																			CCDC82	-	NULL	ENSG00000149231		0.333	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC82	HGNC	protein_coding	OTTHUMT00000395542.2	-	0.00	109	0	C	NM_024725		96098237	-1	tier1	-	no_errors	ENST00000278520	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.828	T
CCL16	6360	genome.wustl.edu	37	17	34308432	34308432	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:34308432A>G	ENST00000293275.3	-	1	100	c.25T>C	c.(25-27)Tct>Cct	p.S9P		NM_004590.2	NP_004581.1	O15467	CCL16_HUMAN	chemokine (C-C motif) ligand 16	9					cell chemotaxis (GO:0060326)|cell communication (GO:0007154)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive chemotaxis (GO:0050918)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)			endometrium(1)|lung(2)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACAAGGAGAGACAGGGCAGCC	0.557																																																	0													77.0	58.0	64.0					17																	34308432		2203	4300	6503	SO:0001583	missense	0			AB007454	CCDS11303.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000161573	ENSG00000275152		"""Chemokine ligands"", ""Endogenous ligands"""	10614	protein-coding gene	gene with protein product		601394	"""small inducible cytokine subfamily A (Cys-Cys), member 16"""	SCYA16		8661057	Standard	NM_004590		Approved	NCC-4, SCYL4, LEC, HCC-4, LMC, LCC-1, CKb12, Mtn-1	uc002hkl.3	O15467	OTTHUMG00000188402	ENST00000293275.3:c.25T>C	17.37:g.34308432A>G	ENSP00000293275:p.Ser9Pro		Q4KKU0	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.S9P	ENST00000293275.3	37	c.25	CCDS11303.1	17	.	.	.	.	.	.	.	.	.	.	A	9.498	1.102469	0.20632	.	.	ENSG00000161573	ENST00000293275	T	0.03272	3.99	3.88	2.74	0.32292	.	1.364450	0.05339	N	0.529857	T	0.03434	0.0099	L	0.37697	1.125	0.09310	N	1	P	0.46277	0.875	B	0.35240	0.198	T	0.43294	-0.9400	10	0.36615	T	0.2	.	5.4594	0.16607	0.8591:0.0:0.1409:0.0	.	9	O15467	CCL16_HUMAN	P	9	ENSP00000293275:S9P	ENSP00000293275:S9P	S	-	1	0	CCL16	31332545	0.251000	0.23961	0.002000	0.10522	0.043000	0.13939	0.791000	0.26915	0.663000	0.31027	0.379000	0.24179	TCT	CCL16	-	NULL	ENSG00000161573		0.557	CCL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL16	HGNC	protein_coding	OTTHUMT00000256579.1		0.00	51	0	A	NM_004590		34308432	-1			no_errors	ENST00000293275	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.007	G
CCR2	729230	genome.wustl.edu	37	3	46401294	46401294	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:46401294A>T	ENST00000400888.2	+	2	1107	c.1068A>T	c.(1066-1068)aaA>aaT	p.K356N	CCR2_ENST00000292301.4_Missense_Mutation_p.K356N			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	356					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		GTCGTGGAAAAGGAAAGTCAA	0.498																																																	0													103.0	94.0	97.0					3																	46401294		1568	3582	5150	SO:0001583	missense	0				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.1068A>T	3.37:g.46401294A>T	ENSP00000383681:p.Lys356Asn		A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR2	p.K356N	ENST00000400888.2	37	c.1068	CCDS43078.1	3	.	.	.	.	.	.	.	.	.	.	A	10.44	1.349644	0.24426	.	.	ENSG00000121807	ENST00000292301;ENST00000400888	T;T	0.68331	-0.32;-0.32	3.45	1.05	0.20165	.	2.359950	0.02838	N	0.127600	T	0.46946	0.1419	N	0.08118	0	0.09310	N	1	B	0.29432	0.244	B	0.26864	0.074	T	0.45026	-0.9289	10	0.66056	D	0.02	.	5.6905	0.17827	0.8085:0.0:0.1915:0.0	.	356	P41597	CCR2_HUMAN	N	356	ENSP00000292301:K356N;ENSP00000383681:K356N	ENSP00000292301:K356N	K	+	3	2	CCR2	46376298	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	0.856000	0.27818	0.228000	0.21019	0.528000	0.53228	AAA	CCR2	-	NULL	ENSG00000121807		0.498	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCR2	HGNC	protein_coding	OTTHUMT00000344292.1	-	0.00	44	0	A	NM_000647		46401294	+1	tier1	-	no_errors	ENST00000292301	ensembl	human	known	74_37	missense	44.44	15	12	SNP	0.000	T
CDH24	64403	genome.wustl.edu	37	14	23518387	23518387	+	Silent	SNP	C	C	T	rs555921275		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:23518387C>T	ENST00000267383.5	-	11	1901	c.1809G>A	c.(1807-1809)gcG>gcA	p.A603A	CDH24_ENST00000487137.2_Silent_p.A565A|CDH24_ENST00000554034.1_Silent_p.A565A|CDH24_ENST00000397359.3_Silent_p.A603A|CDH24_ENST00000485922.1_5'UTR			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	603	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		TGCTGCTCAGCGCCGGCTGCC	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16386	0.0		0.0	False		,,,				2504	0.0																0													15.0	16.0	16.0					14																	23518387		2195	4289	6484	SO:0001819	synonymous_variant	0			AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.1809G>A	14.37:g.23518387C>T			D3DS44|Q86UP1|Q9NT84	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A603	ENST00000267383.5	37	c.1809	CCDS9585.1	14																																																																																			CDH24	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000139880		0.672	CDH24-006	KNOWN	basic|CCDS	protein_coding	CDH24	HGNC	protein_coding	OTTHUMT00000257241.2		0.00	12	0	C	NM_022478		23518387	-1			no_errors	ENST00000267383	ensembl	human	known	74_37	silent	42.86	4	3	SNP	0.001	T
CEP97	79598	genome.wustl.edu	37	3	101451488	101451488	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:101451488C>T	ENST00000341893.3	+	6	1470	c.718C>T	c.(718-720)Cag>Tag	p.Q240*	CEP97_ENST00000327230.4_Nonsense_Mutation_p.Q240*|CEP97_ENST00000494050.1_Nonsense_Mutation_p.Q240*|CEP97_ENST00000462076.1_3'UTR			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	240	LRRCT.				cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						TGTGATTTCTCAGAAGGAAAG	0.393																																																	0													121.0	116.0	117.0					3																	101451488		2203	4300	6503	SO:0001587	stop_gained	0			AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.718C>T	3.37:g.101451488C>T	ENSP00000342510:p.Gln240*		B5MDY8|Q8NA71|Q9H5T9	Nonsense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.Q240*	ENST00000341893.3	37	c.718	CCDS2944.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.730127	0.96856	.	.	ENSG00000182504	ENST00000341893;ENST00000327230;ENST00000494050	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-5.0828	20.1086	0.97902	0.0:1.0:0.0:0.0	.	.	.	.	X	240	.	ENSP00000325881:Q240X	Q	+	1	0	CEP97	102934178	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.786000	0.85741	2.756000	0.94617	0.563000	0.77884	CAG	CEP97	-	NULL	ENSG00000182504		0.393	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP97	HGNC	protein_coding	OTTHUMT00000353597.2	-	0.00	56	0	C	NM_024548		101451488	+1	tier1	-	no_errors	ENST00000327230	ensembl	human	known	74_37	nonsense	15.62	27	5	SNP	1.000	T
CETN1	1068	genome.wustl.edu	37	18	580763	580763	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr18:580763G>C	ENST00000327228.3	+	1	397	c.355G>C	c.(355-357)Ggg>Cgg	p.G119R		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	119	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						CGATGAGACCGGGAAGATCTC	0.532																																																	0													83.0	86.0	85.0					18																	580763		2203	4300	6503	SO:0001583	missense	0			U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.355G>C	18.37:g.580763G>C	ENSP00000319052:p.Gly119Arg		B2R536	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.G119R	ENST00000327228.3	37	c.355	CCDS11820.1	18	.	.	.	.	.	.	.	.	.	.	G	17.95	3.512774	0.64522	.	.	ENSG00000177143	ENST00000327228	T	0.69040	-0.37	5.2	5.2	0.72013	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.86628	0.5978	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.89711	0.3912	10	0.87932	D	0	.	16.6478	0.85181	0.0:0.0:1.0:0.0	.	119	Q12798	CETN1_HUMAN	R	119	ENSP00000319052:G119R	ENSP00000319052:G119R	G	+	1	0	CETN1	570763	1.000000	0.71417	0.927000	0.36925	0.178000	0.23041	9.629000	0.98417	2.882000	0.98803	0.655000	0.94253	GGG	CETN1	-	smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000177143		0.532	CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CETN1	HGNC	protein_coding	OTTHUMT00000254314.2		0.00	40	0	G	NM_004066		580763	+1			no_errors	ENST00000327228	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	C
CHDH	55349	genome.wustl.edu	37	3	53856660	53856660	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:53856660C>T	ENST00000315251.6	-	4	1150	c.713G>A	c.(712-714)tGg>tAg	p.W238*		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	238					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	GGCCGCGCTCCACCGTTTGCC	0.632																																																	0													70.0	59.0	63.0					3																	53856660		2203	4300	6503	SO:0001587	stop_gained	0			AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.713G>A	3.37:g.53856660C>T	ENSP00000319851:p.Trp238*		Q9NY17	Nonsense_Mutation	SNP	pfam_GMC_OxRdtase_N,pfam_GMC_OxRtase_C,pirsf_GMC_OxRdtase	p.W238*	ENST00000315251.6	37	c.713	CCDS2873.1	3	.	.	.	.	.	.	.	.	.	.	C	37	6.296854	0.97453	.	.	ENSG00000016391	ENST00000315251	.	.	.	5.65	5.65	0.86999	.	0.060488	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.5161	14.3605	0.66768	0.1479:0.8521:0.0:0.0	.	.	.	.	X	238	.	ENSP00000319851:W238X	W	-	2	0	CHDH	53831700	1.000000	0.71417	1.000000	0.80357	0.173000	0.22820	6.888000	0.75622	2.941000	0.99782	0.655000	0.94253	TGG	CHDH	-	pfam_GMC_OxRdtase_N,pirsf_GMC_OxRdtase	ENSG00000016391		0.632	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHDH	HGNC	protein_coding	OTTHUMT00000350567.2	-	0.00	23	0	C	NM_018397		53856660	-1	tier1	-	no_errors	ENST00000315251	ensembl	human	known	74_37	nonsense	14.81	23	4	SNP	1.000	T
CHMP7	91782	genome.wustl.edu	37	8	23116593	23116593	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:23116593G>T	ENST00000397677.1	+	9	1722	c.1074G>T	c.(1072-1074)caG>caT	p.Q358H	CHMP7_ENST00000313219.7_Missense_Mutation_p.Q358H|CHMP7_ENST00000520102.1_3'UTR	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	358					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		GTGACACCCAGGATGAAGTTT	0.408																																																	0													138.0	139.0	139.0					8																	23116593		2203	4300	6503	SO:0001583	missense	0			BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.1074G>T	8.37:g.23116593G>T	ENSP00000380794:p.Gln358His		B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Missense_Mutation	SNP	pfam_Snf7	p.Q358H	ENST00000397677.1	37	c.1074	CCDS6040.1	8	.	.	.	.	.	.	.	.	.	.	G	20.2	3.955863	0.73902	.	.	ENSG00000147457	ENST00000397677;ENST00000313219	T;T	0.73152	-0.72;-0.72	5.97	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.78916	0.4359	M	0.66939	2.045	0.51767	D	0.99993	D	0.67145	0.996	D	0.64042	0.921	T	0.77117	-0.2706	10	0.42905	T	0.14	-19.885	10.2151	0.43164	0.2197:0.0:0.7803:0.0	.	358	Q8WUX9	CHMP7_HUMAN	H	358	ENSP00000380794:Q358H;ENSP00000324491:Q358H	ENSP00000324491:Q358H	Q	+	3	2	CHMP7	23172538	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.614000	0.54160	0.834000	0.34852	0.655000	0.94253	CAG	CHMP7	-	pfam_Snf7	ENSG00000147457		0.408	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP7	HGNC	protein_coding	OTTHUMT00000254717.1		0.00	49	0	G	NM_152272		23116593	+1			no_errors	ENST00000313219	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
CIB3	117286	genome.wustl.edu	37	19	16272270	16272270	+	3'UTR	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:16272270G>T	ENST00000269878.4	-	0	619				CIB3_ENST00000541493.1_5'UTR|CIB3_ENST00000379859.3_3'UTR	NM_054113.2	NP_473454.1	Q96Q77	CIB3_HUMAN	calcium and integrin binding family member 3								calcium ion binding (GO:0005509)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16						CTCCTCTGTGGTGCCATCAGA	0.562																																																	0													120.0	99.0	106.0					19																	16272270		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AB050868	CCDS12340.1, CCDS74305.1	19p13.12	2013-01-10						"""EF-hand domain containing"""	24580	protein-coding gene	gene with protein product		610645					Standard	XM_005259728		Approved	KIP3	uc002nds.3	Q96Q77		ENST00000269878.4:c.*6C>A	19.37:g.16272270G>T			E7EUX1|Q2M1W0|Q6ISP1	RNA	SNP	-	NULL	ENST00000269878.4	37	NULL	CCDS12340.1	19																																																																																			CIB3	-	-	ENSG00000141977		0.562	CIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIB3	HGNC	protein_coding	OTTHUMT00000460351.1	-	0.00	58	0	G	NM_054113		16272270	-1	tier1	-	no_errors	ENST00000541493	ensembl	human	known	74_37	rna	34.38	21	11	SNP	0.000	T
CILP	8483	genome.wustl.edu	37	15	65490736	65490736	+	Silent	SNP	G	G	T	rs530704700		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:65490736G>T	ENST00000261883.4	-	9	2054	c.1888C>A	c.(1888-1890)Cgg>Agg	p.R630R		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	630					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GAAATATTCCGGGGATCCAGG	0.527																																																	0													155.0	153.0	154.0					15																	65490736		2202	4299	6501	SO:0001819	synonymous_variant	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.1888C>A	15.37:g.65490736G>T			B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R630	ENST00000261883.4	37	c.1888	CCDS10203.1	15																																																																																			CILP	-	NULL	ENSG00000138615		0.527	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	-	0.00	88	0	G	NM_003613		65490736	-1	tier1	-	no_errors	ENST00000261883	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.995	T
CLSTN2	64084	genome.wustl.edu	37	3	140277646	140277646	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:140277646A>C	ENST00000458420.3	+	12	2178	c.1988A>C	c.(1987-1989)aAg>aCg	p.K663T		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	663					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CCTGATATCAAGATTGTGAGC	0.557										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0													55.0	55.0	55.0					3																	140277646		2203	4300	6503	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1988A>C	3.37:g.140277646A>C	ENSP00000402460:p.Lys663Thr		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K663T	ENST00000458420.3	37	c.1988	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	A	11.63	1.695701	0.30052	.	.	ENSG00000158258	ENST00000458420	T	0.32272	1.46	5.41	1.84	0.25277	.	0.162265	0.53938	D	0.000060	T	0.19846	0.0477	L	0.43152	1.355	0.29125	N	0.88003	P	0.34462	0.454	B	0.29663	0.105	T	0.10109	-1.0644	9	.	.	.	-11.1602	6.7569	0.23518	0.6357:0.0:0.3643:0.0	.	663	Q9H4D0	CSTN2_HUMAN	T	663	ENSP00000402460:K663T	.	K	+	2	0	CLSTN2	141760336	1.000000	0.71417	0.993000	0.49108	0.479000	0.33129	1.234000	0.32660	0.386000	0.24997	0.528000	0.53228	AAG	CLSTN2	-	NULL	ENSG00000158258		0.557	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	-	0.00	58	0	A	NM_022131		140277646	+1	tier1	-	no_errors	ENST00000458420	ensembl	human	known	74_37	missense	50.00	17	17	SNP	0.998	C
CNTN1	1272	genome.wustl.edu	37	12	41365260	41365260	+	Intron	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:41365260A>C	ENST00000551295.2	+	16	1921				CNTN1_ENST00000547702.1_Missense_Mutation_p.K610T|CNTN1_ENST00000347616.1_Intron|CNTN1_ENST00000348761.2_Intron|CNTN1_ENST00000360099.3_Missense_Mutation_p.K610T|CNTN1_ENST00000547849.1_Missense_Mutation_p.K610T	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GGTGGAGAGAAAAACATGGTG	0.473																																																	0													36.0	34.0	35.0					12																	41365260		876	1991	2867	SO:0001627	intron_variant	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1805-9451A>C	12.37:g.41365260A>C			A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K610T	ENST00000551295.2	37	c.1829	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	A	14.39	2.520807	0.44866	.	.	ENSG00000018236	ENST00000547702;ENST00000547849;ENST00000360099	T;T;T	0.64991	-0.13;-0.13;-0.13	4.64	3.46	0.39613	.	.	.	.	.	T	0.49338	0.1551	.	.	.	0.24428	N	0.994582	B	0.13145	0.007	B	0.13407	0.009	T	0.41574	-0.9501	8	0.46703	T	0.11	.	8.4026	0.32594	0.8015:0.1985:0.0:0.0	.	610	Q12860-3	.	T	610	ENSP00000448004:K610T;ENSP00000448653:K610T;ENSP00000353213:K610T	ENSP00000353213:K610T	K	+	2	0	CNTN1	39651527	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.007000	0.57093	0.896000	0.36366	0.533000	0.62120	AAA	CNTN1	-	NULL	ENSG00000018236		0.473	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	-	0.00	55	0	A	NM_001843		41365260	+1	tier1	-	no_errors	ENST00000360099	ensembl	human	known	74_37	missense	26.92	38	14	SNP	1.000	C
CNTN4	152330	genome.wustl.edu	37	3	3076351	3076351	+	Missense_Mutation	SNP	G	G	A	rs374090181		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:3076351G>A	ENST00000397461.1	+	16	2203	c.1819G>A	c.(1819-1821)Gaa>Aaa	p.E607K	CNTN4_ENST00000427331.1_Missense_Mutation_p.E607K|CNTN4_ENST00000397459.2_Missense_Mutation_p.E279K|CNTN4_ENST00000358480.3_Missense_Mutation_p.E388K|CNTN4_ENST00000418658.1_Missense_Mutation_p.E607K|CNTN4_ENST00000448906.2_Missense_Mutation_p.E279K	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	607	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GACAATAGACGAAATCACAGA	0.537																																																	0								G	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	0,4406		0,0,2203	85.0	72.0	76.0		1819,832,1819,835	4.3	1.0	3		76	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	CNTN4	NM_001206955.1,NM_001206956.1,NM_175607.2,NM_175613.2	56,56,56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign	607/1027,278/698,607/1027,279/699	3076351	1,13005	2203	4300	6503	SO:0001583	missense	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.1819G>A	3.37:g.3076351G>A	ENSP00000380602:p.Glu607Lys		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E607K	ENST00000397461.1	37	c.1819	CCDS43041.1	3	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444907	0.83993	0.0	1.16E-4	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31;0.31	4.27	4.27	0.50696	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.60830	0.2299	M	0.70108	2.13	0.80722	D	1	P;P;P	0.44946	0.678;0.725;0.846	B;B;B	0.42188	0.22;0.379;0.327	T	0.69672	-0.5082	10	0.59425	D	0.04	.	17.0894	0.86618	0.0:0.0:1.0:0.0	.	606;607;607	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	K	607;607;607;388;279;279	ENSP00000396010:E607K;ENSP00000380602:E607K;ENSP00000413642:E607K;ENSP00000351267:E388K;ENSP00000380600:E279K;ENSP00000392077:E279K	ENSP00000351267:E388K	E	+	1	0	CNTN4	3051351	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.609000	0.82925	2.086000	0.62901	0.563000	0.77884	GAA	CNTN4	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144619		0.537	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	-	0.00	50	0	G			3076351	+1	tier1	-	no_errors	ENST00000397461	ensembl	human	known	74_37	missense	42.42	19	14	SNP	1.000	A
CNTN3	5067	genome.wustl.edu	37	3	74350929	74350929	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:74350929T>G	ENST00000263665.6	-	14	1841	c.1814A>C	c.(1813-1815)aAg>aCg	p.K605T		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	605	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TTCATCTACCTTCACATTTTC	0.428																																																	0													260.0	228.0	239.0					3																	74350929		2203	4300	6503	SO:0001583	missense	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1814A>C	3.37:g.74350929T>G	ENSP00000263665:p.Lys605Thr		B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K605T	ENST00000263665.6	37	c.1814	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	T	7.516	0.655617	0.14580	.	.	ENSG00000113805	ENST00000263665	T	0.56611	0.45	5.98	2.19	0.27852	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.263388	0.43416	D	0.000573	T	0.25158	0.0611	N	0.10664	0.02	0.09310	N	0.999999	B	0.09022	0.002	B	0.14023	0.01	T	0.16424	-1.0403	10	0.15499	T	0.54	.	5.3514	0.16038	0.0:0.214:0.2549:0.5312	.	605	Q9P232	CNTN3_HUMAN	T	605	ENSP00000263665:K605T	ENSP00000263665:K605T	K	-	2	0	CNTN3	74433619	0.004000	0.15560	0.986000	0.45419	0.919000	0.55068	0.615000	0.24329	0.131000	0.18576	-0.376000	0.06991	AAG	CNTN3	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113805		0.428	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	-	0.00	75	0	T	NM_020872		74350929	-1	tier1	-	no_errors	ENST00000263665	ensembl	human	known	74_37	missense	20.00	35	9	SNP	0.065	G
CNTNAP2	26047	genome.wustl.edu	37	7	147869444	147869444	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:147869444G>A	ENST00000361727.3	+	18	3400	c.2884G>A	c.(2884-2886)Gga>Aga	p.G962R	CNTNAP2_ENST00000538075.1_Missense_Mutation_p.G21R	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	962	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTTCATATCCGGATGCTCGGG	0.532										HNSCC(39;0.1)																																							0													113.0	108.0	110.0					7																	147869444		2203	4300	6503	SO:0001583	missense	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2884G>A	7.37:g.147869444G>A	ENSP00000354778:p.Gly962Arg		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G962R	ENST00000361727.3	37	c.2884	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	G	19.59	3.856056	0.71834	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	D;D	0.87491	-2.26;-2.26	5.28	4.4	0.53042	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.85682	D	0.000000	D	0.95421	0.8513	H	0.96633	3.855	0.53688	D	0.999971	D	0.89917	1.0	D	0.97110	1.0	D	0.96134	0.9095	10	0.87932	D	0	.	12.512	0.56011	0.0815:0.0:0.9185:0.0	.	962	Q9UHC6	CNTP2_HUMAN	R	962;21	ENSP00000354778:G962R;ENSP00000440732:G21R	ENSP00000354778:G962R	G	+	1	0	CNTNAP2	147500377	1.000000	0.71417	0.093000	0.20910	0.756000	0.42949	9.694000	0.98686	1.236000	0.43740	0.563000	0.77884	GGA	CNTNAP2	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000174469		0.532	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	-	0.00	78	0	G			147869444	+1	tier1	-	no_errors	ENST00000361727	ensembl	human	known	74_37	missense	22.22	35	10	SNP	0.996	A
CNTNAP4	85445	genome.wustl.edu	37	16	76569521	76569521	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:76569521A>T	ENST00000476707.1	+	17	2983	c.2844A>T	c.(2842-2844)gaA>gaT	p.E948D	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.E944D|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.E896D|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.E872D			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	945	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TGGATTTGGAAGAAAGAGCCC	0.517																																																	0													66.0	74.0	72.0					16																	76569521		2186	4294	6480	SO:0001583	missense	0			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2844A>T	16.37:g.76569521A>T	ENSP00000417628:p.Glu948Asp		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E944D	ENST00000476707.1	37	c.2832		16	.	.	.	.	.	.	.	.	.	.	A	21.4	4.148036	0.78001	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.18	0.319	0.15873	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.42420	D	0.000701	D	0.85478	0.5706	.	.	.	0.40371	D	0.97934	D;D;D	0.76494	0.998;0.996;0.999	D;D;D	0.83275	0.971;0.933;0.996	D	0.83846	0.0260	9	0.87932	D	0	.	9.0442	0.36336	0.7046:0.0:0.2954:0.0	.	872;948;945	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	D	944;896;872;948	ENSP00000306893:E944D;ENSP00000439733:E896D;ENSP00000418741:E872D;ENSP00000417628:E948D	ENSP00000306893:E944D	E	+	3	2	CNTNAP4	75127022	1.000000	0.71417	0.989000	0.46669	0.998000	0.95712	1.246000	0.32803	-0.124000	0.11724	0.533000	0.62120	GAA	CNTNAP4	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000152910		0.517	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	HGNC	protein_coding	OTTHUMT00000348216.1	-	0.00	103	0	A	NM_033401		76569521	+1	tier1	-	no_errors	ENST00000307431	ensembl	human	known	74_37	missense	17.19	53	11	SNP	1.000	T
CNTNAP5	129684	genome.wustl.edu	37	2	125232373	125232373	+	Missense_Mutation	SNP	T	T	G	rs377080244		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:125232373T>G	ENST00000431078.1	+	7	1340	c.976T>G	c.(976-978)Ttc>Gtc	p.F326V		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	326	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AAAGAAAAACTTCCATGGATG	0.383																																																	0													55.0	50.0	52.0					2																	125232373		1814	4081	5895	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.976T>G	2.37:g.125232373T>G	ENSP00000399013:p.Phe326Val		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.F326V	ENST00000431078.1	37	c.976	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	T	26.5	4.741892	0.89573	.	.	ENSG00000155052	ENST00000431078	D	0.90732	-2.72	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.52532	D	0.000069	D	0.96873	0.8979	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97914	1.0310	10	0.66056	D	0.02	.	15.379	0.74637	0.0:0.0:0.0:1.0	.	326	Q8WYK1	CNTP5_HUMAN	V	326	ENSP00000399013:F326V	ENSP00000399013:F326V	F	+	1	0	CNTNAP5	124948843	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.461000	0.80834	2.277000	0.76020	0.482000	0.46254	TTC	CNTNAP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000155052		0.383	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	88	0	T			125232373	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	8.62	53	5	SNP	1.000	G
COL11A2	1302	genome.wustl.edu	37	6	33130698	33130698	+	3'UTR	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:33130698G>A	ENST00000374708.4	-	0	5968				COL11A2_ENST00000341947.2_3'UTR|COL11A2_ENST00000374714.1_3'UTR|COL11A2_ENST00000374713.1_3'UTR|COL11A2_ENST00000374712.1_3'UTR|COL11A2_ENST00000357486.1_3'UTR|COL11A2_ENST00000395197.1_3'UTR|COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000361917.1_3'UTR	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2						cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GCCATCTGCGGGATGCAGCCC	0.547																																					Melanoma(1;90 116 3946 5341 17093)												0																																										SO:0001624	3_prime_UTR_variant	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.*757C>T	6.37:g.33130698G>A			A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	RNA	SNP	-	NULL	ENST00000374708.4	37	NULL	CCDS43452.1	6																																																																																			COL11A2	-	-	ENSG00000204248		0.547	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	-	0.00	97	0	G			33130698	-1	tier1	-	no_errors	ENST00000477772	ensembl	human	known	74_37	rna	52.63	27	30	SNP	0.000	A
COL12A1	1303	genome.wustl.edu	37	6	75834919	75834919	+	Silent	SNP	G	G	A	rs555058454		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:75834919G>A	ENST00000322507.8	-	40	6840	c.6531C>T	c.(6529-6531)agC>agT	p.S2177S	COL12A1_ENST00000483888.2_Silent_p.S2177S|COL12A1_ENST00000345356.6_Silent_p.S1013S|COL12A1_ENST00000416123.2_Silent_p.S2177S	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2177	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CGTAGGTGGTGCTGGGATTGA	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		16843	0.0		0.0	False		,,,				2504	0.001																0													129.0	129.0	129.0					6																	75834919		1931	4140	6071	SO:0001819	synonymous_variant	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.6531C>T	6.37:g.75834919G>A			O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.S2177	ENST00000322507.8	37	c.6531	CCDS43482.1	6																																																																																			COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.403	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	70	0	G	NM_004370		75834919	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.952	A
COL1A2	1278	genome.wustl.edu	37	7	94039079	94039079	+	Silent	SNP	C	C	T	rs141762645	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:94039079C>T	ENST00000297268.6	+	19	1452	c.981C>T	c.(979-981)cgC>cgT	p.R327R		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	327					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CTGGACCCCGCGGTATTCCTG	0.592										HNSCC(75;0.22)			C|||	2	0.000399361	0.0008	0.0	5008	,	,		14100	0.0		0.0	False		,,,				2504	0.001																0								C		3,4403	6.2+/-15.9	0,3,2200	102.0	101.0	101.0		981	-7.5	1.0	7	dbSNP_134	101	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	COL1A2	NM_000089.3		0,6,6497	TT,TC,CC		0.0349,0.0681,0.0461		327/1367	94039079	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.981C>T	7.37:g.94039079C>T			P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fib_collagen_C	p.R327	ENST00000297268.6	37	c.981	CCDS34682.1	7																																																																																			COL1A2	-	NULL	ENSG00000164692		0.592	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2		0.00	22	0	C	NM_000089		94039079	+1			no_errors	ENST00000297268	ensembl	human	known	74_37	silent	27.27	8	3	SNP	0.946	T
COL22A1	169044	genome.wustl.edu	37	8	139658917	139658917	+	Silent	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:139658917A>G	ENST00000303045.6	-	47	3902	c.3456T>C	c.(3454-3456)gcT>gcC	p.A1152A	COL22A1_ENST00000435777.1_Silent_p.A1132A|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1152	Collagen-like 10.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTGGAGGCCCAGCCTCTCCCT	0.507										HNSCC(7;0.00092)																																							0													25.0	24.0	24.0					8																	139658917		2203	4299	6502	SO:0001819	synonymous_variant	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3456T>C	8.37:g.139658917A>G			B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.A1152	ENST00000303045.6	37	c.3456	CCDS6376.1	8																																																																																			COL22A1	-	pfam_Collagen	ENSG00000169436		0.507	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	-	0.00	105	0	A	XM_291257		139658917	-1	tier1	-	no_errors	ENST00000303045	ensembl	human	known	74_37	silent	17.91	55	12	SNP	0.999	G
COLQ	8292	genome.wustl.edu	37	3	15493171	15493171	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:15493171G>T	ENST00000383788.5	-	17	1473	c.1348C>A	c.(1348-1350)Ccc>Acc	p.P450T	COLQ_ENST00000383781.4_Missense_Mutation_p.P440T|EAF1-AS1_ENST00000608408.1_RNA|COLQ_ENST00000383785.2_3'UTR|COLQ_ENST00000383787.2_Missense_Mutation_p.P441T|COLQ_ENST00000603752.1_5'Flank|COLQ_ENST00000435459.2_Missense_Mutation_p.P440T|EAF1-AS1_ENST00000609310.1_RNA|COLQ_ENST00000383786.5_Missense_Mutation_p.P416T|COLQ_ENST00000603808.1_Missense_Mutation_p.P451T	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	450					acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						TAGCGGCAGGGCGTGGAGTCG	0.567																																																	0													85.0	84.0	84.0					3																	15493171		2203	4300	6503	SO:0001583	missense	0			AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.1348C>A	3.37:g.15493171G>T	ENSP00000373298:p.Pro450Thr		B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	pfam_Collagen,tigrfam_Myxo_disulph_rpt	p.P450T	ENST00000383788.5	37	c.1348	CCDS33709.1	3	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854276	0.32791	.	.	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000435459;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786	D;D;D;D;D	0.90504	-2.51;-2.68;-2.63;-2.62;-2.66	5.49	4.59	0.56863	.	0.224832	0.45867	D	0.000329	D	0.88171	0.6365	L	0.51422	1.61	0.80722	D	1	P;P;P;P	0.45283	0.855;0.481;0.773;0.855	B;B;B;B	0.43950	0.437;0.42;0.253;0.359	D	0.87301	0.2305	10	0.56958	D	0.05	-4.754	9.9128	0.41417	0.0783:0.1377:0.784:0.0	.	416;441;450;440	Q9Y215-3;Q9Y215-5;Q9Y215;Q9Y215-2	.;.;COLQ_HUMAN;.	T	441;440;440;450;440;451;416	ENSP00000373297:P441T;ENSP00000373291:P440T;ENSP00000402511:P440T;ENSP00000373298:P450T;ENSP00000373296:P416T	ENSP00000373291:P440T	P	-	1	0	COLQ	15468175	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	2.008000	0.40893	1.248000	0.43934	0.561000	0.74099	CCC	COLQ	-	NULL	ENSG00000206561		0.567	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COLQ	HGNC	protein_coding	OTTHUMT00000343575.1	-	0.00	40	0	G	NM_005677		15493171	-1	tier1	-	no_errors	ENST00000383788	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.995	T
COL6A6	131873	genome.wustl.edu	37	3	130307988	130307988	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:130307988G>T	ENST00000358511.6	+	11	4211	c.4180G>T	c.(4180-4182)Gat>Tat	p.D1394Y	COL6A6_ENST00000453409.2_Missense_Mutation_p.D1394Y	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1394	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CATTGGAGGAGATGGCACAAT	0.443																																																	0													148.0	156.0	154.0					3																	130307988		1980	4178	6158	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4180G>T	3.37:g.130307988G>T	ENSP00000351310:p.Asp1394Tyr		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D1394Y	ENST00000358511.6	37	c.4180	CCDS46911.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.77|15.77	2.932133|2.932133	0.52866|0.52866	.|.	.|.	ENSG00000206384|ENSG00000206384	ENST00000358511;ENST00000453409|ENST00000511332	D;D|.	0.93488|.	-3.23;-3.23|.	5.8|5.8	4.92|4.92	0.64577|0.64577	.|.	0.149015|.	0.31279|.	N|.	0.007926|.	T|T	0.60104|0.60104	0.2243|0.2243	M|M	0.84082|0.84082	2.675|2.675	0.30645|0.30645	N|N	0.756041|0.756041	D|.	0.67145|.	0.996|.	D|.	0.66847|.	0.947|.	T|T	0.65191|0.65191	-0.6228|-0.6228	10|5	0.72032|.	D|.	0.01|.	.|.	6.722|6.722	0.23334|0.23334	0.2275:0.0:0.7725:0.0|0.2275:0.0:0.7725:0.0	.|.	1394|.	A6NMZ7|.	CO6A6_HUMAN|.	Y|D	1394|151	ENSP00000351310:D1394Y;ENSP00000399236:D1394Y|.	ENSP00000351310:D1394Y|.	D|E	+|+	1|3	0|2	COL6A6|COL6A6	131790678|131790678	0.989000|0.989000	0.36119|0.36119	0.713000|0.713000	0.30519|0.30519	0.427000|0.427000	0.31564|0.31564	2.262000|2.262000	0.43285|0.43285	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	GAT|GAG	COL6A6	-	pfam_Collagen	ENSG00000206384		0.443	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	-	0.00	115	0	G	NM_001102608		130307988	+1	tier1	-	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.902	T
CSMD1	64478	genome.wustl.edu	37	8	3038632	3038632	+	Splice_Site	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:3038632T>G	ENST00000520002.1	-	38	6283	c.5728A>C	c.(5728-5730)Act>Cct	p.T1910P	CSMD1_ENST00000602557.1_Splice_Site_p.T1910P|CSMD1_ENST00000602723.1_Splice_Site_p.T1910P|CSMD1_ENST00000537824.1_Splice_Site_p.T1909P|CSMD1_ENST00000400186.3_Splice_Site_p.T1910P|CSMD1_ENST00000542608.1_Splice_Site_p.T1909P|CSMD1_ENST00000539096.1_Splice_Site_p.T1909P|CSMD1_ENST00000523387.1_5'UTR			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1910	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.T1909P(1)|p.T1638P(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTGACCTTACTTTTGTATTCC	0.378																																																	2	Substitution - Missense(2)	lung(2)											72.0	69.0	70.0					8																	3038632		1871	4107	5978	SO:0001630	splice_region_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5728+1A>C	8.37:g.3038632T>G			Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.T1910P	ENST00000520002.1	37	c.5728		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.9|20.9	4.059023|4.059023	0.76074|0.76074	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.60797	.|0.16;0.16;0.16;0.16;0.16	5.12|5.12	5.12|5.12	0.69794|0.69794	.|CUB (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74068|0.74068	0.3668|0.3668	M|M	0.72894|0.72894	2.215|2.215	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;P	.|0.76494	.|0.999;0.983;0.788	.|D;P;P	.|0.79784	.|0.993;0.811;0.533	T|T	0.75539|0.75539	-0.3282|-0.3282	5|9	.|.	.|.	.|.	.|.	14.9285|14.9285	0.70898|0.70898	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1910;1910;1910	.|E5RIG2;Q96PZ7;Q96PZ7-4	.|.;CSMD1_HUMAN;.	T|P	1389|1910;1910;1771;1909;1909;1909	.|ENSP00000383047:T1910P;ENSP00000430733:T1910P;ENSP00000441462:T1909P;ENSP00000446243:T1909P;ENSP00000441675:T1909P	.|.	N|T	-|-	2|1	0|0	CSMD1|CSMD1	3026039|3026039	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	6.011000|6.011000	0.70760|0.70760	1.923000|1.923000	0.55706|0.55706	0.533000|0.533000	0.62120|0.62120	AAC|ACT	CSMD1	-	superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183117		0.378	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	-	0.00	77	0	T	NM_033225	Missense_Mutation	3038632	-1	tier1	-	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	15.15	56	10	SNP	1.000	G
CSMD1	64478	genome.wustl.edu	37	8	3216778	3216778	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:3216778A>G	ENST00000520002.1	-	22	3758	c.3203T>C	c.(3202-3204)cTg>cCg	p.L1068P	CSMD1_ENST00000602557.1_Missense_Mutation_p.L1068P|CSMD1_ENST00000602723.1_Missense_Mutation_p.L1068P|CSMD1_ENST00000537824.1_Missense_Mutation_p.L1067P|CSMD1_ENST00000400186.3_Missense_Mutation_p.L1068P|CSMD1_ENST00000542608.1_Missense_Mutation_p.L1067P|CSMD1_ENST00000539096.1_Missense_Mutation_p.L1067P			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1068	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGAAAACGTCAGAGAGTCTCC	0.547																																																	0													69.0	76.0	74.0					8																	3216778		2202	4300	6502	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3203T>C	8.37:g.3216778A>G	ENSP00000430733:p.Leu1068Pro		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.L1068P	ENST00000520002.1	37	c.3203		8	.	.	.	.	.	.	.	.	.	.	a	15.86	2.957370	0.53400	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35	5.24	5.24	0.73138	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.56097	D	0.000023	D	0.85217	0.5646	M	0.91140	3.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.998;0.987	D	0.88829	0.3304	10	0.87932	D	0	.	15.156	0.72743	1.0:0.0:0.0:0.0	.	1068;1068;1068	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	P	1068;1068;930;1067;1067;1067	ENSP00000383047:L1068P;ENSP00000430733:L1068P;ENSP00000441462:L1067P;ENSP00000446243:L1067P;ENSP00000441675:L1067P	ENSP00000320445:L930P	L	-	2	0	CSMD1	3204185	1.000000	0.71417	0.927000	0.36925	0.068000	0.16541	9.088000	0.94132	1.969000	0.57287	0.449000	0.29647	CTG	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.547	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	-	0.00	57	0	A	NM_033225		3216778	-1	tier1	-	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	21.88	25	7	SNP	1.000	G
CSMD3	114788	genome.wustl.edu	37	8	114111134	114111134	+	Missense_Mutation	SNP	A	A	C	rs201269934		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:114111134A>C	ENST00000297405.5	-	5	1012	c.768T>G	c.(766-768)agT>agG	p.S256R	CSMD3_ENST00000343508.3_Missense_Mutation_p.S216R|CSMD3_ENST00000352409.3_Missense_Mutation_p.S256R|CSMD3_ENST00000519485.1_5'UTR|CSMD3_ENST00000455883.2_Missense_Mutation_p.S256R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	256	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CATTAGGAAAACTAGGGCTGG	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													122.0	106.0	112.0					8																	114111134		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.768T>G	8.37:g.114111134A>C	ENSP00000297405:p.Ser256Arg		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S256R	ENST00000297405.5	37	c.768	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	A	18.24	3.579972	0.65992	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.28454	1.61;1.61;1.61;1.61	5.41	1.77	0.24775	CUB (5);	0.227214	0.39274	N	0.001405	T	0.18087	0.0434	L	0.28504	0.86	0.27825	N	0.941678	B;B;B;B	0.32467	0.202;0.062;0.372;0.051	B;B;B;B	0.30179	0.034;0.032;0.112;0.062	T	0.12889	-1.0530	10	0.72032	D	0.01	.	5.0457	0.14483	0.5997:0.0:0.2668:0.1335	.	256;256;256;216	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	R	216;256;256;256	ENSP00000345799:S216R;ENSP00000297405:S256R;ENSP00000412263:S256R;ENSP00000343124:S256R	ENSP00000297405:S256R	S	-	3	2	CSMD3	114180310	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	1.484000	0.35508	0.437000	0.26423	0.533000	0.62120	AGT	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	58	0	A	NM_052900		114111134	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	18.03	50	11	SNP	0.995	C
CTDSP2	10106	genome.wustl.edu	37	12	58217849	58217849	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:58217849delC	ENST00000398073.2	-	7	831	c.528delG	c.(526-528)ctgfs	p.L177fs	CTDSP2_ENST00000548823.1_Intron|MIR26A2_ENST00000385054.1_RNA|CTDSP2_ENST00000547701.1_Frame_Shift_Del_p.L25fs	NM_005730.3	NP_005721.3	O14595	CTDS2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2	177	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein dephosphorylation (GO:0006470)	nucleoplasm (GO:0005654)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					ACCGGTCCAGCAGGTCTGTCA	0.597																																																	0													26.0	31.0	30.0					12																	58217849		2033	4191	6224	SO:0001589	frameshift_variant	0			AF000152	CCDS41801.1	12q14.1	2012-06-14			ENSG00000175215	ENSG00000175215		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	17077	protein-coding gene	gene with protein product	"""conserved gene amplified in osteosarcoma"", ""nuclear LIM interactor-interacting factor 2"", ""NLI-interacting factor 2"", ""small CTD phosphatase 2"""	608711				9315096, 12721286	Standard	XM_005268556		Approved	OS4, SCP2, PSR2	uc001sqm.3	O14595	OTTHUMG00000170483	ENST00000398073.2:c.528delG	12.37:g.58217849delC	ENSP00000381148:p.Leu177fs		A8K5H4|Q53ZR2|Q6NZY3|Q9UEX1	Frame_Shift_Del	DEL	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.L177fs	ENST00000398073.2	37	c.528	CCDS41801.1	12																																																																																			CTDSP2	-	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	ENSG00000175215		0.597	CTDSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSP2	HGNC	protein_coding	OTTHUMT00000409353.1		0.00	52	0	C	NM_005730		58217849	-1	tier1		no_errors	ENST00000398073	ensembl	human	known	74_37	frame_shift_del	11.76	15	2	DEL	1.000	-
CUX2	23316	genome.wustl.edu	37	12	111731320	111731320	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:111731320G>A	ENST00000261726.6	+	6	661	c.507G>A	c.(505-507)ggG>ggA	p.G169G		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	169					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GCATTCCCGGGAAAGCCCTCC	0.607																																																	0													31.0	41.0	38.0					12																	111731320		2046	4209	6255	SO:0001819	synonymous_variant	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.507G>A	12.37:g.111731320G>A			A7E2Y4	Silent	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.G169	ENST00000261726.6	37	c.507	CCDS41837.1	12																																																																																			CUX2	-	NULL	ENSG00000111249		0.607	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	-	0.00	90	0	G	NM_015267		111731320	+1	tier1	-	no_errors	ENST00000261726	ensembl	human	known	74_37	silent	25.42	44	15	SNP	0.987	A
CUX2	23316	genome.wustl.edu	37	12	111748306	111748306	+	Silent	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:111748306C>A	ENST00000261726.6	+	15	1874	c.1720C>A	c.(1720-1722)Cgg>Agg	p.R574R		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	574					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CATCGGGCAGCGGGTGTTTGG	0.672																																																	0													71.0	83.0	79.0					12																	111748306		2157	4237	6394	SO:0001819	synonymous_variant	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1720C>A	12.37:g.111748306C>A			A7E2Y4	Silent	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.R574	ENST00000261726.6	37	c.1720	CCDS41837.1	12																																																																																			CUX2	-	pfam_Hmoeo_CUT,superfamily_Lambda_DNA-bd_dom,pfscan_Hmoeo_CUT	ENSG00000111249		0.672	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	-	0.00	54	0	C	NM_015267		111748306	+1	tier1	-	no_errors	ENST00000261726	ensembl	human	known	74_37	silent	17.78	37	8	SNP	1.000	A
CYTH3	9265	genome.wustl.edu	37	7	6210872	6210872	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:6210872G>A	ENST00000350796.3	-	7	659	c.523C>T	c.(523-525)Cgc>Tgc	p.R175C	CYTH3_ENST00000396741.2_Missense_Mutation_p.R90C|CYTH3_ENST00000488964.1_5'UTR	NM_004227.3	NP_004218.1	O43739	CYH3_HUMAN	cytohesin 3	175	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				establishment of epithelial cell polarity (GO:0090162)|Golgi vesicle transport (GO:0048193)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|urinary_tract(1)	19						AGGCAGTAGCGAGAAGCGAAA	0.622																																																	0													108.0	110.0	110.0					7																	6210872		2203	4300	6503	SO:0001583	missense	0			AJ223957	CCDS5346.1	7p22.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000008256	ENSG00000008256		"""Pleckstrin homology (PH) domain containing"""	9504	protein-coding gene	gene with protein product		605081	"""pleckstrin homology, Sec7 and coiled-coil domains 3"""	PSCD3		9072969	Standard	NM_004227		Approved	GRP1, ARNO3, cytohesin-3	uc003spt.3	O43739	OTTHUMG00000023440	ENST00000350796.3:c.523C>T	7.37:g.6210872G>A	ENSP00000297044:p.Arg175Cys		A4D2N8	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.R175C	ENST00000350796.3	37	c.523	CCDS5346.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.242021	0.95272	.	.	ENSG00000008256	ENST00000350796;ENST00000396741	T;T	0.58797	0.31;0.31	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.82811	0.5118	H	0.94423	3.535	0.80722	D	1	D;D	0.89917	0.992;1.0	P;D	0.68353	0.613;0.957	D	0.87986	0.2746	10	0.87932	D	0	.	18.8342	0.92155	0.0:0.0:1.0:0.0	.	90;175	B7Z2V9;O43739-2	.;.	C	175;90	ENSP00000297044:R175C;ENSP00000379967:R90C	ENSP00000297044:R175C	R	-	1	0	CYTH3	6177397	1.000000	0.71417	0.907000	0.35723	0.802000	0.45316	4.580000	0.60942	2.459000	0.83118	0.655000	0.94253	CGC	CYTH3	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom	ENSG00000008256		0.622	CYTH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH3	HGNC	protein_coding	OTTHUMT00000207396.2	-	0.00	87	0	G	NM_004227		6210872	-1	tier1	-	no_errors	ENST00000350796	ensembl	human	known	74_37	missense	16.67	35	7	SNP	1.000	A
DAB2	1601	genome.wustl.edu	37	5	39390560	39390560	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:39390560T>G	ENST00000320816.6	-	5	915	c.448A>C	c.(448-450)Aaa>Caa	p.K150Q	DAB2_ENST00000512525.1_5'UTR|DAB2_ENST00000509337.1_Missense_Mutation_p.K150Q|DAB2_ENST00000339788.6_Missense_Mutation_p.K150Q|DAB2_ENST00000545653.1_Missense_Mutation_p.K150Q	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	150	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			TGCCCGGTTTTTATGGCAAAA	0.458																																																	0													93.0	91.0	91.0					5																	39390560		2203	4300	6503	SO:0001583	missense	0			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.448A>C	5.37:g.39390560T>G	ENSP00000313391:p.Lys150Gln		A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.K150Q	ENST00000320816.6	37	c.448	CCDS34149.1	5	.	.	.	.	.	.	.	.	.	.	T	27.9	4.874639	0.91664	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.6	5.6	0.85130	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.45397	0.1340	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.41016	-0.9532	10	0.87932	D	0	-16.9535	16.0863	0.81056	0.0:0.0:0.0:1.0	.	150;150	P98082;P98082-3	DAB2_HUMAN;.	Q	150	ENSP00000313391:K150Q;ENSP00000345508:K150Q;ENSP00000439919:K150Q;ENSP00000426245:K150Q	ENSP00000313391:K150Q	K	-	1	0	DAB2	39426317	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.566000	0.82347	2.251000	0.74343	0.528000	0.53228	AAA	DAB2	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	ENSG00000153071		0.458	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	HGNC	protein_coding	OTTHUMT00000367014.1	-	0.00	49	0	T	NM_001343		39390560	-1	tier1	-	no_errors	ENST00000320816	ensembl	human	known	74_37	missense	18.52	22	5	SNP	1.000	G
DAXX	1616	genome.wustl.edu	37	6	33289534	33289534	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:33289534T>C	ENST00000374542.5	-	2	373	c.169A>G	c.(169-171)Aaa>Gaa	p.K57E	DAXX_ENST00000477162.1_5'UTR|DAXX_ENST00000414083.2_Intron|DAXX_ENST00000266000.6_Missense_Mutation_p.K57E	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	57	Necessary for interaction with USP7 and ATRX.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						TTGTAGCATTTCTTGCCGCCC	0.597			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																			Rec	yes		6	6p21.3	1616	death-domain associated protein		E	0													230.0	236.0	234.0					6																	33289534		2203	4300	6503	SO:0001583	missense	0			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.169A>G	6.37:g.33289534T>C	ENSP00000363668:p.Lys57Glu		B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	pfam_Daxx	p.K57E	ENST00000374542.5	37	c.169	CCDS4776.1	6	.	.	.	.	.	.	.	.	.	.	T	3.657	-0.070228	0.07228	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000446403;ENST00000453407	.	.	.	5.12	3.94	0.45596	.	0.343848	0.34223	N	0.004151	T	0.42988	0.1227	L	0.57536	1.79	0.80722	D	1	P;P	0.45827	0.867;0.78	P;B	0.50314	0.637;0.334	T	0.39292	-0.9621	9	0.17369	T	0.5	-7.0235	8.1038	0.30874	0.1793:0.0:0.0:0.8207	.	69;57	B4E1C1;Q9UER7	.;DAXX_HUMAN	E	57	.	ENSP00000266000:K57E	K	-	1	0	DAXX	33397512	1.000000	0.71417	0.999000	0.59377	0.734000	0.41952	0.846000	0.27682	0.954000	0.37851	0.448000	0.29417	AAA	DAXX	-	pfam_Daxx	ENSG00000204209		0.597	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAXX	HGNC	protein_coding	OTTHUMT00000076403.1	-	0.00	57	0	T			33289534	-1	tier1	-	no_errors	ENST00000266000	ensembl	human	known	74_37	missense	58.14	18	25	SNP	1.000	C
DCC	1630	genome.wustl.edu	37	18	50731590	50731590	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr18:50731590A>C	ENST00000442544.2	+	10	2194	c.1578A>C	c.(1576-1578)caA>caC	p.Q526H	DCC_ENST00000581580.1_Missense_Mutation_p.Q181H|DCC_ENST00000412726.1_Missense_Mutation_p.Q374H	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	526					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATACAGTGCAAGTTCCAGGGC	0.373																																																	0													132.0	141.0	138.0					18																	50731590		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1578A>C	18.37:g.50731590A>C	ENSP00000389140:p.Gln526His			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q526H	ENST00000442544.2	37	c.1578	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	A	11.55	1.672955	0.29693	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.54675	0.66;0.56	5.78	5.78	0.91487	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.071257	0.56097	D	0.000029	T	0.53110	0.1776	L	0.49126	1.545	0.41166	D	0.986136	B;B;B	0.23442	0.006;0.006;0.085	B;B;B	0.33196	0.021;0.021;0.159	T	0.53208	-0.8471	10	0.52906	T	0.07	.	15.0889	0.72177	1.0:0.0:0.0:0.0	.	374;374;526	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	H	526;459;374	ENSP00000389140:Q526H;ENSP00000397322:Q374H	ENSP00000304146:Q459H	Q	+	3	2	DCC	48985588	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	3.670000	0.54569	2.197000	0.70478	0.533000	0.62120	CAA	DCC	-	superfamily_Fibronectin_type3	ENSG00000187323		0.373	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	58	0	A	NM_005215		50731590	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	19.44	29	7	SNP	1.000	C
DCX	1641	genome.wustl.edu	37	X	110653364	110653364	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:110653364G>A	ENST00000338081.3	-	2	677	c.506C>T	c.(505-507)aCg>aTg	p.T169M	DCX_ENST00000356220.3_Missense_Mutation_p.T88M|DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Missense_Mutation_p.T88M|DCX_ENST00000356915.2_Missense_Mutation_p.T88M|DCX_ENST00000488120.1_Missense_Mutation_p.T88M	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	169	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						CAGAGATCGCGTCAGGTCAGC	0.522																																																	0													231.0	169.0	190.0					X																	110653364		2203	4300	6503	SO:0001583	missense	0			AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.506C>T	X.37:g.110653364G>A	ENSP00000337697:p.Thr169Met		A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	p.T169M	ENST00000338081.3	37	c.506	CCDS14556.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.5|23.5	4.422263|4.422263	0.83559|0.83559	.|.	.|.	ENSG00000077279|ENSG00000077279	ENST00000358070|ENST00000356915;ENST00000371993;ENST00000338081;ENST00000356220;ENST00000488120;ENST00000468911	.|D;D;D;D;D;D	.|0.96427	.|-4.01;-4.01;-4.01;-4.01;-4.01;-4.01	5.5|5.5	5.5|5.5	0.81552|0.81552	.|Doublecortin domain (5);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98419|0.98419	0.9474|0.9474	M|M	0.89095|0.89095	3.005|3.005	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.87578	.|0.983;0.998	D|D	0.99218|0.99218	1.0878|1.0878	5|10	.|0.66056	.|D	.|0.02	.|.	18.4403|18.4403	0.90664|0.90664	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|157;169	.|B4DM53;O43602	.|.;DCX_HUMAN	C|M	161|88;88;169;88;88;88	.|ENSP00000349385:T88M;ENSP00000361061:T88M;ENSP00000337697:T169M;ENSP00000348553:T88M;ENSP00000419861:T88M;ENSP00000418811:T88M	.|ENSP00000337697:T169M	R|T	-|-	1|2	0|0	DCX|DCX	110540020|110540020	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.963000|0.963000	0.63663|0.63663	9.657000|9.657000	0.98554|0.98554	2.551000|2.551000	0.86045|0.86045	0.600000|0.600000	0.82982|0.82982	CGC|ACG	DCX	-	pfam_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	ENSG00000077279		0.522	DCX-006	KNOWN	basic|CCDS	protein_coding	DCX	HGNC	protein_coding	OTTHUMT00000357058.1	-	0.00	35	0	G	NM_178153		110653364	-1	tier1	-	no_errors	ENST00000338081	ensembl	human	known	74_37	missense	42.86	16	12	SNP	1.000	A
DDX20	11218	genome.wustl.edu	37	1	112302086	112302086	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:112302086G>T	ENST00000369702.4	+	3	1081	c.461G>T	c.(460-462)gGa>gTa	p.G154V	DDX20_ENST00000475700.1_5'Flank|DDX20_ENST00000536167.1_Intron	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	154	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGCCATTGGAATAAAAATG	0.353																																																	0													109.0	105.0	106.0					1																	112302086		2203	4300	6503	SO:0001583	missense	0			AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.461G>T	1.37:g.112302086G>T	ENSP00000358716:p.Gly154Val		B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.G154V	ENST00000369702.4	37	c.461	CCDS842.1	1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482752	0.84747	.	.	ENSG00000064703	ENST00000369702	T	0.04706	3.57	4.97	4.97	0.65823	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.14227	0.0344	M	0.67625	2.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01062	-1.1464	10	0.87932	D	0	-42.2447	17.8201	0.88648	0.0:0.0:1.0:0.0	.	154	Q9UHI6	DDX20_HUMAN	V	154	ENSP00000358716:G154V	ENSP00000358716:G154V	G	+	2	0	DDX20	112103609	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.334000	0.96470	2.299000	0.77371	0.591000	0.81541	GGA	DDX20	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000064703		0.353	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX20	HGNC	protein_coding	OTTHUMT00000033063.2	-	0.00	68	0	G	NM_007204		112302086	+1	tier1	-	no_errors	ENST00000369702	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
DDX49	54555	genome.wustl.edu	37	19	19035489	19035489	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:19035489G>T	ENST00000247003.4	+	8	977	c.910G>T	c.(910-912)Gca>Tca	p.A304S	DDX49_ENST00000599156.1_3'UTR|DDX49_ENST00000438170.2_Missense_Mutation_p.A197S|AC002985.3_ENST00000596918.1_Intron	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	304	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			GATCCTGATCGCAACAGACGT	0.572																																																	0													88.0	89.0	89.0					19																	19035489		2203	4300	6503	SO:0001583	missense	0				CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.910G>T	19.37:g.19035489G>T	ENSP00000247003:p.Ala304Ser		E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A304S	ENST00000247003.4	37	c.910	CCDS12390.1	19	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958314	0.92726	.	.	ENSG00000105671	ENST00000247003;ENST00000438170	T;T	0.06768	3.26;3.26	4.77	4.77	0.60923	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.19644	0.0472	L	0.38838	1.175	0.80722	D	1	D;D	0.56746	0.977;0.977	D;D	0.64687	0.928;0.928	T	0.00950	-1.1503	10	0.72032	D	0.01	-18.693	16.7798	0.85560	0.0:0.0:1.0:0.0	.	304;304	A8K7A1;Q9Y6V7	.;DDX49_HUMAN	S	304;197	ENSP00000247003:A304S;ENSP00000395377:A197S	ENSP00000247003:A304S	A	+	1	0	DDX49	18896489	1.000000	0.71417	0.747000	0.31113	0.987000	0.75469	9.092000	0.94157	2.183000	0.69458	0.561000	0.74099	GCA	DDX49	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000105671		0.572	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX49	HGNC	protein_coding	OTTHUMT00000464593.1	-	0.00	94	0	G	NM_019070		19035489	+1	tier1	-	no_errors	ENST00000247003	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
DDX60	55601	genome.wustl.edu	37	4	169172191	169172191	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:169172191C>T	ENST00000393743.3	-	28	4063	c.3772G>A	c.(3772-3774)Gaa>Aaa	p.E1258K	DDX60_ENST00000505393.1_5'Flank	NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1258	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		ATACCCCTTTCTGCCAAGGCT	0.338																																																	0													112.0	117.0	115.0					4																	169172191		2201	4300	6501	SO:0001583	missense	0			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.3772G>A	4.37:g.169172191C>T	ENSP00000377344:p.Glu1258Lys		Q6PK35|Q9NVE3	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1258K	ENST00000393743.3	37	c.3772	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	C	6.004	0.369086	0.11352	.	.	ENSG00000137628	ENST00000393743	T	0.71103	-0.54	5.3	-10.6	0.00265	Helicase, C-terminal (2);	2.199350	0.01523	N	0.018441	T	0.33059	0.0850	N	0.02158	-0.66	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.35943	-0.9768	10	0.05833	T	0.94	.	5.9082	0.19012	0.0699:0.1857:0.1938:0.5506	.	1258	Q8IY21	DDX60_HUMAN	K	1258	ENSP00000377344:E1258K	ENSP00000377344:E1258K	E	-	1	0	DDX60	169408766	0.000000	0.05858	0.000000	0.03702	0.119000	0.20118	-3.944000	0.00329	-2.264000	0.00689	-0.499000	0.04595	GAA	DDX60	-	superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000137628		0.338	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	HGNC	protein_coding	OTTHUMT00000364622.1		0.00	123	0	C	NM_017631		169172191	-1			no_errors	ENST00000393743	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.000	T
DEFB115	245929	genome.wustl.edu	37	20	29847380	29847380	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr20:29847380A>G	ENST00000400552.1	+	2	212	c.212A>G	c.(211-213)aAg>aGg	p.K71R		NM_001037730.1	NP_001032819.1	Q30KQ5	DB115_HUMAN	defensin, beta 115	71					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|lung(3)|ovary(1)|skin(1)	6			Colorectal(19;0.00445)|COAD - Colon adenocarcinoma(19;0.0347)			CCTAAAGAAAAGGATAAACTA	0.348																																																	0													87.0	82.0	83.0					20																	29847380		1864	4107	5971	SO:0001583	missense	0			DQ012019	CCDS42859.1	20q11.1	2008-07-17			ENSG00000215547	ENSG00000215547		"""Defensins, beta"""	18096	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037730		Approved	DEFB-15	uc002wvp.1	Q30KQ5	OTTHUMG00000159284	ENST00000400552.1:c.212A>G	20.37:g.29847380A>G	ENSP00000383398:p.Lys71Arg			Missense_Mutation	SNP	NULL	p.K71R	ENST00000400552.1	37	c.212	CCDS42859.1	20	.	.	.	.	.	.	.	.	.	.	A	9.358	1.067148	0.20067	.	.	ENSG00000215547	ENST00000400552	T	0.32272	1.46	3.17	2.07	0.26955	.	.	.	.	.	T	0.21103	0.0508	.	.	.	0.09310	N	1	B	0.21225	0.053	B	0.20767	0.031	T	0.21280	-1.0250	8	0.51188	T	0.08	.	5.0088	0.14302	0.86:0.0:0.14:0.0	.	71	Q30KQ5	DB115_HUMAN	R	71	ENSP00000383398:K71R	ENSP00000383398:K71R	K	+	2	0	DEFB115	29311041	0.006000	0.16342	0.013000	0.15412	0.004000	0.04260	0.232000	0.17891	0.627000	0.30340	0.329000	0.21502	AAG	DEFB115	-	NULL	ENSG00000215547		0.348	DEFB115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB115	HGNC	protein_coding	OTTHUMT00000354402.1		0.00	56	0	A	NM_001037730		29847380	+1			no_errors	ENST00000400552	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.015	G
DENND4C	55667	genome.wustl.edu	37	9	19324506	19324506	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:19324506G>T	ENST00000380432.2	+	9	1278		c.e9+1		DENND4C_ENST00000602925.1_Splice_Site|DENND4C_ENST00000434457.2_Splice_Site			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C						cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						CATAGAAAAGGTAAAAGTTTG	0.284																																																	0													74.0	82.0	79.0					9																	19324506		2201	4295	6496	SO:0001630	splice_region_variant	0			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.1245+1G>T	9.37:g.19324506G>T			A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Splice_Site	SNP	-	e12+1	ENST00000380432.2	37	c.1953+1		9	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402449	0.83230	.	.	ENSG00000137145	ENST00000380437	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4075	0.90541	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DENND4C	19314506	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.569000	0.98170	2.656000	0.90262	0.591000	0.81541	.	DENND4C	-	-	ENSG00000137145		0.284	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	HGNC	protein_coding		-	0.00	78	0	G	NM_017925	Intron	19324506	+1	tier1	-	no_errors	ENST00000602925	ensembl	human	known	74_37	splice_site	7.84	47	4	SNP	1.000	T
DEPDC5	9681	genome.wustl.edu	37	22	32289687	32289687	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr22:32289687G>T	ENST00000382112.3	+	38	4196	c.4126G>T	c.(4126-4128)Gag>Tag	p.E1376*	DEPDC5_ENST00000400246.1_Nonsense_Mutation_p.E1385*|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000266091.3_Nonsense_Mutation_p.E1363*|DEPDC5_ENST00000400249.2_Nonsense_Mutation_p.E1354*|DEPDC5_ENST00000382111.2_Nonsense_Mutation_p.E1385*|DEPDC5_ENST00000535622.1_Nonsense_Mutation_p.E1285*|DEPDC5_ENST00000539165.1_Nonsense_Mutation_p.E202*|DEPDC5_ENST00000400248.2_Nonsense_Mutation_p.E1354*	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1385					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.E1285Q(1)|p.E1354Q(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TGCAGCCTTTGAGATCAAGCT	0.537																																																	2	Substitution - Missense(2)	lung(2)											82.0	87.0	85.0					22																	32289687		2055	4203	6258	SO:0001587	stop_gained	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4126G>T	22.37:g.32289687G>T	ENSP00000371546:p.Glu1376*		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Nonsense_Mutation	SNP	pfam_IML1,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.E1363*	ENST00000382112.3	37	c.4087	CCDS46692.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	44|44	11.076734|11.076734	0.99512|0.99512	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165|ENST00000433147	.|.	.|.	.|.	4.99|4.99	4.99|4.99	0.66335|0.66335	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.66056|.	D|.	0.02|.	.|.	17.2842|17.2842	0.87137|0.87137	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1285;1363;1354;1285;1385;1376;1385;1354;202|760	.|.	ENSP00000266091:E1363X|.	E|X	+|+	1|2	0|2	DEPDC5|DEPDC5	30619687|30619687	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.997000|0.997000	0.91878|0.91878	9.513000|9.513000	0.98010|0.98010	2.310000|2.310000	0.77875|0.77875	0.563000|0.563000	0.77884|0.77884	GAG|TGA	DEPDC5	-	NULL	ENSG00000100150		0.537	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1		0.00	34	0	G	NM_014662		32289687	+1			no_errors	ENST00000266091	ensembl	human	known	74_37	nonsense	7.41	25	2	SNP	1.000	T
DGKB	1607	genome.wustl.edu	37	7	14613990	14613990	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:14613990T>A	ENST00000403951.2	-	20	2039	c.1620A>T	c.(1618-1620)gaA>gaT	p.E540D	DGKB_ENST00000258767.5_Missense_Mutation_p.E540D|DGKB_ENST00000407950.1_Missense_Mutation_p.E532D|DGKB_ENST00000406247.3_Missense_Mutation_p.E540D|DGKB_ENST00000444700.2_Missense_Mutation_p.E521D|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000402815.1_Missense_Mutation_p.E539D|DGKB_ENST00000399322.3_Missense_Mutation_p.E540D			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	540	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						GATTCTCACCTTCGTAACCTA	0.323																																																	0													140.0	123.0	128.0					7																	14613990		1819	4087	5906	SO:0001583	missense	0			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1620A>T	7.37:g.14613990T>A	ENSP00000385780:p.Glu540Asp		A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.E540D	ENST00000403951.2	37	c.1620	CCDS47547.1	7	.	.	.	.	.	.	.	.	.	.	T	14.24	2.475178	0.43942	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93;1.93	5.43	5.43	0.79202	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.19087	0.0458	N	0.12920	0.275	0.52501	D	0.999959	B;B;B;B	0.27316	0.175;0.075;0.075;0.058	B;B;B;B	0.33690	0.168;0.101;0.133;0.06	T	0.10154	-1.0642	10	0.24483	T	0.36	.	15.4862	0.75569	0.0:0.0:0.0:1.0	.	539;521;540;540	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	D	540;540;540;539;532;521;540	ENSP00000385780:E540D;ENSP00000382260:E540D;ENSP00000258767:E540D;ENSP00000384909:E539D;ENSP00000385031:E532D;ENSP00000388451:E521D;ENSP00000386066:E540D	ENSP00000258767:E540D	E	-	3	2	DGKB	14580515	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	3.265000	0.51561	2.063000	0.61619	0.533000	0.62120	GAA	DGKB	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000136267		0.323	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKB	HGNC	protein_coding	OTTHUMT00000326356.2	-	0.00	61	0	T	NM_004080		14613990	-1	tier1	-	no_errors	ENST00000258767	ensembl	human	known	74_37	missense	13.33	39	6	SNP	1.000	A
DHRS3	9249	genome.wustl.edu	37	1	12632790	12632792	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:12632790_12632792delGGA	ENST00000376223.2	-	5	1171_1173	c.788_790delTCC	c.(787-792)ctccca>cca	p.L263del	RNU6ATAC18P_ENST00000408413.1_RNA	NM_004753.4	NP_004744.2	O75911	DHRS3_HUMAN	dehydrogenase/reductase (SDR family) member 3	263					bone morphogenesis (GO:0060349)|cardiac septum morphogenesis (GO:0060411)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|phototransduction, visible light (GO:0007603)|regulation of ossification (GO:0030278)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|photoreceptor outer segment membrane (GO:0042622)	electron carrier activity (GO:0009055)|NADP-retinol dehydrogenase activity (GO:0052650)|nucleotide binding (GO:0000166)|retinol dehydrogenase activity (GO:0004745)			cervix(1)|large_intestine(4)|lung(2)|prostate(1)|skin(1)	9	Ovarian(185;0.249)	Lung NSC(185;4.11e-05)|all_lung(284;4.58e-05)|Renal(390;0.000147)|Colorectal(325;0.000585)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;9.25e-07)|COAD - Colon adenocarcinoma(227;0.000326)|BRCA - Breast invasive adenocarcinoma(304;0.000344)|Kidney(185;0.00235)|KIRC - Kidney renal clear cell carcinoma(229;0.00656)|STAD - Stomach adenocarcinoma(313;0.00798)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	ATTGTCCATGGGAGGAGGAGGAG	0.552																																																	0																																										SO:0001651	inframe_deletion	0			AF061741	CCDS146.1	1p36.1	2011-09-20			ENSG00000162496	ENSG00000162496	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	17693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 1"""	612830				9705317, 12226107, 19027726	Standard	XM_005263533		Approved	retSDR1, Rsdr1, SDR1, RDH17, SDR16C1	uc001auc.3	O75911	OTTHUMG00000001885	ENST00000376223.2:c.788_790delTCC	1.37:g.12632799_12632801delGGA	ENSP00000365397:p.Leu263del		B2R7F3|Q5VUY3|Q6UY38|Q9BUC8	In_Frame_Del	DEL	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Polysac_CapD-like,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.L263in_frame_del	ENST00000376223.2	37	c.790_788	CCDS146.1	1																																																																																			DHRS3	-	NULL	ENSG00000162496		0.552	DHRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS3	HGNC	protein_coding	OTTHUMT00000005318.1		0.00	82	0	GGA	NM_004753		12632792	-1	tier1		no_errors	ENST00000376223	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	1.000:0.999:1.000	-
DHX40	79665	genome.wustl.edu	37	17	57644075	57644075	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:57644075G>A	ENST00000251241.4	+	2	347	c.200G>A	c.(199-201)aGg>aAg	p.R67K	DHX40_ENST00000451169.2_5'UTR|DHX40_ENST00000425628.3_Intron	NM_024612.4	NP_078888.4	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	67	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(7)|large_intestine(6)|lung(6)|prostate(1)	20	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					CAAGCTGTGAGGGACAATTCA	0.363																																																	0													62.0	63.0	62.0					17																	57644075		2203	4300	6503	SO:0001583	missense	0			AF260270	CCDS11617.1, CCDS54150.1	17q22	2014-01-28	2003-06-13	2003-06-20		ENSG00000108406		"""DEAH-boxes"""	18018	protein-coding gene	gene with protein product		607570	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 40 (RNA helicase)"""	DDX40			Standard	NM_024612		Approved	ARG147, PAD, FLJ22060	uc002ixn.2	Q8IX18		ENST00000251241.4:c.200G>A	17.37:g.57644075G>A	ENSP00000251241:p.Arg67Lys		B3KTJ5|C9JR60|Q5JPH4|Q8TC86|Q8WY53|Q9BXM1|Q9H6M9	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R67K	ENST00000251241.4	37	c.200	CCDS11617.1	17	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051711	0.36181	.	.	ENSG00000108406	ENST00000251241;ENST00000425628	T	0.07688	3.17	5.47	3.14	0.36123	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.353403	0.36134	N	0.002763	T	0.04272	0.0118	N	0.10837	0.055	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.40590	-0.9555	10	0.34782	T	0.22	.	7.5476	0.27777	0.1748:0.1427:0.6825:0.0	.	67	Q8IX18	DHX40_HUMAN	K	67	ENSP00000251241:R67K	ENSP00000251241:R67K	R	+	2	0	DHX40	54998857	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.000000	0.29770	1.313000	0.45069	0.561000	0.74099	AGG	DHX40	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000108406		0.363	DHX40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX40	HGNC	protein_coding	OTTHUMT00000446095.1	-	0.00	122	0	G	NM_024612		57644075	+1	tier1	-	no_errors	ENST00000251241	ensembl	human	known	74_37	missense	27.14	51	19	SNP	0.996	A
DLC1	10395	genome.wustl.edu	37	8	12947789	12947789	+	Nonsense_Mutation	SNP	G	G	T	rs139251311	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:12947789G>T	ENST00000276297.4	-	15	4455	c.4046C>A	c.(4045-4047)tCg>tAg	p.S1349*	DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000520226.1_Nonsense_Mutation_p.S838*|DLC1_ENST00000358919.2_Nonsense_Mutation_p.S912*|DLC1_ENST00000512044.2_Nonsense_Mutation_p.S946*	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1349	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.S1349L(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						AGCCTGCTCCGAAGTGGAGTA	0.502																																																	1	Substitution - Missense(1)	large_intestine(1)											75.0	76.0	76.0					8																	12947789		2203	4300	6503	SO:0001587	stop_gained	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4046C>A	8.37:g.12947789G>T	ENSP00000276297:p.Ser1349*		B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Nonsense_Mutation	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.S1349*	ENST00000276297.4	37	c.4046	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	G	44	10.945485	0.99493	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	.	.	.	5.06	5.06	0.68205	.	0.119358	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	19.0004	0.92830	0.0:0.0:1.0:0.0	.	.	.	.	X	1349;912;288;946;838	.	ENSP00000276297:S1349X	S	-	2	0	DLC1	12992160	1.000000	0.71417	0.138000	0.22173	0.732000	0.41865	5.411000	0.66386	2.809000	0.96659	0.555000	0.69702	TCG	DLC1	-	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	ENSG00000164741		0.502	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2		0.00	36	0	G	NM_182643, NM_006094		12947789	-1			no_errors	ENST00000276297	ensembl	human	known	74_37	nonsense	10.00	18	2	SNP	0.790	T
DLGAP3	58512	genome.wustl.edu	37	1	35370007	35370007	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:35370007C>T	ENST00000373347.1	-	3	1246	c.978G>A	c.(976-978)tcG>tcA	p.S326S	DLGAP3_ENST00000235180.4_Silent_p.S326S|DLGAP3_ENST00000495979.1_5'Flank			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	326					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)	p.S326S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				TTCGCTTGACCGACTGTCCAT	0.662																																																	1	Substitution - coding silent(1)	endometrium(1)											47.0	48.0	48.0					1																	35370007		2203	4300	6503	SO:0001819	synonymous_variant	0			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.978G>A	1.37:g.35370007C>T			Q5TDD5|Q9H3X7	Silent	SNP	pfam_GKAP	p.S326	ENST00000373347.1	37	c.978	CCDS30670.1	1																																																																																			DLGAP3	-	NULL	ENSG00000116544		0.662	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	-	0.00	55	0	C	NM_021234		35370007	-1	tier1	-	no_errors	ENST00000235180	ensembl	human	known	74_37	silent	14.55	47	8	SNP	0.201	T
DNAH2	146754	genome.wustl.edu	37	17	7636537	7636537	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:7636537G>T	ENST00000572933.1	+	5	1992	c.532G>T	c.(532-534)Gtc>Ttc	p.V178F	DNAH2_ENST00000082259.3_Missense_Mutation_p.V178F|DNAH2_ENST00000389173.2_Missense_Mutation_p.V178F|DNAH2_ENST00000570791.1_Missense_Mutation_p.V178F			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	178	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCTCGGTGGAGTCTTTGCCCC	0.552																																																	0													94.0	89.0	91.0					17																	7636537		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.532G>T	17.37:g.7636537G>T	ENSP00000458355:p.Val178Phe		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.V178F	ENST00000572933.1	37	c.532	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084865	0.55861	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.42131	0.98;0.98	5.42	4.25	0.50352	.	0.580978	0.14346	N	0.325389	T	0.36717	0.0977	L	0.39898	1.24	0.36345	D	0.859725	P;P	0.38250	0.624;0.589	B;B	0.40009	0.154;0.316	T	0.48758	-0.9007	10	0.72032	D	0.01	.	9.536	0.39222	0.0903:0.1495:0.7602:0.0	.	178;178	Q9P225;Q9P225-3	DYH2_HUMAN;.	F	178	ENSP00000373825:V178F;ENSP00000082259:V178F	ENSP00000082259:V178F	V	+	1	0	DNAH2	7577262	0.290000	0.24343	0.962000	0.40283	0.831000	0.47069	0.533000	0.23082	2.561000	0.86390	0.561000	0.74099	GTC	DNAH2	-	NULL	ENSG00000183914		0.552	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	-	0.00	37	0	G	NM_020877		7636537	+1	tier1	-	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.505	T
DNAH5	1767	genome.wustl.edu	37	5	13717530	13717530	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:13717530T>G	ENST00000265104.4	-	73	12703	c.12599A>C	c.(12598-12600)aAg>aCg	p.K4200T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4200	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K4200T(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGCACCGAACTTGCGCCTCTC	0.552									Kartagener syndrome																																								1	Substitution - Missense(1)	pancreas(1)											70.0	64.0	66.0					5																	13717530		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12599A>C	5.37:g.13717530T>G	ENSP00000265104:p.Lys4200Thr		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K4200T	ENST00000265104.4	37	c.12599	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546348	0.86022	.	.	ENSG00000039139	ENST00000265104	T	0.12147	2.71	5.45	5.45	0.79879	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.48978	0.1530	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63395	-0.6647	10	0.87932	D	0	.	15.5182	0.75842	0.0:0.0:0.0:1.0	.	4200	Q8TE73	DYH5_HUMAN	T	4200	ENSP00000265104:K4200T	ENSP00000265104:K4200T	K	-	2	0	DNAH5	13770530	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	8.020000	0.88740	2.067000	0.61834	0.533000	0.62120	AAG	DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.552	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	60	0	T	NM_001369		13717530	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	G
DNAJA1	3301	genome.wustl.edu	37	9	33029944	33029944	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:33029944delA	ENST00000330899.4	+	4	555	c.372delA	c.(370-372)agafs	p.R124fs	DNAJA1_ENST00000495015.1_Intron|DNAJA1_ENST00000544625.1_5'UTR	NM_001539.2	NP_001530.1	P31689	DNJA1_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 1	124					androgen receptor signaling pathway (GO:0030521)|DNA damage response, detection of DNA damage (GO:0042769)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of apoptotic process (GO:0043065)|protein folding (GO:0006457)|protein localization to mitochondrion (GO:0070585)|regulation of protein transport (GO:0051223)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasmic side of endoplasmic reticulum membrane (GO:0098554)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|G-protein coupled receptor binding (GO:0001664)|Hsp70 protein binding (GO:0030544)|low-density lipoprotein particle receptor binding (GO:0050750)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			large_intestine(2)|ovary(1)|skin(3)	6			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.102)		GTGCAACAAGAAAACTGGCTC	0.318																																																	0													100.0	101.0	101.0					9																	33029944		2203	4299	6502	SO:0001589	frameshift_variant	0			L08069	CCDS6533.1	9p13.3	2011-09-02			ENSG00000086061	ENSG00000086061		"""Heat shock proteins / DNAJ (HSP40)"""	5229	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 7"""	602837		HSJ2		8334160, 11147971	Standard	NM_001539		Approved	HSPF4, hdj-2, dj-2, NEDD7	uc003zsd.1	P31689	OTTHUMG00000019760	ENST00000330899.4:c.372delA	9.37:g.33029944delA	ENSP00000369127:p.Arg124fs		Q5T7Q0|Q86TL9	Frame_Shift_Del	DEL	pfam_DnaJ_C,pfam_DnaJ_domain,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_domain,pfscan_DnaJ_domain,pfscan_HSP_DnaJ_Cys-rich_dom,prints_DnaJ_domain	p.K125fs	ENST00000330899.4	37	c.372	CCDS6533.1	9																																																																																			DNAJA1	-	pfam_HSP_DnaJ_Cys-rich_dom,superfamily_HSP40/DnaJ_pept-bd,pfscan_HSP_DnaJ_Cys-rich_dom	ENSG00000086061		0.318	DNAJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJA1	HGNC	protein_coding	OTTHUMT00000052031.1		0.00	61	0	A			33029944	+1	tier1		no_errors	ENST00000330899	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	0.900	-
DNAJC6	9829	genome.wustl.edu	37	1	65852544	65852544	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:65852544G>T	ENST00000395325.3	+	8	1031	c.874G>T	c.(874-876)Gtg>Ttg	p.V292L	DNAJC6_ENST00000371069.4_Missense_Mutation_p.V349L|DNAJC6_ENST00000498720.1_3'UTR|DNAJC6_ENST00000263441.7_Missense_Mutation_p.V279L	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	292	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						GAACATCACTGTGCAAGGAGA	0.413																																																	0													145.0	121.0	129.0					1																	65852544		2203	4300	6503	SO:0001583	missense	0			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.874G>T	1.37:g.65852544G>T	ENSP00000378735:p.Val292Leu		B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_C2_dom,smart_DnaJ_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.V349L	ENST00000395325.3	37	c.1045	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130056	0.77549	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	D;D;D	0.83992	-1.79;-1.79;-1.79	4.35	4.35	0.52113	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.136292	0.48767	D	0.000175	T	0.75309	0.3832	L	0.31294	0.92	0.58432	D	0.999996	P;P;D	0.54772	0.949;0.926;0.968	P;P;P	0.54499	0.538;0.668;0.754	T	0.72364	-0.4316	10	0.14252	T	0.57	.	17.4275	0.87530	0.0:0.0:1.0:0.0	.	349;292;279	O75061-2;O75061;D3DQ66	.;AUXI_HUMAN;.	L	279;292;349	ENSP00000263441:V279L;ENSP00000378735:V292L;ENSP00000360108:V349L	ENSP00000263441:V279L	V	+	1	0	DNAJC6	65625132	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.151000	0.94674	2.410000	0.81850	0.557000	0.71058	GTG	DNAJC6	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom	ENSG00000116675		0.413	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	HGNC	protein_coding	OTTHUMT00000025134.1	-	0.00	51	0	G			65852544	+1	tier1	-	no_errors	ENST00000371069	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.996	T
DNLZ	728489	genome.wustl.edu	37	9	139256519	139256519	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:139256519G>A	ENST00000371738.3	-	3	556	c.482C>T	c.(481-483)cCg>cTg	p.P161L	DNLZ_ENST00000371739.3_Silent_p.S114S|CARD9_ENST00000460290.1_5'Flank	NM_001080849.1	NP_001074318.1	Q5SXM8	DNLZ_HUMAN	DNL-type zinc finger	161						mitochondrion (GO:0005739)	zinc ion binding (GO:0008270)			central_nervous_system(1)|prostate(1)	2		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.42e-06)|Epithelial(140;3.3e-06)		ACCCGCTTCCGGAGCTGCAGT	0.692																																																	0													14.0	18.0	17.0					9																	139256519		2191	4296	6487	SO:0001583	missense	0			AL592301	CCDS35179.1	9q34.3	2013-01-10	2007-12-18	2007-12-18	ENSG00000213221	ENSG00000213221		"""Zinc fingers"""	33879	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 15 homolog (yeast)"", ""HSP70 escort protein"""		"""chromosome 9 open reading frame 151"""	C9orf151		21530495, 22162012	Standard	NM_001080849		Approved	RP11-413M3.2, ZIM17, bA413M3.2, TIMM15, HEP	uc004chf.2	Q5SXM8	OTTHUMG00000020931	ENST00000371738.3:c.482C>T	9.37:g.139256519G>A	ENSP00000360803:p.Pro161Leu		B2RUX5|B9EJE1	Missense_Mutation	SNP	pfam_Znf_DNL-typ	p.P161L	ENST00000371738.3	37	c.482	CCDS35179.1	9	.	.	.	.	.	.	.	.	.	.	G	9.069	0.996313	0.19043	.	.	ENSG00000213221	ENST00000371738	T	0.30714	1.52	3.49	-3.14	0.05250	Zinc finger, DNL-type (1);	0.345575	0.17891	U	0.158536	T	0.15869	0.0382	L	0.29908	0.895	0.09310	N	1	B	0.17852	0.024	B	0.06405	0.002	T	0.08186	-1.0734	10	0.46703	T	0.11	0.1753	4.2269	0.10584	0.3871:0.0:0.3695:0.2434	.	161	Q5SXM8	DNLZ_HUMAN	L	161	ENSP00000360803:P161L	ENSP00000360803:P161L	P	-	2	0	DNLZ	138376340	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.273000	0.08548	-0.734000	0.04843	-0.339000	0.08088	CCG	DNLZ	-	NULL	ENSG00000213221		0.692	DNLZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNLZ	HGNC	protein_coding	OTTHUMT00000055075.2	-	0.00	54	0	G	NM_001080849		139256519	-1	tier1	-	no_errors	ENST00000371738	ensembl	human	known	74_37	missense	11.76	45	6	SNP	0.000	A
DPP10	57628	genome.wustl.edu	37	2	116538543	116538543	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:116538543G>T	ENST00000410059.1	+	16	1935	c.1455G>T	c.(1453-1455)atG>atT	p.M485I	DPP10_ENST00000409163.1_Missense_Mutation_p.M435I|DPP10_ENST00000393147.2_Missense_Mutation_p.M489I|DPP10_ENST00000310323.8_Missense_Mutation_p.M478I	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	485						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TTAGTCCCATGAATCAACATT	0.303																																																	0													102.0	97.0	99.0					2																	116538543		2202	4294	6496	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1455G>T	2.37:g.116538543G>T	ENSP00000386565:p.Met485Ile		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.M489I	ENST00000410059.1	37	c.1467	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354341	0.41700	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.86	4.8	0.61643	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.291247	0.37437	N	0.002084	T	0.17492	0.0420	N	0.08118	0	0.33360	D	0.572206	B;B;B;B	0.21821	0.017;0.061;0.021;0.021	B;B;B;B	0.22152	0.006;0.038;0.011;0.011	T	0.12837	-1.0532	10	0.42905	T	0.14	-21.4297	13.1246	0.59346	0.0866:0.0:0.9134:0.0	.	478;489;481;485	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	I	485;435;489;478;435	ENSP00000386565:M485I;ENSP00000387038:M435I;ENSP00000376855:M489I;ENSP00000309066:M478I	ENSP00000309066:M478I	M	+	3	0	DPP10	116255013	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.057000	0.41365	2.777000	0.95525	0.655000	0.94253	ATG	DPP10	-	pfam_Peptidase_S9B	ENSG00000175497		0.303	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	-	0.00	60	0	G	NM_020868		116538543	+1	tier1	-	no_errors	ENST00000393147	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
DPP10	57628	genome.wustl.edu	37	2	116539961	116539961	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:116539961C>T	ENST00000410059.1	+	17	1997	c.1517C>T	c.(1516-1518)aCg>aTg	p.T506M	DPP10_ENST00000409163.1_Missense_Mutation_p.T456M|DPP10_ENST00000393147.2_Missense_Mutation_p.T510M|DPP10_ENST00000310323.8_Missense_Mutation_p.T499M	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	506						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CTACATAGTACGGACAACCCA	0.343																																																	0													142.0	140.0	140.0					2																	116539961		2203	4300	6503	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1517C>T	2.37:g.116539961C>T	ENSP00000386565:p.Thr506Met		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.T510M	ENST00000410059.1	37	c.1529	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052039	0.36181	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.56	5.56	0.83823	.	0.173140	0.52532	D	0.000080	T	0.49338	0.1551	M	0.80422	2.495	0.40860	D	0.983826	D;D;D;D	0.58620	0.98;0.983;0.966;0.966	P;P;P;P	0.51516	0.672;0.5;0.472;0.472	T	0.56062	-0.8041	10	0.56958	D	0.05	-12.2172	16.6941	0.85330	0.0:1.0:0.0:0.0	.	499;510;502;506	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	M	506;456;510;499;456	ENSP00000386565:T506M;ENSP00000387038:T456M;ENSP00000376855:T510M;ENSP00000309066:T499M	ENSP00000309066:T499M	T	+	2	0	DPP10	116256431	0.111000	0.22076	0.199000	0.23439	0.030000	0.12068	1.031000	0.30165	2.614000	0.88457	0.555000	0.69702	ACG	DPP10	-	NULL	ENSG00000175497		0.343	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4		0.00	102	0	C	NM_020868		116539961	+1			no_errors	ENST00000393147	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.508	T
DYNC2H1	79659	genome.wustl.edu	37	11	103191922	103191923	+	Frame_Shift_Ins	INS	-	-	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:103191922_103191923insT	ENST00000375735.2	+	81	12034_12035	c.11890_11891insT	c.(11890-11892)attfs	p.I3964fs	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Frame_Shift_Ins_p.I3971fs	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3964					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.P1406fs*44(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CAAGAAAAGCATTTTTCCATAT	0.327																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.11895dupT	11.37:g.103191927_103191927dupT	ENSP00000364887:p.Ile3964fs		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Frame_Shift_Ins	INS	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P3973fs	ENST00000375735.2	37	c.11911_11912	CCDS53701.1	11																																																																																			DYNC2H1	-	pfam_Dynein_heavy_dom	ENSG00000187240		0.327	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1		0.00	72	0	-	XM_370652		103191923	+1	tier1		no_errors	ENST00000398093	ensembl	human	known	74_37	frame_shift_ins	23.08	40	12	INS	0.000:0.006	T
EHD3	30845	genome.wustl.edu	37	2	31484569	31484569	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:31484569A>G	ENST00000322054.5	+	5	1355	c.1070A>G	c.(1069-1071)aAg>aGg	p.K357R	EHD3_ENST00000541626.1_Intron	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	357					blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					CCCAATCTGAAGAGGATGCAG	0.587																																																	0													86.0	85.0	86.0					2																	31484569		2203	4300	6503	SO:0001583	missense	0			AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1070A>G	2.37:g.31484569A>G	ENSP00000327116:p.Lys357Arg		B4DFR5|D6W574|Q8N514|Q9NZB3	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.K357R	ENST00000322054.5	37	c.1070	CCDS1774.1	2	.	.	.	.	.	.	.	.	.	.	A	12.31	1.898172	0.33535	.	.	ENSG00000013016	ENST00000322054	T	0.18016	2.24	6.04	4.88	0.63580	.	0.081118	0.85682	N	0.000000	T	0.12646	0.0307	L	0.37697	1.125	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.10382	-1.0632	10	0.15066	T	0.55	-40.9297	9.7831	0.40660	0.852:0.0:0.148:0.0	.	357	Q9NZN3	EHD3_HUMAN	R	357	ENSP00000327116:K357R	ENSP00000327116:K357R	K	+	2	0	EHD3	31338073	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.310000	0.59141	1.107000	0.41642	0.459000	0.35465	AAG	EHD3	-	NULL	ENSG00000013016		0.587	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD3	HGNC	protein_coding	OTTHUMT00000216810.1	-	0.00	70	0	A	NM_014600		31484569	+1	tier1	-	no_errors	ENST00000322054	ensembl	human	known	74_37	missense	13.51	32	5	SNP	1.000	G
EHMT1	79813	genome.wustl.edu	37	9	140611616	140611616	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:140611616G>A	ENST00000460843.1	+	3	651	c.624G>A	c.(622-624)ccG>ccA	p.P208P	EHMT1_ENST00000462484.1_Silent_p.P208P|EHMT1_ENST00000334856.6_Silent_p.P177P|EHMT1_ENST00000371394.2_3'UTR	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	208					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AGACCATGCCGAAGTCCGTCG	0.552																																																	0													24.0	27.0	26.0					9																	140611616		2134	4142	6276	SO:0001819	synonymous_variant	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.624G>A	9.37:g.140611616G>A			B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.P208	ENST00000460843.1	37	c.624	CCDS7050.2	9																																																																																			EHMT1	-	NULL	ENSG00000181090		0.552	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2		0.00	45	0	G	NM_024757		140611616	+1			no_errors	ENST00000460843	ensembl	human	known	74_37	silent	5.26	35	2	SNP	0.684	A
EIF3D	8664	genome.wustl.edu	37	22	36919267	36919267	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr22:36919267G>T	ENST00000216190.8	-	6	824	c.454C>A	c.(454-456)Cag>Aag	p.Q152K	EIF3D_ENST00000405442.1_Missense_Mutation_p.Q152K|EIF3D_ENST00000541106.1_Missense_Mutation_p.Q103K	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D											cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						TGTGATTTCTGATCCCATTTC	0.368																																																	0													170.0	172.0	171.0					22																	36919267		2203	4300	6503	SO:0001583	missense	0			U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.454C>A	22.37:g.36919267G>T	ENSP00000216190:p.Gln152Lys			Missense_Mutation	SNP	pfam_eIF3d,pirsf_eIF3d	p.Q152K	ENST00000216190.8	37	c.454	CCDS13930.1	22	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475190	0.63737	.	.	ENSG00000100353	ENST00000216190;ENST00000541106;ENST00000405442;ENST00000455547;ENST00000457241;ENST00000432675	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.52289	0.1725	L	0.29908	0.895	0.80722	D	1	B;B	0.25206	0.12;0.017	B;B	0.20384	0.029;0.008	T	0.44050	-0.9353	9	0.19147	T	0.46	-18.0609	19.8936	0.96942	0.0:0.0:1.0:0.0	.	103;152	B4DVY1;O15371	.;EIF3D_HUMAN	K	152;103;152;152;152;152	.	ENSP00000216190:Q152K	Q	-	1	0	EIF3D	35249213	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.764000	0.91719	2.793000	0.96121	0.655000	0.94253	CAG	EIF3D	-	pfam_eIF3d,pirsf_eIF3d	ENSG00000100353		0.368	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3D	HGNC	protein_coding	OTTHUMT00000319026.1	-	0.00	102	0	G			36919267	-1	tier1	-	no_errors	ENST00000216190	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
ENDOV	284131	genome.wustl.edu	37	17	78399375	78399375	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:78399375G>A	ENST00000518137.1	+	7	697	c.669G>A	c.(667-669)ctG>ctA	p.L223L	ENDOV_ENST00000518907.1_Silent_p.L29L|ENDOV_ENST00000517795.1_Silent_p.L29L|ENDOV_ENST00000323854.5_Silent_p.L178L|ENDOV_ENST00000522751.1_Silent_p.L29L|ENDOV_ENST00000520367.1_Silent_p.L178L|ENDOV_ENST00000520284.1_Silent_p.L29L|ENDOV_ENST00000518901.1_Silent_p.L29L|ENDOV_ENST00000517295.2_Silent_p.L151L	NM_173627.3	NP_775898.2	Q8N8Q3	ENDOV_HUMAN	endonuclease V	223					DNA repair (GO:0006281)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|magnesium ion binding (GO:0000287)|single-stranded RNA binding (GO:0003727)|structure-specific DNA binding (GO:0043566)			endometrium(1)|lung(1)|pancreas(1)|prostate(1)	4						CTGTGCGCCTGACTTGCTGCT	0.682								Direct reversal of damage																																									0													18.0	22.0	21.0					17																	78399375		2070	4220	6290	SO:0001819	synonymous_variant	0				CCDS54172.1, CCDS54173.1, CCDS54174.1	17q25.3	2011-05-05			ENSG00000173818	ENSG00000173818			26640	protein-coding gene	gene with protein product						12853604	Standard	NM_001164638		Approved	FLJ35220	uc021ueo.1	Q8N8Q3	OTTHUMG00000164638	ENST00000518137.1:c.669G>A	17.37:g.78399375G>A			I3L3S4|Q6P2G2|Q86X99|Q8NAK0	Missense_Mutation	SNP	NULL	p.D108N	ENST00000518137.1	37	c.322	CCDS54172.1	17																																																																																			ENDOV	-	NULL	ENSG00000173818		0.682	ENDOV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENDOV	HGNC	protein_coding	OTTHUMT00000379487.1	-	0.00	29	0	G	NM_173627		78399375	+1	tier1	-	no_errors	ENST00000520484	ensembl	human	known	74_37	missense	35.06	50	27	SNP	0.952	A
Unknown	0	genome.wustl.edu	37	13	47038950	47038950	+	IGR	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr13:47038950G>A								RP11-189B4.6 (5630 upstream) : LRCH1 (88352 downstream)																							gcagtctaccggagcctaagg	0.517																																																	0																																										SO:0001628	intergenic_variant	0																															13.37:g.47038950G>A				RNA	SNP	-	NULL		37	NULL		13																																																																																			RP11-189B4.6	-	-	ENSG00000231817	0	0.517					ENSG00000231817	Clone_based_vega_gene			-	0.00	24	0	G			47038950	-1	tier1	-	no_errors	ENST00000593640	ensembl	human	known	74_37	rna	45.45	6	5	SNP	0.154	A
RP11-423O2.5	0	genome.wustl.edu	37	1	142803527	142803527	+	lincRNA	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:142803527A>C	ENST00000423385.1	-	0	1438																											CTTTTTCTTTAATAGATGTTG	0.269																																																	0																																												0																															1.37:g.142803527A>C				RNA	SNP	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			RP11-423O2.5	-	-	ENSG00000234978		0.269	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	Clone_based_vega_gene	lincRNA	OTTHUMT00000193203.1	-	0.00	834	0	A			142803527	-1	tier1	-	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	6.01	547	35	SNP	0.184	C
LOC100507537	100507537	genome.wustl.edu	37	3	155011551	155011551	+	lincRNA	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:155011551G>A	ENST00000489090.1	-	0	13				RP11-451G4.3_ENST00000470024.1_lincRNA	NR_037902.1																						GCTGCCAATTGTCTGCAGAGT	0.443																																																	0																																												0																															3.37:g.155011551G>A				RNA	SNP	-	NULL	ENST00000489090.1	37	NULL		3																																																																																			RP11-451G4.3	-	-	ENSG00000242790		0.443	RP11-451G4.2-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000242790	Clone_based_vega_gene	lincRNA	OTTHUMT00000351109.1	-	0.00	11	0	G			155011551	+1	tier1	-	no_errors	ENST00000470024	ensembl	human	known	74_37	rna	33.33	10	5	SNP	1.000	A
CTB-52I2.4	0	genome.wustl.edu	37	19	18142240	18142240	+	RNA	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:18142240G>A	ENST00000594957.3	+	0	1001																											CCATGAGGGCGGCAATGTAAG	0.547																																																	0																																												0																															19.37:g.18142240G>A				RNA	SNP	-	NULL	ENST00000594957.3	37	NULL		19																																																																																			CTB-52I2.4	-	-	ENSG00000268032		0.547	CTB-52I2.4-002	KNOWN	basic	processed_transcript	ENSG00000268032	Clone_based_vega_gene	pseudogene	OTTHUMT00000466852.4	-	0.00	33	0	G			18142240	+1	tier1	-	no_errors	ENST00000594957	ensembl	human	known	74_37	rna	28.57	10	4	SNP	1.000	A
EPHA8	2046	genome.wustl.edu	37	1	22913120	22913120	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:22913120C>T	ENST00000166244.3	+	4	1043	c.971C>T	c.(970-972)gCc>gTc	p.A324V	EPHA8_ENST00000374644.4_Missense_Mutation_p.A324V|EPHA8_ENST00000538803.1_Missense_Mutation_p.A324V	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	324	Cys-rich.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCGTCCTCAGCCTGCACCCGT	0.672																																																	0													41.0	41.0	41.0					1																	22913120		2203	4300	6503	SO:0001583	missense	0			BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.971C>T	1.37:g.22913120C>T	ENSP00000166244:p.Ala324Val		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.A324V	ENST00000166244.3	37	c.971	CCDS225.1	1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.944922	0.92593	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;D;D	0.97378	-0.87;-4.36;-4.36	4.05	4.05	0.47172	.	0.141721	0.48286	D	0.000190	D	0.97219	0.9091	M	0.79926	2.475	0.43508	D	0.995764	P;P	0.44521	0.501;0.837	B;P	0.47864	0.058;0.559	D	0.98068	1.0397	10	0.72032	D	0.01	.	15.3	0.73940	0.0:1.0:0.0:0.0	.	324;324	P29322;P29322-2	EPHA8_HUMAN;.	V	324	ENSP00000166244:A324V;ENSP00000363775:A324V;ENSP00000440274:A324V	ENSP00000166244:A324V	A	+	2	0	EPHA8	22785707	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.603000	0.82811	2.265000	0.75225	0.455000	0.32223	GCC	EPHA8	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Growth_fac_rcpt_N_dom	ENSG00000070886		0.672	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA8	HGNC	protein_coding	OTTHUMT00000008085.1	-	0.00	89	0	C	NM_020526		22913120	+1	tier1	-	no_errors	ENST00000166244	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
EPHA10	284656	genome.wustl.edu	37	1	38219911	38219911	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:38219911C>T	ENST00000373048.4	-	4	981	c.982G>A	c.(982-984)Gac>Aac	p.D328N	EPHA10_ENST00000427468.2_Missense_Mutation_p.D328N|EPHA10_ENST00000446149.2_Intron|EPHA10_ENST00000540011.1_5'Flank|EPHA10_ENST00000330210.7_Intron	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	328					ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAGGGCGGGTCGGTGGGTGAG	0.701																																																	0													20.0	28.0	25.0					1																	38219911		1976	4106	6082	SO:0001583	missense	0			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.982G>A	1.37:g.38219911C>T	ENSP00000362139:p.Asp328Asn		A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.D328N	ENST00000373048.4	37	c.982	CCDS41305.1	1	.	.	.	.	.	.	.	.	.	.	c	34	5.402129	0.96030	.	.	ENSG00000183317	ENST00000427468;ENST00000373048	T;T	0.79845	-1.31;-1.31	3.95	3.95	0.45737	.	2.092330	0.02951	N	0.141745	D	0.92328	0.7566	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.82420	-0.0466	10	0.87932	D	0	.	15.2034	0.73159	0.0:1.0:0.0:0.0	.	328	Q5JZY3	EPHAA_HUMAN	N	328	ENSP00000397746:D328N;ENSP00000362139:D328N	ENSP00000362139:D328N	D	-	1	0	EPHA10	37992498	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.644000	0.74338	2.050000	0.60909	0.487000	0.48397	GAC	EPHA10	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Growth_fac_rcpt_N_dom	ENSG00000183317		0.701	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	EPHA10	HGNC	protein_coding	OTTHUMT00000012497.2	-	0.00	160	0	C	NM_173641		38219911	-1	tier1	-	no_errors	ENST00000427468	ensembl	human	known	74_37	missense	9.15	149	15	SNP	0.999	T
ERC2	26059	genome.wustl.edu	37	3	55543760	55543760	+	3'UTR	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:55543760T>G	ENST00000288221.6	-	0	4713				ERC2_ENST00000486496.1_5'UTR	NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		AGGTCCAGAGTTAATTGCACC	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.*1584A>C	3.37:g.55543760T>G			Q2T9F6|Q86TK4	RNA	SNP	-	NULL	ENST00000288221.6	37	NULL	CCDS46851.1	3																																																																																			ERC2	-	-	ENSG00000187672		0.378	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	47	0	T	NM_015576		55543760	-1	tier1	-	no_errors	ENST00000484530	ensembl	human	known	74_37	rna	19.05	34	8	SNP	1.000	G
ETV6	2120	genome.wustl.edu	37	12	12022497	12022497	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:12022497C>T	ENST00000396373.4	+	5	877	c.603C>T	c.(601-603)ctC>ctT	p.L201L		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	201					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				AGCGGCCCCTCCGGTCCCCCC	0.632			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																			Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	0													130.0	147.0	142.0					12																	12022497		2203	4300	6503	SO:0001819	synonymous_variant	0			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.603C>T	12.37:g.12022497C>T			A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Silent	SNP	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.L201	ENST00000396373.4	37	c.603	CCDS8643.1	12																																																																																			ETV6	-	NULL	ENSG00000139083		0.632	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV6	HGNC	protein_coding	OTTHUMT00000400130.2	-	0.00	22	0	C	NM_001987		12022497	+1	tier1	-	no_errors	ENST00000396373	ensembl	human	known	74_37	silent	23.33	23	7	SNP	0.914	T
EVPLL	645027	genome.wustl.edu	37	17	18284967	18284967	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:18284967C>T	ENST00000399134.4	+	4	627	c.269C>T	c.(268-270)gCc>gTc	p.A90V	RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like	90										NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GAGTACTGTGCCCTGTACGAG	0.632																																																	0													143.0	130.0	134.0					17																	18284967		692	1591	2283	SO:0001583	missense	0				CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.269C>T	17.37:g.18284967C>T	ENSP00000382086:p.Ala90Val		B4DPD4	Missense_Mutation	SNP	NULL	p.A90V	ENST00000399134.4	37	c.269	CCDS45626.1	17	.	.	.	.	.	.	.	.	.	.	.	12.17	1.857923	0.32791	.	.	ENSG00000214860	ENST00000399134	T	0.19532	2.14	.	.	.	.	.	.	.	.	T	0.09818	0.0241	L	0.27053	0.805	0.21950	N	0.999454	P	0.41041	0.736	B	0.28784	0.094	T	0.22068	-1.0227	8	0.56958	D	0.05	.	3.3254	0.07064	0.4581:0.5417:1.0E-4:1.0E-4	.	90	A8MZ36	EVPLL_HUMAN	V	90	ENSP00000382086:A90V	ENSP00000382086:A90V	A	+	2	0	EVPLL	18225692	0.870000	0.30015	0.970000	0.41538	0.179000	0.23085	0.687000	0.25407	0.432000	0.26286	0.074000	0.15403	GCC	EVPLL	-	NULL	ENSG00000214860		0.632	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EVPLL	HGNC	protein_coding	OTTHUMT00000130836.2		0.00	66	0	C	NM_001145127		18284967	+1			no_errors	ENST00000399134	ensembl	human	novel	74_37	missense	9.09	40	4	SNP	0.998	T
EYS	346007	genome.wustl.edu	37	6	64430573	64430573	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:64430573delA	ENST00000370621.3	-	44	9943	c.9417delT	c.(9415-9417)tttfs	p.F3139fs	EYS_ENST00000370616.2_Frame_Shift_Del_p.F3139fs|EYS_ENST00000503581.1_Frame_Shift_Del_p.F3118fs			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	3139	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTGGTTCCTGAAAAAATACAA	0.284																																																	0													75.0	68.0	70.0					6																	64430573		692	1586	2278	SO:0001589	frameshift_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.9417delT	6.37:g.64430573delA	ENSP00000359655:p.Phe3139fs		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Frame_Shift_Del	DEL	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.Q3140fs	ENST00000370621.3	37	c.9417		6																																																																																			EYS	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000188107		0.284	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3		0.00	83	0	A	XM_294050		64430573	-1	tier1		no_errors	ENST00000370616	ensembl	human	known	74_37	frame_shift_del	22.73	34	10	DEL	1.000	-
EYA4	2070	genome.wustl.edu	37	6	133595940	133595940	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:133595940A>C	ENST00000367895.5	+	2	486	c.22A>C	c.(22-24)Aat>Cat	p.N8H	EYA4_ENST00000355286.6_Missense_Mutation_p.N8H|EYA4_ENST00000525849.1_Missense_Mutation_p.N8H|EYA4_ENST00000531901.1_Missense_Mutation_p.N8H|EYA4_ENST00000430974.2_Missense_Mutation_p.N8H|EYA4_ENST00000452339.2_Missense_Mutation_p.N8H|EYA4_ENST00000355167.3_Missense_Mutation_p.N8H|EYA4_ENST00000431403.2_Missense_Mutation_p.N8H	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	8					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CCAGGATTTAAATGAACAATC	0.353																																					Melanoma(57;398 1237 3528 4702 7415)												0													97.0	101.0	100.0					6																	133595940		2203	4300	6503	SO:0001583	missense	0			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.22A>C	6.37:g.133595940A>C	ENSP00000356870:p.Asn8His		B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.N8H	ENST00000367895.5	37	c.22	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	A	19.23	3.787282	0.70337	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D;D	0.90324	-2.61;-2.56;-2.65;-2.65;-2.65;-2.65;-2.65;-2.65	5.74	5.74	0.90152	.	0.251736	0.33670	N	0.004669	D	0.87649	0.6230	N	0.19112	0.55	0.32768	N	0.504164	B;D;D;D;B;B	0.60575	0.32;0.988;0.966;0.988;0.32;0.115	B;D;D;D;B;B	0.69654	0.124;0.965;0.965;0.965;0.124;0.176	D	0.88680	0.3201	10	0.49607	T	0.09	-0.0858	12.4274	0.55556	1.0:0.0:0.0:0.0	.	8;8;8;8;8;8	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	H	8	ENSP00000395916:N8H;ENSP00000388670:N8H;ENSP00000356870:N8H;ENSP00000347294:N8H;ENSP00000347434:N8H;ENSP00000432770:N8H;ENSP00000433219:N8H;ENSP00000404558:N8H	ENSP00000347294:N8H	N	+	1	0	EYA4	133637633	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.186000	0.65082	2.187000	0.69744	0.528000	0.53228	AAT	EYA4	-	NULL	ENSG00000112319		0.353	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	HGNC	protein_coding	OTTHUMT00000042282.2	-	0.00	110	0	A	NM_004100		133595940	+1	tier1	-	no_errors	ENST00000355167	ensembl	human	known	74_37	missense	16.92	54	11	SNP	1.000	C
FAM120A	23196	genome.wustl.edu	37	9	96324520	96324520	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:96324520G>T	ENST00000277165.6	+	17	3173	c.2979G>T	c.(2977-2979)gtG>gtT	p.V993V	FAM120A_ENST00000333936.5_Silent_p.V1021V|FAM120A_ENST00000340893.4_Silent_p.V947V	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	993	RNA binding.					cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CCACCCCAGTGATTAGAACAT	0.378																																																	0													149.0	131.0	137.0					9																	96324520		2203	4300	6503	SO:0001819	synonymous_variant	0			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.2979G>T	9.37:g.96324520G>T			A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Silent	SNP	NULL	p.V1021	ENST00000277165.6	37	c.3063	CCDS6706.1	9																																																																																			FAM120A	-	NULL	ENSG00000048828		0.378	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	-	0.00	89	0	G	NM_014612		96324520	+1	tier1	-	no_errors	ENST00000333936	ensembl	human	known	74_37	silent	5.26	72	4	SNP	1.000	T
FAM171A1	221061	genome.wustl.edu	37	10	15325921	15325921	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:15325921G>A	ENST00000378116.4	-	2	287	c.281C>T	c.(280-282)gCc>gTc	p.A94V		NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	94						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TGGCACGTAGGCATGCTTCGA	0.552																																																	0													115.0	94.0	102.0					10																	15325921		2203	4300	6503	SO:0001583	missense	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.281C>T	10.37:g.15325921G>A	ENSP00000367356:p.Ala94Val		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.A94V	ENST00000378116.4	37	c.281	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187499	0.78789	.	.	ENSG00000148468	ENST00000378116;ENST00000378114;ENST00000396781;ENST00000455654	T;T	0.34275	1.37;1.37	5.07	4.14	0.48551	.	0.110151	0.64402	D	0.000008	T	0.53400	0.1794	L	0.51422	1.61	0.50313	D	0.99986	D	0.71674	0.998	D	0.69307	0.963	T	0.58244	-0.7670	10	0.87932	D	0	-21.0077	15.6906	0.77450	0.0:0.1375:0.8625:0.0	.	94	Q5VUB5	F1711_HUMAN	V	94;94;95;94	ENSP00000367356:A94V;ENSP00000407796:A94V	ENSP00000367354:A94V	A	-	2	0	FAM171A1	15365927	1.000000	0.71417	0.978000	0.43139	0.803000	0.45373	5.690000	0.68241	1.219000	0.43474	0.591000	0.81541	GCC	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.552	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1		0.00	45	0	G	XM_167709		15325921	-1			no_errors	ENST00000378116	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	A
FAM26E	254228	genome.wustl.edu	37	6	116833249	116833249	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:116833249C>T	ENST00000368599.3	+	1	441	c.390C>T	c.(388-390)agC>agT	p.S130S	TRAPPC3L_ENST00000368602.3_Intron|TRAPPC3L_ENST00000356128.4_Intron	NM_153711.2	NP_714922.1	Q8N5C1	FA26E_HUMAN	family with sequence similarity 26, member E	130					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7		all_cancers(87;0.0608)|all_epithelial(87;0.05)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0242)|all cancers(137;0.0419)|OV - Ovarian serous cystadenocarcinoma(136;0.0671)|Epithelial(106;0.212)		GTGCCATGAGCGGGACGAGAA	0.498																																																	0													58.0	55.0	56.0					6																	116833249		2203	4300	6503	SO:0001819	synonymous_variant	0			BC032556	CCDS5108.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000178033	ENSG00000178033			21568	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 188"""	C6orf188			Standard	NM_153711		Approved	dJ493F7.3, MGC45451	uc003pwy.3	Q8N5C1	OTTHUMG00000015442	ENST00000368599.3:c.390C>T	6.37:g.116833249C>T			B2RDJ9|B3KSR3	Silent	SNP	NULL	p.S130	ENST00000368599.3	37	c.390	CCDS5108.1	6																																																																																			FAM26E	-	NULL	ENSG00000178033		0.498	FAM26E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM26E	HGNC	protein_coding	OTTHUMT00000041956.1	-	0.00	67	0	C	NM_153711		116833249	+1	tier1	-	no_errors	ENST00000368599	ensembl	human	known	74_37	silent	17.14	29	6	SNP	0.847	T
FAM90A1	55138	genome.wustl.edu	37	12	8376111	8376111	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:8376111G>A	ENST00000538603.1	-	6	924	c.366C>T	c.(364-366)tcC>tcT	p.S122S	FAM90A1_ENST00000307435.6_Silent_p.S122S	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	122							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		GAGGTTTCCTGGAAAATATGT	0.547													.|||	2	0.000399361	0.0	0.0029	5008	,	,		16708	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001819	synonymous_variant	0			AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.366C>T	12.37:g.8376111G>A			D3DUU9|Q9NVZ6	Silent	SNP	NULL	p.S122	ENST00000538603.1	37	c.366	CCDS31738.1	12																																																																																			FAM90A1	-	NULL	ENSG00000171847		0.547	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM90A1	HGNC	protein_coding	OTTHUMT00000400468.1	-	0.00	342	0	G	NM_018088		8376111	-1	tier1	rs138311120	no_errors	ENST00000307435	ensembl	human	known	74_37	silent	7.18	181	14	SNP	0.000	A
FASTKD1	79675	genome.wustl.edu	37	2	170402728	170402728	+	Splice_Site	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:170402728C>T	ENST00000453153.2	-	8	2047	c.1701G>A	c.(1699-1701)aaG>aaA	p.K567K	FASTKD1_ENST00000453929.2_Splice_Site_p.K567K	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	567					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						TAAATTTCACCTTTTCAATCT	0.348																																																	0													32.0	35.0	34.0					2																	170402728		2200	4294	6494	SO:0001630	splice_region_variant	0			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.1701+1G>A	2.37:g.170402728C>T			Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Silent	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.K567	ENST00000453153.2	37	c.1701	CCDS33318.1	2																																																																																			FASTKD1	-	NULL	ENSG00000138399		0.348	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FASTKD1	HGNC	protein_coding	OTTHUMT00000337788.2	-	0.00	60	0	C	NM_024622	Silent	170402728	-1	tier1	-	no_errors	ENST00000453153	ensembl	human	known	74_37	silent	19.23	21	5	SNP	1.000	T
FCF1	51077	genome.wustl.edu	37	14	75182772	75182772	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:75182772C>T	ENST00000341162.4	+	4	316	c.262C>T	c.(262-264)Cag>Tag	p.Q88*	AREL1_ENST00000557401.1_5'Flank|AC007956.1_ENST00000338772.5_5'Flank|AREL1_ENST00000356357.4_5'Flank|FCF1_ENST00000534938.2_Nonsense_Mutation_p.Q76*|FCF1_ENST00000553615.1_Nonsense_Mutation_p.Q73*	NM_015962.4	NP_057046.1	Q9Y324	FCF1_HUMAN	FCF1 rRNA-processing protein	88	PINc.				rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.0037)		GGACTTAGTGCAGTCAATGAT	0.353																																																	0													117.0	112.0	114.0					14																	75182772		2203	4300	6503	SO:0001587	stop_gained	0			AF132969	CCDS9832.1	14q24.2	2013-05-03	2013-05-03	2007-01-30	ENSG00000119616	ENSG00000119616			20220	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 111"", ""FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)"""	C14orf111		16762320	Standard	XR_245690		Approved	CGI-35, Bka, UTP24	uc001xqh.3	Q9Y324		ENST00000341162.4:c.262C>T	14.37:g.75182772C>T	ENSP00000344393:p.Gln88*		Q86TW8|Q8TBL8	Nonsense_Mutation	SNP	pfam_Fcf1/Utp23,smart_PIN_dom	p.Q88*	ENST00000341162.4	37	c.262	CCDS9832.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.750395	0.96890	.	.	ENSG00000119616	ENST00000341162;ENST00000534938;ENST00000553615	.	.	.	5.44	5.44	0.79542	.	0.047499	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4587	0.94906	0.0:1.0:0.0:0.0	.	.	.	.	X	88;76;73	.	ENSP00000344393:Q88X	Q	+	1	0	FCF1	74252525	1.000000	0.71417	0.923000	0.36655	0.991000	0.79684	7.548000	0.82154	2.828000	0.97474	0.655000	0.94253	CAG	FCF1	-	smart_PIN_dom	ENSG00000119616		0.353	FCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCF1	HGNC	protein_coding	OTTHUMT00000413622.1	-	0.00	26	0	C	NM_015962		75182772	+1	tier1	-	no_errors	ENST00000341162	ensembl	human	known	74_37	nonsense	14.81	23	4	SNP	1.000	T
FCHO1	23149	genome.wustl.edu	37	19	17877516	17877516	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:17877516C>T	ENST00000596536.1	+	7	516	c.233C>T	c.(232-234)tCg>tTg	p.S78L	FCHO1_ENST00000252771.7_Missense_Mutation_p.S78L|FCHO1_ENST00000594202.1_Missense_Mutation_p.S78L|FCHO1_ENST00000595033.1_Missense_Mutation_p.S28L|FCHO1_ENST00000389133.4_Missense_Mutation_p.S78L|FCHO1_ENST00000600676.1_Missense_Mutation_p.S78L|FCHO1_ENST00000539407.1_Missense_Mutation_p.S78L|FCHO1_ENST00000596951.1_Missense_Mutation_p.S78L|FCHO1_ENST00000597512.1_Missense_Mutation_p.S85L	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	78	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.|Mediates membrane-binding.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CGCGTCTCCTCGGACAAGCTG	0.637																																																	0													52.0	43.0	46.0					19																	17877516		2203	4300	6503	SO:0001583	missense	0			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.233C>T	19.37:g.17877516C>T	ENSP00000470731:p.Ser78Leu		A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,superfamily_Clathrin_mu_C,smart_FCH_dom,pfscan_FCH_dom	p.S78L	ENST00000596536.1	37	c.233	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878535	0.72294	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.38401	1.14;1.14;1.14	5.05	5.05	0.67936	Fps/Fes/Fer/CIP4 homology (3);	0.236984	0.37437	N	0.002086	T	0.23846	0.0577	N	0.15975	0.35	0.45648	D	0.998579	B;B;B	0.33512	0.365;0.415;0.152	B;B;B	0.34242	0.098;0.178;0.077	T	0.07986	-1.0744	10	0.32370	T	0.25	-8.2557	13.9458	0.64084	0.0:1.0:0.0:0.0	.	28;78;78	B4E120;O14526;O14526-2	.;FCHO1_HUMAN;.	L	78	ENSP00000252771:S78L;ENSP00000373785:S78L;ENSP00000437978:S78L	ENSP00000252771:S78L	S	+	2	0	FCHO1	17738516	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	5.421000	0.66447	2.361000	0.80049	0.555000	0.69702	TCG	FCHO1	-	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	ENSG00000130475		0.637	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	-	0.00	50	0	C	NM_015122		17877516	+1	tier1	-	no_errors	ENST00000252771	ensembl	human	known	74_37	missense	25.64	29	10	SNP	0.998	T
FERMT3	83706	genome.wustl.edu	37	11	63987724	63987724	+	Missense_Mutation	SNP	G	G	A	rs150164798		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:63987724G>A	ENST00000279227.5	+	11	1344	c.1249G>A	c.(1249-1251)Ggc>Agc	p.G417S	FERMT3_ENST00000345728.5_Missense_Mutation_p.G413S	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	417	FERM.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						TAACGTCTCCGGCCAGAAGTT	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18348	0.0		0.0	False		,,,				2504	0.0																0								G	SER/GLY,SER/GLY	3,4399	6.2+/-15.9	0,3,2198	283.0	283.0	283.0		1237,1249	3.5	0.8	11	dbSNP_134	283	0,8594		0,0,4297	no	missense,missense	FERMT3	NM_031471.5,NM_178443.2	56,56	0,3,6495	AA,AG,GG		0.0,0.0682,0.0231	benign,benign	413/664,417/668	63987724	3,12993	2201	4297	6498	SO:0001583	missense	0			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1249G>A	11.37:g.63987724G>A	ENSP00000279227:p.Gly417Ser		Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	pfam_FERM_central,pfam_Pleckstrin_homology,superfamily_FERM_central,smart_Band_41_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G417S	ENST00000279227.5	37	c.1249	CCDS8060.1	11	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354656	0.41700	6.82E-4	0.0	ENSG00000149781	ENST00000345728;ENST00000279227	T;T	0.74421	-0.84;-0.84	4.36	3.45	0.39498	Band 4.1 domain (1);FERM central domain (1);Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.297787	0.30639	N	0.009185	T	0.59609	0.2206	L	0.35341	1.055	0.44085	D	0.996844	B;B	0.10296	0.0;0.003	B;B	0.11329	0.002;0.006	T	0.54268	-0.8319	10	0.36615	T	0.2	-23.7559	6.7295	0.23375	0.0935:0.0:0.7306:0.1758	.	413;417	Q86UX7-2;Q86UX7	.;URP2_HUMAN	S	413;417	ENSP00000339950:G413S;ENSP00000279227:G417S	ENSP00000279227:G417S	G	+	1	0	FERMT3	63744300	0.995000	0.38212	0.811000	0.32455	0.849000	0.48306	3.530000	0.53539	1.179000	0.42884	0.561000	0.74099	GGC	FERMT3	-	pfam_FERM_central,pfam_Pleckstrin_homology,smart_Band_41_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000149781		0.612	FERMT3-001	KNOWN	basic|CCDS	protein_coding	FERMT3	HGNC	protein_coding	OTTHUMT00000396297.1	-	0.00	24	0	G	NM_031471		63987724	+1	tier1	rs150164798	no_errors	ENST00000279227	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.943	A
FGF3	2248	genome.wustl.edu	37	11	69625251	69625251	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:69625251C>T	ENST00000334134.2	-	3	632	c.542G>A	c.(541-543)cGc>cAc	p.R181H		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	181					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			GTCCAGCACGCGGGGCAGGAA	0.687																																																	0													22.0	24.0	23.0					11																	69625251		2190	4268	6458	SO:0001583	missense	0				CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.542G>A	11.37:g.69625251C>T	ENSP00000334122:p.Arg181His		Q0VG69	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.R181H	ENST00000334134.2	37	c.542	CCDS8195.1	11	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849693	0.91277	.	.	ENSG00000186895	ENST00000334134	T	0.69435	-0.4	4.01	4.01	0.46588	.	0.055897	0.64402	D	0.000002	T	0.73713	0.3622	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.73244	-0.4044	9	.	.	.	.	16.1475	0.81580	0.0:1.0:0.0:0.0	.	181	P11487	FGF3_HUMAN	H	181	ENSP00000334122:R181H	.	R	-	2	0	FGF3	69334432	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.414000	0.66405	1.763000	0.52060	0.462000	0.41574	CGC	FGF3	-	superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam	ENSG00000186895		0.687	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF3	HGNC	protein_coding	OTTHUMT00000396835.1	-	0.00	112	0	C	NM_005247		69625251	-1	tier1	rs148203315	no_errors	ENST00000334134	ensembl	human	known	74_37	missense	25.00	66	22	SNP	1.000	T
FLRT2	23768	genome.wustl.edu	37	14	86089254	86089254	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:86089254G>T	ENST00000330753.4	+	2	2163	c.1396G>T	c.(1396-1398)Gtt>Ttt	p.V466F	FLRT2_ENST00000554746.1_Missense_Mutation_p.V466F	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	466	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		AGGGGGCATCGTTCAGGAGCG	0.498																																																	0													118.0	104.0	109.0					14																	86089254		2203	4300	6503	SO:0001583	missense	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1396G>T	14.37:g.86089254G>T	ENSP00000332879:p.Val466Phe		A0AV84|B7ZLP3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.V466F	ENST00000330753.4	37	c.1396	CCDS9877.1	14	.	.	.	.	.	.	.	.	.	.	G	16.26	3.074370	0.55646	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.57595	0.39;0.39	6.17	6.17	0.99709	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.185726	0.45867	D	0.000339	T	0.43255	0.1239	L	0.29908	0.895	0.40469	D	0.980323	P	0.38992	0.653	B	0.36989	0.238	T	0.44174	-0.9345	10	0.54805	T	0.06	-17.768	14.9567	0.71120	0.0674:0.0:0.9326:0.0	.	466	O43155	FLRT2_HUMAN	F	466;466;119	ENSP00000332879:V466F;ENSP00000451050:V466F	ENSP00000332879:V466F	V	+	1	0	FLRT2	85159007	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	3.319000	0.51983	2.941000	0.99782	0.655000	0.94253	GTT	FLRT2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000185070		0.498	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	-	0.00	74	0	G			86089254	+1	tier1	-	no_errors	ENST00000330753	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.971	T
FMN2	56776	genome.wustl.edu	37	1	240255871	240255871	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:240255871C>T	ENST00000319653.9	+	1	692	c.462C>T	c.(460-462)gtC>gtT	p.V154V		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	154					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGGCTAGGGTCGGGGGCCGGC	0.662																																																	0													22.0	27.0	25.0					1																	240255871		2203	4300	6503	SO:0001819	synonymous_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.462C>T	1.37:g.240255871C>T			B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.V154	ENST00000319653.9	37	c.462	CCDS31069.2	1																																																																																			FMN2	-	NULL	ENSG00000155816		0.662	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	58	0	C	XM_371352		240255871	+1	tier1	-	no_errors	ENST00000319653	ensembl	human	known	74_37	silent	22.86	27	8	SNP	0.005	T
FREM1	158326	genome.wustl.edu	37	9	14788929	14788929	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:14788929C>T	ENST00000380880.3	-	23	4948	c.4165G>A	c.(4165-4167)Gac>Aac	p.D1389N	FREM1_ENST00000422223.2_Missense_Mutation_p.D1389N|FREM1_ENST00000380881.4_Missense_Mutation_p.D1390N			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1389					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTTTCCATGTCCTTGATGGTG	0.448																																																	0													91.0	89.0	89.0					9																	14788929		1944	4122	6066	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.4165G>A	9.37:g.14788929C>T	ENSP00000370262:p.Asp1389Asn		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.D1390N	ENST00000380880.3	37	c.4168	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912422	0.52439	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.29142	1.58;1.58;1.58	5.79	3.93	0.45458	.	0.258932	0.44097	N	0.000493	T	0.20210	0.0486	L	0.28274	0.84	0.53688	D	0.999973	B	0.06786	0.001	B	0.08055	0.003	T	0.04522	-1.0945	10	0.18710	T	0.47	-9.5453	11.523	0.50562	0.0:0.8067:0.1259:0.0675	.	1389	Q5H8C1	FREM1_HUMAN	N	1390;1389;1389	ENSP00000370263:D1390N;ENSP00000412940:D1389N;ENSP00000370262:D1389N	ENSP00000370262:D1389N	D	-	1	0	FREM1	14778929	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	2.267000	0.43329	0.773000	0.33404	0.655000	0.94253	GAC	FREM1	-	NULL	ENSG00000164946		0.448	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	-	0.00	113	0	C	NM_144966		14788929	-1	tier1	-	no_errors	ENST00000380881	ensembl	human	known	74_37	missense	37.29	37	22	SNP	1.000	T
FRG1	2483	genome.wustl.edu	37	4	190884267	190884267	+	Missense_Mutation	SNP	G	G	T	rs373037319		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:190884267G>T	ENST00000226798.4	+	9	982	c.760G>T	c.(760-762)Gac>Tac	p.D254Y		NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	254					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATTGAAAGCCGACAGATACTG	0.299																																																	0													99.0	111.0	107.0					4																	190884267		2203	4300	6503	SO:0001583	missense	0			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.760G>T	4.37:g.190884267G>T	ENSP00000226798:p.Asp254Tyr		A8K775	Missense_Mutation	SNP	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	p.D254Y	ENST00000226798.4	37	c.760	CCDS34121.1	4	.	.	.	.	.	.	.	.	.	.	.	18.00	3.526175	0.64860	.	.	ENSG00000109536	ENST00000226798	T	0.66815	-0.23	4.0	4.0	0.46444	.	0.000000	0.85682	D	0.000000	D	0.83811	0.5335	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.87691	0.2554	10	0.87932	D	0	-19.8783	14.0213	0.64558	0.0:0.0:1.0:0.0	.	254	Q14331	FRG1_HUMAN	Y	254	ENSP00000226798:D254Y	ENSP00000226798:D254Y	D	+	1	0	FRG1	191121261	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.201000	0.95017	1.976000	0.57569	0.479000	0.44913	GAC	FRG1	-	pfam_FRG1	ENSG00000109536		0.299	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	HGNC	protein_coding	OTTHUMT00000359622.4		0.00	46	0	G	NM_004477		190884267	+1			no_errors	ENST00000226798	ensembl	human	known	74_37	missense	9.09	29	3	SNP	1.000	T
FRMD7	90167	genome.wustl.edu	37	X	131233530	131233530	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:131233530C>T	ENST00000298542.4	-	3	346	c.171G>A	c.(169-171)ctG>ctA	p.L57L	FRMD7_ENST00000464296.1_Silent_p.L57L	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	57	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					TCAAAAGCTCCAGCCAAACCT	0.338																																																	0													117.0	112.0	114.0					X																	131233530		2203	4300	6503	SO:0001819	synonymous_variant	0			AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.171G>A	X.37:g.131233530C>T			C0LLJ3|Q5JX99	Silent	SNP	pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,pfscan_FERM_domain	p.L57	ENST00000298542.4	37	c.171	CCDS35397.1	X																																																																																			FRMD7	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000165694		0.338	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD7	HGNC	protein_coding	OTTHUMT00000355031.1	-	0.00	88	0	C	NM_194277		131233530	-1	tier1	-	no_errors	ENST00000298542	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
FSCB	84075	genome.wustl.edu	37	14	44974802	44974802	+	Silent	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:44974802T>C	ENST00000340446.4	-	1	1680	c.1389A>G	c.(1387-1389)aaA>aaG	p.K463K	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	463						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CAGTGGTCTCTTTAGGTAATG	0.512																																																	0													26.0	26.0	26.0					14																	44974802		2202	4300	6502	SO:0001819	synonymous_variant	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1389A>G	14.37:g.44974802T>C			Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	NULL	p.K463	ENST00000340446.4	37	c.1389	CCDS9679.1	14																																																																																			FSCB	-	NULL	ENSG00000189139		0.512	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	-	0.00	45	0	T	NM_032135		44974802	-1	tier1	-	no_errors	ENST00000340446	ensembl	human	known	74_37	silent	30.43	16	7	SNP	0.002	C
FSIP2	401024	genome.wustl.edu	37	2	186672781	186672781	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:186672781G>A	ENST00000424728.1	+	17	18748	c.18748G>A	c.(18748-18750)Gaa>Aaa	p.E6250K	FSIP2_ENST00000343098.5_Missense_Mutation_p.E6339K			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6250										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TGCAACTATTGAAAACATAGT	0.338																																																	0													38.0	34.0	35.0					2																	186672781		1807	4066	5873	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.18748G>A	2.37:g.186672781G>A	ENSP00000401306:p.Glu6250Lys		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.E6339K	ENST00000424728.1	37	c.19015		2	.	.	.	.	.	.	.	.	.	.	G	11.64	1.699188	0.30142	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.54479	0.57;0.57	5.2	4.33	0.51752	.	0.248992	0.28354	N	0.015651	T	0.54078	0.1836	L	0.52011	1.625	0.31548	N	0.659052	.	.	.	.	.	.	T	0.63541	-0.6614	8	0.59425	D	0.04	.	9.5737	0.39445	0.0948:0.0:0.9052:0.0	.	.	.	.	K	6339;6250	ENSP00000344403:E6339K;ENSP00000401306:E6250K	ENSP00000344403:E6339K	E	+	1	0	FSIP2	186381026	1.000000	0.71417	0.951000	0.38953	0.021000	0.10359	3.228000	0.51270	1.425000	0.47237	0.585000	0.79938	GAA	FSIP2	-	NULL	ENSG00000188738		0.338	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	61	0	G	NM_173651		186672781	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	14.29	30	5	SNP	1.000	A
KCNA6	3742	genome.wustl.edu	37	12	4923630	4923630	+	3'UTR	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:4923630T>G	ENST00000433855.1	+	0	5289				GALNT8_ENST00000541339.1_3'UTR	NM_002235.3	NP_002226.1	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6						potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	CTCAAAGATCTTTCTTCTTAA	0.498										HNSCC(72;0.22)																																							0																																										SO:0001624	3_prime_UTR_variant	0			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000433855.1:c.*2833T>G	12.37:g.4923630T>G				RNA	SNP	-	NULL	ENST00000433855.1	37	NULL	CCDS8534.1	12																																																																																			GALNT8	-	-	ENSG00000130035		0.498	KCNA6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT8	HGNC	protein_coding		-	0.00	42	0	T	NM_002235		4923630	+1	tier1	-	no_errors	ENST00000541339	ensembl	human	known	74_37	rna	25.00	24	8	SNP	0.001	G
GEMIN4	50628	genome.wustl.edu	37	17	650986	650986	+	Silent	SNP	C	C	T	rs370552236		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:650986C>T	ENST00000319004.5	-	2	415	c.297G>A	c.(295-297)tcG>tcA	p.S99S	GEMIN4_ENST00000437269.1_Silent_p.S99S|GEMIN4_ENST00000576778.1_Silent_p.S88S	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	99					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TGTTGCCCACCGAGAAGAACA	0.572																																																	0								C		0,4112		0,0,2056	79.0	83.0	81.0		297	-11.3	0.0	17		81	1,8367		0,1,4183	no	coding-synonymous	GEMIN4	NM_015721.2		0,1,6239	TT,TC,CC		0.012,0.0,0.0080		99/1059	650986	1,12479	2056	4184	6240	SO:0001819	synonymous_variant	0			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.297G>A	17.37:g.650986C>T			Q9NZS7|Q9UG32|Q9Y4Q2	Silent	SNP	NULL	p.S99	ENST00000319004.5	37	c.297	CCDS45559.1	17																																																																																			GEMIN4	-	NULL	ENSG00000179409		0.572	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1	-	0.00	50	0	C	NM_015721		650986	-1	tier1	-	no_errors	ENST00000319004	ensembl	human	known	74_37	silent	34.04	31	16	SNP	0.005	T
GEN1	348654	genome.wustl.edu	37	2	17955634	17955634	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:17955634G>T	ENST00000381254.2	+	11	1382	c.1168G>T	c.(1168-1170)Ggt>Tgt	p.G390C	SMC6_ENST00000402989.1_Intron|GEN1_ENST00000317402.7_Missense_Mutation_p.G390C	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	390					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AAGAAAGCTTGGTAGCAGAAA	0.343								Homologous recombination																																									0													96.0	104.0	101.0					2																	17955634		2203	4300	6503	SO:0001583	missense	0			AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.1168G>T	2.37:g.17955634G>T	ENSP00000370653:p.Gly390Cys		Q17RS9|Q6ZN37	Missense_Mutation	SNP	pfam_XPG-I_dom,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.G390C	ENST00000381254.2	37	c.1168	CCDS1691.1	2	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664792	0.88251	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000528873;ENST00000536097	T;T;T	0.43294	0.95;0.95;1.55	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000001	T	0.49355	0.1552	M	0.72118	2.19	0.58432	D	0.999994	P	0.45569	0.861	B	0.42361	0.385	T	0.57046	-0.7878	10	0.62326	D	0.03	-20.4105	18.6291	0.91352	0.0:0.0:1.0:0.0	.	390	Q17RS7	GEN_HUMAN	C	390;390;161;27	ENSP00000318977:G390C;ENSP00000370653:G390C;ENSP00000431542:G161C	ENSP00000318977:G390C	G	+	1	0	GEN1	17819115	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	6.979000	0.76154	2.490000	0.84030	0.557000	0.71058	GGT	GEN1	-	NULL	ENSG00000178295		0.343	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GEN1	HGNC	protein_coding	OTTHUMT00000241661.2	-	0.00	84	0	G	NM_182625		17955634	+1	tier1	-	no_errors	ENST00000317402	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
GK5	256356	genome.wustl.edu	37	3	141932411	141932411	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:141932411G>A	ENST00000392993.2	-	3	425	c.274C>T	c.(274-276)Ctt>Ttt	p.L92F	GK5_ENST00000466685.3_5'UTR|GK5_ENST00000544571.1_Missense_Mutation_p.L92F	NM_001039547.2	NP_001034636.1	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)	92					glycerol catabolic process (GO:0019563)		ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			kidney(1)|large_intestine(1)|lung(7)|urinary_tract(1)	10						GAAATGCCAAGACCAACAATT	0.353																																																	0													164.0	154.0	157.0					3																	141932411		2203	4300	6503	SO:0001583	missense	0			BX648681	CCDS33871.1	3q23	2014-02-12	2006-09-21		ENSG00000175066	ENSG00000175066		"""Glycerol kinases"""	28635	protein-coding gene	gene with protein product						12477932	Standard	NM_001039547		Approved	MGC40579	uc003euq.2	Q6ZS86	OTTHUMG00000133572	ENST00000392993.2:c.274C>T	3.37:g.141932411G>A	ENSP00000418001:p.Leu92Phe		B2R9I2|D3DNG2|Q8N2A7|Q8N5E6	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C	p.L92F	ENST00000392993.2	37	c.274	CCDS33871.1	3	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135458	0.77662	.	.	ENSG00000175066	ENST00000392993;ENST00000544571	T;T	0.52526	0.66;0.66	4.97	4.97	0.65823	Carbohydrate kinase, FGGY, N-terminal (1);	0.071924	0.64402	D	0.000018	T	0.57051	0.2027	M	0.82923	2.615	0.80722	D	1	P	0.36599	0.56	B	0.38683	0.279	T	0.66252	-0.5970	10	0.87932	D	0	-16.8487	17.3671	0.87367	0.0:0.0:1.0:0.0	.	92	Q6ZS86	GLPK5_HUMAN	F	92	ENSP00000418001:L92F;ENSP00000440860:L92F	ENSP00000418001:L92F	L	-	1	0	GK5	143415101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.956000	0.76013	2.457000	0.83068	0.591000	0.81541	CTT	GK5	-	pfam_Carb_kinase_FGGY_N	ENSG00000175066		0.353	GK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK5	HGNC	protein_coding	OTTHUMT00000353999.1	-	0.00	83	0	G	NM_001039547		141932411	-1	tier1	-	no_errors	ENST00000392993	ensembl	human	known	74_37	missense	41.86	24	18	SNP	1.000	A
GPC2	221914	genome.wustl.edu	37	7	99771554	99771554	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:99771554delC	ENST00000292377.2	-	5	963	c.796delG	c.(796-798)gtcfs	p.V266fs	GPC2_ENST00000471050.1_5'UTR	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	266					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGTGAGGGGACCCCCCGGCAC	0.642																																																	0													84.0	94.0	90.0					7																	99771554		2203	4300	6503	SO:0001589	frameshift_variant	0			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.796delG	7.37:g.99771554delC	ENSP00000292377:p.Val266fs		A4D2A7	Frame_Shift_Del	DEL	pfam_Glypican	p.V266fs	ENST00000292377.2	37	c.796	CCDS5689.1	7																																																																																			GPC2	-	pfam_Glypican	ENSG00000213420		0.642	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC2	HGNC	protein_coding	OTTHUMT00000337556.1		0.00	129	0	C	NM_152742		99771554	-1			no_errors	ENST00000292377	ensembl	human	known	74_37	frame_shift_del	5.04	113	6	DEL	0.000	0
GREB1	9687	genome.wustl.edu	37	2	11720943	11720943	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:11720943C>T	ENST00000381486.2	+	7	1186	c.886C>T	c.(886-888)Cga>Tga	p.R296*	GREB1_ENST00000234142.5_Nonsense_Mutation_p.R296*|GREB1_ENST00000389825.3_Nonsense_Mutation_p.R186*|GREB1_ENST00000381483.2_Nonsense_Mutation_p.R296*|GREB1_ENST00000263834.5_Nonsense_Mutation_p.R296*	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	296						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGCCCTGCCGCGACCATCGGC	0.597																																					Ovarian(39;850 945 2785 23371 33093)												0													47.0	47.0	47.0					2																	11720943		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.886C>T	2.37:g.11720943C>T	ENSP00000370896:p.Arg296*		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase	p.R296*	ENST00000381486.2	37	c.886	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.109387	0.94292	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	.	.	.	5.57	2.39	0.29439	.	0.300127	0.26289	N	0.025227	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-41.0761	7.9819	0.30188	0.6191:0.2738:0.1071:0.0	.	.	.	.	X	296;296;186;296;296	.	ENSP00000234142:R296X	R	+	1	2	GREB1	11638394	0.930000	0.31532	0.007000	0.13788	0.064000	0.16182	1.977000	0.40589	0.233000	0.21120	0.561000	0.74099	CGA	GREB1	-	NULL	ENSG00000196208		0.597	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	-	0.00	67	0	C	NM_014668		11720943	+1	tier1	-	no_errors	ENST00000234142	ensembl	human	known	74_37	nonsense	20.00	28	7	SNP	0.061	T
ASB3	51130	genome.wustl.edu	37	2	53831861	53831861	+	IGR	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:53831861G>A								RNU6-997P (34244 upstream) : AC008064.1 (46676 downstream)																							CATGGAGGAAGGGGTGTAAAC	0.493																																																	0																																										SO:0001628	intergenic_variant	0																															2.37:g.53831861G>A				RNA	SNP	-	NULL		37	NULL		2																																																																																			GPR75-ASB3	-	-	ENSG00000115239	0	0.493					GPR75-ASB3	HGNC			-	0.00	56	0	G			53831861	-1	tier1	-	no_errors	ENST00000490794	ensembl	human	putative	74_37	rna	22.22	21	6	SNP	0.000	A
GRIA2	2891	genome.wustl.edu	37	4	158224713	158224713	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:158224713A>G	ENST00000264426.9	+	3	518	c.239A>G	c.(238-240)cAg>cGg	p.Q80R	GRIA2_ENST00000296526.7_Missense_Mutation_p.Q80R|GRIA2_ENST00000507898.1_Missense_Mutation_p.Q33R|GRIA2_ENST00000504801.1_3'UTR|GRIA2_ENST00000449365.1_Missense_Mutation_p.Q33R|GRIA2_ENST00000393815.2_Missense_Mutation_p.Q33R	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	80					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GTCTGCTCCCAGTTTTCGAGA	0.348																																																	0													96.0	95.0	96.0					4																	158224713		2203	4300	6503	SO:0001583	missense	0				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.239A>G	4.37:g.158224713A>G	ENSP00000264426:p.Gln80Arg		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q80R	ENST00000264426.9	37	c.239	CCDS43274.1	4	.	.	.	.	.	.	.	.	.	.	A	23.8	4.461247	0.84317	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000509417;ENST00000296526;ENST00000264426;ENST00000506284;ENST00000505888;ENST00000449365	T;T;T;T;T;D;T;T	0.83506	1.97;1.97;1.97;1.97;1.97;-1.73;1.97;1.97	5.8	5.8	0.92144	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89591	0.6759	L	0.59436	1.845	0.80722	D	1	D;P;D	0.71674	0.998;0.591;0.976	D;B;D	0.85130	0.997;0.416;0.98	D	0.90533	0.4497	10	0.87932	D	0	.	16.1438	0.81548	1.0:0.0:0.0:0.0	.	80;80;33	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	R	33;33;80;80;80;33;33;33	ENSP00000426845:Q33R;ENSP00000377403:Q33R;ENSP00000425217:Q80R;ENSP00000296526:Q80R;ENSP00000264426:Q80R;ENSP00000426513:Q33R;ENSP00000422038:Q33R;ENSP00000389837:Q33R	ENSP00000264426:Q80R	Q	+	2	0	GRIA2	158444163	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.297000	0.96120	2.210000	0.71456	0.528000	0.53228	CAG	GRIA2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000120251		0.348	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA2	HGNC	protein_coding	OTTHUMT00000258367.2	-	0.00	68	0	A			158224713	+1	tier1	-	no_errors	ENST00000264426	ensembl	human	known	74_37	missense	39.34	37	24	SNP	1.000	G
GRM3	2913	genome.wustl.edu	37	7	86415679	86415679	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:86415679G>A	ENST00000361669.2	+	3	1670	c.571G>A	c.(571-573)Gtg>Atg	p.V191M	GRM3_ENST00000394720.2_Missense_Mutation_p.V189M|GRM3_ENST00000536043.1_Missense_Mutation_p.V63M|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000439827.1_Missense_Mutation_p.V191M|AC005009.2_ENST00000418031.1_RNA|GRM3_ENST00000546348.1_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	191					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGCCAGGACCGTGCCCCCCGA	0.567																																					GBM(52;969 1098 3139 52280)												0													119.0	111.0	114.0					7																	86415679		2203	4300	6503	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.571G>A	7.37:g.86415679G>A	ENSP00000355316:p.Val191Met		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B	p.V191M	ENST00000361669.2	37	c.571	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647636	0.87958	.	.	ENSG00000198822	ENST00000361669;ENST00000454217;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84	5.72	5.72	0.89469	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.94059	0.8096	M	0.89968	3.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94697	0.7879	10	0.87932	D	0	.	18.8634	0.92281	0.0:0.0:1.0:0.0	.	63;191;191	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	M	191;63;63;191;189	ENSP00000355316:V191M;ENSP00000405427:V63M;ENSP00000441407:V63M;ENSP00000398767:V191M;ENSP00000378209:V189M	ENSP00000355316:V191M	V	+	1	0	GRM3	86253615	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	9.756000	0.98918	2.711000	0.92665	0.655000	0.94253	GTG	GRM3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000198822		0.567	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	-	0.00	62	0	G			86415679	+1	tier1	-	no_errors	ENST00000361669	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
GSE1	23199	genome.wustl.edu	37	16	85691066	85691066	+	Missense_Mutation	SNP	C	C	T	rs368638789		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:85691066C>T	ENST00000253458.7	+	8	1672	c.1496C>T	c.(1495-1497)gCg>gTg	p.A499V	GSE1_ENST00000393243.1_Missense_Mutation_p.A426V|GSE1_ENST00000405402.2_Missense_Mutation_p.A395V|RN7SL381P_ENST00000577658.1_RNA	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	499																	AAGTGGCTGGCGCGGCAGCGG	0.657																																																	0								C	VAL/ALA,VAL/ALA	0,4382		0,0,2191	31.0	30.0	30.0		1184,1496	5.1	1.0	16		30	1,8593		0,1,4296	no	missense,missense	KIAA0182	NM_001134473.1,NM_014615.2	64,64	0,1,6487	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	395/1114,499/1218	85691066	1,12975	2191	4297	6488	SO:0001583	missense	0			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.1496C>T	16.37:g.85691066C>T	ENSP00000253458:p.Ala499Val		D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	pfam_GSE-like	p.A499V	ENST00000253458.7	37	c.1496	CCDS10952.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.337747|5.337747	0.95758|0.95758	0.0|0.0	1.16E-4|1.16E-4	ENSG00000131149|ENSG00000131149	ENST00000405402;ENST00000253458;ENST00000393243|ENST00000412692	T;T;T|.	0.69926|.	-0.44;-0.44;-0.44|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71082|0.71082	0.3298|0.3298	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.74023|.	0.982;0.96|.	T|T	0.68895|0.68895	-0.5288|-0.5288	10|5	0.49607|.	T|.	0.09|.	-30.0247|-30.0247	18.4259|18.4259	0.90608|0.90608	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	426;499|.	Q14687-3;Q14687|.	.;GSE1_HUMAN|.	V|C	395;499;426|306	ENSP00000384839:A395V;ENSP00000253458:A499V;ENSP00000376934:A426V|.	ENSP00000253458:A499V|.	A|R	+|+	2|1	0|0	KIAA0182|KIAA0182	84248567|84248567	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.783000|5.783000	0.68982|0.68982	2.367000|2.367000	0.80283|0.80283	0.561000|0.561000	0.74099|0.74099	GCG|CGC	GSE1	-	NULL	ENSG00000131149		0.657	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSE1	HGNC	protein_coding	OTTHUMT00000325527.1	-	0.00	42	0	C	NM_014615		85691066	+1	tier1	-	no_errors	ENST00000253458	ensembl	human	known	74_37	missense	13.33	38	6	SNP	1.000	T
GTF3C3	9330	genome.wustl.edu	37	2	197629382	197629382	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:197629382G>A	ENST00000263956.3	-	18	2655	c.2566C>T	c.(2566-2568)Cga>Tga	p.R856*		NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	856					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						ATATCTCTTCGTAAGTCTAAC	0.368																																																	0													122.0	123.0	122.0					2																	197629382		2203	4300	6503	SO:0001587	stop_gained	0			AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.2566C>T	2.37:g.197629382G>A	ENSP00000263956:p.Arg856*		Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R856*	ENST00000263956.3	37	c.2566	CCDS2316.1	2	.	.	.	.	.	.	.	.	.	.	G	38	6.927799	0.97940	.	.	ENSG00000119041	ENST00000263956	.	.	.	5.1	4.21	0.49690	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-10.3324	11.8303	0.52290	0.0:0.0:0.5122:0.4878	.	.	.	.	X	856	.	ENSP00000263956:R856X	R	-	1	2	GTF3C3	197337627	0.991000	0.36638	0.995000	0.50966	0.829000	0.46940	1.042000	0.30303	1.339000	0.45563	0.591000	0.81541	CGA	GTF3C3	-	NULL	ENSG00000119041		0.368	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C3	HGNC	protein_coding	OTTHUMT00000256104.1	-	0.00	100	0	G			197629382	-1	tier1	-	no_errors	ENST00000263956	ensembl	human	known	74_37	nonsense	14.29	42	7	SNP	0.993	A
HDAC1	3065	genome.wustl.edu	37	1	32782361	32782361	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:32782361G>A	ENST00000373548.3	+	3	342	c.258G>A	c.(256-258)gaG>gaA	p.E86E	HDAC1_ENST00000373541.2_5'UTR	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	86	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E86D(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	ACATGTCGGAGTACAGCAAGC	0.507																																																	1	Substitution - Missense(1)	kidney(1)											180.0	159.0	166.0					1																	32782361		2203	4300	6503	SO:0001819	synonymous_variant	0			D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.258G>A	1.37:g.32782361G>A			Q92534	Silent	SNP	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.E86	ENST00000373548.3	37	c.258	CCDS360.1	1																																																																																			HDAC1	-	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1	ENSG00000116478		0.507	HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC1	HGNC	protein_coding	OTTHUMT00000019815.3		0.00	38	0	G	NM_004964		32782361	+1			no_errors	ENST00000373548	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.995	A
HIVEP3	59269	genome.wustl.edu	37	1	42046256	42046256	+	Silent	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:42046256T>G	ENST00000372583.1	-	4	5098	c.4213A>C	c.(4213-4215)Aga>Cga	p.R1405R	HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Silent_p.R1405R|HIVEP3_ENST00000429157.2_Silent_p.R1405R|HIVEP3_ENST00000372584.1_Silent_p.R1405R	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1405					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GTGCCTTTTCTTTCAGGTAAT	0.527																																																	0													115.0	105.0	109.0					1																	42046256		2203	4300	6503	SO:0001819	synonymous_variant	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.4213A>C	1.37:g.42046256T>G			A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1405	ENST00000372583.1	37	c.4213	CCDS463.1	1																																																																																			HIVEP3	-	NULL	ENSG00000127124		0.527	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	-	0.00	27	0	T	NM_024503		42046256	-1	tier1	-	no_errors	ENST00000247584	ensembl	human	known	74_37	silent	33.33	16	8	SNP	0.757	G
HPS1	3257	genome.wustl.edu	37	10	100195011	100195011	+	Intron	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:100195011C>T	ENST00000325103.6	-	5	632				HPS1_ENST00000467246.1_Intron|HPS1_ENST00000338546.5_Intron|HPS1_ENST00000361490.4_Intron	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1						blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		ACAGAGGGGACCAGCTTTGAA	0.582									Hermansky-Pudlak syndrome																																								0													84.0	73.0	76.0					10																	100195011		2203	4300	6503	SO:0001627	intron_variant	0	Familial Cancer Database	HPS, HPS1-8	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.398+17G>A	10.37:g.100195011C>T			A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	RNA	SNP	-	NULL	ENST00000325103.6	37	NULL	CCDS7475.1	10																																																																																			HPS1	-	-	ENSG00000107521		0.582	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS1	HGNC	protein_coding	OTTHUMT00000049776.1	-	0.00	33	0	C	NM_000195, NM_182637, NM_182638, NM_182639		100195011	-1	tier1	-	no_errors	ENST00000474873	ensembl	human	known	74_37	rna	33.33	12	6	SNP	0.002	T
HR	55806	genome.wustl.edu	37	8	21973915	21973915	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:21973915G>T	ENST00000381418.4	-	18	4885	c.3405C>A	c.(3403-3405)agC>agA	p.S1135R	HR_ENST00000312841.8_Missense_Mutation_p.S1080R	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	1135	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GCTGAGTGACGCTGACTGTGC	0.627																																																	0													133.0	86.0	102.0					8																	21973915		2203	4300	6503	SO:0001583	missense	0			AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.3405C>A	8.37:g.21973915G>T	ENSP00000370826:p.Ser1135Arg		Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S1135R	ENST00000381418.4	37	c.3405	CCDS6022.1	8	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716006	0.68844	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.72942	-0.7;-0.7	4.95	-5.06	0.02946	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.197037	0.35708	N	0.003040	T	0.73257	0.3564	L	0.57536	1.79	0.32871	D	0.509218	D;D	0.56521	0.971;0.976	P;P	0.59288	0.773;0.855	T	0.77699	-0.2490	10	0.72032	D	0.01	-2.1624	12.9063	0.58154	0.2539:0.0:0.7461:0.0	.	1080;1135	O43593-2;O43593	.;HAIR_HUMAN	R	1135;1080	ENSP00000370826:S1135R;ENSP00000326765:S1080R	ENSP00000326765:S1080R	S	-	3	2	HR	22029860	0.158000	0.22850	0.861000	0.33841	0.991000	0.79684	-1.018000	0.03626	-1.026000	0.03330	-0.136000	0.14681	AGC	HR	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000168453		0.627	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HR	HGNC	protein_coding	OTTHUMT00000214213.1	-	0.00	44	0	G			21973915	-1	tier1	-	no_errors	ENST00000381418	ensembl	human	known	74_37	missense	9.52	37	4	SNP	0.931	T
HTR3A	3359	genome.wustl.edu	37	11	113853941	113853941	+	Silent	SNP	C	C	T	rs144045043		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:113853941C>T	ENST00000504030.2	+	5	919	c.474C>T	c.(472-474)agC>agT	p.S158S	HTR3A_ENST00000506841.2_Silent_p.S158S|HTR3A_ENST00000535865.1_5'UTR|HTR3A_ENST00000375498.2_Silent_p.S164S|HTR3A_ENST00000355556.2_Silent_p.S164S|HTR3A_ENST00000299961.5_Silent_p.S143S			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	158					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	CTGCCTGTAGCCTCGACATCT	0.552																																																	0								C	,,	0,4402		0,0,2201	211.0	190.0	198.0		492,429,492	5.4	1.0	11	dbSNP_134	198	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous,coding-synonymous,coding-synonymous	HTR3A	NM_000869.5,NM_001161772.2,NM_213621.3	,,	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	,,	164/485,143/464,164/517	113853941	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	0			D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.474C>T	11.37:g.113853941C>T			B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_5HT3_rcpt_A,prints_5HT3_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.S164	ENST00000504030.2	37	c.492		11																																																																																			HTR3A	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000166736		0.552	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	HTR3A	HGNC	protein_coding	OTTHUMT00000360822.2		0.00	71	0	C	NM_000869		113853941	+1			no_errors	ENST00000355556	ensembl	human	known	74_37	silent	7.41	50	4	SNP	1.000	T
IFT74	80173	genome.wustl.edu	37	9	27062674	27062674	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:27062674G>T	ENST00000443698.1	+	20	1914	c.1743G>T	c.(1741-1743)aaG>aaT	p.K581N	IFT74_ENST00000380062.5_Missense_Mutation_p.K581N|IFT74_ENST00000433700.1_Missense_Mutation_p.K581N	NM_001099222.1	NP_001092692.1	Q96LB3	IFT74_HUMAN	intraflagellar transport 74	581					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|keratinocyte development (GO:0003334)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|nucleus (GO:0005634)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)			endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		ATGTGACCAAGCAGATTGCAG	0.383																																																	0													111.0	102.0	105.0					9																	27062674		1876	4109	5985	SO:0001583	missense	0			AK023707	CCDS43793.1, CCDS47955.1	9p21.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000096872	ENSG00000096872		"""Intraflagellar transport homologs"""	21424	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 1"""	608040	"""coiled-coil domain containing 2"", ""intraflagellar transport 74 homolog (Chlamydomonas)"""	CCDC2		11683410	Standard	NM_001099223		Approved	CMG1, CMG-1, FLJ22621	uc003zqg.4	Q96LB3	OTTHUMG00000021028	ENST00000443698.1:c.1743G>T	9.37:g.27062674G>T	ENSP00000404122:p.Lys581Asn		Q3B789|Q5VY34|Q6PGQ8|Q9H643|Q9H8G7	Missense_Mutation	SNP	NULL	p.K581N	ENST00000443698.1	37	c.1743	CCDS43793.1	9	.	.	.	.	.	.	.	.	.	.	G	18.89	3.718851	0.68844	.	.	ENSG00000096872	ENST00000433700;ENST00000443698;ENST00000380062	T;T;T	0.34859	1.34;1.34;1.34	6.04	0.577	0.17385	.	0.048722	0.85682	D	0.000000	T	0.43743	0.1261	M	0.65975	2.015	0.51233	D	0.999918	P	0.52316	0.952	P	0.51701	0.677	T	0.38993	-0.9635	10	0.45353	T	0.12	-20.8872	11.0971	0.48152	0.4621:0.0:0.5379:0.0	.	581	Q96LB3	IFT74_HUMAN	N	581	ENSP00000389224:K581N;ENSP00000404122:K581N;ENSP00000369402:K581N	ENSP00000369402:K581N	K	+	3	2	IFT74	27052674	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	0.976000	0.29462	0.170000	0.19704	-0.471000	0.05019	AAG	IFT74	-	NULL	ENSG00000096872		0.383	IFT74-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT74	HGNC	protein_coding	OTTHUMT00000055476.2	-	0.00	43	0	G	NM_025103		27062674	+1	tier1	-	no_errors	ENST00000380062	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.993	T
IL10RA	3587	genome.wustl.edu	37	11	117859096	117859096	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:117859096G>T	ENST00000227752.3	+	2	187		c.e2-1		IL10RA_ENST00000533700.1_Splice_Site|IL10RA_ENST00000545409.1_Splice_Site|IL10RA_ENST00000541785.1_Splice_Site	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha						cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		CTTCTCCCCAGGGACAGAGCT	0.532																																																	0													106.0	104.0	105.0					11																	117859096		2201	4296	6497	SO:0001630	splice_region_variant	0			U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.68-1G>T	11.37:g.117859096G>T			A8K6I0|B0YJ27	Splice_Site	SNP	-	e2-1	ENST00000227752.3	37	c.68-1	CCDS8388.1	11	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928769	0.34002	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000536858	.	.	.	5.13	3.2	0.36748	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7937	0.52084	0.0:0.342:0.658:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IL10RA	117364306	0.000000	0.05858	0.001000	0.08648	0.340000	0.28889	0.299000	0.19138	0.514000	0.28300	0.555000	0.69702	.	IL10RA	-	-	ENSG00000110324		0.532	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10RA	HGNC	protein_coding	OTTHUMT00000390167.1	-	0.00	76	0	G		Intron	117859096	+1	tier1	-	no_errors	ENST00000227752	ensembl	human	known	74_37	splice_site	7.14	65	5	SNP	0.002	T
IL13RA1	3597	genome.wustl.edu	37	X	117900499	117900499	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:117900499G>T	ENST00000371666.3	+	7	902	c.835G>T	c.(835-837)Gag>Tag	p.E279*	IL13RA1_ENST00000481868.1_3'UTR	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	279	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)	p.E279Q(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						CAAGGTCCAAGAGGCTAAATG	0.338																																																	1	Substitution - Missense(1)	lung(1)											68.0	66.0	67.0					X																	117900499		2203	4300	6503	SO:0001587	stop_gained	0			U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.835G>T	X.37:g.117900499G>T	ENSP00000360730:p.Glu279*		O95646|Q5JSL4|Q99656|Q9UDY5	Nonsense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.E279*	ENST00000371666.3	37	c.835	CCDS14573.1	X	.	.	.	.	.	.	.	.	.	.	G	11.65	1.701722	0.30142	.	.	ENSG00000131724	ENST00000371666	.	.	.	4.54	3.59	0.41128	.	1.784850	0.02826	N	0.126087	.	.	.	.	.	.	0.24516	N	0.994188	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-11.4573	5.6554	0.17640	0.156:0.0:0.844:0.0	.	.	.	.	X	279	.	ENSP00000360730:E279X	E	+	1	0	IL13RA1	117784527	1.000000	0.71417	0.295000	0.24960	0.028000	0.11728	4.150000	0.58098	2.082000	0.62665	0.459000	0.35465	GAG	IL13RA1	-	superfamily_Fibronectin_type3	ENSG00000131724		0.338	IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL13RA1	HGNC	protein_coding	OTTHUMT00000058009.1	-	0.00	78	0	G	NM_001560		117900499	+1	tier1	-	no_errors	ENST00000371666	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	0.213	T
IL22RA1	58985	genome.wustl.edu	37	1	24465107	24465107	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:24465107G>T	ENST00000270800.1	-	2	179	c.141C>A	c.(139-141)ggC>ggA	p.G47G		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	47	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		TGTCTGGGGTGCCCTCCGGCC	0.572																																																	0													102.0	97.0	98.0					1																	24465107		2203	4300	6503	SO:0001819	synonymous_variant	0			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.141C>A	1.37:g.24465107G>T			A8K839|B2R9Y9|Q9HB22	Silent	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.G47	ENST00000270800.1	37	c.141	CCDS247.1	1																																																																																			IL22RA1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000142677		0.572	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IL22RA1	HGNC	protein_coding	OTTHUMT00000008412.1	-	0.00	83	0	G			24465107	-1	tier1	-	no_errors	ENST00000270800	ensembl	human	novel	74_37	silent	8.33	44	4	SNP	0.000	T
IL6ST	3572	genome.wustl.edu	37	5	55259205	55259205	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:55259205G>T	ENST00000381298.2	-	7	1100	c.788C>A	c.(787-789)aCc>aAc	p.T263N	IL6ST_ENST00000536319.1_Missense_Mutation_p.T263N|IL6ST_ENST00000381293.2_Missense_Mutation_p.T97N|IL6ST_ENST00000381287.4_Missense_Mutation_p.T263N|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000381294.3_Missense_Mutation_p.T263N|IL6ST_ENST00000522633.2_Missense_Mutation_p.T263N|IL6ST_ENST00000336909.5_Missense_Mutation_p.T263N|IL6ST_ENST00000577363.1_5'Flank|IL6ST_ENST00000502326.3_Missense_Mutation_p.T263N	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	263	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				GGCATCTTTGGTCCTATATTG	0.333			O		hepatocellular ca																																			Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0													89.0	93.0	92.0					5																	55259205		2203	4297	6500	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.788C>A	5.37:g.55259205G>T	ENSP00000370698:p.Thr263Asn		A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T263N	ENST00000381298.2	37	c.788	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	G	11.93	1.784351	0.31593	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294;ENST00000381287;ENST00000536319;ENST00000381293;ENST00000522633;ENST00000542298	T;T;T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42;0.42;0.42	5.91	4.05	0.47172	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.879360	0.10010	N	0.727379	T	0.55970	0.1954	L	0.59436	1.845	0.26128	N	0.98046	D;B;B;B	0.55172	0.97;0.218;0.285;0.13	P;B;B;B	0.51918	0.684;0.125;0.12;0.117	T	0.40346	-0.9568	10	0.18276	T	0.48	.	8.6546	0.34055	0.1358:0.0:0.7387:0.1255	.	97;263;263;263	Q5FC05;Q5FC04;P40189-2;P40189	.;.;.;IL6RB_HUMAN	N	263;263;263;263;263;97;263;263	ENSP00000370698:T263N;ENSP00000338799:T263N;ENSP00000370694:T263N;ENSP00000370687:T263N;ENSP00000444456:T263N;ENSP00000370693:T97N;ENSP00000435399:T263N	ENSP00000338799:T263N	T	-	2	0	IL6ST	55294962	0.650000	0.27331	0.981000	0.43875	0.734000	0.41952	1.799000	0.38824	1.483000	0.48342	0.655000	0.94253	ACC	IL6ST	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134352		0.333	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	-	0.00	141	0	G	NM_002184		55259205	-1	tier1	-	no_errors	ENST00000336909	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.207	T
INSM2	84684	genome.wustl.edu	37	14	36004316	36004316	+	Silent	SNP	C	C	A	rs540516375		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:36004316C>A	ENST00000307169.3	+	1	1069	c.858C>A	c.(856-858)atC>atA	p.I286I		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	286					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I286I(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		GCTCCCGCATCGTGCGCGTAG	0.677													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15481	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	lung(1)											31.0	32.0	32.0					14																	36004316		2203	4298	6501	SO:0001819	synonymous_variant	0			AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.858C>A	14.37:g.36004316C>A			A1L432|J9Y024|Q8N8K7|Q96Q84	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I286	ENST00000307169.3	37	c.858	CCDS9657.1	14																																																																																			INSM2	-	NULL	ENSG00000168348		0.677	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSM2	HGNC	protein_coding	OTTHUMT00000276686.1		0.00	86	0	C			36004316	+1			no_errors	ENST00000307169	ensembl	human	known	74_37	silent	6.38	44	3	SNP	1.000	A
ITGA3	3675	genome.wustl.edu	37	17	48148781	48148781	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:48148781G>A	ENST00000320031.8	+	6	1188	c.858G>A	c.(856-858)caG>caA	p.Q286Q	ITGA3_ENST00000007722.7_Silent_p.Q286Q|ITGA3_ENST00000544892.1_Silent_p.Q61Q	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	286					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TGCTGAGCCAGGAGGCAGGCG	0.617																																																	0													45.0	45.0	45.0					17																	48148781		2203	4300	6503	SO:0001819	synonymous_variant	0			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.858G>A	17.37:g.48148781G>A			A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.Q286	ENST00000320031.8	37	c.858	CCDS11558.1	17																																																																																			ITGA3	-	smart_Int_alpha_beta-p	ENSG00000005884		0.617	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA3	HGNC	protein_coding	OTTHUMT00000366298.1	-	0.00	21	0	G	NM_005501		48148781	+1	tier1	-	no_errors	ENST00000320031	ensembl	human	known	74_37	silent	36.36	14	8	SNP	0.942	A
KCNA4	3739	genome.wustl.edu	37	11	30033455	30033455	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:30033455C>G	ENST00000328224.6	-	2	2004	c.771G>C	c.(769-771)aaG>aaC	p.K257N	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	257					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	ACTGATAGAACTTCACCTCCT	0.507																																																	0													86.0	78.0	80.0					11																	30033455		1876	4129	6005	SO:0001583	missense	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.771G>C	11.37:g.30033455C>G	ENSP00000328511:p.Lys257Asn			Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv1.4_TID,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.4,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.K257N	ENST00000328224.6	37	c.771	CCDS41629.1	11	.	.	.	.	.	.	.	.	.	.	C	12.40	1.925465	0.34002	.	.	ENSG00000182255	ENST00000328224	T	0.77620	-1.11	5.05	4.14	0.48551	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.75406	0.3845	L	0.53249	1.67	0.80722	D	1	P	0.46987	0.888	P	0.45881	0.496	T	0.76460	-0.2951	10	0.66056	D	0.02	.	10.0669	0.42308	0.0:0.7867:0.0:0.2133	.	257	P22459	KCNA4_HUMAN	N	257	ENSP00000328511:K257N	ENSP00000328511:K257N	K	-	3	2	KCNA4	29990031	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.259000	0.51515	1.134000	0.42165	0.655000	0.94253	AAG	KCNA4	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000182255		0.507	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	HGNC	protein_coding	OTTHUMT00000388074.2	-	0.00	54	0	C	NM_002233		30033455	-1	tier1	-	no_errors	ENST00000328224	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	G
KCNG4	93107	genome.wustl.edu	37	16	84255965	84255965	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:84255965G>A	ENST00000308251.4	-	3	1486	c.1418C>T	c.(1417-1419)gCc>gTc	p.A473V		NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	473					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						GCGGAGGCGGGCCTGAAGCTG	0.582																																																	0													97.0	102.0	101.0					16																	84255965		2200	4300	6500	SO:0001583	missense	0			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.1418C>T	16.37:g.84255965G>A	ENSP00000312129:p.Ala473Val		Q96H24	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.A473V	ENST00000308251.4	37	c.1418	CCDS10945.1	16	.	.	.	.	.	.	.	.	.	.	G	8.031	0.761670	0.15914	.	.	ENSG00000168418	ENST00000308251	D	0.96619	-4.07	5.27	3.3	0.37823	.	0.430974	0.25027	N	0.033702	D	0.92603	0.7650	L	0.54323	1.7	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	D	0.86999	0.2115	10	0.22109	T	0.4	.	6.4849	0.22083	0.1604:0.1492:0.6904:0.0	.	473	Q8TDN1	KCNG4_HUMAN	V	473	ENSP00000312129:A473V	ENSP00000312129:A473V	A	-	2	0	KCNG4	82813466	0.246000	0.23909	0.975000	0.42487	0.634000	0.38068	3.114000	0.50383	1.212000	0.43366	0.563000	0.77884	GCC	KCNG4	-	NULL	ENSG00000168418		0.582	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	HGNC	protein_coding	OTTHUMT00000269079.2	-	0.00	66	0	G	NM_172347		84255965	-1	tier1	-	no_errors	ENST00000308251	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.951	A
KCNS2	3788	genome.wustl.edu	37	8	99441400	99441400	+	Missense_Mutation	SNP	G	G	A	rs201132040		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:99441400G>A	ENST00000287042.4	+	2	1543	c.1193G>A	c.(1192-1194)gGc>gAc	p.G398D	KCNS2_ENST00000521839.1_Missense_Mutation_p.G398D	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	398					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			ATCTTGGCAGGCATCCTCGTG	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20631	0.0		0.0	False		,,,				2504	0.0				Pancreas(138;844 2489 9202 24627)												0													108.0	102.0	104.0					8																	99441400		2203	4300	6503	SO:0001583	missense	0			AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.1193G>A	8.37:g.99441400G>A	ENSP00000287042:p.Gly398Asp		A8KAN1	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv2	p.G398D	ENST00000287042.4	37	c.1193	CCDS6279.1	8	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	21.7	4.194028	0.78902	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	D;D	0.98996	-5.31;-5.31	6.07	6.07	0.98685	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	H	0.99249	4.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97338	0.9955	10	0.87932	D	0	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	398	Q9ULS6	KCNS2_HUMAN	D	398	ENSP00000287042:G398D;ENSP00000430712:G398D	ENSP00000287042:G398D	G	+	2	0	KCNS2	99510576	1.000000	0.71417	0.770000	0.31555	0.981000	0.71138	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	GGC	KCNS2	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv2	ENSG00000156486		0.577	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS2	HGNC	protein_coding	OTTHUMT00000103134.1		0.00	27	0	G	NM_020697		99441400	+1			no_errors	ENST00000287042	ensembl	human	known	74_37	missense	18.18	9	2	SNP	1.000	A
KDM3A	55818	genome.wustl.edu	37	2	86716782	86716782	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:86716782G>T	ENST00000409556.1	+	24	3938	c.3573G>T	c.(3571-3573)aaG>aaT	p.K1191N	KDM3A_ENST00000542128.1_Splice_Site_p.K1139N|KDM3A_ENST00000312912.5_Splice_Site_p.K1191N|KDM3A_ENST00000409064.1_Splice_Site_p.K1191N			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	1191	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						TTCTTAAAAAGGTGTGCTGCT	0.418																																					NSCLC(96;1150 1523 6936 46253 49736)												0													115.0	106.0	109.0					2																	86716782		2203	4300	6503	SO:0001630	splice_region_variant	0			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.3573+1G>T	2.37:g.86716782G>T			D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.K1191N	ENST00000409556.1	37	c.3573	CCDS1990.1	2	.	.	.	.	.	.	.	.	.	.	G	28.6	4.934411	0.92458	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	5.5	5.5	0.81552	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.86896	0.6043	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.992	D	0.87412	0.2376	10	0.62326	D	0.03	.	18.7421	0.91777	0.0:0.0:1.0:0.0	.	1139;1191	F5H070;Q9Y4C1	.;KDM3A_HUMAN	N	1191;1191;1191;1191;1139	ENSP00000386660:K1191N;ENSP00000323659:K1191N;ENSP00000386516:K1191N;ENSP00000438324:K1139N	ENSP00000323659:K1191N	K	+	3	2	KDM3A	86570293	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	9.869000	0.99810	2.740000	0.93945	0.650000	0.86243	AAG	KDM3A	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000115548		0.418	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2	-	0.00	44	0	G	NM_018433	Missense_Mutation	86716782	+1	tier1	-	no_errors	ENST00000312912	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	T
KDM4E	390245	genome.wustl.edu	37	11	94758839	94758839	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:94758839G>T	ENST00000450979.2	+	1	418	c.118G>T	c.(118-120)Gca>Tca	p.A40S		NM_001161630.1	NP_001155102.1	B2RXH2	KDM4E_HUMAN	lysine (K)-specific demethylase 4E	40	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(1)|lung(3)	12						GTCCCAAGGCGCACATCAAGC	0.463																																																	0													92.0	70.0	77.0					11																	94758839		692	1591	2283	SO:0001583	missense	0			BC157851	CCDS44713.1	11q21	2012-03-30	2012-03-28	2012-03-28		ENSG00000235268		"""Chromatin-modifying enzymes / K-demethylases"""	37098	protein-coding gene	gene with protein product			"""lysine (K)-specific demethylase 4D-like"""	KDM4DL		21076780	Standard	NM_001161630		Approved	JMJD2E	uc010ruf.1	B2RXH2		ENST00000450979.2:c.118G>T	11.37:g.94758839G>T	ENSP00000397239:p.Ala40Ser			Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,smart_TF_JmjN,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom	p.A40S	ENST00000450979.2	37	c.118	CCDS44713.1	11	.	.	.	.	.	.	.	.	.	.	g	14.29	2.491678	0.44249	.	.	ENSG00000235268	ENST00000450979	T	0.24151	1.87	2.18	2.18	0.27775	Transcription factor jumonji, JmjN (2);	.	.	.	.	T	0.52386	0.1731	M	0.87617	2.895	0.32152	N	0.584137	D	0.89917	1.0	D	0.97110	1.0	T	0.61987	-0.6949	9	0.52906	T	0.07	-18.7063	10.4356	0.44433	0.0:0.0:1.0:0.0	.	40	B2RXH2	KD4DL_HUMAN	S	40	ENSP00000397239:A40S	ENSP00000397239:A40S	A	+	1	0	KDM4DL	94398487	1.000000	0.71417	0.602000	0.28890	0.425000	0.31504	6.761000	0.74945	1.543000	0.49345	0.455000	0.32223	GCA	KDM4E	-	pfam_TF_JmjN,smart_TF_JmjN,pfscan_TF_JmjN	ENSG00000235268		0.463	KDM4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4E	HGNC	protein_coding	OTTHUMT00000396649.1		0.00	51	0	G	NM_001161630		94758839	+1			no_errors	ENST00000450979	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.986	T
KDM5A	5927	genome.wustl.edu	37	12	419113	419113	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:419113G>A	ENST00000399788.2	-	22	3596	c.3234C>T	c.(3232-3234)acC>acT	p.T1078T	KDM5A_ENST00000382815.4_Silent_p.T1078T	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1078					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						CACCAATGTCGGTCCGGGGGC	0.358			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0													59.0	56.0	57.0					12																	419113		1795	4068	5863	SO:0001819	synonymous_variant	0				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.3234C>T	12.37:g.419113G>A			A8MV76|Q4LE72|Q86XZ1	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.T1078	ENST00000399788.2	37	c.3234	CCDS41736.1	12																																																																																			KDM5A	-	NULL	ENSG00000073614		0.358	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	HGNC	protein_coding	OTTHUMT00000397812.1	-	0.00	89	0	G	NM_005056		419113	-1	tier1	-	no_errors	ENST00000399788	ensembl	human	known	74_37	silent	26.98	46	17	SNP	0.999	A
KIAA1147	57189	genome.wustl.edu	37	7	141365000	141365000	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:141365000C>T	ENST00000536163.1	-	6	938	c.939G>A	c.(937-939)gtG>gtA	p.V313V	RP5-894A10.6_ENST00000602609.1_RNA|KIAA1147_ENST00000482493.1_Silent_p.V209V	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	313										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					CCACATAGGACACCTCTACCT	0.607																																																	0													71.0	77.0	75.0					7																	141365000		2101	4223	6324	SO:0001819	synonymous_variant	0			AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.939G>A	7.37:g.141365000C>T			Q9ULS3	Silent	SNP	pfam_DUF2347	p.V313	ENST00000536163.1	37	c.939	CCDS47726.1	7																																																																																			KIAA1147	-	pfam_DUF2347	ENSG00000257093		0.607	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1147	HGNC	protein_coding	OTTHUMT00000349104.1	-	0.00	61	0	C			141365000	-1	tier1	-	no_errors	ENST00000536163	ensembl	human	known	74_37	silent	34.78	30	16	SNP	1.000	T
KIAA1244	57221	genome.wustl.edu	37	6	138607928	138607928	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:138607928G>T	ENST00000251691.4	+	16	2826	c.2660G>T	c.(2659-2661)aGc>aTc	p.S887I		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		ATGGCGGGGAGCTCCAAAGGG	0.557																																																	0													99.0	104.0	103.0					6																	138607928		2203	4300	6503	SO:0001583	missense	0			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.2660G>T	6.37:g.138607928G>T	ENSP00000251691:p.Ser887Ile			Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold,superfamily_Sec7_dom,smart_Sec7_dom	p.S887I	ENST00000251691.4	37	c.2660	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971058	0.92919	.	.	ENSG00000112379	ENST00000251691	T	0.20069	2.1	5.25	5.25	0.73442	.	0.075717	0.85682	D	0.000000	T	0.36276	0.0961	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	D	0.63488	0.915	T	0.10428	-1.0630	10	0.87932	D	0	-27.5742	19.037	0.92983	0.0:0.0:1.0:0.0	.	887	Q5TH69	BIG3_HUMAN	I	887	ENSP00000251691:S887I	ENSP00000251691:S887I	S	+	2	0	KIAA1244	138649621	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.017000	0.93651	2.738000	0.93877	0.655000	0.94253	AGC	KIAA1244	-	superfamily_ARM-type_fold	ENSG00000112379		0.557	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4		0.00	70	0	G	NM_020340		138607928	+1			no_errors	ENST00000251691	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	T
KIF16B	55614	genome.wustl.edu	37	20	16407773	16407773	+	Missense_Mutation	SNP	C	C	T	rs193920855		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr20:16407773C>T	ENST00000354981.2	-	15	1745	c.1588G>A	c.(1588-1590)Gtg>Atg	p.V530M	KIF16B_ENST00000378003.2_De_novo_Start_InFrame|KIF16B_ENST00000355755.3_Missense_Mutation_p.V530M|KIF16B_ENST00000408042.1_Missense_Mutation_p.V530M	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	530					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GTGGCCTCCACGATCTGAACA	0.443																																																	0													138.0	147.0	144.0					20																	16407773		2203	4300	6503	SO:0001583	missense	0			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.1588G>A	20.37:g.16407773C>T	ENSP00000347076:p.Val530Met		A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.V530M	ENST00000354981.2	37	c.1588	CCDS13122.1	20	.	.	.	.	.	.	.	.	.	.	C	9.695	1.152810	0.21371	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000408042	D;D;D	0.86627	-2.15;-2.15;-2.15	5.62	-4.12	0.03916	Forkhead-associated (FHA) domain (2);SMAD/FHA domain (1);	1.077620	0.07022	N	0.827019	T	0.74951	0.3784	L	0.31476	0.935	0.09310	N	0.999998	B;B;B;B	0.14012	0.006;0.009;0.006;0.007	B;B;B;B	0.08055	0.001;0.003;0.001;0.002	T	0.58014	-0.7711	10	0.34782	T	0.22	.	3.8204	0.08833	0.0926:0.3788:0.1824:0.3462	.	530;530;530;530	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	M	530	ENSP00000347076:V530M;ENSP00000347995:V530M;ENSP00000384164:V530M	ENSP00000347076:V530M	V	-	1	0	KIF16B	16355773	0.000000	0.05858	0.853000	0.33588	0.989000	0.77384	-0.382000	0.07408	-0.340000	0.08388	-0.247000	0.11927	GTG	KIF16B	-	pfam_FHA_dom,superfamily_SMAD_FHA_domain	ENSG00000089177		0.443	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	HGNC	protein_coding	OTTHUMT00000078104.2		0.00	86	0	C	NM_017683		16407773	-1			no_errors	ENST00000408042	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.000	T
KIAA1755	85449	genome.wustl.edu	37	20	36869864	36869864	+	Silent	SNP	T	T	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr20:36869864T>A	ENST00000279024.4	-	3	940	c.669A>T	c.(667-669)ccA>ccT	p.P223P		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	223										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CCTGGTTGTCTGGGGAGCTGG	0.587																																																	0													93.0	89.0	90.0					20																	36869864		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.669A>T	20.37:g.36869864T>A			Q9C0A8	Silent	SNP	superfamily_CRAL-TRIO_dom	p.P223	ENST00000279024.4	37	c.669	CCDS33467.1	20																																																																																			KIAA1755	-	NULL	ENSG00000149633		0.587	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	-	0.00	60	0	T	NM_001029864		36869864	-1	tier1	-	no_errors	ENST00000279024	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.000	A
KIF24	347240	genome.wustl.edu	37	9	34256881	34256881	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:34256881G>T	ENST00000402558.2	-	10	2748	c.2724C>A	c.(2722-2724)caC>caA	p.H908Q	KIF24_ENST00000379174.3_Missense_Mutation_p.H774Q|KIF24_ENST00000379166.2_Missense_Mutation_p.H908Q|KIF24_ENST00000345050.2_Missense_Mutation_p.H774Q			Q5T7B8	KIF24_HUMAN	kinesin family member 24	908					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			GGCTGCAGCTGTGATCGAGTG	0.542																																																	0													82.0	87.0	85.0					9																	34256881		2203	4300	6503	SO:0001583	missense	0			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.2724C>A	9.37:g.34256881G>T	ENSP00000384433:p.His908Gln		Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_SAM_type1,superfamily_P-loop_NTPase,superfamily_SAM/pointed,smart_Kinesin_motor_dom,pfscan_SAM,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.H908Q	ENST00000402558.2	37	c.2724	CCDS6551.2	9	.	.	.	.	.	.	.	.	.	.	G	8.913	0.959262	0.18507	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.97	-8.88	0.00789	.	0.467007	0.18205	N	0.148373	T	0.12732	0.0309	L	0.42245	1.32	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.33803	-0.9854	10	0.13108	T	0.6	.	0.7722	0.01026	0.3902:0.2098:0.1989:0.2011	.	908	Q5T7B8	KIF24_HUMAN	Q	908;774;908;774;908	ENSP00000384433:H908Q;ENSP00000368472:H774Q;ENSP00000368464:H908Q;ENSP00000340179:H774Q	ENSP00000340179:H774Q	H	-	3	2	KIF24	34246881	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-2.855000	0.00729	-1.513000	0.01789	-0.253000	0.11424	CAC	KIF24	-	NULL	ENSG00000186638		0.542	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF24	HGNC	protein_coding	OTTHUMT00000052150.5		0.00	32	0	G			34256881	-1			no_errors	ENST00000379166	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.000	T
KIF2A	3796	genome.wustl.edu	37	5	61657076	61657076	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:61657076G>T	ENST00000401507.3	+	10	1191	c.880G>T	c.(880-882)Gct>Tct	p.A294S	KIF2A_ENST00000381103.2_Missense_Mutation_p.A274S|KIF2A_ENST00000407818.3_Missense_Mutation_p.A294S|KIF2A_ENST00000506857.1_Missense_Mutation_p.A248S|KIF2A_ENST00000509663.2_Intron	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	294	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		AAGGTTTACTGCTAGACCACT	0.303																																																	0													63.0	63.0	63.0					5																	61657076		2203	4299	6502	SO:0001583	missense	0			BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.880G>T	5.37:g.61657076G>T	ENSP00000385622:p.Ala294Ser		A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A294S	ENST00000401507.3	37	c.880	CCDS3980.2	5	.	.	.	.	.	.	.	.	.	.	G	32	5.191998	0.94923	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000514082;ENST00000407818;ENST00000506857	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	5.23	5.23	0.72850	Kinesin, motor domain (4);	0.049290	0.85682	D	0.000000	T	0.47875	0.1469	M	0.71581	2.175	0.80722	D	1	D;D;D;P	0.64830	0.993;0.992;0.994;0.936	D;D;D;D	0.71414	0.973;0.954;0.96;0.956	T	0.49643	-0.8918	10	0.87932	D	0	.	18.8067	0.92040	0.0:0.0:1.0:0.0	.	294;294;294;274	B4DM85;O00139-4;O00139;E9PB70	.;.;KIF2A_HUMAN;.	S	294;274;275;294;248	ENSP00000385622:A294S;ENSP00000370493:A274S;ENSP00000423542:A275S;ENSP00000385000:A294S;ENSP00000423772:A248S	ENSP00000370493:A274S	A	+	1	0	KIF2A	61692833	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.453000	0.82957	0.650000	0.86243	GCT	KIF2A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000068796		0.303	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2A	HGNC	protein_coding	OTTHUMT00000317989.1	-	0.00	76	0	G	NM_004520		61657076	+1	tier1	-	no_errors	ENST00000407818	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
KIF5A	3798	genome.wustl.edu	37	12	57957931	57957931	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:57957931G>T	ENST00000455537.2	+	4	606	c.332G>T	c.(331-333)cGa>cTa	p.R111L	KIF5A_ENST00000286452.5_Intron	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	111	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.R111Q(1)|p.R111L(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						ATCATTCCTCGAATTGCCCGA	0.527																																																	2	Substitution - Missense(2)	large_intestine(1)|lung(1)											108.0	91.0	96.0					12																	57957931		2203	4300	6503	SO:0001583	missense	0			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.332G>T	12.37:g.57957931G>T	ENSP00000408979:p.Arg111Leu		A6H8M5|Q4LE26	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R111L	ENST00000455537.2	37	c.332	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.399334	0.96030	.	.	ENSG00000155980	ENST00000455537	T	0.74421	-0.84	4.87	4.87	0.63330	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.87233	0.6126	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88921	0.3366	10	0.87932	D	0	.	17.3316	0.87265	0.0:0.0:1.0:0.0	.	111	Q12840	KIF5A_HUMAN	L	111	ENSP00000408979:R111L	ENSP00000408979:R111L	R	+	2	0	KIF5A	56244198	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.431000	0.97494	2.691000	0.91804	0.655000	0.94253	CGA	KIF5A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000155980		0.527	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	HGNC	protein_coding	OTTHUMT00000407634.1		0.00	37	0	G	NM_004984		57957931	+1			no_errors	ENST00000455537	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	T
KLF8	11279	genome.wustl.edu	37	X	56291946	56291946	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:56291946C>A	ENST00000468660.1	+	3	703	c.415C>A	c.(415-417)Ctg>Atg	p.L139M	KLF8_ENST00000374928.3_Missense_Mutation_p.L139M	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						TCCTACTGTTCTGACCCCAGG	0.517																																																	0													113.0	89.0	98.0					X																	56291946		2203	4300	6503	SO:0001583	missense	0			U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.415C>A	X.37:g.56291946C>A	ENSP00000417303:p.Leu139Met		B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L139M	ENST00000468660.1	37	c.415	CCDS14373.1	X	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870987	0.33069	.	.	ENSG00000102349	ENST00000374928;ENST00000468660	T;T	0.34859	1.34;1.34	4.5	2.61	0.31194	.	0.000000	0.56097	D	0.000040	T	0.55955	0.1953	M	0.77820	2.39	0.49915	D	0.999839	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	T	0.54662	-0.8260	10	0.72032	D	0.01	.	7.9721	0.30134	0.0:0.7678:0.0:0.2322	.	139;139;139	E7EQQ8;B4DJN3;O95600	.;.;KLF8_HUMAN	M	139	ENSP00000364063:L139M;ENSP00000417303:L139M	ENSP00000431911:L139M	L	+	1	2	KLF8	56308671	0.954000	0.32549	0.263000	0.24496	0.180000	0.23129	1.429000	0.34903	0.381000	0.24851	0.594000	0.82650	CTG	KLF8	-	NULL	ENSG00000102349		0.517	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF8	HGNC	protein_coding	OTTHUMT00000056887.2	-	0.00	28	0	C	NM_007250		56291946	+1	tier1	-	no_errors	ENST00000468660	ensembl	human	known	74_37	missense	79.17	5	19	SNP	1.000	A
KLHL13	90293	genome.wustl.edu	37	X	117033206	117033206	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:117033206A>C	ENST00000262820.3	-	7	2542	c.1633T>G	c.(1633-1635)Ttc>Gtc	p.F545V	KLHL13_ENST00000540167.1_Missense_Mutation_p.F529V|KLHL13_ENST00000539496.1_Missense_Mutation_p.F548V|KLHL13_ENST00000469946.1_Missense_Mutation_p.F494V|KLHL13_ENST00000371882.1_Missense_Mutation_p.F494V|KLHL13_ENST00000371876.1_Missense_Mutation_p.F494V|KLHL13_ENST00000545703.1_Missense_Mutation_p.F503V|KLHL13_ENST00000371878.1_Missense_Mutation_p.F494V|KLHL13_ENST00000541812.1_Missense_Mutation_p.F529V	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	545					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)				NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						GTTCCTCTGAAGTGATTGCCA	0.468																																																	0													247.0	232.0	237.0					X																	117033206		2203	4300	6503	SO:0001583	missense	0			AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.1633T>G	X.37:g.117033206A>C	ENSP00000262820:p.Phe545Val		B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.F548V	ENST00000262820.3	37	c.1642	CCDS14571.1	X	.	.	.	.	.	.	.	.	.	.	A	14.11	2.436970	0.43224	.	.	ENSG00000003096	ENST00000371882;ENST00000371876;ENST00000371878;ENST00000447671;ENST00000541812;ENST00000540167;ENST00000539496;ENST00000262820;ENST00000545703;ENST00000469946	T;T;T;T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.25	5.25	0.73442	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.80793	0.4691	L	0.31526	0.94	0.80722	D	1	B;D;B;B	0.89917	0.056;1.0;0.113;0.137	B;D;B;B	0.91635	0.113;0.999;0.113;0.18	T	0.78563	-0.2156	10	0.27082	T	0.32	.	14.2106	0.65762	1.0:0.0:0.0:0.0	.	529;548;539;545	Q9P2N7-3;Q9P2N7-5;Q9P2N7-4;Q9P2N7	.;.;.;KLH13_HUMAN	V	494;494;494;494;529;529;548;545;503;494	ENSP00000360949:F494V;ENSP00000360943:F494V;ENSP00000360945:F494V;ENSP00000412640:F494V;ENSP00000444450:F529V;ENSP00000441029:F529V;ENSP00000443191:F548V;ENSP00000262820:F545V;ENSP00000440707:F503V;ENSP00000419803:F494V	ENSP00000262820:F545V	F	-	1	0	KLHL13	116917234	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	1.931000	0.55961	0.486000	0.48141	TTC	KLHL13	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000003096		0.468	KLHL13-201	KNOWN	basic|CCDS	protein_coding	KLHL13	HGNC	protein_coding		-	0.00	54	0	A	NM_033495		117033206	-1	tier1	-	no_errors	ENST00000539496	ensembl	human	known	74_37	missense	56.10	18	23	SNP	1.000	C
KNTC1	9735	genome.wustl.edu	37	12	123072328	123072328	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:123072328G>T	ENST00000333479.7	+	39	3978	c.3801G>T	c.(3799-3801)caG>caT	p.Q1267H	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1267					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AATCTAGCCAGTGGGAGCTAG	0.408																																																	0													116.0	106.0	109.0					12																	123072328		1856	4109	5965	SO:0001583	missense	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3801G>T	12.37:g.123072328G>T	ENSP00000328236:p.Gln1267His		A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.Q1267H	ENST00000333479.7	37	c.3801	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857543	0.71834	.	.	ENSG00000184445	ENST00000333479	T	0.18174	2.23	5.7	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.36963	0.0986	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.08166	-1.0735	10	0.46703	T	0.11	-15.5566	9.9675	0.41734	0.1563:0.0:0.8437:0.0	.	1267	P50748	KNTC1_HUMAN	H	1267	ENSP00000328236:Q1267H	ENSP00000328236:Q1267H	Q	+	3	2	KNTC1	121638281	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.472000	0.45136	1.414000	0.47017	0.462000	0.41574	CAG	KNTC1	-	NULL	ENSG00000184445		0.408	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	-	0.00	92	0	G			123072328	+1	tier1	-	no_errors	ENST00000333479	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
KRT23	25984	genome.wustl.edu	37	17	39081761	39081761	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:39081761C>T	ENST00000209718.3	-	7	1411	c.987G>A	c.(985-987)atG>atA	p.M329I	AC004231.2_ENST00000418393.1_RNA|KRT23_ENST00000436344.3_Missense_Mutation_p.M192I	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	329	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				TGATCTCTTGCATGTCCTGGA	0.473																																																	0													174.0	134.0	147.0					17																	39081761		2203	4300	6503	SO:0001583	missense	0			AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.987G>A	17.37:g.39081761C>T	ENSP00000209718:p.Met329Ile		A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.M329I	ENST00000209718.3	37	c.987	CCDS11380.1	17	.	.	.	.	.	.	.	.	.	.	C	8.958	0.969803	0.18659	.	.	ENSG00000108244	ENST00000209718;ENST00000436344	D;D	0.87650	-2.28;-2.28	5.49	4.53	0.55603	Filament (1);	0.000000	0.64402	D	0.000003	T	0.71195	0.3311	N	0.16201	0.385	0.44221	D	0.997051	B	0.30326	0.276	B	0.32393	0.145	T	0.65776	-0.6086	10	0.02654	T	1	.	7.1278	0.25482	0.0:0.7095:0.1416:0.1488	.	329	Q9C075	K1C23_HUMAN	I	329;192	ENSP00000209718:M329I;ENSP00000414056:M192I	ENSP00000209718:M329I	M	-	3	0	KRT23	36335287	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	0.733000	0.26087	1.324000	0.45282	-0.140000	0.14226	ATG	KRT23	-	pfam_IF,prints_Keratin_I	ENSG00000108244		0.473	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT23	HGNC	protein_coding	OTTHUMT00000257223.1		0.00	50	0	C			39081761	-1			no_errors	ENST00000209718	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
KRT6C	286887	genome.wustl.edu	37	12	52865895	52865895	+	Missense_Mutation	SNP	G	G	A	rs533243700		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:52865895G>A	ENST00000252250.6	-	2	757	c.710C>T	c.(709-711)tCg>tTg	p.S237L		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	237	Coil 1B.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		TCTCAGCTCCGAGTCCAGGCG	0.572																																																	0													132.0	95.0	108.0					12																	52865895		2203	4300	6503	SO:0001583	missense	0			L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.710C>T	12.37:g.52865895G>A	ENSP00000252250:p.Ser237Leu		A1L4L5|P48666|Q2TAZ9|Q7RTN9	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.S237L	ENST00000252250.6	37	c.710	CCDS8829.1	12	.	.	.	.	.	.	.	.	.	.	G	13.98	2.400331	0.42613	.	.	ENSG00000170465	ENST00000252250;ENST00000411979	D	0.86627	-2.15	2.89	2.89	0.33648	Filament (1);	0.000000	0.49305	D	0.000159	D	0.83385	0.5243	M	0.63169	1.94	0.25002	N	0.991466	P	0.36392	0.551	B	0.33799	0.17	T	0.79281	-0.1868	10	0.66056	D	0.02	.	11.7736	0.51972	0.0:0.3419:0.6581:0.0	.	237	P48668	K2C6C_HUMAN	L	237;222	ENSP00000252250:S237L	ENSP00000252250:S237L	S	-	2	0	KRT6C	51152162	0.001000	0.12720	0.947000	0.38551	0.270000	0.26580	0.896000	0.28377	1.907000	0.55213	0.407000	0.27541	TCG	KRT6C	-	pfam_IF	ENSG00000170465		0.572	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6C	HGNC	protein_coding	OTTHUMT00000404976.1	-	0.00	108	0	G	NM_173086		52865895	-1	tier1	-	no_errors	ENST00000252250	ensembl	human	known	74_37	missense	33.93	37	19	SNP	0.638	A
L1CAM	3897	genome.wustl.edu	37	X	153134086	153134086	+	Silent	SNP	G	G	A	rs150805225	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:153134086G>A	ENST00000370060.1	-	13	1665	c.1476C>T	c.(1474-1476)acC>acT	p.T492T	L1CAM_ENST00000543994.1_Silent_p.T494T|L1CAM_ENST00000361981.3_Silent_p.T487T|L1CAM_ENST00000361699.4_Silent_p.T492T|L1CAM_ENST00000370057.3_Silent_p.T492T|L1CAM_ENST00000538883.1_Silent_p.T494T|L1CAM_ENST00000370055.1_Silent_p.T487T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	492	Ig-like C2-type 5.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGTAGCGTCCGGTGTCATTGG	0.557													g|||	1	0.000264901	0.0008	0.0	3775	,	,		16721	0.0		0.0	False		,,,				2504	0.0																0								G	,,	1,3834		0,0,1,1632,570	139.0	99.0	113.0		1476,1461,1476	-11.2	0.0	X	dbSNP_134	113	0,6728		0,0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	L1CAM	NM_000425.3,NM_001143963.1,NM_024003.2	,,	0,0,1,4060,2442	AA,AG,A,GG,G		0.0,0.0261,0.0095	,,	492/1258,487/1249,492/1254	153134086	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1476C>T	X.37:g.153134086G>A			A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T494	ENST00000370060.1	37	c.1482	CCDS14733.1	X																																																																																			L1CAM	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000198910		0.557	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	-	0.00	15	0	G	NM_024003		153134086	-1	tier1	rs150805225	no_errors	ENST00000543994	ensembl	human	known	74_37	silent	42.11	11	8	SNP	0.012	A
LENG8	114823	genome.wustl.edu	37	19	54963327	54963327	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:54963327G>T	ENST00000326764.5	+	3	575	c.96G>T	c.(94-96)ccG>ccT	p.P32P	LENG8_ENST00000376514.2_Silent_p.P32P	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	0										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		TGGAGACGCCGATGCACGAGA	0.622																																																	0													79.0	78.0	78.0					19																	54963327		2203	4300	6503	SO:0001819	synonymous_variant	0			AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.96G>T	19.37:g.54963327G>T			B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.P32	ENST00000326764.5	37	c.96	CCDS12894.1	19																																																																																			LENG8	-	NULL	ENSG00000167615		0.622	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG8	HGNC	protein_coding	OTTHUMT00000140523.2	-	0.00	90	0	G	NM_052925		54963327	+1	tier1	-	no_errors	ENST00000326764	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.973	T
LINC00693	645206	genome.wustl.edu	37	3	28617801	28617801	+	RNA	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:28617801T>C	ENST00000432518.2	+	0	623				LINC00693_ENST00000445077.1_RNA|LINC00693_ENST00000443912.1_RNA	NR_038840.1				long intergenic non-protein coding RNA 693																		AGGGAGTTTCTCCGCGCCCGG	0.697																																																	0																																												0					3p24.1	2012-11-14			ENSG00000228214	ENSG00000228214		"""Long non-coding RNAs"""	44526	non-coding RNA	RNA, long non-coding							Standard	NR_038840		Approved		uc021wur.1		OTTHUMG00000155718		3.37:g.28617801T>C				RNA	SNP	-	NULL	ENST00000432518.2	37	NULL		3																																																																																			LINC00693	-	-	ENSG00000228214		0.697	LINC00693-001	KNOWN	basic	antisense	LINC00693	HGNC	antisense	OTTHUMT00000341375.2	-	0.00	53	0	T			28617801	+1	tier1	-	no_errors	ENST00000432518	ensembl	human	known	74_37	rna	40.58	41	28	SNP	1.000	C
LINC00710	254312	genome.wustl.edu	37	10	10988556	10988556	+	RNA	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:10988556T>G	ENST00000428520.2	-	0	276					NR_015413.1				long intergenic non-protein coding RNA 710																		TGTTCTCTTTTTCTTTTCCTA	0.343																																																	0																																												0					10p14	2012-12-05			ENSG00000229240	ENSG00000229240		"""Long non-coding RNAs"""	27386	non-coding RNA	RNA, long non-coding							Standard	NR_015413		Approved		uc009xiu.3		OTTHUMG00000017661		10.37:g.10988556T>G				RNA	SNP	-	NULL	ENST00000428520.2	37	NULL		10																																																																																			LINC00710	-	-	ENSG00000229240		0.343	LINC00710-001	KNOWN	basic	lincRNA	LINC00710	HGNC	processed_transcript	OTTHUMT00000046746.3		0.00	86	0	T	NR_015413		10988556	-1			no_errors	ENST00000428520	ensembl	human	known	74_37	rna	5.33	71	4	SNP	0.001	G
LIPH	200879	genome.wustl.edu	37	3	185237010	185237010	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:185237010G>T	ENST00000296252.4	-	6	947	c.806C>A	c.(805-807)cCc>cAc	p.P269H	LIPH_ENST00000424591.2_Missense_Mutation_p.P235H	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	269					lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GGAGTCACAGGGATACGCAGT	0.473																																																	0													148.0	145.0	146.0					3																	185237010		2203	4300	6503	SO:0001583	missense	0			AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.806C>A	3.37:g.185237010G>T	ENSP00000296252:p.Pro269His		A2IBA7|Q8TEC7	Missense_Mutation	SNP	pfam_Lipase_N,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	p.P269H	ENST00000296252.4	37	c.806	CCDS3272.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.294742|4.294742	0.81025|0.81025	.|.	.|.	ENSG00000163898|ENSG00000163898	ENST00000296252;ENST00000424591|ENST00000452897	D;D|D	0.91894|0.91894	-2.93;-2.93|-2.93	5.01|5.01	5.01|5.01	0.66863|0.66863	Lipase, N-terminal (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.96262|0.96262	0.8781|0.8781	M|M	0.87456|0.87456	2.885|2.885	0.58432|0.58432	D|D	0.999998|0.999998	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.996;0.997|.	D|D	0.96833|0.96833	0.9612|0.9612	10|8	0.87932|0.87932	D|D	0|0	-19.3853|-19.3853	17.5292|17.5292	0.87809|0.87809	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	235;269|.	A2IBA6;Q8WWY8|.	.;LIPH_HUMAN|.	H|T	269;235|60	ENSP00000296252:P269H;ENSP00000396384:P235H|ENSP00000408218:P60T	ENSP00000296252:P269H|ENSP00000408218:P60T	P|P	-|-	2|1	0|0	LIPH|LIPH	186719704|186719704	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.762000|0.762000	0.43233|0.43233	8.318000|8.318000	0.89990|0.89990	2.612000|2.612000	0.88384|0.88384	0.456000|0.456000	0.33151|0.33151	CCC|CCT	LIPH	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH	ENSG00000163898		0.473	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPH	HGNC	protein_coding	OTTHUMT00000345153.1	-	0.00	57	0	G			185237010	-1	tier1	-	no_errors	ENST00000296252	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
HMGA2	8091	genome.wustl.edu	37	12	66275757	66275757	+	Intron	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:66275757G>T	ENST00000403681.2	+	3	1389				RP11-366L20.2_ENST00000504038.2_5'Flank|HMGA2_ENST00000393577.3_Intron|HMGA2_ENST00000536545.1_Intron|HMGA2_ENST00000354636.3_Intron|HMGA2_ENST00000425208.2_3'UTR|HMGA2_ENST00000541363.1_Intron|RP11-366L20.2_ENST00000439236.2_Missense_Mutation_p.T3K|RP11-366L20.2_ENST00000356215.2_Missense_Mutation_p.T3K	NM_003483.4	NP_003474.1	P52926	HMGA2_HUMAN	high mobility group AT-hook 2						adrenal gland development (GO:0030325)|base-excision repair (GO:0006284)|cell proliferation in forebrain (GO:0021846)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|chromatin organization (GO:0006325)|chromosome breakage (GO:0031052)|chromosome condensation (GO:0030261)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA damage response, detection of DNA damage (GO:0042769)|endodermal cell differentiation (GO:0035987)|epithelial to mesenchymal transition (GO:0001837)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|heterochromatin assembly (GO:0031507)|histone H2A-S139 phosphorylation (GO:0035978)|male gonad development (GO:0008584)|mesenchymal cell differentiation (GO:0048762)|mesodermal cell differentiation (GO:0048333)|mesodermal-endodermal cell signaling (GO:0003131)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of DNA binding (GO:0043392)|negative regulation of double-strand break repair via nonhomologous end joining (GO:2001033)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|oncogene-induced cell senescence (GO:0090402)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cellular response to X-ray (GO:2000685)|positive regulation of cellular senescence (GO:2000774)|positive regulation of gene expression (GO:0010628)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle process (GO:0010564)|regulation of cellular response to drug (GO:2001038)|regulation of growth hormone secretion (GO:0060123)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|senescence-associated heterochromatin focus assembly (GO:0035986)|signal transduction (GO:0007165)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|senescence-associated heterochromatin focus (GO:0035985)|SMAD protein complex (GO:0071141)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|AT DNA binding (GO:0003680)|C2H2 zinc finger domain binding (GO:0070742)|cAMP response element binding (GO:0035497)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|DNA-dependent protein kinase activity (GO:0004677)|MH1 domain binding (GO:0035501)|MH2 domain binding (GO:0035500)|nucleosomal DNA binding (GO:0031492)|regulatory region DNA binding (GO:0000975)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		HMGA2/RAD51B(11)|HMGA2/CCNB1IP1(2)|HMGA2/WIF1_ENST00000286574(14)|HMGA2/ALDH2_ENST00000261733(2)|HMGA2/EBF1(2)|HMGA2/LHFP(2)|HMGA2/NFIB_ENST00000397581(8)|HMGA2/LPP(161)|HMGA2/FHIT_ENST00000476844(4)|HMGA2/COX6C(2)	lung(2)	2	all_cancers(1;5.78e-46)		GBM - Glioblastoma multiforme(1;0.00179)|LUSC - Lung squamous cell carcinoma(43;0.156)	GBM - Glioblastoma multiforme(28;0.0386)		GCAGCTGAACGTCTCCATCTC	0.582			T	""" LHFP, RAD51L1, LPP, COX6C, CMKOR1, NFIB, ALDH2, CCNB1IP1, EBF1, WIF1, FHIT"""	"""lipoma, leiomyoma, pleiomorphic salivary gland adenoma"""						OREG0021972	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		12	12q15	8091	high mobility group AT-hook 2 (HMGIC)		M	0																																										SO:0001627	intron_variant	0			U28754	CCDS31854.1, CCDS44936.1, CCDS73491.1, CCDS73492.1	12q15	2011-07-01	2002-07-25	2002-07-26	ENSG00000149948	ENSG00000149948		"""High-mobility group / Canonical"""	5009	protein-coding gene	gene with protein product		600698	"""high-mobility group (nonhistone chromosomal) protein isoform I-C"""	HMGIC		8824803, 9003504	Standard	XM_006719620		Approved	BABL, LIPO	uc001ssx.3	P52926	OTTHUMG00000168936	ENST00000403681.2:c.249+43408G>T	12.37:g.66275757G>T		1090	E7EP85|E7EWA2|Q1M182|Q1M185|Q1M186|Q1M187|Q1M188	Missense_Mutation	SNP	NULL	p.T3K	ENST00000403681.2	37	c.8	CCDS44936.1	12	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353866	0.41700	.	.	ENSG00000197301	ENST00000439236;ENST00000356215	.	.	.	5.38	1.36	0.22044	.	.	.	.	.	T	0.49167	0.1541	.	.	.	0.09310	N	0.999999	D	0.63046	0.992	P	0.61533	0.89	T	0.32745	-0.9895	6	.	.	.	.	2.5619	0.04774	0.2843:0.1203:0.4726:0.1228	.	3	B7WPI5	.	K	3	.	.	T	-	2	0	RP11-366L20.2	64562024	0.001000	0.12720	0.011000	0.14972	0.147000	0.21601	0.122000	0.15687	0.332000	0.23536	0.650000	0.86243	ACG	RP11-366L20.2	-	NULL	ENSG00000197301		0.582	HMGA2-001	KNOWN	basic|CCDS	protein_coding	LOC101927810	Clone_based_vega_gene	protein_coding	OTTHUMT00000401654.1	-	0.00	20	0	G	NM_003483		66275757	-1	tier1	-	no_errors	ENST00000439236	ensembl	human	putative	74_37	missense	21.43	11	3	SNP	0.000	T
RAP1GAP2	23108	genome.wustl.edu	37	17	2865945	2865945	+	Intron	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:2865945G>T	ENST00000254695.8	+	5	291				RAP1GAP2_ENST00000542807.1_Intron|RAP1GAP2_ENST00000540393.2_Intron|CTD-3060P21.1_ENST00000574885.1_RNA|RAP1GAP2_ENST00000366401.4_Intron	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2						negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						TGTGGATCCTGTTTTCCTTGT	0.557																																																	0													59.0	48.0	52.0					17																	2865945		1881	4097	5978	SO:0001627	intron_variant	0			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.202-19G>T	17.37:g.2865945G>T			B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	RNA	SNP	-	NULL	ENST00000254695.8	37	NULL	CCDS45573.1	17																																																																																			CTD-3060P21.1	-	-	ENSG00000262884		0.557	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC101927911	Clone_based_vega_gene	protein_coding	OTTHUMT00000438208.2	-	0.00	69	0	G			2865945	-1	tier1	-	no_errors	ENST00000574885	ensembl	human	known	74_37	rna	6.90	54	4	SNP	0.997	T
SPANXA2-OT1	619455	genome.wustl.edu	37	X	140714833	140714833	+	RNA	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:140714833T>C	ENST00000421554.1	+	0	572				RP1-171K16.5_ENST00000412163.1_lincRNA	NR_037183.1		Q8N9U9	SPOT1_HUMAN	SPANXA2 overlapping transcript 1																		ACCAAGATTCTTGGATGTTGG	0.388																																																	0																																												0			AK093505		Xq27.2	2014-06-02	2014-06-02	2011-08-31	ENSG00000226574	ENSG00000277215		"""Long non-coding RNAs"", ""-"""	31683	non-coding RNA	RNA, long non-coding			"""chromosome X open reading frame 18"", ""SPANXA2 overlapping transcript 1 (non-protein coding)"""	CXorf18			Standard	NR_037183		Approved	FLJ36186	uc004fbm.1	Q8N9U9	OTTHUMG00000022566		X.37:g.140714833T>C				RNA	SNP	-	NULL	ENST00000421554.1	37	NULL		X																																																																																			RP1-171K16.5	-	-	ENSG00000223438		0.388	SPANXA2-OT1-001	KNOWN	basic	processed_transcript	LOC645188	Clone_based_vega_gene	processed_transcript	OTTHUMT00000058601.2		0.00	15	0	T	NR_037183		140714833	+1			no_errors	ENST00000412163	ensembl	human	known	74_37	rna	42.86	4	3	SNP	0.000	C
LPHN2	23266	genome.wustl.edu	37	1	82452943	82452943	+	Intron	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:82452943G>A	ENST00000370728.1	+	24	4270				LPHN2_ENST00000271029.4_Intron|LPHN2_ENST00000319517.6_Intron|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370725.1_Intron|LPHN2_ENST00000359929.3_Intron|LPHN2_ENST00000370715.1_Intron|LPHN2_ENST00000370727.1_Intron|LPHN2_ENST00000370721.1_Intron|LPHN2_ENST00000370723.1_Intron|LPHN2_ENST00000370713.1_Intron|LPHN2_ENST00000370730.1_Intron|LPHN2_ENST00000394879.1_Intron|LPHN2_ENST00000335786.5_Intron|LPHN2_ENST00000370717.2_Intron			O95490	LPHN2_HUMAN	latrophilin 2						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TTTTAACACAGGTGGCATAAA	0.318																																																	0													18.0	19.0	19.0					1																	82452943		873	1989	2862	SO:0001627	intron_variant	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.3625+230G>A	1.37:g.82452943G>A			A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Splice_Site	SNP	-	NULL	ENST00000370728.1	37	c.NULL		1																																																																																			LPHN2	-	-	ENSG00000117114		0.318	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	-	0.00	76	0	G	NM_012302		82452943	+1	tier1	-	no_errors	ENST00000472424	ensembl	human	known	74_37	splice_site	37.29	37	22	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141202169	141202169	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:141202169C>A	ENST00000389484.3	-	64	11108	c.10137G>T	c.(10135-10137)gaG>gaT	p.E3379D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3379	LDL-receptor class A 22. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.E3379D(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACAATCATTCTCTCCATCAC	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - Missense(1)	large_intestine(1)											110.0	103.0	106.0					2																	141202169		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10137G>T	2.37:g.141202169C>A	ENSP00000374135:p.Glu3379Asp		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.E3379D	ENST00000389484.3	37	c.10137	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381811	0.24944	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95518	-3.73	5.85	-1.6	0.08426	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.85526	0.5717	N	0.05534	-0.03	0.38656	D	0.951962	B	0.20550	0.046	B	0.22601	0.04	T	0.70850	-0.4760	10	0.19147	T	0.46	.	8.8089	0.34954	0.0:0.4152:0.1002:0.4846	.	3379	Q9NZR2	LRP1B_HUMAN	D	3379;3317	ENSP00000374135:E3379D	ENSP00000374135:E3379D	E	-	3	2	LRP1B	140918639	0.262000	0.24073	0.993000	0.49108	0.997000	0.91878	-0.296000	0.08287	-0.208000	0.10171	0.563000	0.77884	GAG	LRP1B	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	40	0	C	NM_018557		141202169	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.966	A
LRP1B	53353	genome.wustl.edu	37	2	141660604	141660604	+	Silent	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:141660604A>G	ENST00000389484.3	-	23	4622	c.3651T>C	c.(3649-3651)taT>taC	p.Y1217Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1217	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GATTGCTACAATAATCCACAA	0.428										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													187.0	166.0	173.0					2																	141660604		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3651T>C	2.37:g.141660604A>G			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.Y1217	ENST00000389484.3	37	c.3651	CCDS2182.1	2																																																																																			LRP1B	-	smart_EG-like_dom	ENSG00000168702		0.428	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	36	0	A	NM_018557		141660604	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	25.00	33	11	SNP	0.808	G
LRRC40	55631	genome.wustl.edu	37	1	70616844	70616844	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:70616844A>G	ENST00000370952.3	-	13	1563	c.1484T>C	c.(1483-1485)gTa>gCa	p.V495A		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	495						membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						TTGCAGTCTTACCAGTGATTC	0.289																																																	0													56.0	57.0	57.0					1																	70616844		2200	4293	6493	SO:0001583	missense	0				CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.1484T>C	1.37:g.70616844A>G	ENSP00000359990:p.Val495Ala		Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.V495A	ENST00000370952.3	37	c.1484	CCDS646.1	1	.	.	.	.	.	.	.	.	.	.	A	2.895	-0.228807	0.06022	.	.	ENSG00000066557	ENST00000370952	T	0.52526	0.66	5.74	-0.528	0.11905	.	0.691515	0.14833	N	0.295736	T	0.06735	0.0172	N	0.16368	0.405	0.09310	N	0.999998	B	0.06786	0.001	B	0.06405	0.002	T	0.29822	-0.9999	10	0.08599	T	0.76	.	1.2103	0.01903	0.2687:0.2086:0.3332:0.1894	.	495	Q9H9A6	LRC40_HUMAN	A	495	ENSP00000359990:V495A	ENSP00000359990:V495A	V	-	2	0	LRRC40	70389432	0.218000	0.23608	0.582000	0.28627	0.527000	0.34593	0.047000	0.14056	0.289000	0.22422	0.533000	0.62120	GTA	LRRC40	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000066557		0.289	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC40	HGNC	protein_coding	OTTHUMT00000025914.1	-	0.00	61	0	A	NM_017768		70616844	-1	tier1	-	no_errors	ENST00000370952	ensembl	human	known	74_37	missense	11.11	56	7	SNP	0.451	G
LRRC9	341883	genome.wustl.edu	37	14	60483410	60483410	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:60483410G>T	ENST00000445360.1	+	24	3423	c.3219G>T	c.(3217-3219)ttG>ttT	p.L1073F	RP11-16B13.1_ENST00000555432.1_RNA|RP11-16B13.1_ENST00000554123.1_RNA			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	1073																	CAAAAGATTTGTTTGGTGGTA	0.353																																																	0																																										SO:0001583	missense	0			AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.3219G>T	14.37:g.60483410G>T	ENSP00000454748:p.Leu1073Phe			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L1073F	ENST00000445360.1	37	c.3219		14																																																																																			LRRC9	-	NULL	ENSG00000131951		0.353	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC9	HGNC	protein_coding	OTTHUMT00000072281.3	-	0.00	85	0	G			60483410	+1	tier1	-	no_errors	ENST00000254271	ensembl	human	known	74_37	missense	28.57	30	12	SNP	1.000	T
LRRTM4	80059	genome.wustl.edu	37	2	77745909	77745909	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:77745909T>G	ENST00000409093.1	-	3	1422	c.1086A>C	c.(1084-1086)gaA>gaC	p.E362D	LRRTM4_ENST00000409088.3_Missense_Mutation_p.E362D|LRRTM4_ENST00000409911.1_Missense_Mutation_p.E363D|LRRTM4_ENST00000409282.1_Missense_Mutation_p.E363D|LRRTM4_ENST00000409884.1_Missense_Mutation_p.E362D			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	362	LRRCT.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CCACCTGGACTTCAGAACAGA	0.463																																																	0													111.0	106.0	108.0					2																	77745909		1901	4115	6016	SO:0001583	missense	0			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1086A>C	2.37:g.77745909T>G	ENSP00000386357:p.Glu362Asp		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E363D	ENST00000409093.1	37	c.1089	CCDS46346.1	2	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.314700	0.00235	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.51574	0.7;0.73;0.73;0.81;0.82	5.83	0.68	0.17980	.	0.494060	0.23303	N	0.049641	T	0.15478	0.0373	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.002;0.002	T	0.27606	-1.0069	10	0.02654	T	1	.	4.1798	0.10369	0.2641:0.145:0.0:0.5909	.	363;362;362	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	D	363;362;362;362;363	ENSP00000387228:E363D;ENSP00000387297:E362D;ENSP00000386357:E362D;ENSP00000386236:E362D;ENSP00000386286:E363D	ENSP00000386236:E362D	E	-	3	2	LRRTM4	77599417	0.914000	0.31030	0.997000	0.53966	0.633000	0.38033	0.173000	0.16724	0.094000	0.17404	-1.157000	0.01802	GAA	LRRTM4	-	NULL	ENSG00000176204		0.463	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	HGNC	protein_coding	OTTHUMT00000328225.1	-	0.00	26	0	T	NM_024993		77745909	-1	tier1	-	no_errors	ENST00000409911	ensembl	human	known	74_37	missense	47.06	9	8	SNP	0.003	G
MAB21L1	4081	genome.wustl.edu	37	13	36050159	36050159	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr13:36050159G>A	ENST00000379919.4	-	1	673	c.117C>T	c.(115-117)tcC>tcT	p.S39S	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000537702.1_5'Flank	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	39					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		TCAGTACGTCGGAAACTACTT	0.517																																																	0													104.0	105.0	105.0					13																	36050159		2203	4300	6503	SO:0001819	synonymous_variant	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.117C>T	13.37:g.36050159G>A			Q6I9T5	Silent	SNP	pfam_Mab-21_dom	p.S39	ENST00000379919.4	37	c.117	CCDS9353.1	13																																																																																			MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.517	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	-	0.00	44	0	G	NM_005584		36050159	-1	tier1	-	no_errors	ENST00000379919	ensembl	human	known	74_37	silent	39.29	17	11	SNP	1.000	A
MAGEB5	347541	genome.wustl.edu	37	X	26235727	26235727	+	Silent	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:26235727T>G	ENST00000602297.1	+	2	556	c.309T>G	c.(307-309)acT>acG	p.T103T	MAGEB5_ENST00000379029.2_Silent_p.T103T	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	103	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									lung(1)|ovary(1)	2						TCAACCCAACTTGTCACTTAT	0.448																																																	0																																										SO:0001819	synonymous_variant	0			AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.309T>G	X.37:g.26235727T>G				Silent	SNP	pfam_MAGE,pfscan_MAGE	p.T103	ENST00000602297.1	37	c.309		X																																																																																			MAGEB5	-	pfam_MAGE,pfscan_MAGE	ENSG00000188408		0.448	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	MAGEB5	HGNC	protein_coding	OTTHUMT00000056126.2	-	0.00	21	0	T	XM_293407		26235727	+1	tier1	-	no_errors	ENST00000379029	ensembl	human	known	74_37	silent	47.06	9	8	SNP	0.000	G
MAGEH1	28986	genome.wustl.edu	37	X	55479467	55479467	+	Silent	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:55479467A>G	ENST00000342972.1	+	1	930	c.660A>G	c.(658-660)taA>taG	p.*220*	hsa-mir-4536-2_ENST00000583537.1_RNA	NM_014061.3	NP_054780.2	Q9H213	MAGH1_HUMAN	melanoma antigen family H, 1	0					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|skin(2)	15						CCGCCCCTTAAGTAGATCTGA	0.502																																																	0													48.0	47.0	47.0					X																	55479467		2201	4298	6499	SO:0001819	synonymous_variant	0			AF320912	CCDS14369.1	Xp11.22	2008-02-05			ENSG00000187601	ENSG00000187601			24092	protein-coding gene	gene with protein product		300548				12414813, 9485030	Standard	NM_014061		Approved	APR1	uc004dum.3	Q9H213	OTTHUMG00000021655	ENST00000342972.1:c.660A>G	X.37:g.55479467A>G			B2R8V9|Q5JRJ3|Q9Y5M2	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.*220	ENST00000342972.1	37	c.660	CCDS14369.1	X																																																																																			MAGEH1	-	NULL	ENSG00000187601		0.502	MAGEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEH1	HGNC	protein_coding	OTTHUMT00000056868.1	-	0.00	34	0	A	NM_014061		55479467	+1	tier1	-	no_errors	ENST00000342972	ensembl	human	known	74_37	silent	31.58	13	6	SNP	0.000	G
MAGEC3	139081	genome.wustl.edu	37	X	140983147	140983147	+	Silent	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:140983147A>G	ENST00000298296.1	+	5	1002	c.1002A>G	c.(1000-1002)ggA>ggG	p.G334G	MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000409007.1_5'Flank|MAGEC3_ENST00000448920.1_Silent_p.G86G|MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000544766.1_5'UTR	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	334	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					AGGAGTCTGGACTCAGGTCAG	0.577																																																	0													123.0	107.0	113.0					X																	140983147		2202	4300	6502	SO:0001819	synonymous_variant	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1002A>G	X.37:g.140983147A>G			Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.G334	ENST00000298296.1	37	c.1002	CCDS14676.1	X																																																																																			MAGEC3	-	NULL	ENSG00000165509		0.577	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	-	0.00	67	0	A	NM_138702		140983147	+1	tier1	-	no_errors	ENST00000298296	ensembl	human	known	74_37	silent	12.00	44	6	SNP	0.000	G
MAML3	55534	genome.wustl.edu	37	4	140811069	140811069	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:140811069C>T	ENST00000509479.2	-	2	2377	c.1521G>A	c.(1519-1521)caG>caA	p.Q507Q	MAML3_ENST00000398940.1_Intron|MAML3_ENST00000327122.5_Silent_p.Q351Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgttgctgctgctgctgct	0.517																																																	0													39.0	47.0	44.0					4																	140811069		2177	4289	6466	SO:0001819	synonymous_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1521G>A	4.37:g.140811069C>T				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q507	ENST00000509479.2	37	c.1521	CCDS54805.1	4																																																																																			MAML3	-	NULL	ENSG00000196782		0.517	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	-	0.00	24	0	C			140811069	-1	tier1	-	no_errors	ENST00000509479	ensembl	human	known	74_37	silent	19.05	17	4	SNP	1.000	T
MAN2A2	4122	genome.wustl.edu	37	15	91456129	91456129	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:91456129C>T	ENST00000559717.1	+	17	2951	c.2492C>T	c.(2491-2493)cCc>cTc	p.P831L	MAN2A2_ENST00000430376.2_Missense_Mutation_p.P21L|MAN2A2_ENST00000360468.3_Missense_Mutation_p.P831L|MAN2A2_ENST00000431652.2_Missense_Mutation_p.P339L			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	831					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			AAGGAGCCCCCCGTGCTGCGT	0.582																																																	0													97.0	92.0	94.0					15																	91456129		2198	4298	6496	SO:0001583	missense	0			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2492C>T	15.37:g.91456129C>T	ENSP00000452948:p.Pro831Leu		A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.P831L	ENST00000559717.1	37	c.2492	CCDS32332.1	15	.	.	.	.	.	.	.	.	.	.	C	29.1	4.978801	0.92982	.	.	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	T;T;D	0.82984	-1.06;-1.06;-1.67	5.02	5.02	0.67125	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.047420	0.85682	D	0.000000	D	0.91901	0.7436	M	0.86420	2.815	0.80722	D	1	P;D;D	0.76494	0.95;0.999;0.996	P;D;D	0.74348	0.84;0.983;0.978	D	0.91033	0.4865	10	0.34782	T	0.22	-18.8331	18.5937	0.91223	0.0:1.0:0.0:0.0	.	339;459;831	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	L	831;339;21	ENSP00000353655:P831L;ENSP00000388221:P339L;ENSP00000394372:P21L	ENSP00000353655:P831L	P	+	2	0	MAN2A2	89257133	1.000000	0.71417	0.149000	0.22428	0.954000	0.61252	7.535000	0.82014	2.635000	0.89317	0.549000	0.68633	CCC	MAN2A2	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom	ENSG00000196547		0.582	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A2	HGNC	protein_coding	OTTHUMT00000418246.5	-	0.00	43	0	C	NM_006122		91456129	+1	tier1	-	no_errors	ENST00000360468	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.998	T
MANBA	4126	genome.wustl.edu	37	4	103578863	103578863	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:103578863C>T	ENST00000226578.4	-	12	1779	c.1680G>A	c.(1678-1680)tgG>tgA	p.W560*	MANBA_ENST00000505239.1_Nonsense_Mutation_p.W503*	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	560					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		TGAAGGACGGCCAGGACTGAT	0.373																																																	0													100.0	94.0	96.0					4																	103578863		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1680G>A	4.37:g.103578863C>T	ENSP00000226578:p.Trp560*		Q96BC3|Q9NYX9	Nonsense_Mutation	SNP	pfam_Glyco_hydro_2_N,pfam_Glyco_hydro_2_TIM,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,superfamily_Glyco_hydro_2_Ig-like	p.W560*	ENST00000226578.4	37	c.1680	CCDS3658.1	4	.	.	.	.	.	.	.	.	.	.	C	39	7.527847	0.98339	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5262	18.8133	0.92068	0.0:1.0:0.0:0.0	.	.	.	.	X	560;503	.	ENSP00000226578:W560X	W	-	3	0	MANBA	103797911	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.403000	0.79983	2.438000	0.82558	0.650000	0.86243	TGG	MANBA	-	superfamily_Glycoside_hydrolase_SF	ENSG00000109323		0.373	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MANBA	HGNC	protein_coding	OTTHUMT00000253803.2		0.00	70	0	C			103578863	-1			no_errors	ENST00000226578	ensembl	human	known	74_37	nonsense	13.64	19	3	SNP	1.000	T
MAP4K4	9448	genome.wustl.edu	37	2	102448250	102448250	+	Silent	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:102448250C>A	ENST00000347699.4	+	7	576	c.576C>A	c.(574-576)ccC>ccA	p.P192P	MAP4K4_ENST00000425019.1_Silent_p.P192P|MAP4K4_ENST00000350878.4_Silent_p.P172P|MAP4K4_ENST00000302217.5_Intron|MAP4K4_ENST00000324219.4_Silent_p.P192P|MAP4K4_ENST00000413150.2_Silent_p.P192P|MAP4K4_ENST00000350198.4_Silent_p.P192P|MAP4K4_ENST00000456652.1_Intron	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	192	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TAGGCACTCCCTACTGGATGG	0.527											OREG0014845	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													83.0	81.0	81.0					2																	102448250		1968	4190	6158	SO:0001819	synonymous_variant	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.576C>A	2.37:g.102448250C>A		1366	O75172|Q9NST7	Silent	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.P192	ENST00000347699.4	37	c.576	CCDS56130.1	2																																																																																			MAP4K4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000071054		0.527	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	-	0.00	126	0	C	NM_004834		102448250	+1	tier1	-	no_errors	ENST00000324219	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.039	A
MAP2	4133	genome.wustl.edu	37	2	210570439	210570439	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:210570439C>T	ENST00000360351.4	+	11	5226	c.4720C>T	c.(4720-4722)Cgg>Tgg	p.R1574W	MAP2_ENST00000392194.1_Missense_Mutation_p.R218W|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000361559.4_Missense_Mutation_p.R218W|MAP2_ENST00000199940.6_Missense_Mutation_p.R275W|MAP2_ENST00000447185.1_Missense_Mutation_p.R1570W	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1574					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TTCTTCAGCACGGCGGACCAC	0.393																																					Pancreas(27;423 979 28787 29963)												0													143.0	145.0	144.0					2																	210570439		2203	4300	6503	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4720C>T	2.37:g.210570439C>T	ENSP00000353508:p.Arg1574Trp		Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.R1574W	ENST00000360351.4	37	c.4720	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995310	0.74703	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185	T;T;T;T;T	0.19806	2.13;2.94;2.12;2.12;2.94	5.44	3.6	0.41247	.	0.000000	0.46442	D	0.000298	T	0.35098	0.0920	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.996;0.988;0.999;0.997	T	0.07481	-1.0770	10	0.66056	D	0.02	-8.5505	14.5087	0.67769	0.2681:0.7319:0.0:0.0	.	1570;218;219;1574;275	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	W	275;1574;218;218;1570	ENSP00000199940:R275W;ENSP00000353508:R1574W;ENSP00000355290:R218W;ENSP00000376032:R218W;ENSP00000392164:R1570W	ENSP00000199940:R275W	R	+	1	2	MAP2	210278684	0.821000	0.29204	0.975000	0.42487	0.880000	0.50808	1.418000	0.34782	0.628000	0.30357	0.591000	0.81541	CGG	MAP2	-	NULL	ENSG00000078018		0.393	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	40	0	C	NM_001039538		210570439	+1	tier1	-	no_errors	ENST00000360351	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	T
MARVELD3	91862	genome.wustl.edu	37	16	71660355	71660355	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:71660355C>T	ENST00000268485.3	+	1	267	c.223C>T	c.(223-225)Cgg>Tgg	p.R75W	MARVELD3_ENST00000299952.4_Missense_Mutation_p.R75W|RP11-432I5.2_ENST00000562763.1_RNA|MARVELD3_ENST00000565261.1_Missense_Mutation_p.R75W|MARVELD3_ENST00000567566.1_Missense_Mutation_p.R75W|MARVELD3_ENST00000567501.1_5'Flank	NM_052858.4	NP_443090.4	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	75	Arg-rich.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				GAACCGGGACCgggagaggga	0.706																																																	0													29.0	45.0	39.0					16																	71660355		1906	3711	5617	SO:0001583	missense	0			BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000268485.3:c.223C>T	16.37:g.71660355C>T	ENSP00000268485:p.Arg75Trp		A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	NULL	p.R75W	ENST00000268485.3	37	c.223	CCDS10904.1	16	.	.	.	.	.	.	.	.	.	.	C	2.694	-0.272461	0.05716	.	.	ENSG00000140832	ENST00000268485;ENST00000299952	T;T	0.64991	-0.13;-0.13	1.8	-3.61	0.04556	.	0.390690	0.08080	U	1.000000	T	0.61375	0.2342	L	0.42245	1.32	0.38770	D	0.954525	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.56434	0.794;0.798;0.722	T	0.61744	-0.7000	10	0.54805	T	0.06	.	5.0546	0.14525	0.413:0.4286:0.1585:0.0	.	75;75;98	Q96A59-2;Q96A59;Q9BSH2	.;MALD3_HUMAN;.	W	75	ENSP00000268485:R75W;ENSP00000299952:R75W	ENSP00000268485:R75W	R	+	1	2	MARVELD3	70217856	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	-2.946000	0.00680	-2.976000	0.00284	-1.855000	0.00564	CGG	MARVELD3	-	NULL	ENSG00000140832		0.706	MARVELD3-002	KNOWN	basic|CCDS	protein_coding	MARVELD3	HGNC	protein_coding	OTTHUMT00000268991.2	-	0.00	42	0	C	NM_052858		71660355	+1	tier1	-	no_errors	ENST00000299952	ensembl	human	known	74_37	missense	28.57	15	6	SNP	0.086	T
MEG3	55384	genome.wustl.edu	37	14	101327163	101327163	+	RNA	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:101327163G>A	ENST00000554041.1	-	0	143																											ggtcagacccgtgggctggac	0.662																																																	0																																												0																															14.37:g.101327163G>A				RNA	SNP	-	NULL	ENST00000554041.1	37	NULL		14																																																																																			MEG3	-	-	ENSG00000214548		0.662	RP11-123M6.2-001	KNOWN	basic	antisense	MEG3	HGNC	antisense	OTTHUMT00000414687.1	-	0.00	49	0	G			101327163	+1	tier1	-	no_errors	ENST00000398460	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.000	A
MEPE	56955	genome.wustl.edu	37	4	88766811	88766811	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:88766811A>G	ENST00000424957.3	+	4	864	c.791A>G	c.(790-792)gAc>gGc	p.D264G	MEPE_ENST00000497649.2_Missense_Mutation_p.D240G|MEPE_ENST00000560249.1_Missense_Mutation_p.D151G|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000540395.1_Missense_Mutation_p.D151G|MEPE_ENST00000395102.4_Missense_Mutation_p.D295G|MEPE_ENST00000361056.3_Missense_Mutation_p.D264G	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	264					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		CCTTTTAAGGACATTCCTGGT	0.458																																																	0													59.0	58.0	59.0					4																	88766811		2203	4300	6503	SO:0001583	missense	0			AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.791A>G	4.37:g.88766811A>G	ENSP00000416984:p.Asp264Gly		A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	pfam_Osteoregulin	p.D264G	ENST00000424957.3	37	c.791	CCDS3625.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.08|13.08	2.130316|2.130316	0.37630|0.37630	.|.	.|.	ENSG00000152595|ENSG00000152595	ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056|ENST00000535138	T;T;T;T;T|.	0.49432|.	0.78;0.79;0.78;0.79;0.78|.	3.84|3.84	2.67|2.67	0.31697|0.31697	.|.	0.273130|.	0.26496|.	N|.	0.024046|.	T|T	0.49355|0.49355	0.1552|0.1552	M|M	0.74258|0.74258	2.255|2.255	0.26592|0.26592	N|N	0.973183|0.973183	B|.	0.31817|.	0.341|.	B|.	0.31869|.	0.137|.	T|T	0.46596|0.46596	-0.9180|-0.9180	10|6	0.54805|0.72032	T|D	0.06|0.01	-15.3475|-15.3475	5.9596|5.9596	0.19293|0.19293	0.8837:0.0:0.1163:0.0|0.8837:0.0:0.1163:0.0	.|.	264|.	Q9NQ76|.	MEPE_HUMAN|.	G|A	264;295;240;151;264|264	ENSP00000416984:D264G;ENSP00000378534:D295G;ENSP00000422747:D240G;ENSP00000443491:D151G;ENSP00000354341:D264G|.	ENSP00000354341:D264G|ENSP00000445423:T264A	D|T	+|+	2|1	0|0	MEPE|MEPE	88985835|88985835	0.442000|0.442000	0.25633|0.25633	0.867000|0.867000	0.34043|0.34043	0.916000|0.916000	0.54674|0.54674	2.528000|2.528000	0.45624|0.45624	0.850000|0.850000	0.35239|0.35239	0.459000|0.459000	0.35465|0.35465	GAC|ACA	MEPE	-	NULL	ENSG00000152595		0.458	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPE	HGNC	protein_coding	OTTHUMT00000253038.1	-	0.00	28	0	A			88766811	+1	tier1	-	no_errors	ENST00000361056	ensembl	human	known	74_37	missense	43.75	9	7	SNP	0.907	G
MGA	23269	genome.wustl.edu	37	15	42042415	42042415	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:42042415G>T	ENST00000570161.1	+	16	6610	c.6610G>T	c.(6610-6612)Gaa>Taa	p.E2204*	MGA_ENST00000545763.1_Nonsense_Mutation_p.E1995*|MGA_ENST00000389936.4_Nonsense_Mutation_p.E2165*|MGA_ENST00000219905.7_Nonsense_Mutation_p.E2204*|MGA_ENST00000566586.1_Nonsense_Mutation_p.E1995*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GTTAATTAAAGAAACAAAGAC	0.408																																																	0													138.0	135.0	136.0					15																	42042415		1858	4103	5961	SO:0001587	stop_gained	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6610G>T	15.37:g.42042415G>T	ENSP00000457035:p.Glu2204*		Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.E2204*	ENST00000570161.1	37	c.6610	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	15.97	2.991161	0.54041	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	4.36	2.42	0.29668	.	1.910490	0.02601	N	0.101063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.2916	0.06950	0.0942:0.3224:0.4178:0.1656	.	.	.	.	X	2204;2165;1995	.	ENSP00000219905:E2204X	E	+	1	0	MGA	39829707	0.986000	0.35501	0.975000	0.42487	0.283000	0.27025	0.203000	0.17315	0.444000	0.26612	0.467000	0.42956	GAA	MGA	-	NULL	ENSG00000174197		0.408	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1		0.00	66	0	G	NM_001164273.1		42042415	+1			no_errors	ENST00000219905	ensembl	human	known	74_37	nonsense	6.67	28	2	SNP	0.008	T
MICALCL	84953	genome.wustl.edu	37	11	12315442	12315442	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:12315442delA	ENST00000256186.2	+	3	755	c.464delA	c.(463-465)gaafs	p.E155fs		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	155					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		GAAGACCGGGAAAAAGGGAGT	0.572																																																	0													60.0	68.0	65.0					11																	12315442		1949	4131	6080	SO:0001589	frameshift_variant	0			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.464delA	11.37:g.12315442delA	ENSP00000256186:p.Glu155fs		Q7RTP7|Q96JU6	Frame_Shift_Del	DEL	pfam_DUF3585,smart_ProQ/FinO	p.S158fs	ENST00000256186.2	37	c.464	CCDS41620.1	11																																																																																			MICALCL	-	NULL	ENSG00000133808		0.572	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALCL	HGNC	protein_coding	OTTHUMT00000386164.1		0.00	38	0	A	NM_032867		12315442	+1	tier1		no_errors	ENST00000256186	ensembl	human	known	74_37	frame_shift_del	6.67	28	2	DEL	0.000	-
MEST	4232	genome.wustl.edu	37	7	130135888	130135888	+	Intron	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:130135888G>T	ENST00000223215.4	+	2	402				MEST_ENST00000437945.1_Intron|MEST_ENST00000341441.5_Intron|MEST_ENST00000378576.4_Intron|hsa-mir-335_ENST00000604666.1_RNA|MEST_ENST00000393187.1_Intron|MIR335_ENST00000362173.1_RNA|MEST_ENST00000416162.2_Intron	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript						mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					aacagcatttggagataggtg	0.358																																					Colon(126;2182 2305 6517 35181)												0													41.0	40.0	40.0					7																	130135888		692	1591	2283	SO:0001627	intron_variant	0				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.181+525G>T	7.37:g.130135888G>T			B2R6S1|O14973|O15007|Q6AI49|Q92571	RNA	SNP	-	NULL	ENST00000223215.4	37	NULL	CCDS5822.1	7																																																																																			hsa-mir-335	-	-	ENSG00000270823		0.358	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR335	miRBase	protein_coding	OTTHUMT00000345183.2	-	0.00	47	0	G	NM_002402		130135888	-1	tier1	-	no_errors	ENST00000604666	ensembl	human	known	74_37	rna	15.38	22	4	SNP	0.006	T
MKI67	4288	genome.wustl.edu	37	10	129905112	129905113	+	Frame_Shift_Del	DEL	TG	TG	-	rs145960091		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:129905112_129905113delTG	ENST00000368654.3	-	13	5366_5367	c.4991_4992delCA	c.(4990-4992)acafs	p.T1664fs	MKI67_ENST00000368653.3_Frame_Shift_Del_p.T1304fs	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1664	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTGTTGGCTCTGTGTGTGTGTG	0.51																																																	0																																										SO:0001589	frameshift_variant	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4991_4992delCA	10.37:g.129905122_129905123delTG	ENSP00000357643:p.Thr1664fs		Q5VWH2	Frame_Shift_Del	DEL	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.T1664fs	ENST00000368654.3	37	c.4992_4991	CCDS7659.1	10																																																																																			MKI67	-	pfam_K167R	ENSG00000148773		0.510	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1		0.00	60	0	TG	NM_002417		129905113	-1	tier1		no_errors	ENST00000368654	ensembl	human	known	74_37	frame_shift_del	10.16	115	13	DEL	0.000:0.000	-
MMP16	4325	genome.wustl.edu	37	8	89086899	89086899	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:89086899G>A	ENST00000286614.6	-	7	1437	c.1156C>T	c.(1156-1158)Cgg>Tgg	p.R386W	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	386					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GGCAAGCCCCGCCAGAAGTAA	0.433																																																	0													138.0	135.0	136.0					8																	89086899		2203	4300	6503	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1156C>T	8.37:g.89086899G>A	ENSP00000286614:p.Arg386Trp		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.R386W	ENST00000286614.6	37	c.1156	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	G	19.76	3.888164	0.72524	.	.	ENSG00000156103	ENST00000286614	T	0.02787	4.16	4.88	0.476	0.16779	Hemopexin/matrixin, conserved site (1);Hemopexin/matrixin (2);	0.099224	0.64402	D	0.000003	T	0.16257	0.0391	M	0.88979	2.995	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.75484	0.986;0.929	T	0.03287	-1.1052	10	0.49607	T	0.09	.	14.5279	0.67902	0.0:0.0:0.4489:0.5511	.	386;386	P51512-2;P51512	.;MMP16_HUMAN	W	386	ENSP00000286614:R386W	ENSP00000286614:R386W	R	-	1	2	MMP16	89156015	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.213000	0.32407	0.151000	0.19162	-0.158000	0.13435	CGG	MMP16	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat	ENSG00000156103		0.433	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	-	0.00	78	0	G	NM_005941		89086899	-1	tier1	-	no_errors	ENST00000286614	ensembl	human	known	74_37	missense	29.69	45	19	SNP	1.000	A
MOCS1	4337	genome.wustl.edu	37	6	39880681	39880681	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:39880681C>T	ENST00000340692.5	-	7	828	c.825G>A	c.(823-825)tgG>tgA	p.W275*	MOCS1_ENST00000432280.2_Nonsense_Mutation_p.W246*|MOCS1_ENST00000373175.4_Nonsense_Mutation_p.W246*|MOCS1_ENST00000308559.7_Nonsense_Mutation_p.W275*|MOCS1_ENST00000373195.3_Nonsense_Mutation_p.W188*|MOCS1_ENST00000373188.2_Nonsense_Mutation_p.W275*|MOCS1_ENST00000425303.2_Nonsense_Mutation_p.W275*|MOCS1_ENST00000373186.4_Nonsense_Mutation_p.W275*			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	275	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					CCAGCTCTGGCCACTGCTGCC	0.582																																					NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)												0													273.0	257.0	263.0					6																	39880681		2203	4300	6503	SO:0001587	stop_gained	0			AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.825G>A	6.37:g.39880681C>T	ENSP00000344794:p.Trp275*		B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Nonsense_Mutation	SNP	pfam_Mopterin_CF_biosynth-C_dom,pfam_Mob_synth_C,pfam_rSAM,superfamily_Mopterin_CF_biosynth-C_dom,smart_Elp3/MiaB/NifB,tigrfam_MoaA,tigrfam_Mo_CF_biosynth-C	p.W275*	ENST00000340692.5	37	c.825		6	.	.	.	.	.	.	.	.	.	.	C	34	5.409656	0.96072	.	.	ENSG00000124615	ENST00000373186;ENST00000308559;ENST00000373175;ENST00000373188;ENST00000373195;ENST00000341481;ENST00000340692;ENST00000425303;ENST00000432280	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-19.1588	17.9918	0.89171	0.0:1.0:0.0:0.0	.	.	.	.	X	275;275;246;275;188;27;275;275;246	.	.	W	-	3	0	MOCS1	39988659	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.452000	0.80683	2.346000	0.79739	0.655000	0.94253	TGG	MOCS1	-	pfam_Mob_synth_C,tigrfam_MoaA	ENSG00000124615		0.582	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	MOCS1	HGNC	protein_coding	OTTHUMT00000040476.2		0.00	31	0	C	NM_005943		39880681	-1			no_errors	ENST00000340692	ensembl	human	known	74_37	nonsense	9.52	38	4	SNP	1.000	T
MPDZ	8777	genome.wustl.edu	37	9	13110012	13110012	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:13110012C>A	ENST00000319217.7	-	45	6128	c.5881G>T	c.(5881-5883)Gca>Tca	p.A1961S	MPDZ_ENST00000381022.2_Missense_Mutation_p.A1932S|MPDZ_ENST00000536827.1_Missense_Mutation_p.A1899S|MPDZ_ENST00000546205.1_Missense_Mutation_p.A1975S|MPDZ_ENST00000541718.1_Missense_Mutation_p.A1932S|MPDZ_ENST00000541093.1_Missense_Mutation_p.A195S|MPDZ_ENST00000538841.1_Missense_Mutation_p.A820S|MPDZ_ENST00000381015.4_Missense_Mutation_p.A1961S|MPDZ_ENST00000447879.1_Missense_Mutation_p.A1928S	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1961					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.A1933S(1)|p.A1932S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CTGGAACTTGCAGGCTCCTGC	0.458																																																	2	Substitution - Missense(2)	lung(2)											74.0	74.0	74.0					9																	13110012		1985	4173	6158	SO:0001583	missense	0			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.5881G>T	9.37:g.13110012C>A	ENSP00000320006:p.Ala1961Ser		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.A1961S	ENST00000319217.7	37	c.5881		9	.	.	.	.	.	.	.	.	.	.	C	5.562	0.288497	0.10513	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000438511;ENST00000541093;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T;T;T;T;T	0.13778	2.85;2.82;2.82;2.56;2.63;2.79;2.82;2.83;2.87;2.85;2.85	5.83	1.89	0.25635	PDZ/DHR/GLGF (1);	0.871227	0.09683	N	0.769523	T	0.06554	0.0168	N	0.19112	0.55	0.09310	N	1	B;B;B;B;P;B;B;B	0.35174	0.236;0.001;0.0;0.348;0.488;0.348;0.013;0.0	B;B;B;B;B;B;B;B	0.36244	0.05;0.002;0.003;0.22;0.155;0.108;0.013;0.001	T	0.25950	-1.0117	10	0.05959	T	0.93	.	2.1696	0.03846	0.1154:0.3619:0.3025:0.2202	.	1899;820;666;1928;1841;1932;1961;654	B7ZMI4;B7ZB24;B4DGX5;O75970-3;E7EPZ1;O75970-2;O75970;B3KRN5	.;.;.;.;.;.;MPDZ_HUMAN;.	S	1961;1932;1932;502;195;897;820;1899;1928;1961;1841;1975	ENSP00000320006:A1961S;ENSP00000439807:A1932S;ENSP00000370410:A1932S;ENSP00000415964:A502S;ENSP00000445259:A195S;ENSP00000444230:A897S;ENSP00000444717:A820S;ENSP00000444151:A1899S;ENSP00000415208:A1928S;ENSP00000370403:A1961S;ENSP00000446358:A1975S	ENSP00000320006:A1961S	A	-	1	0	MPDZ	13100012	0.193000	0.23313	0.061000	0.19648	0.474000	0.32979	0.411000	0.21115	0.467000	0.27218	0.644000	0.83932	GCA	MPDZ	-	superfamily_PDZ	ENSG00000107186		0.458	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	HGNC	protein_coding	OTTHUMT00000055485.2		0.00	50	0	C	NM_003829		13110012	-1			no_errors	ENST00000319217	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.005	A
MROH9	80133	genome.wustl.edu	37	1	170993634	170993634	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:170993634A>C	ENST00000367759.4	+	18	2161	c.2007A>C	c.(2005-2007)gaA>gaC	p.E669D		NM_001163629.1	NP_001157101.1	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	0																	TGGTTCTAGAAGGCTTGGTGC	0.373																																																	0													320.0	282.0	294.0					1																	170993634		692	1591	2283	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367759.4:c.2007A>C	1.37:g.170993634A>C	ENSP00000356733:p.Glu669Asp		A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E669D	ENST00000367759.4	37	c.2007	CCDS53429.1	1	.	.	.	.	.	.	.	.	.	.	A	3.354	-0.131847	0.06753	.	.	ENSG00000117501	ENST00000367759	T	0.66638	-0.22	5.91	2.18	0.27775	.	.	.	.	.	T	0.16642	0.0400	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.22068	-1.0227	9	0.20046	T	0.44	.	2.5269	0.04693	0.611:0.1572:0.0813:0.1505	.	669	F5GWX6	.	D	669	ENSP00000356733:E669D	ENSP00000356733:E669D	E	+	3	2	C1orf129	169260258	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.769000	0.26604	0.105000	0.17753	0.533000	0.62120	GAA	MROH9	-	superfamily_ARM-type_fold	ENSG00000117501		0.373	MROH9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH9	HGNC	protein_coding		-	0.00	101	0	A	NM_025063		170993634	+1	tier1	-	no_errors	ENST00000367759	ensembl	human	known	74_37	missense	21.69	65	18	SNP	0.000	C
MUC12	10071	genome.wustl.edu	37	7	100647092	100647092	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:100647092G>A	ENST00000379442.3	+	5	13677	c.13677G>A	c.(13675-13677)ccG>ccA	p.P4559P	MUC12_ENST00000536621.1_Silent_p.P4416P			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4559	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACAGCAGCCCGGGCTCAACTC	0.532																																																	0													59.0	92.0	82.0					7																	100647092		669	1580	2249	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.13677G>A	7.37:g.100647092G>A			A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA_dom	p.P4416	ENST00000379442.3	37	c.13248		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.532	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	334	0	G	XM_379904		100647092	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	silent	8.92	245	24	SNP	0.000	A
MUC19	283463	genome.wustl.edu	37	12	40918475	40918475	+	3'UTR	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:40918475A>C	ENST00000474954.1	+	0	1173				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						aaattacagaaaattatcata	0.254																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*1170A>C	12.37:g.40918475A>C			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.254	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	19	0	A	XM_003403524		40918475	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	25.00	12	4	SNP	0.346	C
MUC19	283463	genome.wustl.edu	37	12	40919205	40919205	+	3'UTR	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:40919205A>G	ENST00000474954.1	+	0	1903				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CTCTGGTACAAGAGTCACCCC	0.517																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*1900A>G	12.37:g.40919205A>G			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.517	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	134	0	A	XM_003403524		40919205	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	22.50	62	18	SNP	0.008	G
MUC19	283463	genome.wustl.edu	37	12	40925451	40925451	+	3'UTR	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:40925451T>G	ENST00000474954.1	+	0	3721				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CCTACAAAACTTAGTGAAAAC	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*3718T>G	12.37:g.40925451T>G			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.368	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	24	0	T	XM_003403524		40925451	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.002	G
MXRA5	25878	genome.wustl.edu	37	X	3235678	3235678	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:3235678G>A	ENST00000217939.6	-	6	6198	c.6044C>T	c.(6043-6045)gCg>gTg	p.A2015V		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2015	Ig-like C2-type 4.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGAGAAGGACGCCTCCTTGAT	0.632																																																	0													38.0	33.0	35.0					X																	3235678		2203	4300	6503	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6044C>T	X.37:g.3235678G>A	ENSP00000217939:p.Ala2015Val		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A2015V	ENST00000217939.6	37	c.6044	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	g	9.806	1.181820	0.21787	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.64618	-0.11	3.55	3.55	0.40652	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35235	U	0.003354	T	0.45094	0.1325	N	0.04148	-0.265	0.09310	N	0.999999	P	0.52842	0.956	P	0.52309	0.695	T	0.46857	-0.9161	10	0.02654	T	1	.	14.9544	0.71101	0.0:0.0:1.0:0.0	.	2015	Q9NR99	MXRA5_HUMAN	V	2015	ENSP00000217939:A2015V	ENSP00000217939:A2015V	A	-	2	0	MXRA5	3245678	0.722000	0.28017	0.059000	0.19551	0.954000	0.61252	2.360000	0.44151	1.399000	0.46721	0.544000	0.68410	GCG	MXRA5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000101825		0.632	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2		0.00	41	0	G	NM_015419		3235678	-1			no_errors	ENST00000217939	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.221	A
MXRA5	25878	genome.wustl.edu	37	X	3242385	3242385	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:3242385C>T	ENST00000217939.6	-	5	1495	c.1341G>A	c.(1339-1341)acG>acA	p.T447T		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	447						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CCTTCTTGGCCGTACTCTGAC	0.488																																																	0													127.0	124.0	125.0					X																	3242385		2203	4300	6503	SO:0001819	synonymous_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1341G>A	X.37:g.3242385C>T			Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T447	ENST00000217939.6	37	c.1341	CCDS14124.1	X																																																																																			MXRA5	-	NULL	ENSG00000101825		0.488	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	-	0.00	24	0	C	NM_015419		3242385	-1	tier1	-	no_errors	ENST00000217939	ensembl	human	known	74_37	silent	50.00	7	7	SNP	0.022	T
MYH10	4628	genome.wustl.edu	37	17	8409731	8409731	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:8409731G>T	ENST00000269243.4	-	25	3336	c.3198C>A	c.(3196-3198)gaC>gaA	p.D1066E	MYH10_ENST00000379980.4_Missense_Mutation_p.D1082E|MYH10_ENST00000396239.1_Missense_Mutation_p.D1087E|MYH10_ENST00000360416.3_Missense_Mutation_p.D1097E	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1066					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GGTCCTGCAGGTCGGTCGTCT	0.537																																																	0													127.0	108.0	115.0					17																	8409731		2203	4300	6503	SO:0001583	missense	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.3198C>A	17.37:g.8409731G>T	ENSP00000269243:p.Asp1066Glu		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1087E	ENST00000269243.4	37	c.3261	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	G	9.598	1.127921	0.20959	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	4.87	-0.0229	0.13945	.	0.000000	0.85682	D	0.000000	D	0.82641	0.5081	L	0.38733	1.17	0.50171	D	0.999859	B;B;B	0.13145	0.007;0.002;0.007	B;B;B	0.25987	0.029;0.065;0.029	T	0.75221	-0.3394	10	0.72032	D	0.01	.	10.5367	0.45009	0.4187:0.0:0.5812:0.0	.	1075;1097;1066	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	E	1066;1097;1087;1082	ENSP00000269243:D1066E;ENSP00000353590:D1097E;ENSP00000379539:D1087E;ENSP00000369315:D1082E	ENSP00000269243:D1066E	D	-	3	2	MYH10	8350456	1.000000	0.71417	0.987000	0.45799	0.549000	0.35272	1.768000	0.38511	0.161000	0.19458	0.563000	0.77884	GAC	MYH10	-	superfamily_HR1_rho-bd	ENSG00000133026		0.537	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	-	0.00	76	0	G			8409731	-1	tier1	-	no_errors	ENST00000396239	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
MYH2	4620	genome.wustl.edu	37	17	10432983	10432983	+	Silent	SNP	G	G	C	rs267604722		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:10432983G>C	ENST00000245503.5	-	24	3399	c.3015C>G	c.(3013-3015)ctC>ctG	p.L1005L	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000397183.2_Silent_p.L1005L|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1005					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GGGCCTCCTGGAGAGCCTTCT	0.488																																																	0													133.0	130.0	131.0					17																	10432983		2202	4281	6483	SO:0001819	synonymous_variant	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3015C>G	17.37:g.10432983G>C			A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1005	ENST00000245503.5	37	c.3015	CCDS11156.1	17																																																																																			MYH2	-	superfamily_Prefoldin	ENSG00000125414		0.488	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	-	0.00	64	0	G	NM_017534		10432983	-1	tier1	-	no_errors	ENST00000245503	ensembl	human	known	74_37	silent	18.09	77	17	SNP	1.000	C
NACAD	23148	genome.wustl.edu	37	7	45120588	45120588	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:45120588C>A	ENST00000490531.2	-	6	4457	c.4438G>T	c.(4438-4440)Gca>Tca	p.A1480S		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	1480					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A1480T(1)		breast(1)|endometrium(2)|skin(2)	5						TTCTCAGCTGCGGCTTTGTGC	0.592																																																	1	Substitution - Missense(1)	endometrium(1)											83.0	80.0	81.0					7																	45120588		692	1591	2283	SO:0001583	missense	0			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.4438G>T	7.37:g.45120588C>A	ENSP00000420477:p.Ala1480Ser			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,pfscan_Nas_poly-pep-assoc_cplx_dom	p.A1480S	ENST00000490531.2	37	c.4438	CCDS47582.1	7	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228042	0.79576	.	.	ENSG00000136274	ENST00000490531	T	0.17854	2.25	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.53351	0.1791	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.68880	-0.5292	10	0.87932	D	0	-18.0272	15.8202	0.78633	0.0:1.0:0.0:0.0	.	1480	O15069	NACAD_HUMAN	S	1480	ENSP00000420477:A1480S	ENSP00000420477:A1480S	A	-	1	0	NACAD	45087113	1.000000	0.71417	0.593000	0.28771	0.808000	0.45660	7.573000	0.82421	2.302000	0.77476	0.442000	0.29010	GCA	NACAD	-	NULL	ENSG00000136274		0.592	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	HGNC	protein_coding	OTTHUMT00000353652.2		0.00	30	0	C	NM_001146334		45120588	-1			no_errors	ENST00000490531	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	A
NAV1	89796	genome.wustl.edu	37	1	201618242	201618242	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:201618242C>A	ENST00000367296.4	+	1	866	c.446C>A	c.(445-447)gCc>gAc	p.A149D	NAV1_ENST00000367297.4_Missense_Mutation_p.A149D|NAV1_ENST00000367300.3_Missense_Mutation_p.A149D|NAV1_ENST00000367302.1_Missense_Mutation_p.A162D|NAV1_ENST00000295624.6_Missense_Mutation_p.A149D	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	149					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CTCTTCCAGGCCAAGGGCAGC	0.687																																																	0													29.0	32.0	31.0					1																	201618242		2201	4298	6499	SO:0001583	missense	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.446C>A	1.37:g.201618242C>A	ENSP00000356265:p.Ala149Asp		A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A149D	ENST00000367296.4	37	c.446	CCDS1414.2	1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697227	0.48202	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	4.89	4.89	0.63831	.	0.240256	0.34314	N	0.004080	T	0.22513	0.0543	N	0.08118	0	0.26255	N	0.978661	B	0.16603	0.018	B	0.22880	0.042	T	0.08848	-1.0702	10	0.56958	D	0.05	-12.9535	7.0835	0.25244	0.0:0.7309:0.176:0.0931	.	149	Q8NEY1-3	.	D	162;149;149;149;149	ENSP00000356271:A162D;ENSP00000356265:A149D;ENSP00000295624:A149D;ENSP00000356266:A149D;ENSP00000356269:A149D	ENSP00000295624:A149D	A	+	2	0	NAV1	199884865	0.999000	0.42202	1.000000	0.80357	0.812000	0.45895	1.978000	0.40598	2.251000	0.74343	0.313000	0.20887	GCC	NAV1	-	NULL	ENSG00000134369		0.687	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1		0.00	46	0	C	NM_020443		201618242	+1			no_errors	ENST00000367296	ensembl	human	known	74_37	missense	17.95	32	7	SNP	1.000	A
NBAS	51594	genome.wustl.edu	37	2	15555674	15555674	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:15555674G>T	ENST00000281513.5	-	25	2958	c.2933C>A	c.(2932-2934)cCa>cAa	p.P978Q	NBAS_ENST00000441750.1_Intron	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	978					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ACTTACATCTGGTTTGGAATG	0.338																																																	0													54.0	59.0	57.0					2																	15555674		2203	4299	6502	SO:0001583	missense	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2933C>A	2.37:g.15555674G>T	ENSP00000281513:p.Pro978Gln		O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.P978Q	ENST00000281513.5	37	c.2933	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235762	0.58886	.	.	ENSG00000151779	ENST00000281513	T	0.17213	2.29	6.17	5.29	0.74685	Secretory pathway Sec39 (1);	0.045517	0.85682	D	0.000000	T	0.34861	0.0912	L	0.45698	1.435	0.80722	D	1	D	0.56746	0.977	P	0.62298	0.9	T	0.08848	-1.0702	10	0.87932	D	0	.	17.6818	0.88246	0.0:0.1228:0.8772:0.0	.	978	A2RRP1	NBAS_HUMAN	Q	978	ENSP00000281513:P978Q	ENSP00000281513:P978Q	P	-	2	0	NBAS	15473125	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.484000	0.81180	1.615000	0.50252	0.655000	0.94253	CCA	NBAS	-	pfam_Sec39	ENSG00000151779		0.338	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	-	0.00	165	0	G	NM_015909		15555674	-1	tier1	-	no_errors	ENST00000281513	ensembl	human	known	74_37	missense	5.68	83	5	SNP	1.000	T
NCK2	8440	genome.wustl.edu	37	2	106471533	106471533	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:106471533T>G	ENST00000233154.4	+	3	456	c.14T>G	c.(13-15)gTt>gGt	p.V5G	AC009505.2_ENST00000596418.1_RNA|AC009505.2_ENST00000598281.1_RNA|NCK2_ENST00000451463.2_Missense_Mutation_p.V5G|AC009505.2_ENST00000427050.2_RNA|NCK2_ENST00000522586.1_Missense_Mutation_p.V5G|NCK2_ENST00000393349.2_Missense_Mutation_p.V5G	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	5	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						ACAGAAGAAGTTATTGTGATA	0.502																																																	0													81.0	82.0	82.0					2																	106471533		2203	4300	6503	SO:0001583	missense	0			AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.14T>G	2.37:g.106471533T>G	ENSP00000233154:p.Val5Gly		D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.V5G	ENST00000233154.4	37	c.14	CCDS33266.1	2	.	.	.	.	.	.	.	.	.	.	T	16.86	3.238331	0.58886	.	.	ENSG00000071051	ENST00000233154;ENST00000451463;ENST00000393348;ENST00000522586;ENST00000425756;ENST00000393349	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	5.84	5.84	0.93424	Src homology-3 domain (4);	0.058441	0.64402	D	0.000002	T	0.31167	0.0788	L	0.49126	1.545	0.80722	D	1	B;B	0.34181	0.164;0.44	B;B	0.30646	0.055;0.118	T	0.10730	-1.0617	10	0.87932	D	0	.	16.2141	0.82191	0.0:0.0:0.0:1.0	.	5;5	E7ERP6;O43639	.;NCK2_HUMAN	G	5	ENSP00000233154:V5G;ENSP00000410428:V5G;ENSP00000377017:V5G;ENSP00000431109:V5G;ENSP00000408040:V5G;ENSP00000377018:V5G	ENSP00000233154:V5G	V	+	2	0	NCK2	105837965	1.000000	0.71417	0.929000	0.37066	0.996000	0.88848	4.695000	0.61767	2.230000	0.72887	0.528000	0.53228	GTT	NCK2	-	superfamily_SH3_domain,smart_SH3_domain,pirsf_Cytoplasmic_NCK,pfscan_SH3_domain,prints_SH3_domain	ENSG00000071051		0.502	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCK2	HGNC	protein_coding	OTTHUMT00000329634.1	-	0.00	63	0	T	NM_003581		106471533	+1	tier1	-	no_errors	ENST00000233154	ensembl	human	known	74_37	missense	22.73	34	10	SNP	0.999	G
NCOR2	9612	genome.wustl.edu	37	12	124887093	124887094	+	In_Frame_Ins	INS	-	-	TGT			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:124887093_124887094insTGT	ENST00000405201.1	-	14	1496_1497	c.1496_1497insACA	c.(1495-1497)cag>caACAg	p.499_499Q>QQ	NCOR2_ENST00000429285.2_In_Frame_Ins_p.498_498Q>QQ|NCOR2_ENST00000356219.3_In_Frame_Ins_p.499_499Q>QQ|NCOR2_ENST00000404121.2_In_Frame_Ins_p.69_69Q>QQ|NCOR2_ENST00000397355.1_In_Frame_Ins_p.499_499Q>QQ|NCOR2_ENST00000404621.1_In_Frame_Ins_p.498_498Q>QQ			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgctg	0.619																																																	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)																																								SO:0001652	inframe_insertion	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1494_1496dupACA	12.37:g.124887097_124887099dupTGT	ENSP00000384018:p.Gln510dup		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.503in_frame_insQ	ENST00000405201.1	37	c.1497_1496	CCDS41858.2	12																																																																																			NCOR2	-	NULL	ENSG00000196498		0.619	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2		0.00	26	0	-	NM_006312		124887094	-1	tier1		no_errors	ENST00000356219	ensembl	human	known	74_37	in_frame_ins	10.53	17	2	INS	0.999:0.999	TGT
NEFH	4744	genome.wustl.edu	37	22	29879382	29879382	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr22:29879382C>T	ENST00000310624.6	+	2	935	c.902C>T	c.(901-903)tCg>tTg	p.S301L		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	301	Coil 2B.|Rod.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GACCGACTGTCGGAGGCAGCC	0.562																																																	0													134.0	141.0	139.0					22																	29879382		2203	4300	6503	SO:0001583	missense	0				CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.902C>T	22.37:g.29879382C>T	ENSP00000311997:p.Ser301Leu		B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	pfam_IF,pfam_DUF1388	p.S301L	ENST00000310624.6	37	c.902	CCDS13858.1	22	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735505	0.69189	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.89270	-2.49	5.62	5.62	0.85841	Filament (1);	0.000000	0.41712	D	0.000824	D	0.94725	0.8298	M	0.86953	2.85	0.43559	D	0.995872	D	0.89917	1.0	D	0.70227	0.968	D	0.95200	0.8316	10	0.87932	D	0	.	14.5042	0.67741	0.1467:0.8533:0.0:0.0	.	301	P12036	NFH_HUMAN	L	301	ENSP00000311997:S301L	ENSP00000311997:S301L	S	+	2	0	NEFH	28209382	1.000000	0.71417	0.970000	0.41538	0.700000	0.40528	5.550000	0.67268	2.651000	0.90000	0.650000	0.86243	TCG	NEFH	-	pfam_IF	ENSG00000100285		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEFH	HGNC	protein_coding	OTTHUMT00000321553.2	-	0.00	26	0	C	NM_021076		29879382	+1	tier1	-	no_errors	ENST00000310624	ensembl	human	known	74_37	missense	28.57	15	6	SNP	0.998	T
NEIL1	79661	genome.wustl.edu	37	15	75646605	75646605	+	Silent	SNP	G	G	A	rs368488989		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:75646605G>A	ENST00000564784.1	+	8	1490	c.861G>A	c.(859-861)ccG>ccA	p.P287P	NEIL1_ENST00000569035.1_Silent_p.P287P|NEIL1_ENST00000355059.4_Silent_p.P287P|MIR631_ENST00000384904.1_RNA|RP11-817O13.6_ENST00000563660.1_lincRNA			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	287					base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						ATCCTGGACCGTTGGCACCCA	0.547								Base excision repair (BER), DNA glycosylases																																									0								G		0,4394		0,0,2197	105.0	98.0	100.0		861	-4.8	0.7	15		100	1,8587	1.2+/-3.3	0,1,4293	no	coding-synonymous	NEIL1	NM_024608.2		0,1,6490	AA,AG,GG		0.0116,0.0,0.0077		287/391	75646605	1,12981	2197	4294	6491	SO:0001819	synonymous_variant	0			AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.861G>A	15.37:g.75646605G>A			D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Silent	SNP	pfam_Endonuclease-VIII_DNA-bd,pfam_DNA_glycosylase/AP_lyase_cat,pfam_DNA_glyclase/AP_lyase_DNA-bd,superfamily_DNA_glycosylase/AP_lyase_cat,superfamily_Ribosomal_S13-like_H2TH,smart_DNA_glycosylase/AP_lyase_cat,pfscan_DNA_glycosylase/AP_lyase_cat	p.P287	ENST00000564784.1	37	c.861	CCDS10278.1	15																																																																																			NEIL1	-	pfam_Endonuclease-VIII_DNA-bd	ENSG00000140398		0.547	NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NEIL1	HGNC	protein_coding	OTTHUMT00000419885.1	-	0.00	84	0	G	NM_024608		75646605	+1	tier1	-	no_errors	ENST00000355059	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.124	A
NLGN1	22871	genome.wustl.edu	37	3	173997426	173997426	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:173997426T>G	ENST00000457714.1	+	6	2064	c.1635T>G	c.(1633-1635)aaT>aaG	p.N545K	NLGN1_ENST00000401917.3_Missense_Mutation_p.N585K|NLGN1_ENST00000545397.1_Missense_Mutation_p.N545K|NLGN1_ENST00000361589.4_Missense_Mutation_p.N545K	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	562					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ACTGGACAAATTTTGCTAAAA	0.318																																																	0													49.0	50.0	50.0					3																	173997426		2192	4271	6463	SO:0001583	missense	0			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1635T>G	3.37:g.173997426T>G	ENSP00000392500:p.Asn545Lys		Q9UPT2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.N585K	ENST00000457714.1	37	c.1755	CCDS3222.1	3	.	.	.	.	.	.	.	.	.	.	T	16.62	3.172654	0.57584	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	6.17	2.56	0.30785	.	0.000000	0.85682	D	0.000000	D	0.82834	0.5123	H	0.95982	3.75	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82384	-0.0484	10	0.87932	D	0	.	8.5218	0.33279	0.0:0.4211:0.0:0.5789	.	585;545	D2X2H5;Q8N2Q7-2	.;.	K	545;545;545;585	ENSP00000392500:N545K;ENSP00000354541:N545K;ENSP00000441108:N545K;ENSP00000385750:N585K	ENSP00000354541:N545K	N	+	3	2	NLGN1	175480120	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.733000	0.47360	0.215000	0.20761	0.533000	0.62120	AAT	NLGN1	-	pfam_CarbesteraseB	ENSG00000169760		0.318	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	-	0.00	31	0	T	NM_014932		173997426	+1	tier1	-	no_errors	ENST00000401917	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	G
NLGN3	54413	genome.wustl.edu	37	X	70373312	70373312	+	Intron	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:70373312G>A	ENST00000358741.3	+	4	820				NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Intron|NLGN3_ENST00000374051.3_Intron	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3						adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GTGTCTCCCCGTGTCTGGTCC	0.577																																					Esophageal Squamous(103;760 1488 16849 22250 40351)												0													60.0	49.0	52.0					X																	70373312		2203	4300	6503	SO:0001627	intron_variant	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.518-15G>A	X.37:g.70373312G>A			B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	RNA	SNP	-	NULL	ENST00000358741.3	37	NULL	CCDS55441.1	X																																																																																			NLGN3	-	-	ENSG00000196338		0.577	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	-	0.00	69	0	G	NM_018977		70373312	+1	tier1	-	no_errors	ENST00000476589	ensembl	human	known	74_37	rna	60.00	12	18	SNP	1.000	A
NLRP14	338323	genome.wustl.edu	37	11	7059855	7059855	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:7059855T>G	ENST00000299481.4	+	2	384	c.38T>G	c.(37-39)tTt>tGt	p.F13C		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	13	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TTTCCTGATTTTGGGCTGCTA	0.398																																																	0													91.0	99.0	96.0					11																	7059855		2201	4296	6497	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.38T>G	11.37:g.7059855T>G	ENSP00000299481:p.Phe13Cys		Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.F13C	ENST00000299481.4	37	c.38	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	T	15.46	2.841424	0.51057	.	.	ENSG00000158077	ENST00000299481	T	0.49720	0.77	4.22	3.08	0.35506	Pyrin (2);DEATH-like (2);	0.143196	0.32952	N	0.005460	T	0.48114	0.1482	L	0.29908	0.895	0.26832	N	0.968566	D	0.58620	0.983	P	0.60886	0.88	T	0.31558	-0.9939	10	0.72032	D	0.01	.	7.1898	0.25818	0.1972:0.0:0.0:0.8027	.	13	Q86W24	NAL14_HUMAN	C	13	ENSP00000299481:F13C	ENSP00000299481:F13C	F	+	2	0	NLRP14	7016431	0.973000	0.33851	0.986000	0.45419	0.881000	0.50899	0.709000	0.25734	0.940000	0.37473	0.533000	0.62120	TTT	NLRP14	-	pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN	ENSG00000158077		0.398	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1	-	0.00	55	0	T	NM_176822		7059855	+1	tier1	-	no_errors	ENST00000299481	ensembl	human	known	74_37	missense	30.36	39	17	SNP	0.989	G
NLRP4	147945	genome.wustl.edu	37	19	56382310	56382310	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:56382310G>A	ENST00000301295.6	+	7	2894	c.2472G>A	c.(2470-2472)ctG>ctA	p.L824L	NLRP4_ENST00000346986.5_Silent_p.L768L|NLRP4_ENST00000587891.1_Silent_p.L749L	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	824					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		ACGAAGGACTGAAAACTCTCT	0.502																																																	0													135.0	118.0	124.0					19																	56382310		2203	4300	6503	SO:0001819	synonymous_variant	0			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2472G>A	19.37:g.56382310G>A			Q86W87|Q96AY6	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L824	ENST00000301295.6	37	c.2472	CCDS12936.1	19																																																																																			NLRP4	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000160505		0.502	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	-	0.00	44	0	G	NM_134444		56382310	+1	tier1	-	no_errors	ENST00000301295	ensembl	human	known	74_37	silent	17.65	14	3	SNP	0.004	A
NOP14	8602	genome.wustl.edu	37	4	2956249	2956249	+	Missense_Mutation	SNP	G	G	T	rs186503666		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:2956249G>T	ENST00000314262.6	-	4	562	c.514C>A	c.(514-516)Ctt>Att	p.L172I	NOP14_ENST00000398071.4_Missense_Mutation_p.L172I|NOP14_ENST00000502735.1_Missense_Mutation_p.L172I|NOP14_ENST00000416614.2_Missense_Mutation_p.L172I|NOP14-AS1_ENST00000503709.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	172					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TTCTTGTGAAGGAGCCCACCG	0.557																																																	0													88.0	84.0	86.0					4																	2956249		2203	4300	6503	SO:0001583	missense	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.514C>A	4.37:g.2956249G>T	ENSP00000315674:p.Leu172Ile		D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	pfam_Nop14	p.L172I	ENST00000314262.6	37	c.514	CCDS33945.1	4	.	.	.	.	.	.	.	.	.	.	G	14.36	2.513373	0.44660	.	.	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	4.82	3.96	0.45880	.	0.259016	0.39544	N	0.001321	T	0.46814	0.1412	M	0.85299	2.745	0.45747	D	0.998649	P;P	0.49185	0.759;0.92	B;P	0.47626	0.237;0.552	T	0.58803	-0.7572	10	0.87932	D	0	-1.1005	14.5178	0.67830	0.0:0.1481:0.8519:0.0	.	172;172	E9PFK5;P78316	.;NOP14_HUMAN	I	172;172;172;172;71	ENSP00000405068:L172I;ENSP00000315674:L172I;ENSP00000427415:L172I;ENSP00000381146:L172I	ENSP00000315674:L172I	L	-	1	0	NOP14	2926047	1.000000	0.71417	0.002000	0.10522	0.004000	0.04260	7.403000	0.79983	0.994000	0.38892	0.655000	0.94253	CTT	NOP14	-	pfam_Nop14	ENSG00000087269		0.557	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	HGNC	protein_coding	OTTHUMT00000358135.2	-	0.00	52	0	G	NM_003703		2956249	-1	tier1	-	no_errors	ENST00000416614	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.997	T
NOTCH1	4851	genome.wustl.edu	37	9	139391546	139391546	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:139391546C>T	ENST00000277541.6	-	34	6720	c.6645G>A	c.(6643-6645)tcG>tcA	p.S2215S		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2215					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K2182fs*61(1)|p.S2163_T2283del(1)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCAGTGGCGGCGAGGCCACGT	0.687			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	2	Deletion - Frameshift(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(2)											31.0	40.0	37.0					9																	139391546		2170	4247	6417	SO:0001819	synonymous_variant	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.6645G>A	9.37:g.139391546C>T			Q59ED8|Q5SXM3	Silent	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.S2215	ENST00000277541.6	37	c.6645	CCDS43905.1	9																																																																																			NOTCH1	-	pirsf_Notch,prints_Notch_1	ENSG00000148400		0.687	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	39	0	C	NM_017617		139391546	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	silent	33.33	28	14	SNP	0.044	T
NOTCH1	4851	genome.wustl.edu	37	9	139412280	139412280	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:139412280C>T	ENST00000277541.6	-	8	1440	c.1365G>A	c.(1363-1365)gaG>gaA	p.E455E	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	455	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TCGAGACGCACTCGTTGACGT	0.667			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													58.0	65.0	63.0					9																	139412280		2178	4262	6440	SO:0001819	synonymous_variant	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1365G>A	9.37:g.139412280C>T			Q59ED8|Q5SXM3	Silent	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.E455	ENST00000277541.6	37	c.1365	CCDS43905.1	9																																																																																			NOTCH1	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom	ENSG00000148400		0.667	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	54	0	C	NM_017617		139412280	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	silent	38.46	15	10	SNP	1.000	T
NPFF	8620	genome.wustl.edu	37	12	53901175	53901175	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:53901175C>T	ENST00000267017.3	-	1	247	c.84G>A	c.(82-84)caG>caA	p.Q28Q	NPFF_ENST00000609999.1_5'UTR|RP11-793H13.10_ENST00000591834.1_Intron	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor	28					acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						GCTGGTCTTCCTGCTGGCCTC	0.572																																																	0													126.0	117.0	120.0					12																	53901175		2203	4300	6503	SO:0001819	synonymous_variant	0			AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856	ENST00000267017.3:c.84G>A	12.37:g.53901175C>T			Q3SXL4	Silent	SNP	pirsf_FMRFamid-related_peptide,prints_FMRFamid-related_peptide	p.Q28	ENST00000267017.3	37	c.84	CCDS8862.1	12																																																																																			NPFF	-	pirsf_FMRFamid-related_peptide,prints_FMRFamid-related_peptide	ENSG00000139574		0.572	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPFF	HGNC	protein_coding	OTTHUMT00000406301.1	-	0.00	52	0	C	NM_003717		53901175	-1	tier1	-	no_errors	ENST00000267017	ensembl	human	known	74_37	silent	22.73	17	5	SNP	0.000	T
NPY5R	4889	genome.wustl.edu	37	4	164272519	164272519	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:164272519G>T	ENST00000515560.1	+	4	2616	c.1094G>T	c.(1093-1095)aGt>aTt	p.S365I	NPY5R_ENST00000338566.3_Missense_Mutation_p.S365I|NPY5R_ENST00000506953.1_Missense_Mutation_p.S365I			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	365					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.S365I(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				AGATCTCGAAGTGTTTTCTAC	0.353																																					Melanoma(139;1287 1774 9781 19750 25599)												1	Substitution - Missense(1)	lung(1)											122.0	116.0	118.0					4																	164272519		2203	4300	6503	SO:0001583	missense	0			BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.1094G>T	4.37:g.164272519G>T	ENSP00000423917:p.Ser365Ile		Q6GTR7|Q92916	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_NPY5_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.S365I	ENST00000515560.1	37	c.1094	CCDS3804.1	4	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443395	0.43429	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.37915	1.17;1.17;1.17	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	0.325852	0.25642	N	0.029268	T	0.37625	0.1010	L	0.46157	1.445	0.26632	N	0.97245	P	0.46142	0.873	P	0.45998	0.5	T	0.32534	-0.9903	10	0.62326	D	0.03	.	12.5668	0.56314	0.0827:0.0:0.9173:0.0	.	365	Q15761	NPY5R_HUMAN	I	365	ENSP00000339377:S365I;ENSP00000423917:S365I;ENSP00000423474:S365I	ENSP00000339377:S365I	S	+	2	0	NPY5R	164491969	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.017000	0.49615	2.428000	0.82296	0.460000	0.39030	AGT	NPY5R	-	pfam_GPCR_Rhodpsn,prints_NPY5_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000164129		0.353	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY5R	HGNC	protein_coding	OTTHUMT00000364633.1		0.00	51	0	G	NM_006174		164272519	+1			no_errors	ENST00000338566	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.994	T
NRG1	3084	genome.wustl.edu	37	8	32616855	32616855	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:32616855A>G	ENST00000405005.3	+	10	962	c.962A>G	c.(961-963)gAg>gGg	p.E321G	NRG1_ENST00000523079.1_Missense_Mutation_p.E318G|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000338921.4_Missense_Mutation_p.E329G|NRG1_ENST00000521670.1_Missense_Mutation_p.E321G|NRG1_ENST00000539990.1_Missense_Mutation_p.E164G|NRG1_ENST00000519301.1_Missense_Mutation_p.E271G|NRG1_ENST00000356819.4_Missense_Mutation_p.E326G|NRG1_ENST00000287845.5_Missense_Mutation_p.E292G|NRG1_ENST00000287842.3_Missense_Mutation_p.E318G			Q02297	NRG1_HUMAN	neuregulin 1	321					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		ATCTCCAGTGAGCATATTGTT	0.428																																																	0													191.0	161.0	171.0					8																	32616855		2203	4300	6503	SO:0001583	missense	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.962A>G	8.37:g.32616855A>G	ENSP00000384620:p.Glu321Gly		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.E329G	ENST00000405005.3	37	c.986	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	A	26.4	4.738631	0.89573	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000521670;ENST00000539990	T;T;T;T;T;T;T;T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04;0.04;0.04;0.04;0.04;0.04;0.04;0.04	6.16	6.16	0.99307	Neuregulin 1-related, C-terminal (1);	0.114367	0.64402	D	0.000017	T	0.75554	0.3865	L	0.49126	1.545	0.58432	D	0.999992	D;D;D;D;D;D;P;D;D;D;D	0.76494	0.996;0.998;0.999;0.971;0.977;0.998;0.885;0.971;0.987;0.971;0.997	D;D;D;P;D;D;B;P;D;P;D	0.83275	0.996;0.966;0.988;0.855;0.911;0.988;0.392;0.855;0.964;0.855;0.984	T	0.76353	-0.2990	10	0.59425	D	0.04	-2.3719	16.8061	0.85666	1.0:0.0:0.0:0.0	.	164;167;318;292;326;317;329;318;321;326;321	B7Z1E3;B7Z1D7;E9PHH4;F8W9E3;Q7RTW4;B0FYA9;Q02297-2;Q02297-7;Q02297;Q02297-6;Q02297-3	.;.;.;.;.;.;.;.;NRG1_HUMAN;.;.	G	288;271;394;318;329;326;321;292;318;321;321;164	ENSP00000430053:E288G;ENSP00000429582:E271G;ENSP00000429067:E394G;ENSP00000430120:E318G;ENSP00000343395:E329G;ENSP00000349275:E326G;ENSP00000287840:E321G;ENSP00000287845:E292G;ENSP00000287842:E318G;ENSP00000384620:E321G;ENSP00000428828:E321G;ENSP00000439276:E164G	ENSP00000287840:E321G	E	+	2	0	NRG1	32736397	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.330000	0.90019	2.367000	0.80283	0.528000	0.53228	GAG	NRG1	-	pfam_Neuregulin_1_C,prints_Neuregulin	ENSG00000157168		0.428	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	73	0	A			32616855	+1	tier1	-	no_errors	ENST00000338921	ensembl	human	known	74_37	missense	8.11	68	6	SNP	1.000	G
OBSCN	84033	genome.wustl.edu	37	1	228548224	228548224	+	Intron	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:228548224T>G	ENST00000422127.1	+	80	18705				OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000570156.2_Intron|OBSCN_ENST00000284548.11_Missense_Mutation_p.V6544G|OBSCN_ENST00000366709.4_Missense_Mutation_p.V3663G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGACCCCAGGTCCGTAGCCTT	0.701																																																	0													17.0	22.0	20.0					1																	228548224		1976	4147	6123	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18662-2053T>G	1.37:g.228548224T>G			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Ig-like_dom,pfscan_DH-domain	p.V3663G	ENST00000422127.1	37	c.10988	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	T	12.38	1.919638	0.33908	.	.	ENSG00000154358	ENST00000284548;ENST00000366709	T;T	0.56103	0.48;0.62	4.58	-9.16	0.00694	.	.	.	.	.	T	0.27349	0.0671	L	0.31294	0.92	0.27258	N	0.958691	B	0.09022	0.002	B	0.08055	0.003	T	0.07597	-1.0764	9	0.19147	T	0.46	.	1.9115	0.03288	0.2425:0.3571:0.2424:0.158	.	6544	Q5VST9-3	.	G	6544;3663	ENSP00000284548:V6544G;ENSP00000355670:V3663G	ENSP00000284548:V6544G	V	+	2	0	OBSCN	226614847	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.612000	0.05616	-3.729000	0.00114	-0.462000	0.05337	GTC	OBSCN	-	NULL	ENSG00000154358		0.701	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	29	0	T	NM_052843		228548224	+1	tier1	-	no_errors	ENST00000366709	ensembl	human	known	74_37	missense	38.46	16	10	SNP	0.000	G
ODF1	4956	genome.wustl.edu	37	8	103572944	103572944	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:103572944T>G	ENST00000285402.3	+	2	741	c.585T>G	c.(583-585)tgT>tgG	p.C195W	ODF1_ENST00000518835.1_Intron	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	195					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			TCGGCAGCTGTGTCAAGATCG	0.567																																																	0													112.0	81.0	91.0					8																	103572944		2203	4300	6503	SO:0001583	missense	0			M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.585T>G	8.37:g.103572944T>G	ENSP00000285402:p.Cys195Trp		Q3SX72	Missense_Mutation	SNP	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom	p.C195W	ENST00000285402.3	37	c.585	CCDS6293.1	8	.	.	.	.	.	.	.	.	.	.	T	14.18	2.458314	0.43634	.	.	ENSG00000155087	ENST00000285402	D	0.86497	-2.13	5.06	-4.87	0.03123	Heat shock protein Hsp20 (1);	0.000000	0.64402	D	0.000012	T	0.80949	0.4722	N	0.08118	0	0.53688	D	0.999976	D	0.67145	0.996	D	0.70716	0.97	T	0.78465	-0.2193	10	0.87932	D	0	-15.1727	8.1327	0.31037	0.1227:0.1846:0.0:0.6927	.	195	Q14990	ODFP1_HUMAN	W	195	ENSP00000285402:C195W	ENSP00000285402:C195W	C	+	3	2	ODF1	103642120	0.002000	0.14202	0.835000	0.33067	0.829000	0.46940	-2.139000	0.01302	-0.804000	0.04410	-1.477000	0.00996	TGT	ODF1	-	pfscan_a-crystallin/Hsp20_dom	ENSG00000155087		0.567	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF1	HGNC	protein_coding	OTTHUMT00000379884.1	-	0.00	66	0	T			103572944	+1	tier1	-	no_errors	ENST00000285402	ensembl	human	known	74_37	missense	36.36	28	16	SNP	0.387	G
OGDH	4967	genome.wustl.edu	37	7	44695934	44695934	+	Intron	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:44695934G>T	ENST00000222673.5	+	4	559				OGDH_ENST00000444676.1_Nonsense_Mutation_p.E179*|OGDH_ENST00000447398.1_Nonsense_Mutation_p.E175*|OGDH_ENST00000443864.2_Intron|OGDH_ENST00000543843.1_Nonsense_Mutation_p.E115*|OGDH_ENST00000449767.1_Intron|OGDH_ENST00000439616.2_Intron	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)						2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	AGTTTTCAAGGAACGACTTCG	0.413																																																	0																																										SO:0001627	intron_variant	0			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.517+8576G>T	7.37:g.44695934G>T			B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Nonsense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.E115*	ENST00000222673.5	37	c.343	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	37	6.158521	0.97334	.	.	ENSG00000105953	ENST00000447398;ENST00000444676;ENST00000543843	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	19.9169	0.97065	0.0:0.0:1.0:0.0	.	.	.	.	X	175;179;115	.	ENSP00000414662:E179X	E	+	1	0	OGDH	44662459	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.730000	0.68546	2.809000	0.96659	0.650000	0.86243	GAA	OGDH	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000105953		0.413	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	HGNC	protein_coding	OTTHUMT00000339391.1	-	0.00	79	0	G			44695934	+1	tier1	-	no_errors	ENST00000543843	ensembl	human	known	74_37	nonsense	8.70	42	4	SNP	1.000	T
OR1A1	8383	genome.wustl.edu	37	17	3119716	3119716	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:3119716A>C	ENST00000304094.1	+	1	802	c.802A>C	c.(802-804)Aaa>Caa	p.K268Q		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						TTATAGCCTAAAAGACGCAGT	0.483																																																	0													152.0	134.0	140.0					17																	3119716		2203	4300	6503	SO:0001583	missense	0			AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.802A>C	17.37:g.3119716A>C	ENSP00000305207:p.Lys268Gln		A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K268Q	ENST00000304094.1	37	c.802	CCDS11022.1	17	.	.	.	.	.	.	.	.	.	.	A	10.25	1.298131	0.23650	.	.	ENSG00000172146	ENST00000304094	T	0.00048	8.82	4.75	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000052	T	0.00144	0.0004	N	0.19112	0.55	0.09310	N	1	P	0.39376	0.67	P	0.47251	0.542	T	0.55724	-0.8096	10	0.40728	T	0.16	.	9.7419	0.40424	0.9128:0.0:0.0872:0.0	.	268	Q9P1Q5	OR1A1_HUMAN	Q	268	ENSP00000305207:K268Q	ENSP00000305207:K268Q	K	+	1	0	OR1A1	3066466	0.000000	0.05858	0.799000	0.32177	0.183000	0.23260	-0.325000	0.07976	2.126000	0.65437	0.418000	0.28097	AAA	OR1A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172146		0.483	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A1	HGNC	protein_coding	OTTHUMT00000207292.1	-	0.00	52	0	A	NM_014565		3119716	+1	tier1	-	no_errors	ENST00000304094	ensembl	human	known	74_37	missense	29.73	26	11	SNP	0.014	C
OR1L4	254973	genome.wustl.edu	37	9	125486279	125486279	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:125486279A>G	ENST00000259466.1	+	1	11	c.11A>G	c.(10-12)aAg>aGg	p.K4R		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						ATGGAGACAAAGAATTATAGC	0.478																																																	0													143.0	139.0	140.0					9																	125486279		2203	4300	6503	SO:0001583	missense	0				CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.11A>G	9.37:g.125486279A>G	ENSP00000259466:p.Lys4Arg		Q6IFN0|Q96R81	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K4R	ENST00000259466.1	37	c.11	CCDS35129.1	9	.	.	.	.	.	.	.	.	.	.	a	1.778	-0.482583	0.04383	.	.	ENSG00000136939	ENST00000259466	T	0.00374	7.72	3.94	1.47	0.22746	.	1.638690	0.03490	N	0.216383	T	0.00144	0.0004	N	0.03177	-0.4	0.09310	N	1	B	0.28713	0.22	B	0.24541	0.054	T	0.24261	-1.0165	10	0.11794	T	0.64	-2.6954	6.1171	0.20132	0.6685:0.0:0.3315:0.0	.	4	Q8NGR5	OR1L4_HUMAN	R	4	ENSP00000259466:K4R	ENSP00000259466:K4R	K	+	2	0	OR1L4	124526100	0.000000	0.05858	0.012000	0.15200	0.039000	0.13416	0.335000	0.19806	0.104000	0.17725	0.254000	0.18369	AAG	OR1L4	-	NULL	ENSG00000136939		0.478	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1L4	HGNC	protein_coding	OTTHUMT00000053951.1	-	0.00	66	0	A			125486279	+1	tier1	-	no_errors	ENST00000259466	ensembl	human	known	74_37	missense	17.57	61	13	SNP	0.026	G
OR1N2	138882	genome.wustl.edu	37	9	125316158	125316158	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:125316158G>A	ENST00000373688.2	+	1	768	c.710G>A	c.(709-711)cGc>cAc	p.R237H		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	237			R -> C (in dbSNP:rs41316976).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						TCCTATGTCCGCATTTTCTGG	0.517																																																	0													252.0	239.0	243.0					9																	125316158		2203	4300	6503	SO:0001583	missense	0				CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.710G>A	9.37:g.125316158G>A	ENSP00000362792:p.Arg237His		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R237H	ENST00000373688.2	37	c.710	CCDS35123.1	9	.	.	.	.	.	.	.	.	.	.	G	1.404	-0.577288	0.03854	.	.	ENSG00000171501	ENST00000373688	T	0.00107	8.72	4.56	-0.82	0.10826	GPCR, rhodopsin-like superfamily (1);	0.976894	0.08366	N	0.956924	T	0.00109	0.0003	N	0.17594	0.5	0.09310	N	1	B	0.16396	0.017	B	0.20184	0.028	T	0.01225	-1.1413	10	0.28530	T	0.3	.	4.6663	0.12668	0.5603:0.0:0.2724:0.1672	.	237	Q8NGR9	OR1N2_HUMAN	H	237	ENSP00000362792:R237H	ENSP00000362792:R237H	R	+	2	0	OR1N2	124355979	0.000000	0.05858	0.004000	0.12327	0.987000	0.75469	-2.545000	0.00933	-0.028000	0.13850	0.644000	0.83932	CGC	OR1N2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000171501		0.517	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1N2	HGNC	protein_coding	OTTHUMT00000053937.2	-	0.00	26	0	G			125316158	+1	tier1	-	no_errors	ENST00000373688	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.000	A
OR1L6	392390	genome.wustl.edu	37	9	125512401	125512401	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:125512401T>G	ENST00000373684.1	+	1	383	c.383T>G	c.(382-384)gTt>gGt	p.V128G	OR1L6_ENST00000304720.2_Missense_Mutation_p.V92G			Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L, member 6	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	12						GAGACAAAGGTTATCTCCTAT	0.468																																																	0													124.0	115.0	118.0					9																	125512401		2203	4300	6503	SO:0001583	missense	0				CCDS35130.1, CCDS35130.2	9q33.2	2013-09-20			ENSG00000171459	ENSG00000171459		"""GPCR / Class A : Olfactory receptors"""	8218	protein-coding gene	gene with protein product				OR1L7			Standard	NM_001004453		Approved		uc022bna.1	Q8NGR2	OTTHUMG00000020621	ENST00000373684.1:c.383T>G	9.37:g.125512401T>G	ENSP00000362788:p.Val128Gly		Q6IFM8|Q96R80	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V128G	ENST00000373684.1	37	c.383		9	.	.	.	.	.	.	.	.	.	.	.	0.786	-0.760633	0.02996	.	.	ENSG00000171459	ENST00000373684;ENST00000304720	T;T	0.01998	4.51;4.51	4.06	0.0532	0.14305	GPCR, rhodopsin-like superfamily (1);	1.445290	0.04270	N	0.341889	T	0.01835	0.0058	L	0.28344	0.845	0.09310	N	1	B	0.28233	0.204	B	0.24701	0.055	T	0.46428	-0.9192	10	0.28530	T	0.3	0.0814	0.9037	0.01280	0.1601:0.2997:0.1563:0.3839	.	128	Q8NGR2	OR1L6_HUMAN	G	128;92	ENSP00000362788:V128G;ENSP00000304235:V92G	ENSP00000304235:V92G	V	+	2	0	OR1L6	124552222	0.000000	0.05858	0.001000	0.08648	0.043000	0.13939	-2.752000	0.00791	0.011000	0.14865	-0.242000	0.12053	GTT	OR1L6	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171459		0.468	OR1L6-201	KNOWN	basic	protein_coding	OR1L6	HGNC	protein_coding		-	0.00	63	0	T			125512401	+1	tier1	-	no_errors	ENST00000373684	ensembl	human	known	74_37	missense	39.39	40	26	SNP	0.003	G
OR4C12	283093	genome.wustl.edu	37	11	50003189	50003189	+	Silent	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:50003189C>A	ENST00000335238.4	-	1	882	c.849G>T	c.(847-849)gtG>gtT	p.V283V		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	283			V -> L (in dbSNP:rs4598671). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V283V(1)		NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						GTGTGTAGACCACGGGATTTA	0.398																																																	1	Substitution - coding silent(1)	lung(1)											68.0	62.0	64.0					11																	50003189		2201	4296	6497	SO:0001819	synonymous_variant	0			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.849G>T	11.37:g.50003189C>A			B2RNF0|Q6IF49	Silent	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.V283	ENST00000335238.4	37	c.849	CCDS31496.1	11																																																																																			OR4C12	-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221954		0.398	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	HGNC	protein_coding	OTTHUMT00000391104.1		0.00	38	0	C	NM_001005270		50003189	-1			no_errors	ENST00000335238	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.979	A
OR4C46	119749	genome.wustl.edu	37	11	51515472	51515472	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:51515472T>A	ENST00000328188.1	+	1	191	c.191T>A	c.(190-192)cTc>cAc	p.L64H		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CTGGCCTATCTCTCCTTTATT	0.478																																																	0													238.0	226.0	230.0					11																	51515472		2201	4296	6497	SO:0001583	missense	0				CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.191T>A	11.37:g.51515472T>A	ENSP00000329056:p.Leu64His			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L64H	ENST00000328188.1	37	c.191	CCDS31498.1	11	.	.	.	.	.	.	.	.	.	.	.	11.84	1.758380	0.31137	.	.	ENSG00000185926	ENST00000328188	T	0.09255	3.0	2.63	2.63	0.31362	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35013	N	0.003513	T	0.50034	0.1592	H	0.99777	4.77	0.19575	N	0.999962	D	0.76494	0.999	D	0.81914	0.995	T	0.56111	-0.8033	10	0.87932	D	0	.	8.8424	0.35151	0.0:0.0:0.0:1.0	.	64	A6NHA9	O4C46_HUMAN	H	64	ENSP00000329056:L64H	ENSP00000329056:L64H	L	+	2	0	OR4C46	51372048	0.740000	0.28207	0.573000	0.28510	0.027000	0.11550	5.280000	0.65603	1.239000	0.43787	0.113000	0.15668	CTC	OR4C46	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000185926		0.478	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C46	HGNC	protein_coding	OTTHUMT00000391155.1	-	0.00	50	0	T	NM_001004703		51515472	+1	tier1	-	no_errors	ENST00000328188	ensembl	human	known	74_37	missense	33.33	31	16	SNP	0.285	A
OR4C16	219428	genome.wustl.edu	37	11	55340184	55340184	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:55340184A>C	ENST00000314634.3	+	1	581	c.581A>C	c.(580-582)aAc>aCc	p.N194T		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				TATGTGGTTAACCTACTCCTG	0.448																																																	0													95.0	89.0	91.0					11																	55340184		2201	4296	6497	SO:0001583	missense	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.581A>C	11.37:g.55340184A>C	ENSP00000324913:p.Asn194Thr		Q6IEV8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N194T	ENST00000314634.3	37	c.581	CCDS31502.1	11	.	.	.	.	.	.	.	.	.	.	A	9.932	1.215216	0.22373	.	.	ENSG00000181935	ENST00000314634	T	0.00123	8.7	4.98	1.3	0.21679	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.00271	0.0008	L	0.48260	1.515	0.09310	N	1	D	0.67145	0.996	D	0.71414	0.973	T	0.49978	-0.8881	10	0.87932	D	0	.	8.1149	0.30937	0.7457:0.0:0.2543:0.0	.	194	Q8NGL9	OR4CG_HUMAN	T	194	ENSP00000324913:N194T	ENSP00000324913:N194T	N	+	2	0	OR4C16	55096760	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.317000	0.19487	0.380000	0.24823	0.448000	0.29417	AAC	OR4C16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181935		0.448	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	-	0.00	73	0	A	NM_001004701		55340184	+1	tier1	-	no_errors	ENST00000314634	ensembl	human	known	74_37	missense	25.40	47	16	SNP	0.001	C
OR4Q3	441669	genome.wustl.edu	37	14	20216438	20216438	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:20216438delC	ENST00000331723.1	+	1	852	c.852delC	c.(850-852)aacfs	p.N284fs		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTATGTTGAACCCCCTCATCT	0.413																																																	0													118.0	118.0	118.0					14																	20216438		2203	4299	6502	SO:0001589	frameshift_variant	0			AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.852delC	14.37:g.20216438delC	ENSP00000330049:p.Asn284fs		Q6IEX4	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L286fs	ENST00000331723.1	37	c.852	CCDS32020.1	14																																																																																			OR4Q3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000182652		0.413	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4Q3	HGNC	protein_coding	OTTHUMT00000409818.2		0.00	20	0	C			20216438	+1	tier1		no_errors	ENST00000331723	ensembl	human	known	74_37	frame_shift_del	14.29	18	3	DEL	0.999	-
OR4K2	390431	genome.wustl.edu	37	14	20344520	20344520	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:20344520T>G	ENST00000298642.2	+	1	130	c.94T>G	c.(94-96)Tca>Gca	p.S32A		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TATGGTGTTTTCATTGCTTTA	0.418																																																	0													297.0	306.0	303.0					14																	20344520		2203	4300	6503	SO:0001583	missense	0				CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.94T>G	14.37:g.20344520T>G	ENSP00000298642:p.Ser32Ala		B2RNK8|Q6IFA5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S32A	ENST00000298642.2	37	c.94	CCDS32023.1	14	.	.	.	.	.	.	.	.	.	.	.	15.68	2.903669	0.52333	.	.	ENSG00000165762	ENST00000298642	T	0.00574	6.47	5.4	5.4	0.78164	.	0.166592	0.28549	N	0.014941	T	0.00695	0.0023	L	0.58428	1.81	0.27802	N	0.942466	P	0.34997	0.479	B	0.31390	0.129	T	0.47433	-0.9118	10	0.29301	T	0.29	.	7.9061	0.29763	0.0:0.0894:0.0:0.9106	.	32	Q8NGD2	OR4K2_HUMAN	A	32	ENSP00000298642:S32A	ENSP00000298642:S32A	S	+	1	0	OR4K2	19414360	0.000000	0.05858	0.996000	0.52242	0.993000	0.82548	0.013000	0.13310	2.265000	0.75225	0.533000	0.62120	TCA	OR4K2	-	prints_GPCR_Rhodpsn	ENSG00000165762		0.418	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K2	HGNC	protein_coding	OTTHUMT00000409864.1	-	0.00	75	0	T			20344520	+1	tier1	-	no_errors	ENST00000298642	ensembl	human	known	74_37	missense	26.23	45	16	SNP	0.989	G
OR5J2	282775	genome.wustl.edu	37	11	55944875	55944875	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:55944875A>G	ENST00000312298.1	+	1	782	c.782A>G	c.(781-783)cAg>cGg	p.Q261R		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					AGCTACATTCAGCCAAGCTCC	0.443																																																	0													123.0	122.0	122.0					11																	55944875		2201	4296	6497	SO:0001583	missense	0			AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.782A>G	11.37:g.55944875A>G	ENSP00000310788:p.Gln261Arg		Q6IEU5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.Q261R	ENST00000312298.1	37	c.782	CCDS31522.1	11	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.397584	0.00198	.	.	ENSG00000174957	ENST00000312298	T	0.36520	1.25	4.26	4.26	0.50523	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000066	T	0.15912	0.0383	N	0.16478	0.41	0.09310	N	1	B	0.29188	0.236	B	0.31614	0.133	T	0.33266	-0.9875	10	0.02654	T	1	.	3.1819	0.06587	0.6575:0.0:0.1466:0.1959	.	261	Q8NH18	OR5J2_HUMAN	R	261	ENSP00000310788:Q261R	ENSP00000310788:Q261R	Q	+	2	0	OR5J2	55701451	0.000000	0.05858	0.200000	0.23457	0.045000	0.14185	-0.174000	0.09839	1.724000	0.51502	0.482000	0.46254	CAG	OR5J2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174957		0.443	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5J2	HGNC	protein_coding	OTTHUMT00000391544.1	-	0.00	50	0	A	NM_001005492		55944875	+1	tier1	-	no_errors	ENST00000312298	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.021	G
OR8H3	390152	genome.wustl.edu	37	11	55889885	55889885	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:55889885T>G	ENST00000313472.3	+	1	37	c.37T>G	c.(37-39)Ttc>Gtc	p.F13V		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					TGTGGCTGACTTCATCCTTAC	0.463																																																	0													181.0	172.0	175.0					11																	55889885		2201	4296	6497	SO:0001583	missense	0			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.37T>G	11.37:g.55889885T>G	ENSP00000323928:p.Phe13Val		Q6IFB7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F13V	ENST00000313472.3	37	c.37	CCDS31519.1	11	.	.	.	.	.	.	.	.	.	.	T	14.48	2.549001	0.45383	.	.	ENSG00000181761	ENST00000313472	T	0.04551	3.6	3.43	3.43	0.39272	.	0.000000	0.52532	D	0.000061	T	0.27967	0.0689	M	0.93939	3.475	0.39299	D	0.96487	D	0.89917	1.0	D	0.91635	0.999	T	0.41142	-0.9525	10	0.87932	D	0	.	12.2375	0.54524	0.0:0.0:0.0:1.0	.	13	Q8N146	OR8H3_HUMAN	V	13	ENSP00000323928:F13V	ENSP00000323928:F13V	F	+	1	0	OR8H3	55646461	0.994000	0.37717	0.946000	0.38457	0.120000	0.20174	2.672000	0.46850	1.322000	0.45245	0.136000	0.15936	TTC	OR8H3	-	NULL	ENSG00000181761		0.463	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	HGNC	protein_coding	OTTHUMT00000391541.1	-	0.00	92	0	T	NM_001005201		55889885	+1	tier1	-	no_errors	ENST00000313472	ensembl	human	known	74_37	missense	21.92	57	16	SNP	0.990	G
OR5T3	390154	genome.wustl.edu	37	11	56020501	56020501	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:56020501A>C	ENST00000303059.3	+	1	826	c.826A>C	c.(826-828)Act>Cct	p.T276P		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					CTCTCACCTAACTGGAGTGAC	0.408																																																	0													197.0	177.0	184.0					11																	56020501		2201	4295	6496	SO:0001583	missense	0			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.826A>C	11.37:g.56020501A>C	ENSP00000305403:p.Thr276Pro		Q6IFC7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T276P	ENST00000303059.3	37	c.826	CCDS31524.1	11	.	.	.	.	.	.	.	.	.	.	A	10.42	1.344164	0.24339	.	.	ENSG00000172489	ENST00000303059	T	0.39229	1.09	4.46	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.135539	0.33631	N	0.004711	T	0.74921	0.3780	H	0.98351	4.21	0.09310	N	1	D	0.57257	0.979	D	0.69142	0.962	T	0.72541	-0.4262	10	0.87932	D	0	.	10.3959	0.44201	0.9191:0.0:0.0809:0.0	.	276	Q8NGG3	OR5T3_HUMAN	P	276	ENSP00000305403:T276P	ENSP00000305403:T276P	T	+	1	0	OR5T3	55777077	0.000000	0.05858	0.556000	0.28293	0.189000	0.23516	0.449000	0.21744	1.995000	0.58328	0.523000	0.50628	ACT	OR5T3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172489		0.408	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1	-	0.00	71	0	A	NM_001004747		56020501	+1	tier1	-	no_errors	ENST00000303059	ensembl	human	known	74_37	missense	22.22	42	12	SNP	0.020	C
ORC2	4999	genome.wustl.edu	37	2	201778130	201778130	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:201778130G>T	ENST00000234296.2	-	17	1784	c.1535C>A	c.(1534-1536)tCt>tAt	p.S512Y		NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	512					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						ATCTTGAAAAGAAAGGCCTGG	0.408																																																	0													64.0	66.0	65.0					2																	201778130		2203	4300	6503	SO:0001583	missense	0				CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1535C>A	2.37:g.201778130G>T	ENSP00000234296:p.Ser512Tyr		Q13204|Q53TX5	Missense_Mutation	SNP	pfam_ORC2	p.S512Y	ENST00000234296.2	37	c.1535	CCDS2334.1	2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.975573	0.74360	.	.	ENSG00000115942	ENST00000234296	T	0.44881	0.91	5.6	4.72	0.59763	.	0.112285	0.64402	D	0.000006	T	0.65739	0.2720	M	0.83953	2.67	0.58432	D	0.999991	P	0.52463	0.953	P	0.61800	0.894	T	0.72283	-0.4339	10	0.66056	D	0.02	-0.991	16.5252	0.84329	0.0:0.131:0.869:0.0	.	512	Q13416	ORC2_HUMAN	Y	512	ENSP00000234296:S512Y	ENSP00000234296:S512Y	S	-	2	0	ORC2	201486375	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	7.726000	0.84824	1.336000	0.45506	0.591000	0.81541	TCT	ORC2	-	pfam_ORC2	ENSG00000115942		0.408	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC2	HGNC	protein_coding	OTTHUMT00000256191.2		0.00	55	0	G	NM_006190		201778130	-1			no_errors	ENST00000234296	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
PAK6	56924	genome.wustl.edu	37	15	40558217	40558217	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:40558217G>C	ENST00000542403.2	+	3	490	c.379G>C	c.(379-381)Gac>Cac	p.D127H	PAK6_ENST00000560346.1_Missense_Mutation_p.D127H|PAK6_ENST00000559901.1_3'UTR|PAK6_ENST00000441369.1_Missense_Mutation_p.D127H|PAK6_ENST00000260404.4_Missense_Mutation_p.D127H|PAK6_ENST00000455577.2_Missense_Mutation_p.D127H|PAK6_ENST00000453867.1_Missense_Mutation_p.D127H|RP11-133K1.2_ENST00000558658.1_3'UTR	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	127	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		CACCGACCCAGACATGTACCT	0.687																																																	0													13.0	13.0	13.0					15																	40558217		2176	4267	6443	SO:0001583	missense	0			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.379G>C	15.37:g.40558217G>C	ENSP00000439597:p.Asp127His		A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.D127H	ENST00000542403.2	37	c.379	CCDS10054.1	15	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183895	0.78677	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.74632	-0.83;-0.83;-0.86;-0.83;-0.83	5.39	4.41	0.53225	.	1.105250	0.06723	N	0.775337	T	0.72423	0.3458	N	0.19112	0.55	0.41450	D	0.987978	P;D	0.56035	0.956;0.974	P;P	0.53360	0.533;0.724	T	0.66972	-0.5788	10	0.66056	D	0.02	.	10.6714	0.45760	0.0:0.1423:0.7103:0.1474	.	127;127	Q9NQU5;G5E9R2	PAK6_HUMAN;.	H	127	ENSP00000406873:D127H;ENSP00000401153:D127H;ENSP00000409465:D127H;ENSP00000260404:D127H;ENSP00000439597:D127H	ENSP00000260404:D127H	D	+	1	0	PAK6	38345509	1.000000	0.71417	0.969000	0.41365	0.996000	0.88848	4.148000	0.58085	2.543000	0.85770	0.561000	0.74099	GAC	PAK6	-	NULL	ENSG00000137843		0.687	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PAK6	HGNC	protein_coding	OTTHUMT00000418355.1	-	0.00	80	0	G			40558217	+1	tier1	-	no_errors	ENST00000260404	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.991	C
PAPPA2	60676	genome.wustl.edu	37	1	176526097	176526097	+	Silent	SNP	C	C	T	rs371392086		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:176526097C>T	ENST00000367662.3	+	2	1803	c.639C>T	c.(637-639)tcC>tcT	p.S213S	PAPPA2_ENST00000367661.3_Silent_p.S213S	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	213					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						AGGGAGACTCCGGTATCTCTT	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14145	0.0		0.0	False		,,,				2504	0.0																0								C	,	1,3983		0,1,1991	91.0	98.0	96.0		639,639	-5.1	0.0	1		96	0,8302		0,0,4151	no	coding-synonymous,coding-synonymous	PAPPA2	NM_020318.2,NM_021936.2	,	0,1,6142	TT,TC,CC		0.0,0.0251,0.0081	,	213/1792,213/828	176526097	1,12285	1992	4151	6143	SO:0001819	synonymous_variant	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.639C>T	1.37:g.176526097C>T			A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.S213	ENST00000367662.3	37	c.639	CCDS41438.1	1																																																																																			PAPPA2	-	superfamily_ConA-like_lec_gl_sf	ENSG00000116183		0.562	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	25	0	C			176526097	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	silent	57.14	3	4	SNP	0.000	T
PCDH20	64881	genome.wustl.edu	37	13	61986010	61986010	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr13:61986010A>G	ENST00000409186.1	-	5	4327	c.2222T>C	c.(2221-2223)cTt>cCt	p.L741P	PCDH20_ENST00000409204.4_Missense_Mutation_p.L741P			Q8N6Y1	PCD20_HUMAN	protocadherin 20	741	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		AAACAAAACAAGAGGAGGGTT	0.448																																																	0													113.0	118.0	117.0					13																	61986010		2203	4300	6503	SO:0001583	missense	0			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2222T>C	13.37:g.61986010A>G	ENSP00000386653:p.Leu741Pro		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L741P	ENST00000409186.1	37	c.2222	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	A	13.33	2.205280	0.39003	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.01963	4.53;4.53	5.94	5.94	0.96194	.	0.116020	0.36167	N	0.002755	T	0.05456	0.0144	M	0.64404	1.975	0.80722	D	1	P	0.51653	0.947	P	0.44597	0.454	T	0.19192	-1.0313	10	0.62326	D	0.03	.	16.3908	0.83537	1.0:0.0:0.0:0.0	.	741	A8K1K9	.	P	741;741;487	ENSP00000387250:L741P;ENSP00000386653:L741P	ENSP00000351500:L487P	L	-	2	0	PCDH20	60884011	1.000000	0.71417	0.998000	0.56505	0.764000	0.43329	6.141000	0.71744	2.269000	0.75478	0.455000	0.32223	CTT	PCDH20	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000197991		0.448	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2	-	0.00	20	0	A	NM_022843		61986010	-1	tier1	-	no_errors	ENST00000409186	ensembl	human	known	74_37	missense	31.25	11	5	SNP	0.990	G
PCDH7	5099	genome.wustl.edu	37	4	30723471	30723471	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:30723471delT	ENST00000361762.2	+	1	1435	c.427delT	c.(427-429)ttcfs	p.F143fs	PCDH7_ENST00000543491.1_Frame_Shift_Del_p.F143fs	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	143	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CACGCCCACCTTCCCGTCGCC	0.647																																																	0													37.0	28.0	31.0					4																	30723471		2203	4300	6503	SO:0001589	frameshift_variant	0			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.427delT	4.37:g.30723471delT	ENSP00000355243:p.Phe143fs		O60246|O60247|Q4W5C4	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F143fs	ENST00000361762.2	37	c.427	CCDS33971.1	4																																																																																			PCDH7	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000169851		0.647	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	HGNC	protein_coding	OTTHUMT00000360366.1		0.00	56	0	T	NM_032457, NM_002589		30723471	+1	tier1		no_errors	ENST00000543491	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	1.000	-
PCDHA4	56144	genome.wustl.edu	37	5	140188701	140188701	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:140188701G>T	ENST00000530339.1	+	1	1929	c.1929G>T	c.(1927-1929)ccG>ccT	p.P643P	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Silent_p.P643P|PCDHA4_ENST00000356878.4_Silent_p.P643P|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	643	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGACGCTCCGCGCCACCGCC	0.682																																																	0													77.0	79.0	78.0					5																	140188701		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1929G>T	5.37:g.140188701G>T			O75285|Q2M253	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P643	ENST00000530339.1	37	c.1929	CCDS54916.1	5																																																																																			PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204967		0.682	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2		0.00	67	0	G	NM_018907		140188701	+1			no_errors	ENST00000530339	ensembl	human	known	74_37	silent	5.77	49	3	SNP	0.000	T
PCDHB10	56126	genome.wustl.edu	37	5	140572811	140572811	+	Missense_Mutation	SNP	G	G	A	rs201669614		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:140572811G>A	ENST00000239446.4	+	1	870	c.686G>A	c.(685-687)cGc>cAc	p.R229H		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	229	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTACTGTACGCATCGTTGTC	0.547																																																	0													77.0	81.0	79.0					5																	140572811		2203	4300	6503	SO:0001583	missense	0			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.686G>A	5.37:g.140572811G>A	ENSP00000239446:p.Arg229His		Q96T99	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R229H	ENST00000239446.4	37	c.686	CCDS4252.1	5	.	.	.	.	.	.	.	.	.	.	G	0.109	-1.141008	0.01728	.	.	ENSG00000120324	ENST00000239446	T	0.01767	4.65	3.41	-0.677	0.11357	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01353	0.0044	N	0.17800	0.525	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.48468	-0.9033	9	0.18710	T	0.47	.	8.514	0.33235	0.4693:0.0:0.5307:0.0	.	229	Q9UN67	PCDBA_HUMAN	H	229	ENSP00000239446:R229H	ENSP00000239446:R229H	R	+	2	0	PCDHB10	140552995	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.497000	0.00969	-0.294000	0.08973	-0.264000	0.10439	CGC	PCDHB10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120324		0.547	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB10	HGNC	protein_coding	OTTHUMT00000251821.1		0.00	70	0	G	NM_018930		140572811	+1			no_errors	ENST00000239446	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.000	A
PDE10A	10846	genome.wustl.edu	37	6	165844941	165844941	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:165844941G>A	ENST00000366882.1	-	9	837	c.683C>T	c.(682-684)gCc>gTc	p.A228V	PDE10A_ENST00000354448.4_Missense_Mutation_p.A228V|PDE10A_ENST00000539869.2_Missense_Mutation_p.A238V			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	228	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TGAAGCCCAGGCAAGATTTGC	0.358																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0													111.0	115.0	113.0					6																	165844941		2203	4300	6503	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.683C>T	6.37:g.165844941G>A	ENSP00000355847:p.Ala228Val		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.A238V	ENST00000366882.1	37	c.713		6	.	.	.	.	.	.	.	.	.	.	G	13.44	2.237602	0.39598	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.69306	-0.39;-0.39	5.5	5.5	0.81552	GAF (2);	0.000000	0.85682	D	0.000000	T	0.49677	0.1571	N	0.17474	0.49	0.80722	D	1	P;B	0.39157	0.662;0.005	P;B	0.47891	0.56;0.009	T	0.50136	-0.8863	10	0.16420	T	0.52	.	19.3976	0.94612	0.0:0.0:1.0:0.0	.	238;228	Q9ULW9;Q9Y233	.;PDE10_HUMAN	V	228;256;238;228;227	ENSP00000355847:A228V;ENSP00000346435:A228V	ENSP00000341187:A238V	A	-	2	0	PDE10A	165764931	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.475000	0.97721	2.575000	0.86900	0.650000	0.86243	GCC	PDE10A	-	pfam_GAF,smart_GAF	ENSG00000112541		0.358	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	-	0.00	120	0	G			165844941	-1	tier1	-	no_errors	ENST00000539869	ensembl	human	known	74_37	missense	16.67	45	9	SNP	1.000	A
PDE6H	5149	genome.wustl.edu	37	12	15131010	15131010	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:15131010G>T	ENST00000266395.2	+	2	170	c.64G>T	c.(64-66)Ggc>Tgc	p.G22C		NM_006205.2	NP_006196.1	Q13956	CNCG_HUMAN	phosphodiesterase 6H, cGMP-specific, cone, gamma	22	Arg/Lys-rich (basic).				activation of MAPK activity (GO:0000187)|negative regulation of catalytic activity (GO:0043086)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|lung(6)|ovary(1)|skin(2)	10					Sildenafil(DB00203)|Vardenafil(DB00862)	CCCACGCAAAGGCCCTCCCAA	0.493																																																	0													59.0	55.0	56.0					12																	15131010		2203	4300	6503	SO:0001583	missense	0				CCDS8672.1	12p13	2008-03-18					3.1.4.17	"""Phosphodiesterases"""	8790	protein-coding gene	gene with protein product		601190				8786098	Standard	NM_006205		Approved		uc001rcr.3	Q13956		ENST00000266395.2:c.64G>T	12.37:g.15131010G>T	ENSP00000266395:p.Gly22Cys		Q52LY7	Missense_Mutation	SNP	pfam_PDE6_gamma,pirsf_PDE6_gamma	p.G22C	ENST00000266395.2	37	c.64	CCDS8672.1	12	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700404	0.88924	.	.	ENSG00000139053	ENST00000266395	T	0.63417	-0.04	5.18	5.18	0.71444	.	0.054225	0.64402	D	0.000001	T	0.78233	0.4251	.	.	.	0.80722	D	1	D	0.57899	0.981	D	0.63703	0.917	T	0.80876	-0.1186	9	0.87932	D	0	.	16.2338	0.82360	0.0:0.0:1.0:0.0	.	22	Q13956	CNCG_HUMAN	C	22	ENSP00000266395:G22C	ENSP00000266395:G22C	G	+	1	0	PDE6H	15022277	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.107000	0.94261	2.686000	0.91538	0.655000	0.94253	GGC	PDE6H	-	pfam_PDE6_gamma,pirsf_PDE6_gamma	ENSG00000139053		0.493	PDE6H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6H	HGNC	protein_coding	OTTHUMT00000400880.1	-	0.00	56	0	G			15131010	+1	tier1	-	no_errors	ENST00000266395	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
PDX1	3651	genome.wustl.edu	37	13	28498435	28498435	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr13:28498435G>A	ENST00000381033.4	+	2	568	c.449G>A	c.(448-450)cGc>cAc	p.R150H	PDX1-AS1_ENST00000499662.2_RNA	NM_000209.3	NP_000200.1	O00330	ODPX_HUMAN	pancreatic and duodenal homeobox 1	0	Pro-rich.				cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)					all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		AAGCGGACGCGCACGGCCTAC	0.682																																																	0													29.0	32.0	31.0					13																	28498435		2203	4300	6503	SO:0001583	missense	0			AF035260	CCDS9327.1	13q12.1	2012-03-09	2006-12-01	2006-12-01	ENSG00000139515	ENSG00000139515		"""Homeoboxes / ANTP class : HOXL subclass"""	6107	protein-coding gene	gene with protein product	"""somatostatin transcription factor 1"""	600733	"""insulin promoter factor 1, homeodomain transcription factor"""	IPF1		7590740	Standard	NM_000209		Approved	IDX-1, STF-1, PDX-1, MODY4	uc001urt.2	P52945	OTTHUMG00000016638	ENST00000381033.4:c.449G>A	13.37:g.28498435G>A	ENSP00000370421:p.Arg150His		B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.R150H	ENST00000381033.4	37	c.449	CCDS9327.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.566215	0.96540	.	.	ENSG00000139515	ENST00000381033	D	0.99167	-5.51	5.01	5.01	0.66863	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99701	0.9886	H	0.99764	4.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96917	0.9671	10	0.87932	D	0	.	18.6704	0.91508	0.0:0.0:1.0:0.0	.	150	P52945	PDX1_HUMAN	H	150	ENSP00000370421:R150H	ENSP00000370421:R150H	R	+	2	0	PDX1	27396435	1.000000	0.71417	0.978000	0.43139	0.955000	0.61496	7.934000	0.87649	2.474000	0.83562	0.561000	0.74099	CGC	PDX1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_antennapedia	ENSG00000139515		0.682	PDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDX1	HGNC	protein_coding	OTTHUMT00000044310.2	-	0.00	49	0	G	NM_000209		28498435	+1	tier1	-	no_errors	ENST00000381033	ensembl	human	known	74_37	missense	19.05	16	4	SNP	1.000	A
PDZD8	118987	genome.wustl.edu	37	10	119043842	119043842	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:119043842G>T	ENST00000334464.5	-	5	2641	c.2402C>A	c.(2401-2403)tCa>tAa	p.S801*	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	801					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		ATGGTGGTCTGATTCTCCTTC	0.373																																																	0													68.0	68.0	68.0					10																	119043842		2203	4300	6503	SO:0001587	stop_gained	0			AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2402C>A	10.37:g.119043842G>T	ENSP00000334642:p.Ser801*		Q86WE0|Q86WE5|Q9UFF1	Nonsense_Mutation	SNP	pfam_PDZ,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_PDZ,smart_PDZ,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_PDZ,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.S801*	ENST00000334464.5	37	c.2402	CCDS7600.1	10	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115052	0.56505	.	.	ENSG00000165650	ENST00000334464	.	.	.	5.62	3.58	0.41010	.	1.245700	0.05096	N	0.486049	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	1.1047	9.0758	0.36519	0.1547:0.0:0.7128:0.1325	.	.	.	.	X	801	.	ENSP00000334642:S801X	S	-	2	0	PDZD8	119033832	0.001000	0.12720	0.975000	0.42487	0.986000	0.74619	0.971000	0.29396	1.377000	0.46286	0.563000	0.77884	TCA	PDZD8	-	NULL	ENSG00000165650		0.373	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD8	HGNC	protein_coding	OTTHUMT00000050565.1	-	0.00	25	0	G	NM_173791		119043842	-1	tier1	-	no_errors	ENST00000334464	ensembl	human	known	74_37	nonsense	18.18	18	4	SNP	0.000	T
PEG3	5178	genome.wustl.edu	37	19	57325595	57325595	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:57325595T>G	ENST00000326441.9	-	10	4578	c.4215A>C	c.(4213-4215)gaA>gaC	p.E1405D	PEG3_ENST00000598410.1_Missense_Mutation_p.E1281D|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.E1405D|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.E1279D	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1405	3 X 7 AA repeat of P-E-V-E-A-A-E.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGCCTCCACTTCTGGCTCGG	0.572																																																	0													44.0	47.0	46.0					19																	57325595		2180	4254	6434	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4215A>C	19.37:g.57325595T>G	ENSP00000326581:p.Glu1405Asp		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E1405D	ENST00000326441.9	37	c.4215	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	T	14.17	2.454787	0.43634	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02737	4.18;4.18	3.93	-7.13	0.01532	.	0.000000	0.41823	D	0.000806	T	0.01800	0.0057	L	0.29908	0.895	.	.	.	P;P;P	0.47762	0.9;0.9;0.9	B;B;B	0.42112	0.376;0.376;0.376	T	0.19160	-1.0314	9	0.56958	D	0.05	-16.9672	4.9568	0.14046	0.129:0.5741:0.1304:0.1665	.	1281;1405;1340	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	D	1405	ENSP00000326581:E1405D;ENSP00000403051:E1405D	ENSP00000326581:E1405D	E	-	3	2	ZIM2	62017407	0.000000	0.05858	0.018000	0.16275	0.428000	0.31595	-2.927000	0.00690	-1.613000	0.01577	-0.326000	0.08463	GAA	PEG3	-	NULL	ENSG00000198300		0.572	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	67	0	T			57325595	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	25.49	38	13	SNP	0.000	G
PER2	8864	genome.wustl.edu	37	2	239162260	239162260	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:239162260C>T	ENST00000254657.3	-	19	2683	c.2404G>A	c.(2404-2406)Gtc>Atc	p.V802I	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	802					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CGAGGTTTGACCCGCTTGGAC	0.537																																																	0													12.0	15.0	14.0					2																	239162260		2197	4297	6494	SO:0001583	missense	0			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2404G>A	2.37:g.239162260C>T	ENSP00000254657:p.Val802Ile		A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS	p.V802I	ENST00000254657.3	37	c.2404	CCDS2528.1	2	.	.	.	.	.	.	.	.	.	.	C	0.756	-0.770921	0.02974	.	.	ENSG00000132326	ENST00000254657	T	0.10477	2.87	4.3	2.02	0.26589	.	0.683311	0.15133	N	0.278718	T	0.07954	0.0199	L	0.41824	1.3	0.80722	D	1	B;B	0.16603	0.018;0.001	B;B	0.13407	0.009;0.003	T	0.18398	-1.0338	10	0.22109	T	0.4	-10.2896	5.7721	0.18259	0.0:0.6552:0.1977:0.1471	.	802;802	B4DH14;O15055	.;PER2_HUMAN	I	802	ENSP00000254657:V802I	ENSP00000254657:V802I	V	-	1	0	PER2	238826999	0.000000	0.05858	0.137000	0.22149	0.081000	0.17604	0.259000	0.18405	0.928000	0.37168	-0.264000	0.10439	GTC	PER2	-	NULL	ENSG00000132326		0.537	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	HGNC	protein_coding	OTTHUMT00000257167.1	-	0.00	54	0	C	NM_022817		239162260	-1	tier1	-	no_errors	ENST00000254657	ensembl	human	known	74_37	missense	30.91	38	17	SNP	0.984	T
PFKFB3	5209	genome.wustl.edu	37	10	6258137	6258137	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:6258137G>T	ENST00000379775.4	+	4	679	c.349G>T	c.(349-351)Gaa>Taa	p.E117*	PFKFB3_ENST00000536985.1_Nonsense_Mutation_p.E97*|PFKFB3_ENST00000360521.2_Nonsense_Mutation_p.E117*|PFKFB3_ENST00000317350.4_Nonsense_Mutation_p.E117*|PFKFB3_ENST00000540253.1_Nonsense_Mutation_p.E131*|PFKFB3_ENST00000379782.3_Nonsense_Mutation_p.E117*|PFKFB3_ENST00000379785.1_Nonsense_Mutation_p.E117*|PFKFB3_ENST00000379789.4_Nonsense_Mutation_p.E97*	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	117	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						CCTGGCGAAAGAAGGGGGACA	0.587																																																	0													157.0	130.0	139.0					10																	6258137		2203	4300	6503	SO:0001587	stop_gained	0				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.349G>T	10.37:g.6258137G>T	ENSP00000369100:p.Glu117*		B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Nonsense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.E131*	ENST00000379775.4	37	c.391	CCDS7078.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.176369	0.94846	.	.	ENSG00000170525	ENST00000536985;ENST00000379789;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	0.2543	18.7928	0.91982	0.0:0.0:1.0:0.0	.	.	.	.	X	97;97;131;117;117;117;117;117;117	.	ENSP00000369105:E117X	E	+	1	0	PFKFB3	6298143	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	7.559000	0.82265	2.428000	0.82296	0.591000	0.81541	GAA	PFKFB3	-	pfam_6Phosfructo_kin,pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,pirsf_Bifunct_6PFK/fruc_bisP_Ptase	ENSG00000170525		0.587	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PFKFB3	HGNC	protein_coding	OTTHUMT00000046647.1		0.00	71	0	G			6258137	+1			no_errors	ENST00000540253	ensembl	human	known	74_37	nonsense	8.57	32	3	SNP	1.000	T
PFKFB3	5209	genome.wustl.edu	37	10	6261588	6261588	+	Silent	SNP	C	C	T	rs545085751		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:6261588C>T	ENST00000379775.4	+	7	885	c.555C>T	c.(553-555)gaC>gaT	p.D185D	PFKFB3_ENST00000536985.1_Missense_Mutation_p.T182M|PFKFB3_ENST00000360521.2_Silent_p.D185D|PFKFB3_ENST00000317350.4_Silent_p.D185D|PFKFB3_ENST00000540253.1_Silent_p.D199D|PFKFB3_ENST00000379782.3_Silent_p.D185D|PFKFB3_ENST00000379785.1_Silent_p.D185D|PFKFB3_ENST00000379789.4_Silent_p.D165D	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	185	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						AAGCCATGGACGACTTCATGA	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		16671	0.0		0.0	False		,,,				2504	0.001																0													95.0	91.0	92.0					10																	6261588		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.555C>T	10.37:g.6261588C>T			B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,prints_6Pfruct_kin	p.T182M	ENST00000379775.4	37	c.545	CCDS7078.1	10	.	.	.	.	.	.	.	.	.	.	C	14.10	2.436033	0.43224	.	.	ENSG00000170525	ENST00000536985	.	.	.	5.37	-4.97	0.03029	.	.	.	.	.	T	0.52175	0.1718	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58951	-0.7545	5	0.72032	D	0.01	-7.6616	3.3675	0.07208	0.2318:0.2614:0.3771:0.1297	.	.	.	.	M	182	.	ENSP00000443319:T182M	T	+	2	0	PFKFB3	6301594	0.931000	0.31567	0.971000	0.41717	0.589000	0.36550	0.046000	0.14035	-0.575000	0.05982	-0.964000	0.02622	ACG	PFKFB3	-	NULL	ENSG00000170525		0.542	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PFKFB3	HGNC	protein_coding	OTTHUMT00000046647.1	-	0.00	68	0	C			6261588	+1	tier1	-	no_errors	ENST00000536985	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.938	T
PGM5	5239	genome.wustl.edu	37	9	71114230	71114230	+	Missense_Mutation	SNP	G	G	A	rs142216683		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:71114230G>A	ENST00000396396.1	+	10	1796	c.1567G>A	c.(1567-1569)Gca>Aca	p.A523T		NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	523					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						CAGACTGTACGCAGAGAGCTA	0.572																																																	0													108.0	96.0	100.0					9																	71114230		2203	4300	6503	SO:0001583	missense	0			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1567G>A	9.37:g.71114230G>A	ENSP00000379678:p.Ala523Thr		B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.A523T	ENST00000396396.1	37	c.1567	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756873	0.69648	.	.	ENSG00000154330	ENST00000396396	T	0.43688	0.94	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.42653	0.1212	L	0.41236	1.265	0.53688	D	0.999976	P	0.51351	0.944	P	0.44422	0.449	T	0.41998	-0.9477	10	0.87932	D	0	.	18.5632	0.91108	0.0:0.0:1.0:0.0	.	523	Q15124	PGM5_HUMAN	T	523	ENSP00000379678:A523T	ENSP00000379678:A523T	A	+	1	0	PGM5	70304050	0.981000	0.34729	1.000000	0.80357	0.973000	0.67179	3.531000	0.53546	2.686000	0.91538	0.650000	0.86243	GCA	PGM5	-	NULL	ENSG00000154330		0.572	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	-	0.00	32	0	G	NM_021965		71114230	+1	tier1	-	no_errors	ENST00000396396	ensembl	human	known	74_37	missense	16.13	26	5	SNP	1.000	A
PLA2R1	22925	genome.wustl.edu	37	2	160901437	160901437	+	Missense_Mutation	SNP	C	C	A	rs373497970		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:160901437C>A	ENST00000283243.7	-	2	547	c.341G>T	c.(340-342)cGg>cTg	p.R114L	PLA2R1_ENST00000392771.1_Missense_Mutation_p.R114L	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	114	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						ACAGCGCCACCGTAAGGAAAC	0.522																																																	0													82.0	80.0	80.0					2																	160901437		2203	4300	6503	SO:0001583	missense	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.341G>T	2.37:g.160901437C>A	ENSP00000283243:p.Arg114Leu		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.R114L	ENST00000283243.7	37	c.341	CCDS33309.1	2	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920850	0.33908	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.32515	1.45;1.45	6.07	1.88	0.25563	Ricin B-related lectin (1);Ricin B lectin (2);	0.392565	0.30781	N	0.008900	T	0.22627	0.0546	L	0.47716	1.5	0.37130	D	0.901226	B;P;B	0.35844	0.019;0.524;0.389	B;B;B	0.28849	0.021;0.095;0.07	T	0.09618	-1.0666	10	0.42905	T	0.14	.	10.1919	0.43032	0.0:0.7723:0.0:0.2277	.	114;114;114	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	L	114	ENSP00000283243:R114L;ENSP00000376524:R114L	ENSP00000283243:R114L	R	-	2	0	PLA2R1	160609683	1.000000	0.71417	0.971000	0.41717	0.187000	0.23431	1.606000	0.36826	0.049000	0.15920	0.655000	0.94253	CGG	PLA2R1	-	superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000153246		0.522	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1	-	0.00	51	0	C			160901437	-1	tier1	-	no_errors	ENST00000283243	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	A
PLA2R1	22925	genome.wustl.edu	37	2	160918876	160918878	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:160918876_160918878delCAG	ENST00000283243.7	-	1	243_245	c.37_39delCTG	c.(37-39)ctgdel	p.L13del	PLA2R1_ENST00000392771.1_In_Frame_Del_p.L13del	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	13					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						GCGGCGCCCCcagcagcagcagc	0.729																																																	0									,,	16,82,2566		4,0,8,17,48,1255					,,	-3.1	0.0			4	2,158,4972		0,1,1,22,113,2429	no	codingComplex,codingComplex,codingComplex	PLA2R1	NM_007366.4,NM_001195641.1,NM_001007267.2	,,	4,1,9,39,161,3684	A1A1,A1A2,A1R,A2A2,A2R,RR		3.1177,3.6787,3.3094	,,	,,		18,240,7538				SO:0001651	inframe_deletion	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.37_39delCTG	2.37:g.160918885_160918887delCAG	ENSP00000283243:p.Leu13del		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	In_Frame_Del	DEL	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.L13in_frame_del	ENST00000283243.7	37	c.39_37	CCDS33309.1	2																																																																																			PLA2R1	-	NULL	ENSG00000153246		0.729	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1		0.00	41	0	CAG			160918878	-1	tier1		no_errors	ENST00000283243	ensembl	human	known	74_37	in_frame_del	10.71	25	3	DEL	0.922:0.939:0.961	-
PLCD3	113026	genome.wustl.edu	37	17	43192556	43192556	+	Missense_Mutation	SNP	C	C	T	rs199969953		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:43192556C>T	ENST00000322765.5	-	10	1729	c.1616G>A	c.(1615-1617)cGc>cAc	p.R539H	PLCD3_ENST00000540511.1_5'UTR	NM_133373.3	NP_588614.1	Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3	539	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						GGGTCGCAGGCGGGTGGCGTG	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		12363	0.001		0.0	False		,,,				2504	0.0																0								C	HIS/ARG	1,4133		0,1,2066	21.0	27.0	25.0		1616	0.5	1.0	17		25	5,8381		0,5,4188	yes	missense	PLCD3	NM_133373.3	29	0,6,6254	TT,TC,CC		0.0596,0.0242,0.0479	benign	539/790	43192556	6,12514	2067	4193	6260	SO:0001583	missense	0			AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000322765.5:c.1616G>A	17.37:g.43192556C>T	ENSP00000313731:p.Arg539His		Q8TEC1|Q8TF37|Q96FL6	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R539H	ENST00000322765.5	37	c.1616		17	.	.	.	.	.	.	.	.	.	.	C	0.254	-1.004273	0.02112	2.42E-4	5.96E-4	ENSG00000161714	ENST00000322765	T	0.66815	-0.23	4.22	0.533	0.17121	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.685583	0.14769	N	0.299499	T	0.53546	0.1803	.	.	.	0.28713	N	0.903458	D	0.59767	0.986	P	0.52598	0.703	T	0.50180	-0.8858	9	0.10111	T	0.7	.	4.0545	0.09810	0.1551:0.2938:0.4551:0.096	.	539	Q8N3E9	PLCD3_HUMAN	H	539	ENSP00000313731:R539H	ENSP00000313731:R539H	R	-	2	0	PLCD3	40548082	0.993000	0.37304	1.000000	0.80357	0.299000	0.27559	0.160000	0.16462	0.422000	0.26005	0.462000	0.41574	CGC	PLCD3	-	pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y,pfscan_PLipase_C_Pinositol-sp_Y	ENSG00000161714		0.672	PLCD3-201	KNOWN	basic|appris_principal	protein_coding	PLCD3	HGNC	protein_coding		-	0.00	75	0	C	NM_133373		43192556	-1	tier1	rs199969953	no_errors	ENST00000322765	ensembl	human	known	74_37	missense	14.08	61	10	SNP	0.997	T
PLGLB1	5343	genome.wustl.edu	37	2	87240111	87240111	+	3'UTR	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:87240111G>A	ENST00000355705.3	-	0	492				RGPD1_ENST00000559485.1_3'UTR|PLGLB1_ENST00000409310.2_Intron|PLGLB1_ENST00000478636.1_5'UTR|RGPD1_ENST00000409776.2_3'UTR	NM_001032392.2	NP_001027564.1	Q02325	PLGB_HUMAN	plasminogen-like B1							extracellular region (GO:0005576)				large_intestine(1)	1						ACACAAAGATGAAAGGAAAAG	0.453																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M86874, M86875, M86876	CCDS33238.1	2p11.2	2008-02-05	2005-03-31	2005-03-31	ENSG00000183281	ENSG00000183281			9072	protein-coding gene	gene with protein product		173340	"""plasminogen-like"""	PLGL		1554698, 2714803	Standard	NM_001032392		Approved	PRP-B		Q02325	OTTHUMG00000154612	ENST00000355705.3:c.*133C>T	2.37:g.87240111G>A			Q580R1	RNA	SNP	-	NULL	ENST00000355705.3	37	NULL	CCDS33238.1	2																																																																																			PLGLB1	-	-	ENSG00000183281		0.453	PLGLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLGLB1	HGNC	protein_coding	OTTHUMT00000330379.1	-	0.00	371	0	G			87240111	-1	tier1	-	no_errors	ENST00000478636	ensembl	human	known	74_37	rna	15.71	160	30	SNP	0.157	A
PLCL1	5334	genome.wustl.edu	37	2	198948610	198948610	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:198948610A>C	ENST00000428675.1	+	2	767	c.369A>C	c.(367-369)aaA>aaC	p.K123N	PLCL1_ENST00000437704.2_Missense_Mutation_p.K25N	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	123	Interaction with PPP1C.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	AGTTGAAGAAAGTCCGGCCAA	0.458																																																	0													78.0	73.0	75.0					2																	198948610		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.369A>C	2.37:g.198948610A>C	ENSP00000402861:p.Lys123Asn		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.K123N	ENST00000428675.1	37	c.369	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	A	20.2	3.950579	0.73787	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.70282	-0.47;-0.47	5.67	-2.5	0.06384	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	D	0.84293	0.5440	M	0.92923	3.36	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84729	0.0744	9	.	.	.	.	11.5031	0.50450	0.6566:0.0:0.3434:0.0	.	123;49	Q15111;B4DYZ4	PLCL1_HUMAN;.	N	123;25	ENSP00000402861:K123N;ENSP00000414138:K25N	.	K	+	3	2	PLCL1	198656855	0.998000	0.40836	0.949000	0.38748	0.985000	0.73830	0.868000	0.27982	-0.339000	0.08401	0.533000	0.62120	AAA	PLCL1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000115896		0.458	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	-	0.00	72	0	A	NM_006226		198948610	+1	tier1	-	no_errors	ENST00000428675	ensembl	human	known	74_37	missense	15.09	45	8	SNP	0.986	C
PML	5371	genome.wustl.edu	37	15	74335355	74335355	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:74335355G>T	ENST00000268058.3	+	8	1832	c.1736G>T	c.(1735-1737)aGc>aTc	p.S579I	PML_ENST00000565898.1_Missense_Mutation_p.S531I|PML_ENST00000395135.3_Missense_Mutation_p.S579I|PML_ENST00000569965.1_3'UTR|PML_ENST00000359928.4_3'UTR|PML_ENST00000564428.1_Missense_Mutation_p.S531I	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	579					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						GATGACAGCAGCAGTGAGTCC	0.577			T	"""RARA, PAX5"""	"""APL, ALL"""																																			Dom	yes		15	15q22	5371	promyelocytic leukemia		L	0													85.0	82.0	83.0					15																	74335355		2198	4297	6495	SO:0001583	missense	0			AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1736G>T	15.37:g.74335355G>T	ENSP00000268058:p.Ser579Ile		E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	pfam_DUF3583,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.S579I	ENST00000268058.3	37	c.1736	CCDS10255.1	15	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932766	0.73442	.	.	ENSG00000140464	ENST00000395135;ENST00000268058;ENST00000417341;ENST00000418568	T	0.53857	0.6	4.85	3.91	0.45181	.	0.197372	0.36134	N	0.002771	T	0.54983	0.1892	L	0.29908	0.895	0.80722	D	1	P;D;D;D	0.63046	0.799;0.992;0.992;0.992	B;P;P;P	0.60068	0.252;0.868;0.868;0.868	T	0.58498	-0.7626	10	0.87932	D	0	-21.7979	10.7955	0.46457	0.0:0.1917:0.8083:0.0	.	579;531;531;579	P29590;P29590-11;P29590-12;P29590-5	PML_HUMAN;.;.;.	I	579;579;140;579	ENSP00000268058:S579I	ENSP00000268058:S579I	S	+	2	0	PML	72122408	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.085000	0.50151	1.242000	0.43836	0.561000	0.74099	AGC	PML	-	NULL	ENSG00000140464		0.577	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PML	HGNC	protein_coding	OTTHUMT00000269021.3		0.00	35	0	G	NM_002675		74335355	+1			no_errors	ENST00000268058	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	T
PNOC	5368	genome.wustl.edu	37	8	28196758	28196758	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:28196758G>A	ENST00000301908.3	+	3	536	c.328G>A	c.(328-330)Gag>Aag	p.E110K	RP11-380I10.4_ENST00000521731.1_RNA|PNOC_ENST00000522209.1_Missense_Mutation_p.E46K	NM_006228.3	NP_006219.1	Q13519	PNOC_HUMAN	prepronociceptin	110					neuropeptide signaling pathway (GO:0007218)|sensory perception (GO:0007600)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	5		Ovarian(32;0.000953)		KIRC - Kidney renal clear cell carcinoma(542;0.104)|Kidney(114;0.125)|Colorectal(74;0.145)|BRCA - Breast invasive adenocarcinoma(99;0.245)		GGAGCAGGAAGAGCCCGAGCC	0.632																																																	0													34.0	40.0	38.0					8																	28196758		2203	4300	6503	SO:0001583	missense	0				CCDS6066.1, CCDS64862.1	8p21	2013-02-26			ENSG00000168081	ENSG00000168081		"""Endogenous ligands"""	9163	protein-coding gene	gene with protein product	"""nocistatin"""	601459				8710928, 10101606	Standard	XM_005273532		Approved	PPNOC	uc003xgp.3	Q13519	OTTHUMG00000102125	ENST00000301908.3:c.328G>A	8.37:g.28196758G>A	ENSP00000301908:p.Glu110Lys		B7Z749|Q6FH16	Missense_Mutation	SNP	pfam_Opioid_neupept,prints_Nociceptin,prints_Opioid_neupept	p.E110K	ENST00000301908.3	37	c.328	CCDS6066.1	8	.	.	.	.	.	.	.	.	.	.	G	14.10	2.436097	0.43224	.	.	ENSG00000168081	ENST00000518479;ENST00000301908;ENST00000522209	T;T	0.80824	0.49;-1.42	4.78	1.92	0.25849	.	1.040130	0.07554	N	0.915875	T	0.77157	0.4089	M	0.62088	1.915	0.09310	N	1	B	0.25007	0.116	B	0.29353	0.101	T	0.64032	-0.6502	10	0.52906	T	0.07	-0.5572	4.9131	0.13833	0.1925:0.1738:0.6337:0.0	.	110	Q13519	PNOC_HUMAN	K	110;110;46	ENSP00000428059:E110K;ENSP00000301908:E110K	ENSP00000301908:E110K	E	+	1	0	PNOC	28252677	0.009000	0.17119	0.000000	0.03702	0.001000	0.01503	0.640000	0.24705	0.202000	0.20498	0.655000	0.94253	GAG	PNOC	-	NULL	ENSG00000168081		0.632	PNOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNOC	HGNC	protein_coding	OTTHUMT00000219964.2	-	0.00	40	0	G	NM_006228		28196758	+1	tier1	-	no_errors	ENST00000301908	ensembl	human	known	74_37	missense	17.07	34	7	SNP	0.003	A
PNPLA7	375775	genome.wustl.edu	37	9	140355171	140355171	+	Missense_Mutation	SNP	G	G	A	rs145220396		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:140355171G>A	ENST00000277531.4	-	33	3971	c.3785C>T	c.(3784-3786)aCg>aTg	p.T1262M	PNPLA7_ENST00000492278.1_5'UTR|NSMF_ENST00000265663.7_5'Flank|NSMF_ENST00000371474.3_5'Flank|NSMF_ENST00000392812.4_5'Flank|PNPLA7_ENST00000406427.1_Missense_Mutation_p.T1287M|PNPLA7_ENST00000371457.1_Missense_Mutation_p.T868M|NSMF_ENST00000371475.3_5'Flank|NSMF_ENST00000371473.3_5'Flank|NSMF_ENST00000437259.1_5'Flank|NSMF_ENST00000371472.2_5'Flank	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	1262					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		CTCGTACTCCGTCTGGTAGTC	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20076	0.0		0.0	False		,,,				2504	0.0																0													88.0	70.0	76.0					9																	140355171		2202	4300	6502	SO:0001583	missense	0			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.3785C>T	9.37:g.140355171G>A	ENSP00000277531:p.Thr1262Met		B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.T1287M	ENST00000277531.4	37	c.3860	CCDS7045.1	9	.	.	.	.	.	.	.	.	.	.	G	15.97	2.988825	0.53934	.	.	ENSG00000130653	ENST00000371457;ENST00000371446;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	T;T;T;T;T	0.72394	-0.65;3.27;0.12;0.11;0.12	4.14	3.18	0.36537	.	0.120379	0.56097	D	0.000038	T	0.80929	0.4718	M	0.79475	2.455	0.48830	D	0.999714	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;P	0.71414	0.973;0.972;0.97;0.879	T	0.82104	-0.0622	10	0.66056	D	0.02	-16.5702	9.1838	0.37158	0.0:0.0:0.7846:0.2154	.	670;1287;1262;509	E2QRF8;Q6ZV29-5;Q6ZV29;B3KXH5	.;.;PLPL7_HUMAN;.	M	868;670;1262;1287;1199;1253	ENSP00000360512:T868M;ENSP00000360501:T670M;ENSP00000277531:T1262M;ENSP00000384610:T1287M;ENSP00000400582:T1253M	ENSP00000277531:T1262M	T	-	2	0	PNPLA7	139474992	1.000000	0.71417	0.849000	0.33467	0.325000	0.28411	3.178000	0.50879	1.845000	0.53610	0.563000	0.77884	ACG	PNPLA7	-	NULL	ENSG00000130653		0.622	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA7	HGNC	protein_coding	OTTHUMT00000254787.1	-	0.00	27	0	G	NM_152286		140355171	-1	tier1	-	no_errors	ENST00000406427	ensembl	human	known	74_37	missense	34.78	15	8	SNP	0.985	A
PPARGC1A	10891	genome.wustl.edu	37	4	23815507	23815507	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:23815507C>T	ENST00000264867.2	-	8	1718	c.1599G>A	c.(1597-1599)ttG>ttA	p.L533L	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	533	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				ACACATTGAACAATGAATAGG	0.423																																					Esophageal Squamous(29;694 744 13796 34866 44181)												0													139.0	133.0	135.0					4																	23815507		2203	4300	6503	SO:0001819	synonymous_variant	0			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1599G>A	4.37:g.23815507C>T			B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L533	ENST00000264867.2	37	c.1599	CCDS3429.1	4																																																																																			PPARGC1A	-	NULL	ENSG00000109819		0.423	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	HGNC	protein_coding	OTTHUMT00000214976.1	-	0.00	31	0	C	NM_013261		23815507	-1	tier1	-	no_errors	ENST00000264867	ensembl	human	known	74_37	silent	20.00	12	3	SNP	1.000	T
PPFIA2	8499	genome.wustl.edu	37	12	81657028	81657028	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:81657028T>C	ENST00000549396.1	-	31	3857	c.3697A>G	c.(3697-3699)Aga>Gga	p.R1233G	PPFIA2_ENST00000548586.1_Missense_Mutation_p.R1227G|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R1128G|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R1132G|PPFIA2_ENST00000541570.2_Missense_Mutation_p.R769G|PPFIA2_ENST00000541017.1_Missense_Mutation_p.R419G|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R1233G|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R1218G|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R1221G|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R1212G|PPFIA2_ENST00000550359.2_Missense_Mutation_p.R1080G	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1233					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GTCATTTTTCTTGACTGCCCA	0.423																																																	0													116.0	107.0	110.0					12																	81657028		1910	4141	6051	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3697A>G	12.37:g.81657028T>C	ENSP00000450337:p.Arg1233Gly		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R1233G	ENST00000549396.1	37	c.3697	CCDS55857.1	12	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690408	0.48097	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T;T;T	0.33216	2.15;2.18;1.84;1.42;1.83;2.19;2.15;1.82;2.16	5.08	2.72	0.32119	.	0.122567	0.53938	D	0.000041	T	0.25827	0.0629	L	0.42245	1.32	0.53005	D	0.999968	B	0.27229	0.172	B	0.22386	0.039	T	0.11767	-1.0574	10	0.87932	D	0	-15.1309	12.0462	0.53480	0.0:0.0:0.6105:0.3895	.	1233	O75334	LIPA2_HUMAN	G	1233;1218;769;419;1132;1246;1221;1227;1128;1212	ENSP00000450337:R1233G;ENSP00000450298:R1218G;ENSP00000438337:R769G;ENSP00000445532:R419G;ENSP00000385093:R1132G;ENSP00000327416:R1221G;ENSP00000449338:R1227G;ENSP00000388373:R1128G;ENSP00000447868:R1212G	ENSP00000327416:R1221G	R	-	1	2	PPFIA2	80181159	0.995000	0.38212	0.945000	0.38365	0.947000	0.59692	2.404000	0.44539	0.750000	0.32877	0.528000	0.53228	AGA	PPFIA2	-	NULL	ENSG00000139220		0.423	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	-	0.00	65	0	T			81657028	-1	tier1	-	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.988	C
RAD9A	5883	genome.wustl.edu	37	11	67165845	67165845	+	3'UTR	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:67165845G>A	ENST00000307980.2	+	0	2084				PPP1CA_ENST00000376745.4_3'UTR|PPP1CA_ENST00000312989.7_3'UTR|RAD9A_ENST00000535644.1_3'UTR|PPP1CA_ENST00000532446.1_5'UTR	NM_001243224.1|NM_004584.2	NP_001230153.1|NP_004575.1	Q99638	RAD9A_HUMAN	RAD9 homolog A (S. pombe)						cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)	checkpoint clamp complex (GO:0030896)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|enzyme binding (GO:0019899)|exodeoxyribonuclease III activity (GO:0008853)|histone deacetylase binding (GO:0042826)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			lung(7)|upper_aerodigestive_tract(1)	8			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			GGGACTGGACGCTGCTATTGA	0.607								Other conserved DNA damage response genes																																									0																																										SO:0001624	3_prime_UTR_variant	0			U53174	CCDS8159.1	11q13.1-q13.2	2008-02-05	2003-07-21	2003-07-23	ENSG00000172613	ENSG00000172613			9827	protein-coding gene	gene with protein product		603761	"""RAD9 (S. pombe) homolog"""	RAD9		8943031	Standard	NM_004584		Approved		uc001okr.3	Q99638	OTTHUMG00000167670	ENST00000307980.2:c.*815G>A	11.37:g.67165845G>A			B2RCZ8|Q6FI29|Q96C41	RNA	SNP	-	NULL	ENST00000307980.2	37	NULL	CCDS8159.1	11																																																																																			PPP1CA	-	-	ENSG00000172531		0.607	RAD9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1CA	HGNC	protein_coding	OTTHUMT00000395481.2	-	0.00	33	0	G	NM_004584		67165845	-1	tier1	-	no_errors	ENST00000532446	ensembl	human	known	74_37	rna	22.22	21	6	SNP	0.672	A
PPP1R3G	648791	genome.wustl.edu	37	6	5085802	5085802	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:5085802C>T	ENST00000405617.2	+	1	83	c.83C>T	c.(82-84)cCc>cTc	p.P28L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	28					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						GAGGAGCTGCCCGCCCCGGTG	0.741																																																	0													2.0	4.0	3.0					6																	5085802		512	1306	1818	SO:0001583	missense	0				CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.83C>T	6.37:g.5085802C>T	ENSP00000393832:p.Pro28Leu			Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.P28L	ENST00000405617.2	37	c.83	CCDS47366.1	6	.	.	.	.	.	.	.	.	.	.	C	18.20	3.570873	0.65765	.	.	ENSG00000219607	ENST00000405617	T	0.59364	0.27	4.4	4.4	0.53042	.	.	.	.	.	T	0.20941	0.0504	N	0.08118	0	0.09310	N	1	B	0.23058	0.079	B	0.19391	0.025	T	0.23547	-1.0185	9	0.52906	T	0.07	.	12.4527	0.55686	0.0:1.0:0.0:0.0	.	28	B7ZBB8	PP13G_HUMAN	L	28	ENSP00000393832:P28L	ENSP00000393832:P28L	P	+	2	0	PPP1R3G	5030801	0.003000	0.15002	0.010000	0.14722	0.001000	0.01503	1.763000	0.38461	1.998000	0.58463	0.561000	0.74099	CCC	PPP1R3G	-	NULL	ENSG00000219607		0.741	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PPP1R3G	HGNC	protein_coding	OTTHUMT00000039740.3	-	0.00	38	0	C	NM_001145115		5085802	+1	tier1	-	no_errors	ENST00000405617	ensembl	human	novel	74_37	missense	15.00	17	3	SNP	0.002	T
PRAMEF6	440561	genome.wustl.edu	37	1	13111518	13111518	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:13111518C>T	ENST00000376182.1	-	3	596	c.497G>A	c.(496-498)tGc>tAc	p.C166Y	PRAMEF6_ENST00000376192.5_Missense_Mutation_p.C166Y|PRAMEF6_ENST00000414205.2_Missense_Mutation_p.C166Y	NM_001282323.1	NP_001269252.1	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	166					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|kidney(1)|lung(5)|urinary_tract(2)	9	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAGAAGGAGGCAGGTGAGGTA	0.478																																																	0																																										SO:0001583	missense	0				CCDS30594.1	1p36.21	2013-01-17				ENSG00000232423		"""-"""	30583	protein-coding gene	gene with protein product							Standard	NM_001010889		Approved		uc001auq.2	Q5VXH4	OTTHUMG00000001984	ENST00000376182.1:c.497G>A	1.37:g.13111518C>T	ENSP00000365353:p.Cys166Tyr		A0AUJ9	Missense_Mutation	SNP	NULL	p.C166Y	ENST00000376182.1	37	c.497		1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.669907	0.00006	.	.	ENSG00000232423	ENST00000376192;ENST00000376182;ENST00000414205	T;T;T	0.04015	3.73;3.73;3.73	1.21	-2.41	0.06562	.	0.745300	0.12225	N	0.488004	T	0.01254	0.0041	N	0.01729	-0.75	0.80722	P	0.0	B;B	0.21147	0.052;0.052	B;B	0.18561	0.022;0.022	T	0.38436	-0.9661	9	0.02654	T	1	.	2.6588	0.05020	0.2257:0.1973:0.0:0.577	.	166;166	A6NMV5;Q5TYX0	PRA23_HUMAN;PRAM5_HUMAN	Y	166	ENSP00000365363:C166Y;ENSP00000365353:C166Y;ENSP00000393084:C166Y	ENSP00000365353:C166Y	C	-	2	0	PRAMEF6	13034105	0.000000	0.05858	0.001000	0.08648	0.064000	0.16182	-1.345000	0.02637	-1.902000	0.01094	-1.140000	0.01884	TGC	PRAMEF6	-	NULL	ENSG00000232423		0.478	PRAMEF6-201	KNOWN	basic|appris_candidate_longest	protein_coding	PRAMEF6	HGNC	protein_coding		-	0.00	8	0	C	NM_001010889		13111518	-1	tier1	-	no_errors	ENST00000376182	ensembl	human	known	74_37	missense	66.67	1	2	SNP	0.001	T
PRKCD	5580	genome.wustl.edu	37	3	53221364	53221364	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:53221364C>T	ENST00000394729.2	+	14	1689	c.1361C>T	c.(1360-1362)gCc>gTc	p.A454V	PRKCD_ENST00000330452.3_Missense_Mutation_p.A454V	NM_212539.1	NP_997704.1	Q05655	KPCD_HUMAN	protein kinase C, delta	454	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular senescence (GO:0090398)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-10 production (GO:0032613)|interleukin-12 production (GO:0032615)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|mRNA metabolic process (GO:0016071)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of filopodium assembly (GO:0051490)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil activation (GO:0042119)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of glucosylceramide catabolic process (GO:2000753)|positive regulation of phospholipid scramblase activity (GO:1900163)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sphingomyelin catabolic process (GO:2000755)|positive regulation of superoxide anion generation (GO:0032930)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of receptor activity (GO:0010469)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|termination of signal transduction (GO:0023021)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|insulin receptor substrate binding (GO:0043560)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)	Ingenol Mebutate(DB05013)|Tamoxifen(DB00675)	AGGTTTTATGCCGCTGAGATA	0.587																																																	0													133.0	130.0	131.0					3																	53221364		2203	4300	6503	SO:0001583	missense	0				CCDS2870.1	3p21.31	2009-07-10			ENSG00000163932	ENSG00000163932	2.7.11.1		9399	protein-coding gene	gene with protein product		176977				8188219	Standard	NM_006254		Approved		uc003dgm.3	Q05655	OTTHUMG00000133659	ENST00000394729.2:c.1361C>T	3.37:g.53221364C>T	ENSP00000378217:p.Ala454Val		B0KZ81|B2R834|Q15144|Q86XJ6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.A454V	ENST00000394729.2	37	c.1361	CCDS2870.1	3	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466308	0.84425	.	.	ENSG00000163932	ENST00000394729;ENST00000330452	T;T	0.65732	-0.17;-0.17	5.47	4.58	0.56647	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.314985	0.33199	N	0.005174	T	0.49355	0.1552	L	0.28556	0.865	0.35936	D	0.832857	P	0.46457	0.878	B	0.39217	0.294	T	0.65096	-0.6251	10	0.62326	D	0.03	.	13.8927	0.63750	0.0:0.7762:0.2238:0.0	.	454	Q05655	KPCD_HUMAN	V	454	ENSP00000378217:A454V;ENSP00000331602:A454V	ENSP00000331602:A454V	A	+	2	0	PRKCD	53196404	0.894000	0.30519	0.952000	0.39060	0.896000	0.52359	1.727000	0.38095	2.572000	0.86782	0.591000	0.81541	GCC	PRKCD	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Prot_kin_PKC_delta,pfscan_Prot_kinase_dom	ENSG00000163932		0.587	PRKCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCD	HGNC	protein_coding	OTTHUMT00000257818.1	-	0.00	64	0	C			53221364	+1	tier1	-	no_errors	ENST00000330452	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.392	T
PRSS36	146547	genome.wustl.edu	37	16	31160456	31160456	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:31160456G>T	ENST00000268281.4	-	4	268	c.210C>A	c.(208-210)caC>caA	p.H70Q	PRSS36_ENST00000418068.2_Missense_Mutation_p.H70Q|PRSS36_ENST00000569305.1_Missense_Mutation_p.H70Q	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	70	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)	p.H70Q(1)		kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						CCCCGCAGATGTGGCCACCTC	0.682																																																	1	Substitution - Missense(1)	lung(1)											12.0	13.0	13.0					16																	31160456		2183	4280	6463	SO:0001583	missense	0			AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.210C>A	16.37:g.31160456G>T	ENSP00000268281:p.His70Gln		A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	pirsf_Pept_S1A_polyserase-2,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.H70Q	ENST00000268281.4	37	c.210	CCDS32436.1	16	.	.	.	.	.	.	.	.	.	.	g	20.7	4.028690	0.75390	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.82893	-1.66;-1.66	5.27	4.32	0.51571	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.89308	0.6678	M	0.72894	2.215	0.32663	N	0.517808	D;P;P	0.76494	0.999;0.692;0.507	D;B;B	0.75020	0.985;0.276;0.29	D	0.91079	0.4898	9	0.87932	D	0	.	11.4437	0.50110	0.0881:0.0:0.9119:0.0	.	70;70;70	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	Q	70	ENSP00000268281:H70Q;ENSP00000407160:H70Q	ENSP00000268281:H70Q	H	-	3	2	PRSS36	31067957	0.971000	0.33674	0.987000	0.45799	0.916000	0.54674	1.646000	0.37249	1.211000	0.43351	0.552000	0.68991	CAC	PRSS36	-	pirsf_Pept_S1A_polyserase-2,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000178226		0.682	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRSS36	HGNC	protein_coding	OTTHUMT00000433542.1		0.00	35	0	G	NM_173502		31160456	-1			no_errors	ENST00000268281	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.967	T
PRSS37	136242	genome.wustl.edu	37	7	141537835	141537835	+	Silent	SNP	G	G	T	rs149011966		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:141537835G>T	ENST00000350549.3	-	3	626	c.255C>A	c.(253-255)atC>atA	p.I85I	PRSS37_ENST00000438520.1_Silent_p.I85I	NM_001008270.2|NM_001171951.1	NP_001008271.2|NP_001165422.1	A4D1T9	PRS37_HUMAN	protease, serine, 37	85	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				binding of sperm to zona pellucida (GO:0007339)|cell migration (GO:0016477)|protein maturation (GO:0051604)	extracellular region (GO:0005576)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)	p.I85I(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(3)	15						AGTAGCGGACGATCTGAATGG	0.507																																																	1	Substitution - coding silent(1)	skin(1)											269.0	223.0	239.0					7																	141537835		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34764.1	7q34	2010-05-07			ENSG00000165076	ENSG00000165076		"""Serine peptidases / Serine peptidases"""	29211	protein-coding gene	gene with protein product							Standard	NM_001008270		Approved		uc003vws.2	A4D1T9	OTTHUMG00000157174	ENST00000350549.3:c.255C>A	7.37:g.141537835G>T			B2RPB5	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.I85	ENST00000350549.3	37	c.255	CCDS34764.1	7																																																																																			PRSS37	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000165076		0.507	PRSS37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS37	HGNC	protein_coding	OTTHUMT00000347763.1		0.00	53	0	G	NM_001008270		141537835	-1			no_errors	ENST00000350549	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.280	T
RAB39A	54734	genome.wustl.edu	37	11	107832695	107832695	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:107832695G>T	ENST00000320578.2	+	2	317	c.251G>T	c.(250-252)cGc>cTc	p.R84L		NM_017516.1	NP_059986.1	Q14964	RB39A_HUMAN	RAB39A, member RAS oncogene family	84					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)										TCTTATTACCGCAACTCAGTT	0.353																																																	0													67.0	65.0	66.0					11																	107832695		2201	4298	6499	SO:0001583	missense	0			X99962	CCDS8338.1	11q22.3	2011-11-22	2011-11-22	2011-11-22	ENSG00000179331	ENSG00000179331		"""RAB, member RAS oncogene"""	16521	protein-coding gene	gene with protein product	"""rab-related GTP-binding protein"""		"""RAB39, member RAS oncogene family"""	RAB39		9119394	Standard	NM_017516		Approved		uc001pjt.3	Q14964	OTTHUMG00000166367	ENST00000320578.2:c.251G>T	11.37:g.107832695G>T	ENSP00000322594:p.Arg84Leu		A8KAA4|Q8N6W2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R84L	ENST00000320578.2	37	c.251	CCDS8338.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.145359	0.94603	.	.	ENSG00000179331	ENST00000320578	D	0.82255	-1.59	5.4	5.4	0.78164	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000010	D	0.92616	0.7654	H	0.95260	3.645	0.80722	D	1	D	0.63880	0.993	P	0.55260	0.772	D	0.94426	0.7645	10	0.87932	D	0	.	19.3618	0.94442	0.0:0.0:1.0:0.0	.	84	Q14964	RB39A_HUMAN	L	84	ENSP00000322594:R84L	ENSP00000322594:R84L	R	+	2	0	RAB39	107337905	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.125000	0.94402	2.794000	0.96219	0.650000	0.86243	CGC	RAB39A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000179331		0.353	RAB39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB39A	HGNC	protein_coding	OTTHUMT00000389423.1		0.00	56	0	G	NM_017516		107832695	+1			no_errors	ENST00000320578	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
RABEP2	79874	genome.wustl.edu	37	16	28931200	28931202	+	In_Frame_Del	DEL	CTG	CTG	-	rs373504496		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:28931200_28931202delCTG	ENST00000358201.4	-	3	925_927	c.337_339delCAG	c.(337-339)cagdel	p.Q113del	RABEP2_ENST00000544477.1_In_Frame_Del_p.Q42del|RABEP2_ENST00000561803.1_5'UTR|RABEP2_ENST00000357573.6_In_Frame_Del_p.Q113del	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	113	Poly-Gln.				endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CCTCACAGTCCTGCTGCTGCTGC	0.64																																					Pancreas(66;639 1284 10093 31061 49099)												0																																										SO:0001651	inframe_deletion	0			AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.337_339delCAG	16.37:g.28931209_28931211delCTG	ENSP00000350934:p.Gln113del			In_Frame_Del	DEL	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.Q113in_frame_del	ENST00000358201.4	37	c.339_337	CCDS42140.1	16																																																																																			RABEP2	-	pfam_Rabaptin_coiled-coil	ENSG00000177548		0.640	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RABEP2	HGNC	protein_coding	OTTHUMT00000432691.1		0.00	54	0	CTG	NM_024816		28931202	-1	tier1		no_errors	ENST00000358201	ensembl	human	known	74_37	in_frame_del	9.52	38	4	DEL	1.000:1.000:1.000	-
RAD50	10111	genome.wustl.edu	37	5	131893062	131893062	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:131893062G>T	ENST00000265335.6	+	1	433	c.46G>T	c.(46-48)Gga>Tga	p.G16*	RAD50_ENST00000378823.3_5'UTR			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	16					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCGGAGTTTTGGAATAGAGGA	0.478								Homologous recombination																																									0													120.0	126.0	124.0					5																	131893062		2203	4300	6503	SO:0001587	stop_gained	0			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.46G>T	5.37:g.131893062G>T	ENSP00000265335:p.Gly16*		B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Nonsense_Mutation	SNP	pfam_Rad50_Zn_hook,superfamily_P-loop_NTPase,superfamily_Prefoldin,pfscan_Zn_hook_Rad50,tigrfam_Rad50_eukaryotes	p.G16*	ENST00000265335.6	37	c.46	CCDS34233.1	5	.	.	.	.	.	.	.	.	.	.	G	42	9.524019	0.99195	.	.	ENSG00000113522	ENST00000265335;ENST00000453394	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.9293	17.3711	0.87377	0.0:0.0:1.0:0.0	.	.	.	.	X	16	.	ENSP00000265335:G16X	G	+	1	0	RAD50	131920961	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.201000	0.95017	2.700000	0.92200	0.655000	0.94253	GGA	RAD50	-	superfamily_P-loop_NTPase,tigrfam_Rad50_eukaryotes	ENSG00000113522		0.478	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD50	HGNC	protein_coding	OTTHUMT00000132566.5	-	0.00	82	0	G	NM_005732		131893062	+1	tier1	-	no_errors	ENST00000265335	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	T
RASGRF1	5923	genome.wustl.edu	37	15	79291088	79291088	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:79291088G>A	ENST00000419573.3	-	19	3148	c.2874C>T	c.(2872-2874)ctC>ctT	p.L958L	RASGRF1_ENST00000394745.3_Silent_p.L174L|RASGRF1_ENST00000558480.2_Silent_p.L942L|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	958					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CCCAGTGGCGGAGCACGTTCA	0.627																																																	0													100.0	93.0	95.0					15																	79291088		2196	4293	6489	SO:0001819	synonymous_variant	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2874C>T	15.37:g.79291088G>A			F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L958	ENST00000419573.3	37	c.2874	CCDS10309.1	15																																																																																			RASGRF1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N	ENSG00000058335		0.627	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	-	0.00	68	0	G	NM_002891		79291088	-1	tier1	-	no_errors	ENST00000419573	ensembl	human	known	74_37	silent	47.50	21	19	SNP	0.986	A
RBMXL3	139804	genome.wustl.edu	37	X	114425602	114425602	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:114425602G>T	ENST00000424776.3	+	1	1640	c.1598G>T	c.(1597-1599)gGc>gTc	p.G533V	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	533	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CACAGTGGGGGCCACAGCAGT	0.642																																																	0													33.0	36.0	35.0					X																	114425602		692	1590	2282	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1598G>T	X.37:g.114425602G>T	ENSP00000417451:p.Gly533Val		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G533V	ENST00000424776.3	37	c.1598	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	G	12.15	1.850717	0.32699	.	.	ENSG00000175718	ENST00000424776	T	0.07800	3.16	0.862	0.862	0.19056	.	.	.	.	.	T	0.09905	0.0243	N	0.08118	0	0.32776	N	0.503187	D	0.69078	0.997	D	0.76071	0.987	T	0.33904	-0.9850	9	0.87932	D	0	.	5.4449	0.16529	1.0E-4:0.0:0.9999:0.0	.	533	Q8N7X1	RMXL3_HUMAN	V	533	ENSP00000417451:G533V	ENSP00000417451:G533V	G	+	2	0	RBMXL3	114331858	0.012000	0.17670	0.010000	0.14722	0.010000	0.07245	1.021000	0.30040	0.122000	0.18314	0.124000	0.15798	GGC	RBMXL3	-	NULL	ENSG00000175718		0.642	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3		0.00	118	0	G	NM_001145346		114425602	+1			no_errors	ENST00000424776	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.602	T
RBPJ	3516	genome.wustl.edu	37	4	26417097	26417098	+	Splice_Site	INS	-	-	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:26417097_26417098insT	ENST00000361572.6	+	4	389_390	c.195_196insT	c.(196-198)ttt>Tttt	p.F66fs	RBPJ_ENST00000348160.4_Splice_Site_p.F53fs|RBPJ_ENST00000511401.1_3'UTR|RBPJ_ENST00000342295.1_Splice_Site_p.F66fs|RBPJ_ENST00000507561.1_Splice_Site_p.F31fs|RBPJ_ENST00000504907.1_Splice_Site_p.F52fs|RBPJ_ENST00000355476.3_Splice_Site_p.F52fs|RBPJ_ENST00000345843.3_Splice_Site_p.F51fs|RBPJ_ENST00000342320.4_Splice_Site_p.F52fs			Q06330	SUH_HUMAN	recombination signal binding protein for immunoglobulin kappa J region	66					angiogenesis (GO:0001525)|arterial endothelial cell fate commitment (GO:0060844)|atrioventricular canal development (GO:0036302)|auditory receptor cell fate commitment (GO:0009912)|B cell differentiation (GO:0030183)|blood vessel endothelial cell fate specification (GO:0097101)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac left ventricle morphogenesis (GO:0003214)|Clara cell differentiation (GO:0060486)|defense response to bacterium (GO:0042742)|DNA recombination (GO:0006310)|dorsal aorta morphogenesis (GO:0035912)|endocardium morphogenesis (GO:0003160)|epidermal cell fate specification (GO:0009957)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|gene expression (GO:0010467)|hair follicle maturation (GO:0048820)|humoral immune response (GO:0006959)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901297)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of ephrin receptor signaling pathway (GO:1901189)|positive regulation of ERBB signaling pathway (GO:1901186)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription of Notch receptor target (GO:0007221)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|sebaceous gland development (GO:0048733)|secondary heart field specification (GO:0003139)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|recombinase activity (GO:0000150)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R51S(1)		central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)	15		Breast(46;0.0503)				TATTCTTCAGGTTTTTTTGCCC	0.332																																																	1	Substitution - Missense(1)	central_nervous_system(1)																																								SO:0001630	splice_region_variant	0			L07872	CCDS3436.1, CCDS3437.1, CCDS33969.1, CCDS43219.1	4p15.2	2013-10-18	2007-02-26	2007-02-26	ENSG00000168214	ENSG00000168214			5724	protein-coding gene	gene with protein product	"""suppressor of hairless homolog (Drosophila)"""	147183	"""recombining binding protein suppressor of hairless (Drosophila)"""	IGKJRB1, RBPSUH		8406481, 9290259	Standard	NM_005349		Approved	SUH, IGKJRB, RBPJK, KBF2, RBP-J, CBF1	uc003gsb.2	Q06330	OTTHUMG00000097793	ENST00000361572.6:c.195-1->T	4.37:g.26417104_26417104dupT			B4DY22|Q5XKH9|Q6P1N3	Frame_Shift_Ins	INS	pfam_Beta-trefoil_DNA-bd_dom,pfam_LAG1_DNA-bd,pfam_IPT,superfamily_Beta-trefoil_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set	p.C67fs	ENST00000361572.6	37	c.195_196	CCDS3437.1	4																																																																																			RBPJ	-	pfam_LAG1_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000168214		0.332	RBPJ-002	KNOWN	basic|CCDS	protein_coding	RBPJ	HGNC	protein_coding	OTTHUMT00000215046.2		0.00	28	0	0	NM_015874	Frame_Shift_Ins	26417098	+1			no_errors	ENST00000342295	ensembl	human	known	74_37	frame_shift_ins	31.25	11	5	INS	1.000:1.000	T
RBPJL	11317	genome.wustl.edu	37	20	43945540	43945540	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr20:43945540C>A	ENST00000343694.3	+	12	1567	c.1495C>A	c.(1495-1497)Ctg>Atg	p.L499M	RBPJL_ENST00000464504.1_3'UTR|RBPJL_ENST00000372743.1_Missense_Mutation_p.L498M|RBPJL_ENST00000372741.3_3'UTR	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	499	IPT/TIG.				positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				CGACGCGCTCCTGGAGAGCAT	0.677																																																	0													42.0	51.0	48.0					20																	43945540		2203	4298	6501	SO:0001583	missense	0			AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.1495C>A	20.37:g.43945540C>A	ENSP00000341243:p.Leu499Met		O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	pfam_Beta-trefoil_DNA-bd_dom,pfam_LAG1_DNA-bd,superfamily_Beta-trefoil_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set	p.L499M	ENST00000343694.3	37	c.1495	CCDS13349.1	20	.	.	.	.	.	.	.	.	.	.	C	15.47	2.842512	0.51057	.	.	ENSG00000124232	ENST00000372743;ENST00000343694	T;T	0.44083	0.94;0.93	5.06	3.9	0.45041	.	0.000000	0.52532	D	0.000077	T	0.51092	0.1654	L	0.54323	1.7	0.23459	N	0.997637	D	0.63880	0.993	P	0.59288	0.855	T	0.36286	-0.9754	10	0.33940	T	0.23	-21.3632	11.7213	0.51683	0.0:0.9011:0.0:0.0989	.	499	Q9UBG7	RBPJL_HUMAN	M	498;499	ENSP00000361828:L498M;ENSP00000341243:L499M	ENSP00000341243:L499M	L	+	1	2	RBPJL	43378954	0.723000	0.28027	0.971000	0.41717	0.732000	0.41865	1.266000	0.33039	2.358000	0.79984	0.449000	0.29647	CTG	RBPJL	-	NULL	ENSG00000124232		0.677	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBPJL	HGNC	protein_coding	OTTHUMT00000080391.1		0.00	10	0	C	NM_014276		43945540	+1			no_errors	ENST00000343694	ensembl	human	known	74_37	missense	33.33	16	8	SNP	0.377	A
RER1	11079	genome.wustl.edu	37	1	2332324	2332324	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:2332324G>T	ENST00000605895.1	+	5	448	c.315G>T	c.(313-315)caG>caT	p.Q105H	RER1_ENST00000378513.3_Missense_Mutation_p.R72I|RER1_ENST00000378512.1_Missense_Mutation_p.Q105H|RER1_ENST00000378518.1_Missense_Mutation_p.R72I|RER1_ENST00000488353.1_Missense_Mutation_p.Q105H	NM_007033.4	NP_008964.3	O15258	RER1_HUMAN	retention in endoplasmic reticulum sorting receptor 1	105					positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)	cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)				endometrium(3)|kidney(1)	4	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.28e-37)|OV - Ovarian serous cystadenocarcinoma(86;8.29e-23)|GBM - Glioblastoma multiforme(42;4.71e-08)|Colorectal(212;4.73e-05)|COAD - Colon adenocarcinoma(227;0.00021)|Kidney(185;0.00116)|BRCA - Breast invasive adenocarcinoma(365;0.00459)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0182)|Lung(427;0.204)		CCACCAAACAGAACGAGGAAT	0.483																																																	0													181.0	179.0	180.0					1																	2332324		1903	4113	6016	SO:0001583	missense	0			AF157324	CCDS41232.1	1p36	2013-10-18	2013-10-18		ENSG00000157916	ENSG00000157916			30309	protein-coding gene	gene with protein product			"""RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)"""			9309388, 17668005	Standard	NM_007033		Approved		uc001aje.2	O15258	OTTHUMG00000001403	ENST00000605895.1:c.315G>T	1.37:g.2332324G>T	ENSP00000475168:p.Gln105His		O95322	Missense_Mutation	SNP	pfam_Rer1,pirsf_Rer1	p.Q105H	ENST00000605895.1	37	c.315	CCDS41232.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.58|11.58	1.681225|1.681225	0.29872|0.29872	.|.	.|.	ENSG00000157916|ENSG00000157916	ENST00000306256;ENST00000434662;ENST00000378512;ENST00000443438|ENST00000378518;ENST00000378513	.|.	.|.	.|.	5.68|5.68	2.37|2.37	0.29283|0.29283	.|.	0.115998|.	0.64402|.	N|.	0.000013|.	T|T	0.52306|0.52306	0.1726|0.1726	M|M	0.65975|0.65975	2.015|2.015	0.33589|0.33589	D|D	0.600837|0.600837	D;B|.	0.65815|.	0.995;0.006|.	D;B|.	0.65443|.	0.935;0.027|.	T|T	0.60692|0.60692	-0.7213|-0.7213	9|6	0.46703|0.45353	T|T	0.11|0.12	.|.	2.3481|2.3481	0.04277|0.04277	0.3432:0.0:0.431:0.2258|0.3432:0.0:0.431:0.2258	.|.	105;105|.	Q5T091;O15258|.	.;RER1_HUMAN|.	H|I	105|72	.|.	ENSP00000302088:Q105H|ENSP00000367774:R72I	Q|R	+|+	3|2	2|0	RER1|RER1	2322184|2322184	1.000000|1.000000	0.71417|0.71417	0.848000|0.848000	0.33437|0.33437	0.262000|0.262000	0.26303|0.26303	3.526000|3.526000	0.53509|0.53509	0.720000|0.720000	0.32209|0.32209	0.655000|0.655000	0.94253|0.94253	CAG|AGA	RER1	-	pfam_Rer1,pirsf_Rer1	ENSG00000157916		0.483	RER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RER1	HGNC	protein_coding	OTTHUMT00000004061.2		0.00	139	0	G			2332324	+1			no_errors	ENST00000488353	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
RGPD4	285190	genome.wustl.edu	37	2	108487761	108487761	+	Nonsense_Mutation	SNP	C	C	T	rs556511922		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:108487761C>T	ENST00000408999.3	+	20	3378	c.3301C>T	c.(3301-3303)Cga>Tga	p.R1101*	RGPD4_ENST00000354986.4_Nonsense_Mutation_p.R1101*	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1101	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AATGCTGATGCGAAGAGAACA	0.428													N|||	1	0.000199681	0.0008	0.0	5008	,	,		15728	0.0		0.0	False		,,,				2504	0.0																0													14.0	10.0	11.0					2																	108487761		689	1572	2261	SO:0001587	stop_gained	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3301C>T	2.37:g.108487761C>T	ENSP00000386810:p.Arg1101*		B9A029	Nonsense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.R1101*	ENST00000408999.3	37	c.3301	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	35	5.451421	0.96205	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	.	.	.	2.33	-0.118	0.13547	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.6328	8.471	0.32986	0.534:0.466:0.0:0.0	.	.	.	.	X	1101;1101;859	.	ENSP00000347081:R1101X	R	+	1	2	RGPD4	107854193	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	1.633000	0.37113	0.262000	0.21774	0.162000	0.16502	CGA	RGPD4	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000196862		0.428	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	-	0.00	146	0	C	XM_496581		108487761	+1	tier1	-	no_errors	ENST00000354986	ensembl	human	known	74_37	nonsense	37.40	82	49	SNP	1.000	T
RIMKLB	57494	genome.wustl.edu	37	12	8925956	8925956	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:8925956A>G	ENST00000538135.1	+	6	1562	c.737A>G	c.(736-738)aAg>aGg	p.K246R	RIMKLB_ENST00000357529.3_Missense_Mutation_p.K246R|RIMKLB_ENST00000299673.5_3'UTR|A2ML1-AS1_ENST00000537288.1_RNA|RIMKLB_ENST00000535829.1_Missense_Mutation_p.K246R			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	246	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GAACAAGGGAAGCAGCTAGCT	0.428																																																	0													191.0	190.0	190.0					12																	8925956		2044	4198	6242	SO:0001583	missense	0			AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.737A>G	12.37:g.8925956A>G	ENSP00000440943:p.Lys246Arg		B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Missense_Mutation	SNP	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	p.K246R	ENST00000538135.1	37	c.737	CCDS41748.1	12	.	.	.	.	.	.	.	.	.	.	A	12.14	1.849631	0.32699	.	.	ENSG00000166532	ENST00000535829;ENST00000357529;ENST00000538135	.	.	.	5.56	5.56	0.83823	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	U	0.000000	T	0.27349	0.0671	N	0.11673	0.155	0.40552	D	0.981127	B;B	0.12013	0.005;0.003	B;B	0.16289	0.015;0.01	T	0.19418	-1.0306	9	0.02654	T	1	.	9.1165	0.36762	0.9179:0.0:0.0821:0.0	.	246;246	Q9ULI2-2;Q9ULI2	.;RIMKB_HUMAN	R	246	.	ENSP00000350136:K246R	K	+	2	0	RIMKLB	8817223	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	5.888000	0.69758	2.112000	0.64535	0.482000	0.46254	AAG	RIMKLB	-	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	ENSG00000166532		0.428	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMKLB	HGNC	protein_coding	OTTHUMT00000398874.1	-	0.00	39	0	A	NM_020734		8925956	+1	tier1	-	no_errors	ENST00000357529	ensembl	human	known	74_37	missense	18.75	26	6	SNP	1.000	G
RINT1	60561	genome.wustl.edu	37	7	105189088	105189088	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:105189088G>A	ENST00000257700.2	+	7	1158	c.927G>A	c.(925-927)atG>atA	p.M309I		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	309	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TCCAGGTTATGCTGACTCCTC	0.458																																																	0													195.0	177.0	183.0					7																	105189088		2203	4300	6503	SO:0001583	missense	0			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.927G>A	7.37:g.105189088G>A	ENSP00000257700:p.Met309Ile		Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	pfam_RINT1_TIP1	p.M309I	ENST00000257700.2	37	c.927	CCDS34726.1	7	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967755	0.74131	.	.	ENSG00000135249	ENST00000257700	T	0.33654	1.4	5.93	5.93	0.95920	.	0.076510	0.85682	D	0.000000	T	0.41994	0.1183	L	0.45581	1.43	0.80722	D	1	P	0.35684	0.515	B	0.40636	0.335	T	0.10613	-1.0622	10	0.40728	T	0.16	-17.6605	20.3226	0.98684	0.0:0.0:1.0:0.0	.	309	Q6NUQ1	RINT1_HUMAN	I	309	ENSP00000257700:M309I	ENSP00000257700:M309I	M	+	3	0	RINT1	104976324	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	9.845000	0.99498	2.805000	0.96524	0.650000	0.86243	ATG	RINT1	-	pfam_RINT1_TIP1	ENSG00000135249		0.458	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RINT1	HGNC	protein_coding	OTTHUMT00000348686.1	-	0.00	43	0	G	NM_021930		105189088	+1	tier1	-	no_errors	ENST00000257700	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
RNF17	56163	genome.wustl.edu	37	13	25436917	25436917	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr13:25436917G>T	ENST00000255324.5	+	28	4013	c.3961G>T	c.(3961-3963)Gac>Tac	p.D1321Y	RNF17_ENST00000381921.1_Missense_Mutation_p.D1321Y|RNF17_ENST00000339524.3_Missense_Mutation_p.D373Y	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1321					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GAGACAGGTGGACATTCACAT	0.284																																																	0													85.0	96.0	92.0					13																	25436917		2203	4299	6502	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3961G>T	13.37:g.25436917G>T	ENSP00000255324:p.Asp1321Tyr		Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.D1321Y	ENST00000255324.5	37	c.3961	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529828	0.45073	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000418120;ENST00000339524	T;T;T;T	0.23552	3.47;3.46;2.7;1.9	6.17	4.43	0.53597	.	0.304259	0.28914	N	0.013726	T	0.25121	0.0610	L	0.29908	0.895	0.80722	D	1	B;P	0.43662	0.357;0.814	B;P	0.49502	0.326;0.613	T	0.02553	-1.1142	10	0.54805	T	0.06	-4.6873	7.31	0.26469	0.141:0.1467:0.7123:0.0	.	373;1321	Q5T6R1;Q9BXT8	.;RNF17_HUMAN	Y	1321;1321;645;373	ENSP00000255324:D1321Y;ENSP00000371346:D1321Y;ENSP00000388892:D645Y;ENSP00000344776:D373Y	ENSP00000255324:D1321Y	D	+	1	0	RNF17	24334917	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	2.533000	0.45667	1.616000	0.50265	0.655000	0.94253	GAC	RNF17	-	NULL	ENSG00000132972		0.284	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1		0.00	196	0	G	NM_031994		25436917	+1			no_errors	ENST00000255324	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
RRBP1	6238	genome.wustl.edu	37	20	17641080	17641080	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr20:17641080T>A	ENST00000377813.1	-	3	376	c.73A>T	c.(73-75)Atc>Ttc	p.I25F	RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000377807.2_Missense_Mutation_p.I25F|RRBP1_ENST00000246043.4_Missense_Mutation_p.I25F|RRBP1_ENST00000360807.4_Missense_Mutation_p.I25F			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	25					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						ACCAGGAAGATGCCAATGGCA	0.483																																																	0													90.0	82.0	85.0					20																	17641080		2203	4300	6503	SO:0001583	missense	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.73A>T	20.37:g.17641080T>A	ENSP00000367044:p.Ile25Phe		A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.I25F	ENST00000377813.1	37	c.73		20	.	.	.	.	.	.	.	.	.	.	T	24.3	4.521240	0.85600	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000398782	T;T;T;T;D	0.99129	0.54;0.75;0.54;0.75;-5.46	4.54	4.54	0.55810	.	0.000000	0.32753	N	0.005693	D	0.98406	0.9470	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99819	1.1046	10	0.87932	D	0	-15.4183	13.3362	0.60518	0.0:0.0:0.0:1.0	.	25	Q9P2E9-3	.	F	25	ENSP00000354045:I25F;ENSP00000367044:I25F;ENSP00000367038:I25F;ENSP00000246043:I25F;ENSP00000381762:I25F	ENSP00000246043:I25F	I	-	1	0	RRBP1	17589080	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.956000	0.87863	1.821000	0.53095	0.533000	0.62120	ATC	RRBP1	-	NULL	ENSG00000125844		0.483	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	-	0.00	68	0	T	NM_001042576		17641080	-1	tier1	-	no_errors	ENST00000246043	ensembl	human	known	74_37	missense	48.33	31	29	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237550622	237550622	+	Silent	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:237550622T>C	ENST00000366574.2	+	9	935	c.618T>C	c.(616-618)gcT>gcC	p.A206A	RYR2_ENST00000542537.1_Silent_p.A190A|RYR2_ENST00000360064.6_Silent_p.A204A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	206	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGATGCCGCTTTCCAGCAGA	0.517																																																	0													113.0	114.0	114.0					1																	237550622		1971	4164	6135	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.618T>C	1.37:g.237550622T>C			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.A204	ENST00000366574.2	37	c.612	CCDS55691.1	1																																																																																			RYR2	-	pfam_Ins145_P3_rcpt,smart_MIR_motif	ENSG00000198626		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	28	0	T	NM_001035		237550622	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	35.00	13	7	SNP	0.990	C
SARDH	1757	genome.wustl.edu	37	9	136536709	136536709	+	Silent	SNP	G	G	A	rs371772872		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:136536709G>A	ENST00000371872.4	-	18	2531	c.2274C>T	c.(2272-2274)caC>caT	p.H758H	SARDH_ENST00000371868.1_Silent_p.H186H|SARDH_ENST00000439388.1_Silent_p.H758H|SARDH_ENST00000422262.2_Silent_p.H590H	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	758					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		TGATGAGGCCGTGCTTGGCAC	0.672																																																	0													46.0	35.0	39.0					9																	136536709		2198	4293	6491	SO:0001819	synonymous_variant	0				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.2274C>T	9.37:g.136536709G>A			B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.H758	ENST00000371872.4	37	c.2274	CCDS6978.1	9																																																																																			SARDH	-	pfam_GCV_T_N	ENSG00000123453		0.672	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	HGNC	protein_coding	OTTHUMT00000054931.1	-	0.00	90	0	G			136536709	-1	tier1	-	no_errors	ENST00000371872	ensembl	human	known	74_37	silent	16.92	54	11	SNP	0.964	A
SCGB2A2	4250	genome.wustl.edu	37	11	62038514	62038514	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:62038514A>C	ENST00000227918.2	+	2	279	c.217A>C	c.(217-219)Act>Cct	p.T73P	SCGB2A2_ENST00000525380.1_Missense_Mutation_p.T73P	NM_002411.2	NP_002402.1	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2	73										large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7						AACGGATGAAACTCTGAGCAA	0.378																																																	0													171.0	169.0	170.0					11																	62038514		2202	4299	6501	SO:0001583	missense	0			AF015224	CCDS8018.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000110484	ENSG00000110484		"""Secretoglobins"""	7050	protein-coding gene	gene with protein product	"""mammaglobin A"""	605562	"""mammaglobin 1"""	MGB1		9488047, 8631025, 22155607	Standard	XM_005274005		Approved	UGB2, MGC71974	uc001ntc.3	Q13296	OTTHUMG00000167509	ENST00000227918.2:c.217A>C	11.37:g.62038514A>C	ENSP00000227918:p.Thr73Pro		A1A522|Q86WH8	Missense_Mutation	SNP	pfam_Secretoglobin,superfamily_Secretoglobin	p.T73P	ENST00000227918.2	37	c.217	CCDS8018.1	11	.	.	.	.	.	.	.	.	.	.	A	13.72	2.321900	0.41096	.	.	ENSG00000110484	ENST00000227918;ENST00000525380	T;T	0.17691	2.26;2.26	3.06	3.06	0.35304	.	.	.	.	.	T	0.33206	0.0855	.	.	.	0.09310	N	1	D;D	0.69078	0.997;0.997	P;D	0.64776	0.884;0.929	T	0.04454	-1.0950	8	0.87932	D	0	.	7.9548	0.30035	1.0:0.0:0.0:0.0	.	73;73	Q13296-2;Q13296	.;SG2A2_HUMAN	P	73	ENSP00000227918:T73P;ENSP00000431997:T73P	ENSP00000227918:T73P	T	+	1	0	SCGB2A2	61795090	0.007000	0.16637	0.004000	0.12327	0.009000	0.06853	2.452000	0.44961	1.666000	0.50821	0.378000	0.23410	ACT	SCGB2A2	-	pfam_Secretoglobin,superfamily_Secretoglobin	ENSG00000110484		0.378	SCGB2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB2A2	HGNC	protein_coding	OTTHUMT00000394860.1	-	0.00	86	0	A	NM_002411		62038514	+1	tier1	-	no_errors	ENST00000227918	ensembl	human	known	74_37	missense	9.43	48	5	SNP	0.005	C
SCN5A	6331	genome.wustl.edu	37	3	38629045	38629045	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:38629045G>T	ENST00000333535.4	-	15	2431	c.2282C>A	c.(2281-2283)aCa>aAa	p.T761K	SCN5A_ENST00000451551.2_Missense_Mutation_p.T761K|SCN5A_ENST00000455624.2_Missense_Mutation_p.T761K|SCN5A_ENST00000450102.2_Missense_Mutation_p.T761K|SCN5A_ENST00000413689.1_Missense_Mutation_p.T761K|SCN5A_ENST00000425664.1_Missense_Mutation_p.T761K|SCN5A_ENST00000423572.2_Missense_Mutation_p.T761K|SCN5A_ENST00000443581.1_Missense_Mutation_p.T761K|SCN5A_ENST00000449557.2_Missense_Mutation_p.T761K|SCN5A_ENST00000414099.2_Missense_Mutation_p.T761K			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	761					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CATCTCTGCTGTGAAAATCCC	0.532																																																	0													123.0	124.0	124.0					3																	38629045		2052	4213	6265	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2282C>A	3.37:g.38629045G>T	ENSP00000328968:p.Thr761Lys		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.T761K	ENST00000333535.4	37	c.2282	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522976	0.85600	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.98987	-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3	4.14	4.14	0.48551	Ion transport (1);	0.104908	0.64402	D	0.000004	D	0.99539	0.9835	H	0.96889	3.9	0.58432	D	0.999997	D;D;D;D;D;D;D	0.89917	0.999;0.998;0.988;0.975;0.979;1.0;0.974	D;D;P;P;P;D;P	0.87578	0.998;0.966;0.844;0.863;0.815;0.973;0.647	D	0.97771	1.0226	10	0.87932	D	0	.	16.5932	0.84781	0.0:0.0:1.0:0.0	.	761;761;761;761;761;761;761	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	K	761	ENSP00000398962:T761K;ENSP00000398266:T761K;ENSP00000410257:T761K;ENSP00000388797:T761K;ENSP00000397915:T761K;ENSP00000416634:T761K;ENSP00000328968:T761K;ENSP00000399524:T761K;ENSP00000403355:T761K;ENSP00000413996:T761K	ENSP00000328968:T761K	T	-	2	0	SCN5A	38604049	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.611000	0.98342	2.154000	0.67381	0.555000	0.69702	ACA	SCN5A	-	pfam_Ion_trans_dom	ENSG00000183873		0.532	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	-	0.00	68	0	G	NM_198056		38629045	-1	tier1	-	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
SEMA5A	9037	genome.wustl.edu	37	5	9197360	9197360	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:9197360C>T	ENST00000382496.5	-	10	1653	c.988G>A	c.(988-990)Gcc>Acc	p.A330T		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	330	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CCAGAGAAGGCCTGCGCGATG	0.602																																																	0													86.0	86.0	86.0					5																	9197360		2203	4300	6503	SO:0001583	missense	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.988G>A	5.37:g.9197360C>T	ENSP00000371936:p.Ala330Thr		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.A330T	ENST00000382496.5	37	c.988	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255746	0.39896	.	.	ENSG00000112902	ENST00000382496	T	0.11821	2.74	5.28	3.42	0.39159	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.224065	0.46758	D	0.000272	T	0.11239	0.0274	L	0.38175	1.15	0.41967	D	0.990736	B	0.15141	0.012	B	0.20955	0.032	T	0.07443	-1.0772	10	0.54805	T	0.06	.	8.3524	0.32310	0.0:0.7524:0.1604:0.0871	.	330	Q13591	SEM5A_HUMAN	T	330	ENSP00000371936:A330T	ENSP00000371936:A330T	A	-	1	0	SEMA5A	9250360	1.000000	0.71417	1.000000	0.80357	0.270000	0.26580	3.191000	0.50981	1.301000	0.44836	0.603000	0.83216	GCC	SEMA5A	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000112902		0.602	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2		0.00	104	0	C			9197360	-1			no_errors	ENST00000382496	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
SENP6	26054	genome.wustl.edu	37	6	76386937	76386937	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:76386937G>A	ENST00000447266.2	+	14	2291	c.1813G>A	c.(1813-1815)Gga>Aga	p.G605R	SENP6_ENST00000370010.2_Missense_Mutation_p.G598R|SENP6_ENST00000327284.8_Missense_Mutation_p.G598R|SENP6_ENST00000541192.1_Missense_Mutation_p.G201R|SENP6_ENST00000370014.3_Missense_Mutation_p.G605R	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	605					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				GAGCATCAAAGGAAGTTGTGG	0.294																																																	0													39.0	37.0	37.0					6																	76386937		1793	4062	5855	SO:0001583	missense	0				CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1813G>A	6.37:g.76386937G>A	ENSP00000402527:p.Gly605Arg		A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.G605R	ENST00000447266.2	37	c.1813	CCDS47454.1	6	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991454	0.35131	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000327284;ENST00000447266;ENST00000424947;ENST00000541192	T;T;T;T;T;T	0.29917	2.76;2.76;1.55;2.76;1.55;1.58	5.26	5.26	0.73747	.	0.398519	0.29466	N	0.012068	T	0.36468	0.0968	L	0.51422	1.61	0.34176	D	0.670392	P;B;D	0.62365	0.459;0.177;0.991	B;B;D	0.63381	0.213;0.072;0.914	T	0.20739	-1.0266	10	0.51188	T	0.08	-18.8753	14.4845	0.67606	0.0:0.1468:0.8532:0.0	.	598;605;598	Q9GZR1-2;Q9GZR1;F8W6D9	.;SENP6_HUMAN;.	R	598;605;598;605;495;201	ENSP00000359027:G598R;ENSP00000359031:G605R;ENSP00000321820:G598R;ENSP00000402527:G605R;ENSP00000391426:G495R;ENSP00000441715:G201R	ENSP00000321820:G598R	G	+	1	0	SENP6	76443657	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	6.247000	0.72411	2.475000	0.83589	0.460000	0.39030	GGA	SENP6	-	NULL	ENSG00000112701		0.294	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP6	HGNC	protein_coding	OTTHUMT00000041272.2	-	0.00	225	0	G	NM_015571		76386937	+1	tier1	-	no_errors	ENST00000370014	ensembl	human	known	74_37	missense	41.98	76	55	SNP	1.000	A
SET	6418	genome.wustl.edu	37	9	131455936	131455936	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:131455936G>T	ENST00000372692.4	+	6	792	c.551G>T	c.(550-552)aGt>aTt	p.S184I	SET_ENST00000477806.1_3'UTR|SET_ENST00000372688.4_Missense_Mutation_p.S160I|SET_ENST00000322030.8_Missense_Mutation_p.S171I|SET_ENST00000409104.3_Missense_Mutation_p.S162I	NM_001122821.1	NP_001116293.1	Q01105	SET_HUMAN	SET nuclear proto-oncogene	184	Earmuff domain.				DNA replication (GO:0006260)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of catalytic activity (GO:0043086)|negative regulation of histone acetylation (GO:0035067)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|nucleosome disassembly (GO:0006337)|regulation of catalytic activity (GO:0050790)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone binding (GO:0042393)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(2)|kidney(1)|lung(2)	5		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		AAACGTTCGAGTCAAACGCAG	0.408			T	NUP214	AML																																			Dom	yes		9	9q34	6418	SET translocation		L	0													39.0	35.0	37.0					9																	131455936		2203	4300	6503	SO:0001583	missense	0			M93651	CCDS6907.1, CCDS48037.1, CCDS59149.1, CCDS59150.1	9q34	2014-06-25	2014-06-25		ENSG00000119335	ENSG00000119335			10760	protein-coding gene	gene with protein product	"""protein phosphatase type 2A inhibitor"", ""Template-Activating Factor-I, chromatin remodelling factor"""	600960	"""SET translocation (myeloid leukemia-associated)"""			1630450, 8626647	Standard	NM_003011		Approved	PHAPII, 2PP2A, IPP2A2	uc022bol.1	Q01105	OTTHUMG00000020755	ENST00000372692.4:c.551G>T	9.37:g.131455936G>T	ENSP00000361777:p.Ser184Ile		A5A5H4|A6NGV1|B4DUE2|Q15541|Q5VXV1|Q5VXV2|Q6FHZ5	Missense_Mutation	SNP	pfam_NAP_family	p.S184I	ENST00000372692.4	37	c.551	CCDS48037.1	9	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582688	0.86748	.	.	ENSG00000119335	ENST00000372692;ENST00000409104;ENST00000322030;ENST00000372688;ENST00000372686	T;T;T;T;T	0.24151	1.87;3.12;1.87;3.12;3.12	5.41	5.41	0.78517	.	0.038813	0.85682	D	0.000000	T	0.33294	0.0858	L	0.37697	1.125	0.58432	D	0.999999	B;B;P	0.44380	0.372;0.321;0.834	B;B;P	0.49421	0.215;0.205;0.61	T	0.02251	-1.1188	10	0.51188	T	0.08	.	18.1692	0.89739	0.0:0.0:1.0:0.0	.	160;171;184	A6NGV1;Q01105-2;Q01105	.;.;SET_HUMAN	I	184;162;171;160;159	ENSP00000361777:S184I;ENSP00000387321:S162I;ENSP00000318012:S171I;ENSP00000361773:S160I;ENSP00000361771:S159I	ENSP00000318012:S171I	S	+	2	0	SET	130495757	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.849000	0.92178	2.538000	0.85594	0.555000	0.69702	AGT	SET	-	pfam_NAP_family	ENSG00000119335		0.408	SET-001	KNOWN	basic|CCDS	protein_coding	SET	HGNC	protein_coding	OTTHUMT00000054476.2		0.00	50	0	G	NM_001122821		131455936	+1			no_errors	ENST00000372692	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
SIK3	23387	genome.wustl.edu	37	11	116732947	116732947	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:116732947G>T	ENST00000292055.4	-	16	1917	c.1882C>A	c.(1882-1884)Cac>Aac	p.H628N	SIK3_ENST00000446921.2_Missense_Mutation_p.H686N|SIK3_ENST00000434315.2_Missense_Mutation_p.H527N|SIK3_ENST00000375288.1_Missense_Mutation_p.S59R|SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000375300.1_Missense_Mutation_p.H686N|SIK3_ENST00000542607.1_Missense_Mutation_p.H628N	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	628	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						ATTTGATGGTGCTGCTCCTGC	0.478																																																	0													199.0	184.0	189.0					11																	116732947		2201	4296	6497	SO:0001583	missense	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.1882C>A	11.37:g.116732947G>T	ENSP00000292055:p.His628Asn		A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.H686N	ENST00000292055.4	37	c.2056	CCDS8379.1	11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	g|g|g	22.7|22.7|22.7	4.324182|4.324182|4.324182	0.81580|0.81580|0.81580	.|.|.	.|.|.	ENSG00000160584|ENSG00000160584|ENSG00000160584	ENST00000445177;ENST00000446921|ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315|ENST00000375288	.|T;T;T;T|T	.|0.75477|0.33865	.|-0.92;-0.94;-0.74;-0.53|1.39	5.95|5.95|5.95	5.95|5.95|5.95	0.96441|0.96441|0.96441	.|Protein kinase-like domain (1);|.	.|0.000000|.	.|0.43416|.	.|U|.	.|0.000569|.	T|T|T	0.37210|0.37210|0.37210	0.0995|0.0995|0.0995	L|L|L	0.27053|0.27053|0.27053	0.805|0.805|0.805	0.39022|0.39022|0.39022	D|D|D	0.959763|0.959763|0.959763	.|P;P;P|P	.|0.40144|0.46512	.|0.704;0.651;0.651|0.879	.|B;B;B|P	.|0.41666|0.45829	.|0.363;0.272;0.272|0.494	T|T|T	0.26503|0.26503|0.26503	-1.0101|-1.0101|-1.0101	5|10|9	.|0.59425|0.87932	.|D|D	.|0.04|0	.|.|.	20.3645|20.3645|20.3645	0.98876|0.98876|0.98876	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|628;527;628|59	.|A1A5A8;A1A5A9;Q9Y2K2|Q9Y2K2-2	.|.;.;SIK3_HUMAN|.	E|N|R	727;650|686;628;628;527|59	.|ENSP00000364449:H686N;ENSP00000292055:H628N;ENSP00000438108:H628N;ENSP00000415873:H527N|ENSP00000364437:S59R	.|ENSP00000292055:H628N|ENSP00000364437:S59R	A|H|S	-|-|-	2|1|3	0|0|2	SIK3|SIK3|SIK3	116238157|116238157|116238157	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	9.471000|9.471000|9.471000	0.97696|0.97696|0.97696	2.821000|2.821000|2.821000	0.97095|0.97095|0.97095	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GCA|CAC|AGC	SIK3	-	NULL	ENSG00000160584		0.478	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		-	0.00	92	0	G	NM_025164		116732947	-1	tier1	-	no_errors	ENST00000375300	ensembl	human	known	74_37	missense	6.35	57	4	SNP	1.000	T
SKIDA1	387640	genome.wustl.edu	37	10	21804409	21804409	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:21804409G>A	ENST00000449193.2	-	4	4595	c.2343C>T	c.(2341-2343)taC>taT	p.Y781Y	SKIDA1_ENST00000444772.3_Silent_p.Y702Y	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	700						nucleus (GO:0005634)											CTAGTGTCCGGTAATTTTTTC	0.453																																																	0													128.0	115.0	119.0					10																	21804409		1834	4081	5915	SO:0001819	synonymous_variant	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.2343C>T	10.37:g.21804409G>A			B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.Y781	ENST00000449193.2	37	c.2343	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.453	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2		0.00	63	0	G	NM_207371		21804409	-1			no_errors	ENST00000449193	ensembl	human	known	74_37	silent	5.66	50	3	SNP	1.000	A
SKIDA1	387640	genome.wustl.edu	37	10	21806551	21806551	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:21806551G>T	ENST00000449193.2	-	4	2453	c.201C>A	c.(199-201)ctC>ctA	p.L67L	SKIDA1_ENST00000444772.3_Silent_p.L67L|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	67						nucleus (GO:0005634)											TAATTGCCTTGAGTTTCCGCA	0.557																																																	0													85.0	85.0	85.0					10																	21806551		2132	4238	6370	SO:0001819	synonymous_variant	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.201C>A	10.37:g.21806551G>T			B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.L67	ENST00000449193.2	37	c.201	CCDS44363.1	10																																																																																			SKIDA1	-	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	ENSG00000180592		0.557	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2	-	0.00	41	0	G	NM_207371		21806551	-1	tier1	-	no_errors	ENST00000449193	ensembl	human	known	74_37	silent	6.56	57	4	SNP	1.000	T
SIRT1	23411	genome.wustl.edu	37	10	69676139	69676139	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:69676139G>A	ENST00000212015.6	+	9	2086	c.2033G>A	c.(2032-2034)gGg>gAg	p.G678E	SIRT1_ENST00000432464.1_Missense_Mutation_p.G383E|SIRT1_ENST00000406900.1_Missense_Mutation_p.G375E|SIRT1_ENST00000403579.1_Missense_Mutation_p.G375E	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	678					angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						AGTGATAGTGGGACATGCCAG	0.428																																																	0													123.0	112.0	116.0					10																	69676139		2203	4300	6503	SO:0001583	missense	0			AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.2033G>A	10.37:g.69676139G>A	ENSP00000212015:p.Gly678Glu		Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Missense_Mutation	SNP	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.G678E	ENST00000212015.6	37	c.2033	CCDS7273.1	10	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954768	0.73902	.	.	ENSG00000096717	ENST00000212015;ENST00000432464;ENST00000406900;ENST00000403579	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.98	5.98	0.97165	.	0.192997	0.45126	D	0.000386	T	0.54127	0.1839	L	0.40543	1.245	0.49483	D	0.99979	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.45220	-0.9276	10	0.35671	T	0.21	-16.4748	13.3011	0.60326	0.0725:0.0:0.9275:0.0	.	375;678	B0QZ35;Q96EB6	.;SIRT1_HUMAN	E	678;383;375;375	ENSP00000212015:G678E;ENSP00000409208:G383E;ENSP00000384508:G375E;ENSP00000384063:G375E	ENSP00000212015:G678E	G	+	2	0	SIRT1	69346145	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.545000	0.60698	2.835000	0.97688	0.650000	0.86243	GGG	SIRT1	-	NULL	ENSG00000096717		0.428	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT1	HGNC	protein_coding	OTTHUMT00000048296.1	-	0.00	77	0	G			69676139	+1	tier1	-	no_errors	ENST00000212015	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	A
SLC10A2	6555	genome.wustl.edu	37	13	103718237	103718237	+	Silent	SNP	G	G	T	rs143992162	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr13:103718237G>T	ENST00000245312.3	-	1	959	c.363C>A	c.(361-363)ggC>ggA	p.G121G		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	121					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.G121G(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	GGTCCATGTCGCCATCGACCC	0.493																																																	1	Substitution - coding silent(1)	large_intestine(1)											79.0	75.0	76.0					13																	103718237		2203	4300	6503	SO:0001819	synonymous_variant	0			U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.363C>A	13.37:g.103718237G>T			A1L4F4|Q13839	Silent	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.G121	ENST00000245312.3	37	c.363	CCDS9506.1	13																																																																																			SLC10A2	-	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	ENSG00000125255		0.493	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A2	HGNC	protein_coding	OTTHUMT00000045716.1		0.00	41	0	G			103718237	-1			no_errors	ENST00000245312	ensembl	human	known	74_37	silent	8.00	23	2	SNP	0.008	T
SLC22A7	10864	genome.wustl.edu	37	6	43270095	43270095	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:43270095G>T	ENST00000372585.5	+	8	1314	c.1219G>T	c.(1219-1221)Gct>Tct	p.A407S	SLC22A7_ENST00000372574.3_Missense_Mutation_p.A405S|SLC22A7_ENST00000372589.3_Missense_Mutation_p.A405S	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	407					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CCTCACGCAAGCTGGGACACT	0.642																																																	0													54.0	44.0	48.0					6																	43270095		2203	4300	6503	SO:0001583	missense	0			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1219G>T	6.37:g.43270095G>T	ENSP00000361666:p.Ala407Ser		B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.A407S	ENST00000372585.5	37	c.1219	CCDS4893.2	6	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333427	0.41297	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574;ENST00000436107	T;T;T;T	0.74421	0.33;0.33;0.33;-0.84	5.27	2.48	0.30137	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.170686	0.50627	D	0.000107	T	0.57504	0.2058	L	0.55103	1.725	0.19945	N	0.99994	B;B;B	0.34349	0.45;0.395;0.395	P;B;B	0.45712	0.491;0.358;0.358	T	0.55023	-0.8205	10	0.40728	T	0.16	.	5.6895	0.17821	0.1666:0.0:0.6776:0.1559	.	407;405;405	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	S	405;407;405;100	ENSP00000361670:A405S;ENSP00000361666:A407S;ENSP00000361655:A405S;ENSP00000393836:A100S	ENSP00000361655:A405S	A	+	1	0	SLC22A7	43378073	0.999000	0.42202	0.006000	0.13384	0.636000	0.38137	2.153000	0.42282	0.217000	0.20800	-0.379000	0.06801	GCT	SLC22A7	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000137204		0.642	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	SLC22A7	HGNC	protein_coding	OTTHUMT00000040588.1	-	0.00	40	0	G			43270095	+1	tier1	-	no_errors	ENST00000372585	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.123	T
SLC23A2	9962	genome.wustl.edu	37	20	4854675	4854675	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr20:4854675G>T	ENST00000379333.1	-	11	1401	c.1009C>A	c.(1009-1011)Cct>Act	p.P337T	SLC23A2_ENST00000338244.1_Missense_Mutation_p.P337T|SLC23A2_ENST00000424750.2_Missense_Mutation_p.P223T|SLC23A2_ENST00000468355.1_5'UTR	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	337					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CTGTCGGGAGGGAAGACATCT	0.547																																																	0													144.0	122.0	130.0					20																	4854675		2203	4300	6503	SO:0001583	missense	0			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1009C>A	20.37:g.4854675G>T	ENSP00000368637:p.Pro337Thr		B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	pfam_Xant/urac/vitC	p.P337T	ENST00000379333.1	37	c.1009	CCDS13085.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.35|17.35	3.368365|3.368365	0.61513|0.61513	.|.	.|.	ENSG00000089057|ENSG00000089057	ENST00000423430|ENST00000379333;ENST00000338244;ENST00000424750	.|T;T;T	.|0.19532	.|2.14;2.14;2.14	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.099394|0.099394	0.64402|0.64402	D|D	0.000001|0.000001	T|T	0.46502|0.46502	0.1396|0.1396	M|M	0.62088|0.62088	1.915|1.915	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|0.999;1.0;1.0	T|T	0.29518|0.29518	-1.0009|-1.0009	6|10	.|0.59425	.|D	.|0.04	-13.1768|-13.1768	18.4213|18.4213	0.90591|0.90591	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|223;337;337	.|B4DJZ1;A0MSJ5;Q9UGH3	.|.;.;S23A2_HUMAN	H|T	93|337;337;223	.|ENSP00000368637:P337T;ENSP00000344322:P337T;ENSP00000406601:P223T	.|ENSP00000344322:P337T	P|P	-|-	2|1	0|0	SLC23A2|SLC23A2	4802675|4802675	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.006000|0.006000	0.05464|0.05464	9.761000|9.761000	0.98940|0.98940	2.698000|2.698000	0.92095|0.92095	0.655000|0.655000	0.94253|0.94253	CCC|CCT	SLC23A2	-	pfam_Xant/urac/vitC	ENSG00000089057		0.547	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC23A2	HGNC	protein_coding	OTTHUMT00000077832.1	-	0.00	57	0	G			4854675	-1	tier1	-	no_errors	ENST00000338244	ensembl	human	known	74_37	missense	8.33	55	5	SNP	1.000	T
SLC26A8	116369	genome.wustl.edu	37	6	35965589	35965589	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:35965589G>A	ENST00000490799.1	-	5	906	c.553C>T	c.(553-555)Ccc>Tcc	p.P185S	SLC26A8_ENST00000355574.2_Missense_Mutation_p.P185S|SLC26A8_ENST00000394602.2_Missense_Mutation_p.P185S	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						AGGTAGGAGGGGGCCGAAAAC	0.468																																																	0													106.0	95.0	99.0					6																	35965589		2203	4300	6503	SO:0001583	missense	0			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.553C>T	6.37:g.35965589G>A	ENSP00000417638:p.Pro185Ser			Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	p.P185S	ENST00000490799.1	37	c.553	CCDS4813.1	6	.	.	.	.	.	.	.	.	.	.	G	3.243	-0.154884	0.06544	.	.	ENSG00000112053	ENST00000490799;ENST00000394602;ENST00000355574	D;D;D	0.94650	-3.35;-3.48;-3.35	5.82	3.09	0.35607	.	0.087214	0.50627	D	0.000110	T	0.77831	0.4189	L	0.43923	1.385	0.09310	N	1	B;B	0.32573	0.376;0.208	B;B	0.30572	0.1;0.117	T	0.68911	-0.5284	10	0.07030	T	0.85	.	5.6373	0.17544	0.163:0.0:0.6803:0.1567	.	185;185	Q96RN1;Q96RN1-2	S26A8_HUMAN;.	S	185	ENSP00000417638:P185S;ENSP00000378100:P185S;ENSP00000347778:P185S	ENSP00000347778:P185S	P	-	1	0	SLC26A8	36073567	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	0.580000	0.23803	0.380000	0.24823	0.650000	0.86243	CCC	SLC26A8	-	NULL	ENSG00000112053		0.468	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A8	HGNC	protein_coding	OTTHUMT00000040325.2	-	0.00	120	0	G			35965589	-1	tier1	-	no_errors	ENST00000355574	ensembl	human	known	74_37	missense	9.30	78	8	SNP	0.001	A
SLC30A2	7780	genome.wustl.edu	37	1	26365782	26365782	+	Missense_Mutation	SNP	C	C	A	rs149723161	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:26365782C>A	ENST00000374278.3	-	7	1057	c.841G>T	c.(841-843)Gcc>Tcc	p.A281S	SLC30A2_ENST00000374276.3_Missense_Mutation_p.A330S	NM_032513.3	NP_115902.1	Q9BRI3	ZNT2_HUMAN	solute carrier family 30 (zinc transporter), member 2	281					positive regulation of sequestering of zinc ion (GO:0061090)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)	cation transmembrane transporter activity (GO:0008324)	p.A330T(1)		cervix(1)|endometrium(2)|kidney(1)|lung(8)|stomach(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		ACAGCCTGGGCGTCTGTATTC	0.587																																																	1	Substitution - Missense(1)	endometrium(1)											51.0	50.0	50.0					1																	26365782		2203	4300	6503	SO:0001583	missense	0			AK023491	CCDS272.1, CCDS30644.1	1p35.3	2013-05-22			ENSG00000158014	ENSG00000158014		"""Solute carriers"""	11013	protein-coding gene	gene with protein product		609617		ZNT2			Standard	NM_001004434		Approved		uc001blg.1	Q9BRI3	OTTHUMG00000007508	ENST00000374278.3:c.841G>T	1.37:g.26365782C>A	ENSP00000363396:p.Ala281Ser		Q71RC8	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.A330S	ENST00000374278.3	37	c.988	CCDS272.1	1	.	.	.	.	.	.	.	.	.	.	C	10.29	1.308709	0.23821	.	.	ENSG00000158014	ENST00000374278;ENST00000374276	T;T	0.66460	-0.21;-0.21	5.76	3.79	0.43588	.	0.445236	0.22837	N	0.055035	T	0.38427	0.1040	N	0.11131	0.1	0.29643	N	0.844538	B;B	0.13145	0.007;0.002	B;B	0.15484	0.013;0.007	T	0.26467	-1.0102	10	0.07990	T	0.79	-12.191	5.3487	0.16024	0.1463:0.6337:0.1418:0.0782	.	281;330	Q9BRI3;Q9BRI3-2	ZNT2_HUMAN;.	S	281;330	ENSP00000363396:A281S;ENSP00000363394:A330S	ENSP00000363394:A330S	A	-	1	0	SLC30A2	26238369	0.064000	0.20934	0.892000	0.35008	0.869000	0.49853	0.301000	0.19174	1.444000	0.47605	0.561000	0.74099	GCC	SLC30A2	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000158014		0.587	SLC30A2-001	KNOWN	basic|CCDS	protein_coding	SLC30A2	HGNC	protein_coding	OTTHUMT00000019742.1		0.00	32	0	C	NM_032513		26365782	-1			no_errors	ENST00000374276	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.795	A
SLC6A14	11254	genome.wustl.edu	37	X	115585609	115585609	+	Splice_Site	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:115585609G>A	ENST00000371900.4	+	10	1492		c.e10+1			NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14						amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TGTGACTCAGGTATACTACAG	0.368																																																	0													171.0	127.0	142.0					X																	115585609		2203	4300	6503	SO:0001630	splice_region_variant	0			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1404+1G>A	X.37:g.115585609G>A			Q5H942	Splice_Site	SNP	-	e10+1	ENST00000371900.4	37	c.1404+1	CCDS14570.1	X	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206177	0.58343	.	.	ENSG00000087916	ENST00000371900	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4684	0.75422	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC6A14	115499637	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	8.685000	0.91246	2.246000	0.74042	0.538000	0.68166	.	SLC6A14	-	-	ENSG00000087916		0.368	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A14	HGNC	protein_coding	OTTHUMT00000057986.1	-	0.00	43	0	G		Intron	115585609	+1	tier1	-	no_errors	ENST00000371900	ensembl	human	known	74_37	splice_site	9.76	37	4	SNP	1.000	A
SLC6A2	6530	genome.wustl.edu	37	16	55731829	55731829	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:55731829C>T	ENST00000379906.2	+	9	1536	c.1281C>T	c.(1279-1281)gtC>gtT	p.V427V	SLC6A2_ENST00000561820.1_Silent_p.V427V|SLC6A2_ENST00000566163.1_Silent_p.V382V|SLC6A2_ENST00000568943.1_Silent_p.V427V|SLC6A2_ENST00000219833.8_Silent_p.V427V|SLC6A2_ENST00000567238.1_Silent_p.V322V|SLC6A2_ENST00000414754.3_Silent_p.V427V	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	427					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TGGAGGCTGTCATCACGGGCC	0.592																																																	0													78.0	69.0	72.0					16																	55731829		2198	4300	6498	SO:0001819	synonymous_variant	0				CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1281C>T	16.37:g.55731829C>T			B2R707|B4DX48|Q96KH8	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_noradrenaline	p.V427	ENST00000379906.2	37	c.1281	CCDS10754.1	16																																																																																			SLC6A2	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000103546		0.592	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A2	HGNC	protein_coding	OTTHUMT00000256922.2		0.00	59	0	C			55731829	+1			no_errors	ENST00000219833	ensembl	human	known	74_37	silent	10.00	27	3	SNP	1.000	T
SMAD3	4088	genome.wustl.edu	37	15	67473779	67473779	+	Missense_Mutation	SNP	C	C	T	rs387906850		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:67473779C>T	ENST00000327367.4	+	6	1169	c.859C>T	c.(859-861)Cgg>Tgg	p.R287W	SMAD3_ENST00000439724.3_Missense_Mutation_p.R243W|SMAD3_ENST00000537194.2_Missense_Mutation_p.R92W|SMAD3_ENST00000540846.2_Missense_Mutation_p.R182W	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	287	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.|Sufficient for interaction with XPO4.		R -> W (in LDS3). {ECO:0000269|PubMed:21217753}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		GGAGCTGACACGGAGACACAT	0.622																																																	0													52.0	49.0	50.0					15																	67473779		2201	4299	6500	SO:0001583	missense	0			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.859C>T	15.37:g.67473779C>T	ENSP00000332973:p.Arg287Trp		A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.R287W	ENST00000327367.4	37	c.859	CCDS10222.1	15	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140241	0.37825	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.99698	-6.44;-6.44;-6.44;-6.44	5.1	-1.19	0.09585	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99806	0.9916	H	0.97516	4.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97431	1.0015	10	0.87932	D	0	.	17.576	0.87949	0.6719:0.3281:0.0:0.0	.	243;287	B7Z4Z5;P84022	.;SMAD3_HUMAN	W	287;287;182;243;92	ENSP00000332973:R287W;ENSP00000437757:R182W;ENSP00000401133:R243W;ENSP00000445348:R92W	ENSP00000332973:R287W	R	+	1	2	SMAD3	65260833	0.092000	0.21681	0.129000	0.21949	0.111000	0.19643	0.671000	0.25172	-0.072000	0.12864	-0.277000	0.10078	CGG	SMAD3	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000166949		0.622	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD3	HGNC	protein_coding	OTTHUMT00000256967.2	-	0.00	12	0	C	NM_005902		67473779	+1	tier1	-	no_errors	ENST00000327367	ensembl	human	known	74_37	missense	66.67	4	8	SNP	0.540	T
SLCO3A1	28232	genome.wustl.edu	37	15	92459401	92459401	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:92459401C>T	ENST00000318445.6	+	2	573	c.359C>T	c.(358-360)gCg>gTg	p.A120V	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.A120V	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	120					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GCGCTGGGCGCGCTGCTGTCG	0.711																																																	0													10.0	11.0	11.0					15																	92459401		2139	4114	6253	SO:0001583	missense	0			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.359C>T	15.37:g.92459401C>T	ENSP00000320634:p.Ala120Val		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.A120V	ENST00000318445.6	37	c.359	CCDS10371.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.563359	0.96527	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000553304	T;T;T	0.42131	0.98;0.98;0.98	5.22	4.3	0.51218	Major facilitator superfamily domain, general substrate transporter (1);	0.223552	0.45606	D	0.000341	T	0.61837	0.2379	M	0.73217	2.22	0.80722	D	1	P;D;D	0.89917	0.953;1.0;0.989	B;D;P	0.80764	0.292;0.994;0.88	T	0.64635	-0.6361	10	0.54805	T	0.06	.	13.0575	0.58988	0.0:0.922:0.0:0.078	.	62;120;120	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	V	120;120;62	ENSP00000320634:A120V;ENSP00000387846:A120V;ENSP00000450559:A62V	ENSP00000320634:A120V	A	+	2	0	SLCO3A1	90260405	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	5.750000	0.68712	1.335000	0.45486	0.655000	0.94253	GCG	SLCO3A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000176463		0.711	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	HGNC	protein_coding	OTTHUMT00000313529.1	-	0.00	26	0	C	NM_013272		92459401	+1	tier1	-	no_errors	ENST00000318445	ensembl	human	known	74_37	missense	54.84	14	17	SNP	0.999	T
SMAD4	4089	genome.wustl.edu	37	18	48591903	48591903	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr18:48591903C>T	ENST00000342988.3	+	9	1604	c.1066C>T	c.(1066-1068)Cct>Tct	p.P356S	SMAD4_ENST00000588745.1_Missense_Mutation_p.P260S|SMAD4_ENST00000398417.2_Missense_Mutation_p.P356S	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	356	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		ATACGTGGACCCTTCTGGAGG	0.433																																																	38	Whole gene deletion(36)|Unknown(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)											211.0	176.0	188.0					18																	48591903		2203	4300	6503	SO:0001583	missense	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1066C>T	18.37:g.48591903C>T	ENSP00000341551:p.Pro356Ser		A8K405	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.P356S	ENST00000342988.3	37	c.1066	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	C	34	5.317508	0.95682	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.97404	-4.37;-4.37	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98670	0.9554	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99486	1.0949	10	0.87932	D	0	.	18.9646	0.92691	0.0:1.0:0.0:0.0	.	356	Q13485	SMAD4_HUMAN	S	356	ENSP00000341551:P356S;ENSP00000381452:P356S	ENSP00000341551:P356S	P	+	1	0	SMAD4	46845901	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.929000	0.70096	2.771000	0.95319	0.563000	0.77884	CCT	SMAD4	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000141646		0.433	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	-	0.00	75	0	C	NM_005359		48591903	+1	tier1	-	no_errors	ENST00000342988	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	T
SMG6	23293	genome.wustl.edu	37	17	2202239	2202239	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:2202239C>T	ENST00000263073.6	-	2	1858	c.1808G>A	c.(1807-1809)cGc>cAc	p.R603H	SMG6_ENST00000544865.1_Missense_Mutation_p.R572H	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	603					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CGGACTGATGCGGTCCCTGGA	0.582																																					Melanoma(59;28 1088 11621 25887 46638 50814)												0													160.0	157.0	158.0					17																	2202239		2203	4300	6503	SO:0001583	missense	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.1808G>A	17.37:g.2202239C>T	ENSP00000263073:p.Arg603His		B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	pfam_EST1,smart_PIN_dom	p.R603H	ENST00000263073.6	37	c.1808	CCDS11016.1	17	.	.	.	.	.	.	.	.	.	.	C	15.24	2.773612	0.49786	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.17528	2.27;2.27	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.30759	0.0775	L	0.29908	0.895	0.52501	D	0.999958	D	0.89917	1.0	D	0.64506	0.926	T	0.00995	-1.1487	10	0.41790	T	0.15	-4.8096	19.7468	0.96255	0.0:1.0:0.0:0.0	.	603	Q86US8	EST1A_HUMAN	H	603;572	ENSP00000263073:R603H;ENSP00000443920:R572H	ENSP00000263073:R603H	R	-	2	0	SMG6	2148989	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.551000	0.60740	2.731000	0.93534	0.650000	0.86243	CGC	SMG6	-	NULL	ENSG00000070366		0.582	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	-	0.00	38	0	C			2202239	-1	tier1	-	no_errors	ENST00000263073	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	T
SMARCD2	6603	genome.wustl.edu	37	17	61911928	61911928	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:61911928C>T	ENST00000448276.2	-	7	1092	c.827G>A	c.(826-828)cGg>cAg	p.R276Q	SMARCD2_ENST00000323347.10_Missense_Mutation_p.R228Q|SMARCD2_ENST00000225742.9_Missense_Mutation_p.R201Q	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	276				HR -> YW (in Ref. 1; AAC50696). {ECO:0000305}.	ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						GGTGGGCATCCGGTGCCACTG	0.602											OREG0024642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													125.0	124.0	124.0					17																	61911928		2056	4202	6258	SO:0001583	missense	0			U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.827G>A	17.37:g.61911928C>T	ENSP00000392617:p.Arg276Gln	1057	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,smart_SWIB_domain	p.R276Q	ENST00000448276.2	37	c.827	CCDS45756.1	17	.	.	.	.	.	.	.	.	.	.	.	17.01	3.278999	0.59758	.	.	ENSG00000108604	ENST00000448276;ENST00000225742;ENST00000450364;ENST00000323347	T;T	0.55413	0.52;0.52	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.78464	0.4287	M	0.91717	3.235	0.80722	D	1	D;D;D	0.71674	0.998;0.994;0.994	D;P;P	0.72982	0.979;0.67;0.728	T	0.82671	-0.0342	10	0.87932	D	0	1.4501	17.0059	0.86393	0.0:1.0:0.0:0.0	.	228;239;276	Q92925-3;B9EGA3;Q92925	.;.;SMRD2_HUMAN	Q	276;218;239;228	ENSP00000392617:R276Q;ENSP00000318451:R228Q	ENSP00000225742:R218Q	R	-	2	0	SMARCD2	59265660	0.988000	0.35896	1.000000	0.80357	0.903000	0.53119	5.926000	0.70070	2.885000	0.99019	0.643000	0.83706	CGG	SMARCD2	-	NULL	ENSG00000108604		0.602	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD2	HGNC	protein_coding	OTTHUMT00000444544.1		0.00	39	0	C	NM_001098426		61911928	-1			no_errors	ENST00000448276	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
SNAPC1	6617	genome.wustl.edu	37	14	62248986	62248986	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:62248986C>T	ENST00000216294.4	+	8	951	c.847C>T	c.(847-849)Cgt>Tgt	p.R283C		NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	283					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		AAGAAGGCATCGTCAAGTCAA	0.358																																					NSCLC(27;223 907 37180 39193 46568)												0													97.0	91.0	93.0					14																	62248986		2203	4300	6503	SO:0001583	missense	0			Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.847C>T	14.37:g.62248986C>T	ENSP00000216294:p.Arg283Cys			Missense_Mutation	SNP	pfam_SNAPc_SNAP43	p.R283C	ENST00000216294.4	37	c.847	CCDS9755.1	14	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345176	0.82022	.	.	ENSG00000023608	ENST00000216294	.	.	.	6.06	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.78142	0.4237	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80999	-0.1131	9	0.87932	D	0	-2.6695	16.6144	0.84903	0.1311:0.8689:0.0:0.0	.	283	Q16533	SNPC1_HUMAN	C	283	.	ENSP00000216294:R283C	R	+	1	0	SNAPC1	61318739	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.782000	0.62396	1.524000	0.49035	0.655000	0.94253	CGT	SNAPC1	-	NULL	ENSG00000023608		0.358	SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC1	HGNC	protein_coding	OTTHUMT00000276976.2	-	0.00	42	0	C	NM_003082		62248986	+1	tier1	-	no_errors	ENST00000216294	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
SNX14	57231	genome.wustl.edu	37	6	86238024	86238024	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:86238024C>T	ENST00000314673.3	-	20	2127	c.1951G>A	c.(1951-1953)Gaa>Aaa	p.E651K	SNX14_ENST00000346348.3_Missense_Mutation_p.E598K|SNX14_ENST00000505648.1_Missense_Mutation_p.E599K|SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000369627.2_Missense_Mutation_p.E642K|SNX14_ENST00000513865.1_Intron	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	651	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TTTAAGAATTCATAATTTTTG	0.333																																																	0													154.0	175.0	168.0					6																	86238024		2203	4298	6501	SO:0001583	missense	0			AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.1951G>A	6.37:g.86238024C>T	ENSP00000313121:p.Glu651Lys		B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,pfam_RGS_dom,superfamily_Phox,superfamily_Regulat_G_prot_signal_superfam,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.E651K	ENST00000314673.3	37	c.1951	CCDS5004.1	6	.	.	.	.	.	.	.	.	.	.	C	36	5.642049	0.96704	.	.	ENSG00000135317	ENST00000346348;ENST00000369628;ENST00000314673;ENST00000505648;ENST00000369627;ENST00000515216;ENST00000418862	T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44	5.6	5.6	0.85130	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.36110	0.0955	L	0.45285	1.41	0.80722	D	1	D;D;D;P	0.69078	0.99;0.997;0.96;0.95	P;P;P;P	0.61275	0.886;0.886;0.856;0.828	T	0.01256	-1.1404	10	0.27785	T	0.31	-16.0241	19.6136	0.95619	0.0:1.0:0.0:0.0	.	642;598;651;599	Q9Y5W7-4;Q9Y5W7-2;Q9Y5W7;Q9Y5W7-3	.;.;SNX14_HUMAN;.	K	598;108;651;599;642;569;16	ENSP00000257769:E598K;ENSP00000313121:E651K;ENSP00000427380:E599K;ENSP00000358641:E642K;ENSP00000425630:E569K;ENSP00000391981:E16K	ENSP00000313121:E651K	E	-	1	0	SNX14	86294743	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.280000	0.78610	2.641000	0.89580	0.585000	0.79938	GAA	SNX14	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000135317		0.333	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX14	HGNC	protein_coding	OTTHUMT00000041393.2	-	0.00	55	0	C	NM_153816		86238024	-1	tier1	-	no_errors	ENST00000314673	ensembl	human	known	74_37	missense	23.81	32	10	SNP	1.000	T
SNX29	92017	genome.wustl.edu	37	16	12172757	12172757	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:12172757G>T	ENST00000566228.1	+	11	1456	c.1387G>T	c.(1387-1389)Gag>Tag	p.E463*	SNX29_ENST00000306030.3_Nonsense_Mutation_p.E78*|SNX29_ENST00000323433.4_Nonsense_Mutation_p.E78*	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	463						extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						CTCAGTGCCAGAGTCCATGAC	0.552																																																	0													88.0	83.0	84.0					16																	12172757		2013	4178	6191	SO:0001587	stop_gained	0			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.1387G>T	16.37:g.12172757G>T	ENSP00000456480:p.Glu463*		B5MDW2|Q8N2X2|Q9HA26	Nonsense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.E78*	ENST00000566228.1	37	c.232	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	G	39	7.488475	0.98316	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	.	.	.	5.26	4.31	0.51392	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-15.6272	10.0026	0.41938	0.0936:0.0:0.9064:0.0	.	.	.	.	X	78	.	ENSP00000306940:E78X	E	+	1	0	SNX29	12080258	0.999000	0.42202	0.992000	0.48379	0.940000	0.58332	3.415000	0.52700	1.223000	0.43536	0.558000	0.71614	GAG	SNX29	-	NULL	ENSG00000048471		0.552	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNX29	HGNC	protein_coding	OTTHUMT00000422622.1	-	0.00	36	0	G			12172757	+1	tier1	-	no_errors	ENST00000306030	ensembl	human	known	74_37	nonsense	25.00	9	3	SNP	0.996	T
SOBP	55084	genome.wustl.edu	37	6	107956280	107956282	+	In_Frame_Del	DEL	GCC	GCC	-	rs541688197	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	GCC	GCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:107956280_107956282delGCC	ENST00000317357.5	+	6	2891_2893	c.2232_2234delGCC	c.(2230-2235)cagccg>cag	p.P751del	SOBP_ENST00000494935.1_3'UTR	NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		CTCCCGAGCAgccgccgccgccg	0.749																																																	0																																										SO:0001651	inframe_deletion	0			AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.2232_2234delGCC	6.37:g.107956289_107956291delGCC	ENSP00000318900:p.Pro751del			In_Frame_Del	DEL	NULL	p.P748in_frame_del	ENST00000317357.5	37	c.2232_2234	CCDS43488.1	6																																																																																			SOBP	-	NULL	ENSG00000112320		0.749	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOBP	HGNC	protein_coding	OTTHUMT00000041693.2		0.00	30	0	GCC	NM_018013		107956282	+1	tier1		no_errors	ENST00000317357	ensembl	human	known	74_37	in_frame_del	18.18	9	2	DEL	0.125:0.067:0.048	-
SPAG6	9576	genome.wustl.edu	37	10	22675815	22675815	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:22675815C>T	ENST00000376624.3	+	5	747	c.605C>T	c.(604-606)gCa>gTa	p.A202V	RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000538630.1_Missense_Mutation_p.A177V|SPAG6_ENST00000376601.1_Intron|SPAG6_ENST00000376603.2_Missense_Mutation_p.A278V|SPAG6_ENST00000313311.6_Missense_Mutation_p.A202V	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	202					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						CCAGAGTTAGCACAGACAGTA	0.423																																																	0													112.0	106.0	108.0					10																	22675815		2203	4300	6503	SO:0001583	missense	0			AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.605C>T	10.37:g.22675815C>T	ENSP00000365811:p.Ala202Val		A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,pfam_26S_Psome_nonATP_su5,superfamily_ARM-type_fold,smart_Armadillo	p.A278V	ENST00000376624.3	37	c.833	CCDS7139.1	10	.	.	.	.	.	.	.	.	.	.	C	15.94	2.980249	0.53827	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000538630;ENST00000313311	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.6	4.7	0.59300	Armadillo-like helical (1);Armadillo-type fold (1);	0.046053	0.85682	N	0.000000	D	0.84032	0.5383	M	0.88241	2.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.994;0.998;0.999	D	0.87380	0.2356	10	0.72032	D	0.01	-20.0511	14.7982	0.69894	0.0:0.9307:0.0:0.0693	.	177;278;202;202	B4DXZ4;O75602-3;O75602-2;O75602	.;.;.;SPAG6_HUMAN	V	202;278;177;202	ENSP00000365811:A202V;ENSP00000365788:A278V;ENSP00000441325:A177V;ENSP00000323599:A202V	ENSP00000323599:A202V	A	+	2	0	SPAG6	22715821	1.000000	0.71417	0.718000	0.30602	0.067000	0.16453	5.971000	0.70440	1.509000	0.48786	-0.253000	0.11424	GCA	SPAG6	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000077327		0.423	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG6	HGNC	protein_coding	OTTHUMT00000047187.1	-	0.00	60	0	C			22675815	+1	tier1	-	no_errors	ENST00000376603	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
SPDL1	54908	genome.wustl.edu	37	5	169015479	169015479	+	Missense_Mutation	SNP	G	G	T	rs116483731	byFrequency	TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:169015479G>T	ENST00000265295.4	+	2	338	c.59G>T	c.(58-60)cGa>cTa	p.R20L	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		GAAGAAGAGCGACTAAAAGCT	0.358																																																	0													90.0	88.0	89.0					5																	169015479		2203	4300	6503	SO:0001583	missense	0			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.59G>T	5.37:g.169015479G>T	ENSP00000265295:p.Arg20Leu			Missense_Mutation	SNP	NULL	p.R20L	ENST00000265295.4	37	c.59	CCDS4370.1	5	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779446	0.70107	.	.	ENSG00000040275	ENST00000265295;ENST00000274631;ENST00000506574;ENST00000515224;ENST00000508247;ENST00000513941;ENST00000513795	T	0.27890	1.64	5.3	3.51	0.40186	.	0.310366	0.31404	N	0.007709	T	0.25457	0.0619	L	0.49126	1.545	0.37111	D	0.900347	P	0.35226	0.491	B	0.38225	0.268	T	0.11084	-1.0602	10	0.02654	T	1	-5.0017	11.5565	0.50750	0.1451:0.0:0.8549:0.0	.	20	Q96EA4	SPDLY_HUMAN	L	20	ENSP00000265295:R20L	ENSP00000265295:R20L	R	+	2	0	CCDC99	168948057	0.995000	0.38212	0.926000	0.36857	0.763000	0.43281	3.854000	0.55949	0.731000	0.32448	0.655000	0.94253	CGA	SPDL1	-	NULL	ENSG00000040275		0.358	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDL1	HGNC	protein_coding	OTTHUMT00000252829.2	-	0.00	51	0	G	NM_017785		169015479	+1	tier1	-	no_errors	ENST00000265295	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.972	T
SPTLC2	9517	genome.wustl.edu	37	14	78023429	78023429	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:78023429C>T	ENST00000216484.2	-	7	1104	c.911G>A	c.(910-912)cGa>cAa	p.R304Q	SPTLC2_ENST00000556264.1_5'Flank	NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	304					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	CCAGGGCCTTCGTGTCCGAGG	0.408																																																	0													98.0	94.0	95.0					14																	78023429		2203	4300	6503	SO:0001583	missense	0			AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.911G>A	14.37:g.78023429C>T	ENSP00000216484:p.Arg304Gln		Q16685	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.R304Q	ENST00000216484.2	37	c.911	CCDS9865.1	14	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287852	0.59976	.	.	ENSG00000100596	ENST00000216484	D	0.95001	-3.58	5.05	5.05	0.67936	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.055507	0.64402	D	0.000001	D	0.92021	0.7472	M	0.69185	2.1	0.33603	D	0.60262	B	0.26975	0.165	B	0.20184	0.028	D	0.92830	0.6279	10	0.56958	D	0.05	-8.3325	9.5572	0.39346	0.0:0.8426:0.0:0.1574	.	304	O15270	SPTC2_HUMAN	Q	304	ENSP00000216484:R304Q	ENSP00000216484:R304Q	R	-	2	0	SPTLC2	77093182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.811000	0.62606	2.499000	0.84300	0.563000	0.77884	CGA	SPTLC2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000100596		0.408	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC2	HGNC	protein_coding	OTTHUMT00000414030.1	-	0.00	61	0	C	NM_004863		78023429	-1	tier1	-	no_errors	ENST00000216484	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
SRCAP	10847	genome.wustl.edu	37	16	30750262	30750262	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:30750262G>A	ENST00000262518.4	+	34	9286	c.8901G>A	c.(8899-8901)caG>caA	p.Q2967Q	RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000344771.4_Silent_p.Q2809Q|SRCAP_ENST00000395059.2_Silent_p.Q2905Q	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2967	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GTCGGACACAGCCACCCCCAC	0.562																																																	0													133.0	108.0	117.0					16																	30750262		2197	4300	6497	SO:0001819	synonymous_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.8901G>A	16.37:g.30750262G>A			B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.Q2967	ENST00000262518.4	37	c.8901	CCDS10689.2	16																																																																																			SRCAP	-	NULL	ENSG00000080603		0.562	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1		0.00	25	0	G	NM_006662		30750262	+1			no_errors	ENST00000262518	ensembl	human	known	74_37	silent	16.67	10	2	SNP	1.000	A
SSH2	85464	genome.wustl.edu	37	17	27959375	27959375	+	Missense_Mutation	SNP	G	G	A	rs376316249		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:27959375G>A	ENST00000269033.3	-	15	2907	c.2756C>T	c.(2755-2757)cCa>cTa	p.P919L	SSH2_ENST00000540801.1_Missense_Mutation_p.P946L|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	919					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGAATGTTCTGGGGGGGCTTC	0.483																																																	0													181.0	194.0	190.0					17																	27959375		2203	4300	6503	SO:0001583	missense	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.2756C>T	17.37:g.27959375G>A	ENSP00000269033:p.Pro919Leu		Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.P919L	ENST00000269033.3	37	c.2756	CCDS11253.1	17	.	.	.	.	.	.	.	.	.	.	G	7.009	0.556354	0.13436	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.07216	3.21;3.21	5.63	-0.815	0.10843	.	1.772590	0.02127	N	0.056052	T	0.03608	0.0103	N	0.04203	-0.255	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.34800	-0.9814	10	0.09338	T	0.73	2.0259	4.539	0.12047	0.2727:0.1087:0.5097:0.1088	.	946;919	F5H527;Q76I76	.;SSH2_HUMAN	L	919;946	ENSP00000269033:P919L;ENSP00000444743:P946L	ENSP00000269033:P919L	P	-	2	0	SSH2	24983501	0.001000	0.12720	0.023000	0.16930	0.974000	0.67602	-0.261000	0.08694	-0.032000	0.13758	0.579000	0.79373	CCA	SSH2	-	NULL	ENSG00000141298		0.483	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1		0.00	40	0	G	NM_033389		27959375	-1			no_errors	ENST00000269033	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.003	A
STX6	10228	genome.wustl.edu	37	1	180944246	180944247	+	3'UTR	INS	-	-	A	rs200382375|rs372980374		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:180944246_180944247insA	ENST00000258301.5	-	0	2464_2465				AL162431.1_ENST00000457152.2_Intron|STX6_ENST00000469135.1_5'UTR|RP11-46A10.5_ENST00000358073.2_RNA	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6						endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						CAAAAAGGTTTAAAAAAAAAGT	0.366																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.*1460->T	1.37:g.180944255_180944255dupA			B2R652|B4DR17|Q5VY08|Q6FH83	RNA	INS	-	NULL	ENST00000258301.5	37	NULL	CCDS1341.1	1																																																																																			STX6	-	-	ENSG00000135823		0.366	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX6	HGNC	protein_coding	OTTHUMT00000085143.1		0.00	42	0	-	NM_005819		180944247	-1	tier1		no_errors	ENST00000469135	ensembl	human	known	74_37	rna	12.90	27	4	INS	0.000:0.000	A
STXBP3	6814	genome.wustl.edu	37	1	109339310	109339310	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:109339310C>T	ENST00000370008.3	+	15	1368	c.1318C>T	c.(1318-1320)Cgt>Tgt	p.R440C		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	440					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TGACATGATTCGTAACTGGAG	0.338																																																	0													155.0	149.0	151.0					1																	109339310		2203	4300	6503	SO:0001583	missense	0			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1318C>T	1.37:g.109339310C>T	ENSP00000359025:p.Arg440Cys		A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.R440C	ENST00000370008.3	37	c.1318	CCDS790.1	1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697081	0.68386	.	.	ENSG00000116266	ENST00000370008	T	0.77229	-1.08	5.44	5.44	0.79542	.	0.340848	0.31438	N	0.007644	T	0.70945	0.3282	L	0.52905	1.665	0.45046	D	0.998066	P	0.50710	0.938	P	0.47376	0.545	T	0.75994	-0.3121	10	0.62326	D	0.03	-4.5301	12.3971	0.55391	0.2837:0.7163:0.0:0.0	.	440	O00186	STXB3_HUMAN	C	440	ENSP00000359025:R440C	ENSP00000359025:R440C	R	+	1	0	STXBP3	109140833	0.912000	0.30974	1.000000	0.80357	0.994000	0.84299	1.849000	0.39318	2.548000	0.85928	0.467000	0.42956	CGT	STXBP3	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000116266		0.338	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	HGNC	protein_coding	OTTHUMT00000030591.1	-	0.00	55	0	C	NM_007269		109339310	+1	tier1	-	no_errors	ENST00000370008	ensembl	human	known	74_37	missense	26.15	48	17	SNP	0.983	T
SUPT3H	8464	genome.wustl.edu	37	6	44922333	44922333	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:44922333A>G	ENST00000371459.1	-	8	757	c.592T>C	c.(592-594)Tcc>Ccc	p.S198P	SUPT3H_ENST00000371461.2_Missense_Mutation_p.S209P|SUPT3H_ENST00000371460.1_Missense_Mutation_p.S209P|SUPT3H_ENST00000306867.5_Missense_Mutation_p.S198P|SUPT3H_ENST00000371458.1_5'UTR	NM_001261823.1|NM_003599.3	NP_001248752.1|NP_003590.1	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog (S. cerevisiae)	280					chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	transcription coactivator activity (GO:0003713)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	12						CGAAATTTGGAAGCTTTTTTG	0.328																																																	0													109.0	107.0	108.0					6																	44922333		2203	4300	6503	SO:0001583	missense	0			AF069734	CCDS34465.1, CCDS34466.1, CCDS75464.1	6p21.1-p12.3	2008-05-15	2001-11-28		ENSG00000196284	ENSG00000196284			11466	protein-coding gene	gene with protein product		602947	"""suppressor of Ty (S.cerevisiae) 3 homolog"""			9674425, 9726987	Standard	NM_003599		Approved	SPT3, SPT3L	uc003oxp.4	O75486	OTTHUMG00000014773	ENST00000371459.1:c.592T>C	6.37:g.44922333A>G	ENSP00000360514:p.Ser198Pro		A6NKG9|B2R9Q5|O76066|Q5TAV9|Q86VN7	Missense_Mutation	SNP	pfam_TFIID-18,superfamily_Histone-fold	p.S209P	ENST00000371459.1	37	c.625	CCDS34465.1	6	.	.	.	.	.	.	.	.	.	.	A	20.3	3.958864	0.74016	.	.	ENSG00000196284	ENST00000371460;ENST00000371459;ENST00000306867;ENST00000371461	T;T;T;T	0.46819	0.86;0.88;0.88;0.86	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.60702	0.2289	M	0.69823	2.125	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.75484	0.981;0.986	T	0.65928	-0.6049	10	0.62326	D	0.03	.	15.3438	0.74317	1.0:0.0:0.0:0.0	.	209;280	O75486-3;O75486	.;SUPT3_HUMAN	P	209;198;198;209	ENSP00000360515:S209P;ENSP00000360514:S198P;ENSP00000306718:S198P;ENSP00000360516:S209P	ENSP00000306718:S198P	S	-	1	0	SUPT3H	45030311	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	8.939000	0.92951	2.023000	0.59567	0.454000	0.30748	TCC	SUPT3H	-	NULL	ENSG00000196284		0.328	SUPT3H-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT3H	HGNC	protein_coding	OTTHUMT00000106911.2	-	0.00	99	0	A	NM_181356		44922333	-1	tier1	-	no_errors	ENST00000371460	ensembl	human	known	74_37	missense	8.60	85	8	SNP	1.000	G
SYAP1	94056	genome.wustl.edu	37	X	16778364	16778364	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:16778364C>T	ENST00000380155.3	+	9	1034	c.941C>T	c.(940-942)gCa>gTa	p.A314V		NM_032796.3	NP_116185.2	Q96A49	SYAP1_HUMAN	synapse associated protein 1	314						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				endometrium(3)|lung(4)|pancreas(1)|prostate(1)|skin(1)	10	Hepatocellular(33;0.0997)					GAGGATTCTGCAGATTGGGAA	0.368																																																	0													79.0	80.0	80.0					X																	16778364		2203	4300	6503	SO:0001583	missense	0			AF338728	CCDS14177.1	Xp22.31	2010-06-25	2010-06-25		ENSG00000169895	ENSG00000169895			16273	protein-coding gene	gene with protein product	"""SAP47 homolog (Drosophila)"""					11483580	Standard	NM_032796		Approved	FLJ14495, PRO3113	uc004cxp.3	Q96A49	OTTHUMG00000021192	ENST00000380155.3:c.941C>T	X.37:g.16778364C>T	ENSP00000369500:p.Ala314Val		Q68CP1|Q96C60|Q96JQ6|Q96T20	Missense_Mutation	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.A314V	ENST00000380155.3	37	c.941	CCDS14177.1	X	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093636	0.56075	.	.	ENSG00000169895	ENST00000380155	.	.	.	5.69	4.83	0.62350	.	0.138384	0.64402	N	0.000003	T	0.52322	0.1727	L	0.41824	1.3	0.42321	D	0.99225	B;B	0.13145	0.007;0.002	B;B	0.10450	0.005;0.003	T	0.47222	-0.9134	9	0.32370	T	0.25	-12.099	12.4651	0.55753	0.0:0.9206:0.0:0.0794	.	280;314	B4E1C9;Q96A49	.;SYAP1_HUMAN	V	314	.	ENSP00000369500:A314V	A	+	2	0	SYAP1	16688285	0.999000	0.42202	0.988000	0.46212	0.991000	0.79684	4.367000	0.59498	1.302000	0.44855	0.596000	0.82720	GCA	SYAP1	-	NULL	ENSG00000169895		0.368	SYAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYAP1	HGNC	protein_coding	OTTHUMT00000055904.1	-	0.00	76	0	C	NM_032796		16778364	+1	tier1	-	no_errors	ENST00000380155	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.998	T
SYT4	6860	genome.wustl.edu	37	18	40850380	40850380	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr18:40850380C>A	ENST00000255224.3	-	4	1572	c.1204G>T	c.(1204-1206)Gga>Tga	p.G402*	SYT4_ENST00000586678.1_5'UTR|SYT4_ENST00000590752.1_Nonsense_Mutation_p.G384*	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	402					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CAGTGCTCTCCACCAGTTCCT	0.478																																					NSCLC(85;81 1419 2855 22820 35912)												0													159.0	159.0	159.0					18																	40850380		2203	4300	6503	SO:0001587	stop_gained	0			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.1204G>T	18.37:g.40850380C>A	ENSP00000255224:p.Gly402*		B4DEU3|Q9P2K4	Nonsense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	p.G402*	ENST00000255224.3	37	c.1204	CCDS11922.1	18	.	.	.	.	.	.	.	.	.	.	C	40	8.099758	0.98654	.	.	ENSG00000132872	ENST00000255224;ENST00000442661	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	19.5717	0.95423	0.0:1.0:0.0:0.0	.	.	.	.	X	402;207	.	ENSP00000255224:G402X	G	-	1	0	SYT4	39104378	1.000000	0.71417	0.986000	0.45419	0.989000	0.77384	7.247000	0.78257	2.644000	0.89710	0.655000	0.94253	GGA	SYT4	-	superfamily_C2_dom,smart_C2_dom	ENSG00000132872		0.478	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	HGNC	protein_coding	OTTHUMT00000255851.2	-	0.00	63	0	C	NM_020783		40850380	-1	tier1	-	no_errors	ENST00000255224	ensembl	human	known	74_37	nonsense	15.38	22	4	SNP	1.000	A
TAF1B	9014	genome.wustl.edu	37	2	10059890	10059890	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:10059890delC	ENST00000263663.5	+	14	1694	c.1506delC	c.(1504-1506)ggcfs	p.G502fs	TAF1B_ENST00000396242.3_Frame_Shift_Del_p.G247fs	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	502					gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AAGAGAAAGGCCAATCACTGC	0.383																																																	0													76.0	70.0	72.0					2																	10059890		2203	4300	6503	SO:0001589	frameshift_variant	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1506delC	2.37:g.10059890delC	ENSP00000263663:p.Gly502fs		B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	pfam_TF_Rrn7	p.Q503fs	ENST00000263663.5	37	c.1506	CCDS33143.1	2																																																																																			TAF1B	-	NULL	ENSG00000115750		0.383	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2		0.00	72	0	C	NM_005680		10059890	+1	tier1		no_errors	ENST00000263663	ensembl	human	known	74_37	frame_shift_del	12.50	14	2	DEL	0.963	-
TBCEL	219899	genome.wustl.edu	37	11	120929152	120929152	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:120929152G>A	ENST00000529397.1	+	6	911	c.811G>A	c.(811-813)Gag>Aag	p.E271K	TBCEL_ENST00000422003.2_Missense_Mutation_p.E271K	NM_001130047.1	NP_001123519.1	Q5QJ74	TBCEL_HUMAN	tubulin folding cofactor E-like	271	LRRCT.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)			TECTA/TBCEL(2)	endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		Breast(109;0.00526)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.89e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.121)		ATATACCACCGAGGAGCGAAG	0.398																																																	0													167.0	155.0	159.0					11																	120929152		2203	4299	6502	SO:0001583	missense	0			BC020501	CCDS31692.1	11q23.3	2008-02-05	2006-11-21	2006-11-21		ENSG00000154114			28115	protein-coding gene	gene with protein product		610451	"""leucine rich repeat containing 35"", ""tubulin-specific chaperone e-like"""	LRRC35		15728251	Standard	NM_152715		Approved	MGC10233	uc001pxo.3	Q5QJ74		ENST00000529397.1:c.811G>A	11.37:g.120929152G>A	ENSP00000437184:p.Glu271Lys		Q0VAN6	Missense_Mutation	SNP	pfscan_Ubiquitin_supergroup	p.E271K	ENST00000529397.1	37	c.811	CCDS31692.1	11	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181973	0.57800	.	.	ENSG00000154114	ENST00000529397;ENST00000422003;ENST00000533134;ENST00000533169	T;T;T	0.44083	0.93;0.93;0.93	5.96	5.96	0.96718	.	0.199769	0.52532	D	0.000073	T	0.33323	0.0859	N	0.21097	0.63	0.80722	D	1	B	0.19935	0.04	B	0.12837	0.008	T	0.07009	-1.0795	10	0.21540	T	0.41	-29.5945	20.4192	0.99033	0.0:0.0:1.0:0.0	.	271	Q5QJ74	TBCEL_HUMAN	K	271;271;38;74	ENSP00000437184:E271K;ENSP00000403925:E271K;ENSP00000436419:E38K	ENSP00000403925:E271K	E	+	1	0	TBCEL	120434362	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	4.448000	0.60027	2.831000	0.97527	0.650000	0.86243	GAG	TBCEL	-	NULL	ENSG00000154114		0.398	TBCEL-005	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TBCEL	HGNC	protein_coding	OTTHUMT00000387688.1	-	0.00	83	0	G	NM_152715		120929152	+1	tier1	-	no_errors	ENST00000422003	ensembl	human	known	74_37	missense	28.74	62	25	SNP	1.000	A
TCEAL2	140597	genome.wustl.edu	37	X	101382235	101382235	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:101382235G>A	ENST00000372780.1	+	3	652	c.433G>A	c.(433-435)Ggg>Agg	p.G145R	TCEAL2_ENST00000329035.2_Missense_Mutation_p.G145R	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						AACCAACAAGGGGCTGGCTCA	0.468													G|||	1	0.000264901	0.0	0.0014	3775	,	,		15204	0.0		0.0	False		,,,				2504	0.0																0													115.0	112.0	113.0					X																	101382235		2203	4300	6503	SO:0001583	missense	0			AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.433G>A	X.37:g.101382235G>A	ENSP00000361866:p.Gly145Arg		B2R5C7	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like	p.G145R	ENST00000372780.1	37	c.433	CCDS14496.1	X	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675599	0.47781	.	.	ENSG00000184905	ENST00000372780;ENST00000329035	T;T	0.07800	3.16;3.16	3.43	3.43	0.39272	.	0.000000	0.48286	D	0.000187	T	0.20700	0.0498	L	0.54908	1.71	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00773	-1.1572	10	0.87932	D	0	.	9.4515	0.38729	0.0:0.0:1.0:0.0	.	145	Q9H3H9	TCAL2_HUMAN	R	145	ENSP00000361866:G145R;ENSP00000332359:G145R	ENSP00000332359:G145R	G	+	1	0	TCEAL2	101268891	0.635000	0.27199	0.092000	0.20876	0.771000	0.43674	1.084000	0.30828	1.974000	0.57490	0.594000	0.82650	GGG	TCEAL2	-	pfam_TF_A-like/BEX-like	ENSG00000184905		0.468	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL2	HGNC	protein_coding	OTTHUMT00000057605.1	-	0.00	15	0	G	NM_080390		101382235	+1	tier1	-	no_errors	ENST00000329035	ensembl	human	known	74_37	missense	53.12	15	17	SNP	0.078	A
TCN1	6947	genome.wustl.edu	37	11	59631536	59631536	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:59631536G>A	ENST00000257264.3	-	2	207	c.103C>T	c.(103-105)Cgc>Tgc	p.R35C	TCN1_ENST00000532419.1_5'UTR	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	35	Globular N-terminal alpha domain.		R -> H (in dbSNP:rs34528912).		cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGTTTTAGGCGGATGTAGTTT	0.398																																																	0													185.0	179.0	181.0					11																	59631536		2201	4294	6495	SO:0001583	missense	0			J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.103C>T	11.37:g.59631536G>A	ENSP00000257264:p.Arg35Cys		A8KAC5|Q8WV77	Missense_Mutation	SNP	pfam_Cbl-bd_transpt_euk	p.R35C	ENST00000257264.3	37	c.103	CCDS7978.1	11	.	.	.	.	.	.	.	.	.	.	G	9.676	1.148116	0.21288	.	.	ENSG00000134827	ENST00000257264	T	0.35789	1.29	4.48	-2.66	0.06077	.	2.038570	0.02011	N	0.047039	T	0.32823	0.0842	L	0.54323	1.7	0.09310	N	1	B	0.18461	0.028	B	0.15484	0.013	T	0.28202	-1.0051	10	0.56958	D	0.05	.	5.1985	0.15250	0.3323:0.2723:0.3953:0.0	.	35	P20061	TCO1_HUMAN	C	35	ENSP00000257264:R35C	ENSP00000257264:R35C	R	-	1	0	TCN1	59388112	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.887000	0.04152	-0.614000	0.05687	0.609000	0.83330	CGC	TCN1	-	pfam_Cbl-bd_transpt_euk	ENSG00000134827		0.398	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCN1	HGNC	protein_coding	OTTHUMT00000394503.1	-	0.00	103	0	G	NM_001062		59631536	-1	tier1	-	no_errors	ENST00000257264	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.000	A
TJP3	27134	genome.wustl.edu	37	19	3738902	3738902	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:3738902G>T	ENST00000541714.2	+	13	1863	c.1401G>T	c.(1399-1401)tgG>tgT	p.W467C	TJP3_ENST00000382008.3_Missense_Mutation_p.W481C|TJP3_ENST00000262968.9_Missense_Mutation_p.W500C|TJP3_ENST00000539908.2_Missense_Mutation_p.W431C|TJP3_ENST00000589378.1_Missense_Mutation_p.W476C|TJP3_ENST00000587686.1_Missense_Mutation_p.W486C	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	467					regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGTTTTCTGGAAAATGGTGC	0.642																																																	0													65.0	63.0	64.0					19																	3738902		2203	4299	6502	SO:0001583	missense	0			AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.1401G>T	19.37:g.3738902G>T	ENSP00000439278:p.Trp467Cys		A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	pfam_PDZ,pfam_SH3_2,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS3,prints_ZonOcculdens	p.W500C	ENST00000541714.2	37	c.1500	CCDS32873.2	19	.	.	.	.	.	.	.	.	.	.	G	11.46	1.646160	0.29246	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	4.27	0.729	0.18266	PDZ/DHR/GLGF (1);	0.476802	0.20691	N	0.087441	T	0.32133	0.0819	N	0.08118	0	0.20926	N	0.999823	P;P;P;P	0.46395	0.766;0.663;0.654;0.877	P;B;B;P	0.50136	0.548;0.195;0.346;0.632	T	0.18116	-1.0347	10	0.87932	D	0	.	6.7395	0.23428	0.1685:0.4196:0.412:0.0	.	486;500;481;467	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	C	467;431;481;500	ENSP00000439278:W467C;ENSP00000439991:W431C;ENSP00000371438:W481C;ENSP00000262968:W500C	ENSP00000262968:W500C	W	+	3	0	TJP3	3689902	0.993000	0.37304	0.909000	0.35828	0.639000	0.38242	1.105000	0.31086	0.069000	0.16605	0.485000	0.47835	TGG	TJP3	-	superfamily_PDZ	ENSG00000105289		0.642	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP3	HGNC	protein_coding	OTTHUMT00000453434.1	-	0.00	29	0	G			3738902	+1	tier1	-	no_errors	ENST00000262968	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.143	T
TLR4	7099	genome.wustl.edu	37	9	120475211	120475211	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:120475211T>G	ENST00000355622.6	+	3	906	c.805T>G	c.(805-807)Ttg>Gtg	p.L269V	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.L229V	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	269					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TGAAGGAAACTTGGAAAAGTT	0.353																																																	0													83.0	90.0	88.0					9																	120475211		2203	4300	6503	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.805T>G	9.37:g.120475211T>G	ENSP00000363089:p.Leu269Val		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L269V	ENST00000355622.6	37	c.805	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	T	11.08	1.534751	0.27475	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.39997	1.37;1.05	5.78	-4.6	0.03390	.	1.079840	0.07012	N	0.825204	T	0.20251	0.0487	N	0.17474	0.49	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.19549	-1.0302	10	0.31617	T	0.26	.	2.2069	0.03938	0.4294:0.195:0.0701:0.3054	.	269	O00206	TLR4_HUMAN	V	229;269	ENSP00000377997:L229V;ENSP00000363089:L269V	ENSP00000363089:L269V	L	+	1	2	TLR4	119515032	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.024000	0.01436	-0.463000	0.06973	-0.302000	0.09304	TTG	TLR4	-	pirsf_Toll-like_receptor	ENSG00000136869		0.353	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	-	0.00	60	0	T	NM_138554		120475211	+1	tier1	-	no_errors	ENST00000355622	ensembl	human	known	74_37	missense	17.50	33	7	SNP	0.000	G
TMEM132B	114795	genome.wustl.edu	37	12	125834009	125834009	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:125834009C>T	ENST00000299308.3	+	2	72	c.64C>T	c.(64-66)Cga>Tga	p.R22*	TMEM132B_ENST00000418253.2_3'UTR	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	22						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GACAGAGAGTCGAGGGATTGT	0.468																																																	0													111.0	108.0	109.0					12																	125834009		1930	4150	6080	SO:0001587	stop_gained	0			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.64C>T	12.37:g.125834009C>T	ENSP00000299308:p.Arg22*		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Nonsense_Mutation	SNP	NULL	p.R22*	ENST00000299308.3	37	c.64	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213103	0.79352	.	.	ENSG00000139364	ENST00000299308	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5841	0.95484	0.0:1.0:0.0:0.0	.	.	.	.	X	22	.	ENSP00000299308:R22X	R	+	1	2	TMEM132B	124399962	1.000000	0.71417	0.114000	0.21550	0.068000	0.16541	4.638000	0.61353	2.604000	0.88044	0.655000	0.94253	CGA	TMEM132B	-	NULL	ENSG00000139364		0.468	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	HGNC	protein_coding	OTTHUMT00000400043.1	-	0.00	65	0	C	NM_052907		125834009	+1	tier1	-	no_errors	ENST00000299308	ensembl	human	known	74_37	nonsense	36.11	23	13	SNP	1.000	T
TMEM184B	25829	genome.wustl.edu	37	22	38642064	38642064	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr22:38642064G>A	ENST00000361906.3	-	3	443	c.235C>T	c.(235-237)Cgc>Tgc	p.R79C	TMEM184B_ENST00000361684.4_Missense_Mutation_p.R79C	NM_001195072.1|NM_012264.4	NP_001182001.1|NP_036396.2	Q9Y519	T184B_HUMAN	transmembrane protein 184B	79						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	8	Melanoma(58;0.045)					ACGATGTAGCGCTGCTCGTTG	0.612																																																	0													115.0	88.0	97.0					22																	38642064		2203	4300	6503	SO:0001583	missense	0			AL096879	CCDS13969.2	22q12	2008-02-04	2007-07-11	2007-07-11	ENSG00000198792	ENSG00000198792			1310	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 5"""	C22orf5		10591208	Standard	NM_012264		Approved	HS5O6A, DKFZP586A1024, FM08	uc003avf.1	Q9Y519	OTTHUMG00000030557	ENST00000361906.3:c.235C>T	22.37:g.38642064G>A	ENSP00000355210:p.Arg79Cys		A8K9D7|Q63HM8|Q7Z421|Q8NBM5|Q9UGT8|Q9UGT9|Q9UGV5	Missense_Mutation	SNP	pfam_Ost-alpha	p.R79C	ENST00000361906.3	37	c.235	CCDS13969.2	22	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075842	0.76415	.	.	ENSG00000198792	ENST00000361906;ENST00000361684;ENST00000403210	T;T;T	0.51817	0.69;0.69;0.69	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.76786	0.4036	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.84706	0.0731	10	0.87932	D	0	.	17.2945	0.87167	0.0:0.0:1.0:0.0	.	79	Q9Y519	T184B_HUMAN	C	79;79;13	ENSP00000355210:R79C;ENSP00000354441:R79C;ENSP00000385608:R13C	ENSP00000354441:R79C	R	-	1	0	TMEM184B	36972010	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	6.282000	0.72639	2.060000	0.61445	0.549000	0.68633	CGC	TMEM184B	-	pfam_Ost-alpha	ENSG00000198792		0.612	TMEM184B-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM184B	HGNC	protein_coding	OTTHUMT00000075445.4	-	0.00	46	0	G	NM_012264		38642064	-1	tier1	-	no_errors	ENST00000361684	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	A
TNR	7143	genome.wustl.edu	37	1	175323593	175323593	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:175323593T>G	ENST00000367674.2	-	18	4024	c.3316A>C	c.(3316-3318)Acg>Ccg	p.T1106P	TNR_ENST00000263525.2_Missense_Mutation_p.T1106P			Q92752	TENR_HUMAN	tenascin R	1106	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGGAGCACCGTGTAGTCTGTG	0.557																																																	0													187.0	149.0	162.0					1																	175323593		2203	4300	6503	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3316A>C	1.37:g.175323593T>G	ENSP00000356646:p.Thr1106Pro		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.T1106P	ENST00000367674.2	37	c.3316	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248730	0.80024	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.59638	0.25;0.25	5.3	4.17	0.49024	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.114167	0.64402	D	0.000016	T	0.69762	0.3147	M	0.72624	2.21	0.54753	D	0.999987	D	0.57899	0.981	D	0.64144	0.922	T	0.67496	-0.5656	10	0.34782	T	0.22	.	10.7142	0.46002	0.0:0.0756:0.0:0.9244	.	1106	Q92752	TENR_HUMAN	P	1106;1106;1016	ENSP00000356646:T1106P;ENSP00000263525:T1106P	ENSP00000263525:T1106P	T	-	1	0	TNR	173590216	1.000000	0.71417	0.960000	0.40013	0.980000	0.70556	7.587000	0.82613	0.859000	0.35456	0.528000	0.53228	ACG	TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.557	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	-	0.00	47	0	T	NM_003285		175323593	-1	tier1	-	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	G
TOMM20L	387990	genome.wustl.edu	37	14	58875294	58875294	+	Silent	SNP	T	T	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr14:58875294T>A	ENST00000360945.2	+	5	495	c.453T>A	c.(451-453)ccT>ccA	p.P151P	TIMM9_ENST00000216463.4_5'Flank|TIMM9_ENST00000395159.2_3'UTR|RP11-517O13.1_ENST00000556734.1_RNA	NM_207377.2	NP_997260.1	Q6UXN7	TO20L_HUMAN	translocase of outer mitochondrial membrane 20 homolog (yeast)-like	151					protein targeting (GO:0006605)	integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)				large_intestine(2)|lung(2)	4						AGGATGATCCTGATTGAAAAA	0.353																																																	0													135.0	122.0	127.0					14																	58875294		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9734.1	14q23.1	2009-01-14			ENSG00000196860	ENSG00000196860			33752	protein-coding gene	gene with protein product	"""translocase of outer mitochondrial membrane 20 homolog type I"""					15733919	Standard	NM_207377		Approved	UNQ9438	uc001xdr.1	Q6UXN7	OTTHUMG00000140323	ENST00000360945.2:c.453T>A	14.37:g.58875294T>A			B2RPR0	Silent	SNP	pfam_MAS20_rcpt-related,superfamily_Tom20_dom,pirsf_MAS20_rcpt-related,prints_MAS20_rcpt_metazoan,prints_MAS20_rcpt-related	p.P151	ENST00000360945.2	37	c.453	CCDS9734.1	14																																																																																			TOMM20L	-	superfamily_Tom20_dom,pirsf_MAS20_rcpt-related	ENSG00000196860		0.353	TOMM20L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM20L	HGNC	protein_coding	OTTHUMT00000276937.1		0.00	71	0	T	NM_207377		58875294	+1			no_errors	ENST00000360945	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.151	A
TOR1AIP1	26092	genome.wustl.edu	37	1	179886640	179886640	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:179886640C>T	ENST00000606911.2	+	10	1209	c.1018C>T	c.(1018-1020)Cta>Tta	p.L340L	TOR1AIP1_ENST00000474875.1_3'UTR|TOR1AIP1_ENST00000528443.2_Silent_p.L341L|TOR1AIP1_ENST00000435319.4_Silent_p.L219L|TOR1AIP1_ENST00000271583.3_Silent_p.L356L			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	340					positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						CCGGTGGTGGCTACTTCCTCT	0.428																																																	0													153.0	168.0	163.0					1																	179886640		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.1018C>T	1.37:g.179886640C>T			A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Silent	SNP	pfam_Lamina-ass_polypeptide_CLAP1C	p.L341	ENST00000606911.2	37	c.1021	CCDS1335.1	1																																																																																			TOR1AIP1	-	pfam_Lamina-ass_polypeptide_CLAP1C	ENSG00000143337		0.428	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOR1AIP1	HGNC	protein_coding	OTTHUMT00000100313.4		0.00	33	0	C	NM_015602		179886640	+1			no_errors	ENST00000528443	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.014	T
TP53	7157	genome.wustl.edu	37	17	7577558	7577558	+	Frame_Shift_Del	DEL	G	G	-	rs397516437		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:7577558delG	ENST00000269305.4	-	7	912	c.723delC	c.(721-723)tccfs	p.S241fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.S241fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.S241fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C242fs*5(9)|p.0?(8)|p.?(5)|p.S241del(5)|p.S241F(5)|p.N239_C242delNSSC(3)|p.S241S(3)|p.N239_C242>S(1)|p.S241_C242insX(1)|p.C238fs*21(1)|p.C242fs*20(1)|p.C242fs*23(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCCCATGCAGGAACTGTTAC	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	50	Deletion - In frame(13)|Deletion - Frameshift(13)|Whole gene deletion(8)|Unknown(5)|Substitution - Missense(5)|Substitution - coding silent(3)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - deletion inframe(1)	large_intestine(8)|biliary_tract(6)|breast(5)|upper_aerodigestive_tract(4)|stomach(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|central_nervous_system(2)|urinary_tract(2)|oesophagus(2)|skin(2)|eye(2)|pancreas(2)|liver(1)											138.0	107.0	117.0					17																	7577558		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.723delC	17.37:g.7577558delG	ENSP00000269305:p.Ser241fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C242fs	ENST00000269305.4	37	c.723	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	49	0	G	NM_000546		7577558	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	54.29	16	19	DEL	1.000	-
TRHDE	29953	genome.wustl.edu	37	12	72667155	72667155	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:72667155G>T	ENST00000261180.4	+	1	693	c.597G>T	c.(595-597)gcG>gcT	p.A199A	TRHDE-AS1_ENST00000550334.1_RNA|TRHDE-AS1_ENST00000435350.1_RNA|TRHDE-AS1_ENST00000426250.3_RNA	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	199					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						AGGACCGGGCGTTCGGGGCTG	0.607																																																	0													48.0	52.0	51.0					12																	72667155		2203	4300	6503	SO:0001819	synonymous_variant	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.597G>T	12.37:g.72667155G>T			A5PL19|Q6UWJ4	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.A199	ENST00000261180.4	37	c.597	CCDS9004.1	12																																																																																			TRHDE	-	pfam_Peptidase_M1_N	ENSG00000072657		0.607	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1		0.00	102	0	G	NM_013381		72667155	+1			no_errors	ENST00000261180	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.004	T
TRIM11	81559	genome.wustl.edu	37	1	228582443	228582443	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:228582443G>A	ENST00000284551.6	-	6	1648	c.1370C>T	c.(1369-1371)cCg>cTg	p.P457L	RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000460651.1_5'UTR|TRIM11_ENST00000493030.2_Missense_Mutation_p.P332L	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	457	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				CCCACCTTTCGGCCGGCAGAT	0.647																																																	0													29.0	34.0	32.0					1																	228582443		2203	4299	6502	SO:0001583	missense	0			AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.1370C>T	1.37:g.228582443G>A	ENSP00000284551:p.Pro457Leu		A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P457L	ENST00000284551.6	37	c.1370	CCDS31048.1	1	.	.	.	.	.	.	.	.	.	.	G	1.583	-0.531041	0.04112	.	.	ENSG00000154370	ENST00000284551	T	0.63096	-0.02	4.83	-1.83	0.07833	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	1.842390	0.02925	N	0.138507	T	0.31857	0.0810	N	0.02391	-0.57	0.09310	N	0.99999	B;B	0.09022	0.0;0.002	B;B	0.04013	0.0;0.001	T	0.43032	-0.9416	10	0.02654	T	1	.	8.8478	0.35181	0.7311:0.0:0.2689:0.0	.	456;457	Q96F44-3;Q96F44	.;TRI11_HUMAN	L	457	ENSP00000284551:P457L	ENSP00000284551:P457L	P	-	2	0	TRIM11	226649066	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.031000	0.12287	-0.126000	0.11682	0.655000	0.94253	CCG	TRIM11	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000154370		0.647	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM11	HGNC	protein_coding	OTTHUMT00000095995.3	-	0.00	164	0	G	NM_145214		228582443	-1	tier1	-	no_errors	ENST00000284551	ensembl	human	known	74_37	missense	14.10	67	11	SNP	0.001	A
TRIM49	57093	genome.wustl.edu	37	11	89531678	89531678	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:89531678T>G	ENST00000329758.1	-	8	1307	c.979A>C	c.(979-981)Agt>Cgt	p.S327R	TRIM49_ENST00000532501.2_Missense_Mutation_p.S250R	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GCAAGAAAACTTCTAGGTGTT	0.418																																																	0													13.0	16.0	15.0					11																	89531678		2019	4186	6205	SO:0001583	missense	0			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.979A>C	11.37:g.89531678T>G	ENSP00000327604:p.Ser327Arg		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.S327R	ENST00000329758.1	37	c.979	CCDS8287.1	11	.	.	.	.	.	.	.	.	.	.	T	1.569	-0.534586	0.04082	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.08546	3.08	0.539	-1.08	0.09936	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05823	0.0152	L	0.37850	1.14	0.09310	N	1	B	0.22211	0.066	B	0.20184	0.028	T	0.42666	-0.9438	7	.	.	.	.	.	.	.	.	327	P0CI25	TRI49_HUMAN	R	327;250	ENSP00000327604:S327R	.	S	-	1	0	TRIM49	89171326	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.057000	0.11768	-0.399000	0.07668	-1.394000	0.01149	AGT	TRIM49	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000168930		0.418	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1		0.00	102	0	T	NM_020358		89531678	-1			no_errors	ENST00000329758	ensembl	human	known	74_37	missense	7.69	72	6	SNP	0.000	G
TRIM49C	642612	genome.wustl.edu	37	11	89774338	89774338	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:89774338A>C	ENST00000448984.1	+	8	1308	c.979A>C	c.(979-981)Agt>Cgt	p.S327R	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						AACACCTAGAAGTTTTCTTGC	0.423																																																	0																																										SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.979A>C	11.37:g.89774338A>C	ENSP00000388299:p.Ser327Arg		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.S327R	ENST00000448984.1	37	c.979	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	A	5.198	0.221998	0.09863	.	.	ENSG00000204449	ENST00000448984	T	0.08546	3.08	0.823	-0.7	0.11273	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05593	0.0147	L	0.36672	1.1	0.09310	N	1	B	0.22211	0.066	B	0.20184	0.028	T	0.43163	-0.9408	8	.	.	.	.	2.82	0.05468	0.4537:0.0:0.0:0.5463	.	327	P0CI26	T49L2_HUMAN	R	327	ENSP00000388299:S327R	.	S	+	1	0	TRIM49L2	89413986	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	0.039000	0.13884	-0.248000	0.09583	0.254000	0.18369	AGT	TRIM49C	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000204449		0.423	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1		0.00	173	0	A	NM_001195234		89774338	+1			no_errors	ENST00000448984	ensembl	human	known	74_37	missense	12.70	110	16	SNP	0.001	C
TRIM50	135892	genome.wustl.edu	37	7	72734220	72734220	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:72734220A>G	ENST00000333149.2	-	3	621	c.421T>C	c.(421-423)Tct>Cct	p.S141P	TRIM50_ENST00000493498.1_5'Flank|TRIM50_ENST00000453152.1_Missense_Mutation_p.S141P	NM_178125.2	NP_835226.2	Q86XT4	TRI50_HUMAN	tripartite motif containing 50	141						cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)	20						TTCAGCTCAGAGATGAGGGCT	0.587																																																	0													292.0	243.0	260.0					7																	72734220		2203	4300	6503	SO:0001583	missense	0			AY081948	CCDS34654.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000146755	ENSG00000146755		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19017	protein-coding gene	gene with protein product		612548	"""tripartite motif-containing 50A"", ""tripartite motif-containing 50"""	TRIM50A			Standard	NM_001281450		Approved	FLJ32804	uc003txy.1	Q86XT4	OTTHUMG00000156805	ENST00000333149.2:c.421T>C	7.37:g.72734220A>G	ENSP00000327994:p.Ser141Pro		Q86XT3	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S141P	ENST00000333149.2	37	c.421	CCDS34654.1	7	.	.	.	.	.	.	.	.	.	.	a	14.58	2.579289	0.46006	.	.	ENSG00000146755	ENST00000333149;ENST00000453152	T;T	0.58060	0.36;0.36	4.14	1.74	0.24563	.	0.211460	0.31257	N	0.007961	T	0.42291	0.1196	N	0.24115	0.695	0.21290	N	0.99973	D;D	0.65815	0.995;0.991	P;P	0.55391	0.775;0.601	T	0.25363	-1.0134	10	0.52906	T	0.07	.	0.9227	0.01318	0.4334:0.1669:0.0987:0.301	.	141;141	Q86XT4-2;Q86XT4	.;TRI50_HUMAN	P	141	ENSP00000327994:S141P;ENSP00000413875:S141P	ENSP00000327994:S141P	S	-	1	0	TRIM50	72372156	1.000000	0.71417	0.989000	0.46669	0.957000	0.61999	1.690000	0.37711	0.587000	0.29643	-0.508000	0.04489	TCT	TRIM50	-	NULL	ENSG00000146755		0.587	TRIM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM50	HGNC	protein_coding	OTTHUMT00000345925.1	-	0.00	152	0	A	NM_178125		72734220	-1	tier1	-	no_errors	ENST00000333149	ensembl	human	known	74_37	missense	25.00	63	21	SNP	0.931	G
TRMT11	60487	genome.wustl.edu	37	6	126319386	126319386	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:126319386G>A	ENST00000334379.5	+	5	433	c.312G>A	c.(310-312)tcG>tcA	p.S104S	TRMT11_ENST00000368332.3_Silent_p.S104S|TRMT11_ENST00000450358.1_Silent_p.S104S	NM_001031712.2	NP_001026882.2	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11 homolog (S. cerevisiae)	104					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)|tRNA binding (GO:0000049)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(226;0.0356)		TTCTACATTCGGACTCTACAT	0.279																																																	0													43.0	44.0	44.0					6																	126319386		2187	4293	6480	SO:0001819	synonymous_variant	0			AF182423	CCDS35496.1	6q11.1-q22.33	2009-06-15	2006-11-28	2006-11-28	ENSG00000066651	ENSG00000066651			21080	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 75"""	C6orf75			Standard	XM_006715546		Approved	MDS024, dJ187J11.2, TRM11, TRMT11-1	uc003qam.3	Q7Z4G4	OTTHUMG00000015515	ENST00000334379.5:c.312G>A	6.37:g.126319386G>A			E1P570|Q5JY11|Q6PGQ5|Q9HC13	Missense_Mutation	SNP	NULL	p.R77Q	ENST00000334379.5	37	c.230	CCDS35496.1	6																																																																																			TRMT11	-	NULL	ENSG00000066651		0.279	TRMT11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT11	HGNC	protein_coding		-	0.00	54	0	G	NM_021820		126319386	+1	tier1	-	no_errors	ENST00000461129	ensembl	human	known	74_37	missense	37.04	17	10	SNP	0.932	A
TRNT1	51095	genome.wustl.edu	37	3	3179068	3179068	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr3:3179068G>T	ENST00000251607.6	+	3	375	c.273G>T	c.(271-273)gaG>gaT	p.E91D	TRNT1_ENST00000280591.6_Missense_Mutation_p.E91D	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	91					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		AAATGAAGGAGATGTTTCAGT	0.418																																																	0													87.0	89.0	88.0					3																	3179068		2203	4300	6503	SO:0001583	missense	0			AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.273G>T	3.37:g.3179068G>T	ENSP00000251607:p.Glu91Asp		A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	pfam_PolA_pol_head_dom	p.E91D	ENST00000251607.6	37	c.273	CCDS2561.2	3	.	.	.	.	.	.	.	.	.	.	G	9.560	1.118175	0.20877	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.22945	1.93;1.93	5.25	1.42	0.22433	Poly A polymerase, head domain (1);	0.549995	0.22270	N	0.062267	T	0.15782	0.0380	L	0.40543	1.245	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.0	T	0.11179	-1.0598	10	0.30078	T	0.28	-0.0027	2.8865	0.05662	0.129:0.327:0.3201:0.2239	.	91;91	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	D	91	ENSP00000251607:E91D;ENSP00000280591:E91D	ENSP00000251607:E91D	E	+	3	2	TRNT1	3154068	0.994000	0.37717	0.951000	0.38953	0.717000	0.41224	0.347000	0.20014	-0.024000	0.13941	-0.732000	0.03574	GAG	TRNT1	-	pfam_PolA_pol_head_dom	ENSG00000072756		0.418	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRNT1	HGNC	protein_coding	OTTHUMT00000337616.1		0.00	56	0	G			3179068	+1			no_errors	ENST00000251607	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.973	T
TRPM5	29850	genome.wustl.edu	37	11	2428371	2428371	+	Silent	SNP	A	A	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr11:2428371A>G	ENST00000155858.6	-	20	3104	c.3096T>C	c.(3094-3096)gcT>gcC	p.A1032A	TRPM5_ENST00000452833.1_Silent_p.A1034A|TRPM5_ENST00000533060.1_Silent_p.A1032A|AC124057.5_ENST00000433035.1_RNA|TRPM5_ENST00000528453.1_Silent_p.A1032A	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GCTTGTGCTCAGCCTCCTTCT	0.697																																					NSCLC(1;49 61 17205 18850 43201)												0													26.0	26.0	26.0					11																	2428371		2193	4291	6484	SO:0001819	synonymous_variant	0			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.3096T>C	11.37:g.2428371A>G				Silent	SNP	superfamily_Ankyrin_rpt-contain_dom	p.A1034	ENST00000155858.6	37	c.3102	CCDS31340.1	11																																																																																			TRPM5	-	NULL	ENSG00000070985		0.697	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	-	0.00	148	0	A	NM_014555		2428371	-1	tier1	-	no_errors	ENST00000452833	ensembl	human	known	74_37	silent	5.26	126	7	SNP	0.121	G
TSC2	7249	genome.wustl.edu	37	16	2134649	2134649	+	Nonsense_Mutation	SNP	G	G	T	rs376946970		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:2134649G>T	ENST00000219476.3	+	34	5056	c.4426G>T	c.(4426-4428)Gag>Tag	p.E1476*	TSC2_ENST00000353929.4_Nonsense_Mutation_p.E1433*|TSC2_ENST00000439673.2_Nonsense_Mutation_p.E1373*|TSC2_ENST00000568454.1_Nonsense_Mutation_p.E1420*|TSC2_ENST00000401874.2_Nonsense_Mutation_p.E1409*|TSC2_ENST00000382538.6_Nonsense_Mutation_p.E1361*|TSC2_ENST00000350773.4_Nonsense_Mutation_p.E1453*	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1476					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CAAGAGAGTAGAGAGGGACGC	0.657			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													32.0	37.0	35.0					16																	2134649		2195	4289	6484	SO:0001587	stop_gained	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4426G>T	16.37:g.2134649G>T	ENSP00000219476:p.Glu1476*		A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Nonsense_Mutation	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom,prints_Tuberin	p.E1476*	ENST00000219476.3	37	c.4426	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	G	41	8.797868	0.98958	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	.	.	.	5.03	5.03	0.67393	.	0.287225	0.31721	N	0.007164	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-26.8017	14.0118	0.64503	0.0:0.1515:0.8485:0.0	.	.	.	.	X	1476;1410;1433;1373;1361;1453	.	ENSP00000219476:E1476X	E	+	1	0	TSC2	2074650	1.000000	0.71417	0.890000	0.34922	0.023000	0.10783	7.265000	0.78442	2.343000	0.79666	0.591000	0.81541	GAG	TSC2	-	NULL	ENSG00000103197		0.657	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2		0.00	112	0	G	NM_000548		2134649	+1			no_errors	ENST00000219476	ensembl	human	known	74_37	nonsense	6.56	57	4	SNP	1.000	T
TTC39B	158219	genome.wustl.edu	37	9	15177695	15177695	+	Splice_Site	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:15177695C>A	ENST00000512701.2	-	18	1877	c.1841G>T	c.(1840-1842)aGt>aTt	p.S614I	TTC39B_ENST00000297615.5_Splice_Site_p.S545I|TTC39B_ENST00000507993.1_Splice_Site_p.S449I|TTC39B_ENST00000507285.1_Splice_Site_p.S449I|TTC39B_ENST00000355694.2_Splice_Site_p.S548I|TTC39B_ENST00000380850.4_Splice_Site_p.S601I			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	614								p.S548I(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						TTGGTCTTACCTTTCCACAAC	0.408																																																	1	Substitution - Missense(1)	prostate(1)											150.0	135.0	140.0					9																	15177695		2203	4300	6503	SO:0001630	splice_region_variant	0			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.1841+1G>T	9.37:g.15177695C>A			A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.S614I	ENST00000512701.2	37	c.1841	CCDS6477.2	9	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886205	0.51908	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993	T;T;T;T;T;T	0.73152	-0.72;1.36;0.9;0.9;1.36;1.36	5.82	5.82	0.92795	Tetratricopeptide-like helical (1);	0.184331	0.56097	D	0.000021	D	0.83959	0.5367	M	0.74258	2.255	0.80722	D	1	D;D;B;B;D	0.89917	1.0;0.999;0.431;0.431;0.999	D;D;B;B;D	0.80764	0.991;0.979;0.186;0.186;0.994	T	0.83332	-0.0012	9	.	.	.	-7.2372	17.8623	0.88784	0.0:1.0:0.0:0.0	.	545;601;546;548;131	F5H705;E9PAQ9;A5PLN1;Q5VTQ0;Q8IXZ6	.;.;.;TT39B_HUMAN;.	I	601;545;548;614;449;449	ENSP00000370231:S601I;ENSP00000297615:S545I;ENSP00000347920:S548I;ENSP00000422496:S614I;ENSP00000426539:S449I;ENSP00000423392:S449I	.	S	-	2	0	TTC39B	15167695	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	3.930000	0.56522	2.761000	0.94854	0.655000	0.94253	AGT	TTC39B	-	smart_TPR_repeat	ENSG00000155158		0.408	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3		0.00	63	0	C	NM_152574	Missense_Mutation	15177695	-1			no_errors	ENST00000512701	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	A
TTK	7272	genome.wustl.edu	37	6	80718160	80718160	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:80718160G>T	ENST00000369798.2	+	4	531	c.420G>T	c.(418-420)aaG>aaT	p.K140N	TTK_ENST00000509894.1_Missense_Mutation_p.K140N|TTK_ENST00000230510.3_Missense_Mutation_p.K140N	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	140					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.K124N(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		CAAACTGCAAGAAATTTGCTT	0.299																																																	1	Substitution - Missense(1)	large_intestine(1)											79.0	72.0	74.0					6																	80718160		2203	4299	6502	SO:0001583	missense	0				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.420G>T	6.37:g.80718160G>T	ENSP00000358813:p.Lys140Asn		A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K140N	ENST00000369798.2	37	c.420	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471785	0.84533	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798;ENST00000511260;ENST00000504040	T;T;T;D;T	0.90197	1.36;1.36;1.36;-2.63;1.36	6.01	6.01	0.97437	Tetratricopeptide-like helical (1);	0.096695	0.64402	D	0.000001	D	0.92835	0.7721	M	0.63843	1.955	0.46823	D	0.999215	D;D	0.89917	1.0;0.999	D;D	0.69142	0.962;0.947	D	0.93166	0.6562	10	0.87932	D	0	.	12.7696	0.57412	0.074:0.0:0.926:0.0	.	140;140	P33981;A8K8U5	TTK_HUMAN;.	N	140	ENSP00000422936:K140N;ENSP00000230510:K140N;ENSP00000358813:K140N;ENSP00000421636:K140N;ENSP00000427483:K140N	ENSP00000230510:K140N	K	+	3	2	TTK	80774879	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.759000	0.55227	2.861000	0.98227	0.650000	0.86243	AAG	TTK	-	NULL	ENSG00000112742		0.299	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	HGNC	protein_coding	OTTHUMT00000041316.2		0.00	42	0	G			80718160	+1			no_errors	ENST00000369798	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	T
TTLL7	79739	genome.wustl.edu	37	1	84356015	84356015	+	Silent	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:84356015G>A	ENST00000260505.8	-	19	2735	c.2358C>T	c.(2356-2358)ttC>ttT	p.F786F	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	786					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		CTGAATCACAGAAACAGTTCC	0.353																																																	0													53.0	57.0	56.0					1																	84356015		2203	4300	6503	SO:0001819	synonymous_variant	0			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.2358C>T	1.37:g.84356015G>A			Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Silent	SNP	pfam_TTL/TTLL_fam	p.F786	ENST00000260505.8	37	c.2358	CCDS690.2	1																																																																																			TTLL7	-	NULL	ENSG00000137941		0.353	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL7	HGNC	protein_coding	OTTHUMT00000027498.1	-	0.00	115	0	G	NM_024686		84356015	-1	tier1	-	no_errors	ENST00000260505	ensembl	human	known	74_37	silent	14.08	61	10	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179500965	179500965	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:179500965A>C	ENST00000591111.1	-	176	36634	c.36410T>G	c.(36409-36411)cTt>cGt	p.L12137R	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L4905R|TTN_ENST00000359218.5_Missense_Mutation_p.L4838R|TTN_ENST00000589042.1_Missense_Mutation_p.L13778R|TTN_ENST00000342992.6_Missense_Mutation_p.L11210R|TTN_ENST00000460472.2_Missense_Mutation_p.L4713R|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12137					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACGCACAGGAAGTTCTATGGA	0.358																																																	0													24.0	22.0	22.0					2																	179500965		1856	4086	5942	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36410T>G	2.37:g.179500965A>C	ENSP00000465570:p.Leu12137Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L11210R	ENST00000591111.1	37	c.33629		2	.	.	.	.	.	.	.	.	.	.	A	13.87	2.365260	0.41902	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.05199	3.48;3.48;3.48;3.48	5.62	5.62	0.85841	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.13756	0.0333	L	0.51422	1.61	0.53688	D	0.999979	P;P;P;P	0.51240	0.943;0.943;0.943;0.821	P;P;P;P	0.50440	0.641;0.641;0.641;0.641	T	0.00267	-1.1863	9	0.87932	D	0	.	15.8165	0.78604	1.0:0.0:0.0:0.0	.	4713;4838;4905;12137	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	11210;4713;4905;4838;4713	ENSP00000343764:L11210R;ENSP00000434586:L4713R;ENSP00000340554:L4905R;ENSP00000352154:L4838R	ENSP00000340554:L4905R	L	-	2	0	TTN	179209210	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.281000	0.95811	2.143000	0.66587	0.477000	0.44152	CTT	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.358	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	31	0	A	NM_133378		179500965	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	44.44	10	8	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179602842	179602842	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:179602842T>C	ENST00000591111.1	-	47	13611	c.13387A>G	c.(13387-13389)Agt>Ggt	p.S4463G	TTN_ENST00000342175.6_Missense_Mutation_p.S4609G|TTN_ENST00000359218.5_Missense_Mutation_p.S4542G|TTN_ENST00000589042.1_Missense_Mutation_p.S4780G|TTN_ENST00000342992.6_Missense_Mutation_p.S3536G|TTN_ENST00000460472.2_Missense_Mutation_p.S4417G|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12218	Ig-like 24.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCTGACACTGCCATACTCA	0.428																																																	0													69.0	70.0	70.0					2																	179602842		1990	4170	6160	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13387A>G	2.37:g.179602842T>C	ENSP00000465570:p.Ser4463Gly		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S3536G	ENST00000591111.1	37	c.10606		2	.	.	.	.	.	.	.	.	.	.	T	15.55	2.865774	0.51588	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.8	5.8	0.92144	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79263	0.4416	M	0.77406	2.37	0.22896	N	0.998597	D;D;D;D	0.57257	0.959;0.959;0.959;0.979	P;P;P;P	0.55508	0.652;0.652;0.652;0.777	T	0.74100	-0.3774	9	0.87932	D	0	.	16.1484	0.81586	0.0:0.0:0.0:1.0	.	4417;4542;4609;4463	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	3536;4417;4609;4542;4417	ENSP00000343764:S3536G;ENSP00000434586:S4417G;ENSP00000340554:S4609G;ENSP00000352154:S4542G	ENSP00000340554:S4609G	S	-	1	0	TTN	179311087	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.742000	0.47434	2.226000	0.72624	0.459000	0.35465	AGT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000155657		0.428	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	42	0	T	NM_133378		179602842	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	27.27	24	9	SNP	1.000	C
UBASH3A	53347	genome.wustl.edu	37	21	43852260	43852260	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr21:43852260G>T	ENST00000319294.6	+	9	1250	c.1219G>T	c.(1219-1221)Gtg>Ttg	p.V407L	UBASH3A_ENST00000398367.1_Missense_Mutation_p.V369L|UBASH3A_ENST00000291535.6_Missense_Mutation_p.V369L	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	407	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						CGGGGAGAGAGTGGATCAGAT	0.562																																																	0													174.0	114.0	134.0					21																	43852260		2203	4300	6503	SO:0001583	missense	0			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1219G>T	21.37:g.43852260G>T	ENSP00000317327:p.Val407Leu		G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,pfam_SH3_domain,superfamily_SH3_domain,superfamily_UBA-like,smart_SH3_domain,pfscan_SH3_domain,pfscan_UBA/transl_elong_EF1B_N_euk	p.V407L	ENST00000319294.6	37	c.1219	CCDS13687.1	21	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677056	0.47886	.	.	ENSG00000160185	ENST00000291535;ENST00000319294;ENST00000398367	T;T;T	0.72051	-0.62;-0.62;-0.62	4.96	4.08	0.47627	Histidine phosphatase superfamily, clade-1 (1);	0.101272	0.43416	N	0.000574	T	0.57359	0.2048	L	0.28274	0.84	0.80722	D	1	B;B;B	0.21606	0.047;0.026;0.058	B;B;B	0.21708	0.013;0.013;0.036	T	0.55704	-0.8099	10	0.56958	D	0.05	-30.644	10.8762	0.46913	0.0:0.0:0.8116:0.1884	.	369;369;407	G5E9E4;P57075-2;P57075	.;.;UBS3A_HUMAN	L	369;407;369	ENSP00000291535:V369L;ENSP00000317327:V407L;ENSP00000381408:V369L	ENSP00000291535:V369L	V	+	1	0	UBASH3A	42725329	1.000000	0.71417	0.998000	0.56505	0.819000	0.46315	1.943000	0.40253	1.099000	0.41499	-0.127000	0.14921	GTG	UBASH3A	-	pfam_His_Pase_superF_clade-1	ENSG00000160185		0.562	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	UBASH3A	HGNC	protein_coding	OTTHUMT00000195382.1	-	0.00	46	0	G	NM_001001895		43852260	+1	tier1	-	no_errors	ENST00000319294	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
UGT2B28	54490	genome.wustl.edu	37	4	70146388	70146388	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:70146388C>A	ENST00000335568.5	+	1	172	c.170C>A	c.(169-171)gCa>gAa	p.A57E	UGT2B28_ENST00000511240.1_Missense_Mutation_p.A57E	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	57					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						ACTGTACTGGCATCTTCAGCT	0.408																																																	0													106.0	127.0	120.0					4																	70146388		2085	4253	6338	SO:0001583	missense	0			AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.170C>A	4.37:g.70146388C>A	ENSP00000334276:p.Ala57Glu		B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.A57E	ENST00000335568.5	37	c.170	CCDS3528.1	4	.	.	.	.	.	.	.	.	.	.	-	2.741	-0.262233	0.05791	.	.	ENSG00000135226	ENST00000335568;ENST00000511240	T;T	0.62498	0.02;0.02	2.18	-1.51	0.08664	.	0.427258	0.18758	U	0.131963	T	0.68035	0.2957	M	0.74467	2.265	0.09310	N	1	D;P	0.59767	0.986;0.585	D;P	0.63283	0.913;0.589	T	0.58629	-0.7603	10	0.44086	T	0.13	.	3.7429	0.08537	0.0:0.3024:0.41:0.2876	.	57;57	Q9BY64-2;Q9BY64	.;UDB28_HUMAN	E	57	ENSP00000334276:A57E;ENSP00000427399:A57E	ENSP00000334276:A57E	A	+	2	0	UGT2B28	70180977	0.000000	0.05858	0.027000	0.17364	0.020000	0.10135	0.128000	0.15810	-0.633000	0.05545	0.184000	0.17185	GCA	UGT2B28	-	pfam_UDP_glucos_trans	ENSG00000135226		0.408	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B28	HGNC	protein_coding	OTTHUMT00000251557.2		0.00	159	0	C	NM_053039		70146388	+1			no_errors	ENST00000335568	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.003	A
UNC13C	440279	genome.wustl.edu	37	15	54792315	54792315	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr15:54792315A>C	ENST00000260323.11	+	20	5099	c.5099A>C	c.(5098-5100)aAc>aCc	p.N1700T	UNC13C_ENST00000537900.1_Missense_Mutation_p.N1698T|UNC13C_ENST00000545554.1_Missense_Mutation_p.N1700T	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1700	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTAGATGAAAACGAAGATGTG	0.343																																																	0													135.0	125.0	128.0					15																	54792315		1846	4101	5947	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5099A>C	15.37:g.54792315A>C	ENSP00000260323:p.Asn1700Thr		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.N1700T	ENST00000260323.11	37	c.5099	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	A	21.2	4.107053	0.77096	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.79653	-1.29;-1.29;-1.29	5.5	5.5	0.81552	Munc13 homology 1 (1);	0.149727	0.64402	D	0.000019	D	0.89636	0.6772	M	0.83312	2.635	0.58432	D	0.999995	D	0.69078	0.997	D	0.77004	0.989	D	0.89228	0.3575	10	0.36615	T	0.2	.	15.0943	0.72220	1.0:0.0:0.0:0.0	.	1700	Q8NB66	UN13C_HUMAN	T	1700;1700;1698	ENSP00000260323:N1700T;ENSP00000438156:N1700T;ENSP00000442569:N1698T	ENSP00000260323:N1700T	N	+	2	0	UNC13C	52579607	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.165000	0.94761	2.216000	0.71823	0.533000	0.62120	AAC	UNC13C	-	NULL	ENSG00000137766		0.343	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	71	0	A	NM_173166		54792315	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	46.88	34	30	SNP	1.000	C
URB1	9875	genome.wustl.edu	37	21	33719711	33719711	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr21:33719711G>T	ENST00000382751.3	-	22	3537	c.3422C>A	c.(3421-3423)aCg>aAg	p.T1141K		NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	1141						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						GGGGGATTTCGTGGGTTGCTG	0.612																																																	0													17.0	21.0	19.0					21																	33719711		692	1591	2283	SO:0001583	missense	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.3422C>A	21.37:g.33719711G>T	ENSP00000372199:p.Thr1141Lys		D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	pfam_Npa1_N,superfamily_ARM-type_fold	p.T1141K	ENST00000382751.3	37	c.3422	CCDS46645.1	21	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.164753	0.00318	.	.	ENSG00000142207	ENST00000382751	T	0.28255	1.62	4.9	-3.19	0.05171	.	1.148490	0.06357	N	0.710988	T	0.16896	0.0406	L	0.34521	1.04	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.30736	-0.9968	10	0.07482	T	0.82	-0.0481	4.8339	0.13454	0.3627:0.0:0.2718:0.3655	.	1141	O60287	NPA1P_HUMAN	K	1141	ENSP00000372199:T1141K	ENSP00000372199:T1141K	T	-	2	0	URB1	32641582	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.091000	0.15046	-0.440000	0.07211	-0.137000	0.14449	ACG	URB1	-	NULL	ENSG00000142207		0.612	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	-	0.00	46	0	G			33719711	-1	tier1	-	no_errors	ENST00000382751	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.000	T
USP37	57695	genome.wustl.edu	37	2	219341622	219341622	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:219341622G>T	ENST00000258399.3	-	19	2396	c.1984C>A	c.(1984-1986)Ctc>Atc	p.L662I	USP37_ENST00000475553.1_5'Flank|USP37_ENST00000415516.1_Missense_Mutation_p.L568I|USP37_ENST00000454775.1_Missense_Mutation_p.L662I|USP37_ENST00000418019.1_Missense_Mutation_p.L662I	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	662	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		CTCTGGCTGAGGGCCACAGAA	0.388																																																	0													98.0	94.0	96.0					2																	219341622		2203	4300	6503	SO:0001583	missense	0			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.1984C>A	2.37:g.219341622G>T	ENSP00000258399:p.Leu662Ile		A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19/C67	p.L662I	ENST00000258399.3	37	c.1984	CCDS2418.1	2	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328236	0.24080	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019	T;T;T;T	0.42131	1.01;1.01;0.98;1.01	5.2	2.37	0.29283	Ubiquitin interacting motif (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.609329	0.16443	N	0.214240	T	0.19485	0.0468	N	0.08118	0	0.80722	D	1	B;B	0.19583	0.03;0.037	B;B	0.18871	0.013;0.023	T	0.05468	-1.0883	10	0.46703	T	0.11	-1.7111	3.4538	0.07507	0.1548:0.1349:0.5716:0.1388	.	568;662	Q86T82-2;Q86T82	.;UBP37_HUMAN	I	662;662;568;662	ENSP00000258399:L662I;ENSP00000393662:L662I;ENSP00000400902:L568I;ENSP00000396585:L662I	ENSP00000258399:L662I	L	-	1	0	USP37	219049866	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	1.592000	0.36676	0.327000	0.23409	0.655000	0.94253	CTC	USP37	-	pfam_Peptidase_C19/C67,smart_Ubiquitin-int_motif,pfscan_Peptidase_C19/C67	ENSG00000135913		0.388	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP37	HGNC	protein_coding	OTTHUMT00000256779.3	-	0.00	65	0	G	NM_020935		219341622	-1	tier1	-	no_errors	ENST00000258399	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.985	T
VAC14	55697	genome.wustl.edu	37	16	70778407	70778407	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:70778407G>C	ENST00000261776.5	-	13	1707	c.1447C>G	c.(1447-1449)Ctc>Gtc	p.L483V	RP11-394B2.6_ENST00000567186.1_RNA	NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	483					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				GGGCCATCGAGGGGGCCTGGG	0.652																																																	0													34.0	39.0	37.0					16																	70778407		2198	4300	6498	SO:0001583	missense	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.1447C>G	16.37:g.70778407G>C	ENSP00000261776:p.Leu483Val		B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_VAC14_Fig4p-bd,pfam_HEAT,superfamily_ARM-type_fold	p.L483V	ENST00000261776.5	37	c.1447	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	G	0.109	-1.141516	0.01728	.	.	ENSG00000103043	ENST00000261776	.	.	.	5.4	3.16	0.36331	Armadillo-type fold (1);	0.326219	0.35615	N	0.003087	T	0.22360	0.0539	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13019	-1.0525	9	0.14656	T	0.56	-2.1584	5.1661	0.15086	0.1296:0.4214:0.4491:0.0	.	483	Q08AM6	VAC14_HUMAN	V	483	.	ENSP00000261776:L483V	L	-	1	0	VAC14	69335908	0.005000	0.15991	0.018000	0.16275	0.077000	0.17291	1.656000	0.37355	1.220000	0.43490	0.561000	0.74099	CTC	VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.652	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	-	0.00	84	0	G	NM_018052		70778407	-1	tier1	-	no_errors	ENST00000261776	ensembl	human	known	74_37	missense	15.62	54	10	SNP	0.001	C
VAT1L	57687	genome.wustl.edu	37	16	77850905	77850905	+	Silent	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr16:77850905T>C	ENST00000302536.2	+	2	474	c.321T>C	c.(319-321)tcT>tcC	p.S107S		NM_020927.1	NP_065978.1	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport 1-like	107							oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(10)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24						TTGAGTGTTCTGGGATTGTTG	0.433																																																	0													152.0	139.0	143.0					16																	77850905		2198	4300	6498	SO:0001819	synonymous_variant	0			AB046796	CCDS32492.1	16q23.1	2014-09-09	2013-08-23		ENSG00000171724	ENSG00000171724			29315	protein-coding gene	gene with protein product			"""vesicle amine transport protein 1 homolog (T. californica)-like"""			10997877	Standard	NM_020927		Approved	KIAA1576	uc002ffg.1	Q9HCJ6	OTTHUMG00000176845	ENST00000302536.2:c.321T>C	16.37:g.77850905T>C			Q8IYW8	Silent	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.S107	ENST00000302536.2	37	c.321	CCDS32492.1	16																																																																																			VAT1L	-	pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	ENSG00000171724		0.433	VAT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAT1L	HGNC	protein_coding	OTTHUMT00000434010.1	-	0.00	52	0	T	NM_020927		77850905	+1	tier1	-	no_errors	ENST00000302536	ensembl	human	known	74_37	silent	22.22	28	8	SNP	0.997	C
VIT	5212	genome.wustl.edu	37	2	37032713	37032713	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:37032713C>T	ENST00000389975.3	+	13	1552	c.1250C>T	c.(1249-1251)gCg>gTg	p.A417V	VIT_ENST00000497382.1_Missense_Mutation_p.A86V|VIT_ENST00000401530.1_Missense_Mutation_p.A396V|VIT_ENST00000404084.1_Missense_Mutation_p.A369V|VIT_ENST00000379241.3_Missense_Mutation_p.A395V|VIT_ENST00000379242.3_Missense_Mutation_p.A432V	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	417	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				TCAAGACTTGCGAGAGAGTCA	0.493																																																	0													118.0	101.0	107.0					2																	37032713		2203	4300	6503	SO:0001583	missense	0			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.1250C>T	2.37:g.37032713C>T	ENSP00000374625:p.Ala417Val		A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.A432V	ENST00000389975.3	37	c.1295	CCDS54347.1	2	.	.	.	.	.	.	.	.	.	.	C	30	5.053932	0.93793	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000497382;ENST00000404084;ENST00000379241;ENST00000401530	T;T;T;T;T;T	0.58060	0.36;0.36;1.07;0.36;0.36;1.07	5.49	5.49	0.81192	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.76190	0.3953	M	0.84511	2.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.996	T	0.75193	-0.3404	10	0.33141	T	0.24	-18.351	19.3832	0.94545	0.0:1.0:0.0:0.0	.	396;395;417;432	E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4	.;.;VITRN_HUMAN;.	V	432;417;86;369;395;396	ENSP00000368544:A432V;ENSP00000374625:A417V;ENSP00000417874:A86V;ENSP00000384154:A369V;ENSP00000368543:A395V;ENSP00000385658:A396V	ENSP00000368543:A395V	A	+	2	0	VIT	36886217	1.000000	0.71417	0.290000	0.24890	0.976000	0.68499	7.786000	0.85741	2.569000	0.86673	0.650000	0.86243	GCG	VIT	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000205221		0.493	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		-	0.00	118	0	C			37032713	+1	tier1	-	no_errors	ENST00000379242	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
VNN1	8876	genome.wustl.edu	37	6	133032938	133032938	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:133032938C>A	ENST00000367928.4	-	2	264	c.251G>T	c.(250-252)gGc>gTc	p.G84V		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	84	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)			NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		GAAGTTCCAGCCATAAATAGC	0.458																																																	0													117.0	118.0	117.0					6																	133032938		2203	4300	6503	SO:0001583	missense	0			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.251G>T	6.37:g.133032938C>A	ENSP00000356905:p.Gly84Val		A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.G84V	ENST00000367928.4	37	c.251	CCDS5159.1	6	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639580	0.67244	.	.	ENSG00000112299	ENST00000367928	D	0.88818	-2.43	5.6	5.6	0.85130	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.85682	D	0.000000	D	0.95249	0.8459	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95547	0.8617	10	0.87932	D	0	-10.9464	19.1984	0.93699	0.0:1.0:0.0:0.0	.	84	O95497	VNN1_HUMAN	V	84	ENSP00000356905:G84V	ENSP00000356905:G84V	G	-	2	0	VNN1	133074631	0.999000	0.42202	0.446000	0.26920	0.576000	0.36127	5.426000	0.66476	2.643000	0.89663	0.555000	0.69702	GGC	VNN1	-	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	ENSG00000112299		0.458	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VNN1	HGNC	protein_coding	OTTHUMT00000042263.1		0.00	107	0	C			133032938	-1			no_errors	ENST00000367928	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.986	A
VPS13B	157680	genome.wustl.edu	37	8	100128051	100128051	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr8:100128051G>A	ENST00000358544.2	+	7	997	c.886G>A	c.(886-888)Gaa>Aaa	p.E296K	VPS13B_ENST00000441350.2_Missense_Mutation_p.E296K|VPS13B_ENST00000357162.2_Missense_Mutation_p.E296K|VPS13B_ENST00000395996.1_Missense_Mutation_p.E296K|VPS13B_ENST00000355155.1_Missense_Mutation_p.E296K	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	296					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TAAAGAAGGCGAAATAGAGGA	0.294																																					Colon(161;2205 2542 7338 31318)												0													78.0	80.0	79.0					8																	100128051		2203	4296	6499	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.886G>A	8.37:g.100128051G>A	ENSP00000351346:p.Glu296Lys		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.E296K	ENST00000358544.2	37	c.886	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539883	0.65085	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	T;T;T;T;D	0.84660	-1.34;-0.7;-0.68;-0.38;-1.88	5.65	5.65	0.86999	.	0.063968	0.64402	D	0.000011	D	0.89966	0.6868	L	0.42245	1.32	0.80722	D	1	D;D;D;D;P	0.89917	1.0;0.997;0.995;0.981;0.844	D;P;P;B;B	0.70935	0.971;0.678;0.481;0.204;0.154	D	0.89894	0.4039	10	0.56958	D	0.05	.	19.7362	0.96205	0.0:0.0:1.0:0.0	.	296;296;296;296;296	Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4;Q7Z7G8-5	.;VP13B_HUMAN;.;.;.	K	296	ENSP00000347281:E296K;ENSP00000349685:E296K;ENSP00000351346:E296K;ENSP00000379318:E296K;ENSP00000398472:E296K	ENSP00000347281:E296K	E	+	1	0	VPS13B	100197227	1.000000	0.71417	1.000000	0.80357	0.484000	0.33280	8.913000	0.92730	2.678000	0.91216	0.655000	0.94253	GAA	VPS13B	-	NULL	ENSG00000132549		0.294	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	-	0.00	60	0	G	NM_184042		100128051	+1	tier1	-	no_errors	ENST00000358544	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	A
VPS37B	79720	genome.wustl.edu	37	12	123351892	123351892	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr12:123351892delG	ENST00000267202.2	-	4	1010	c.629delC	c.(628-630)ccafs	p.P213fs	RP11-463O12.3_ENST00000537827.2_lincRNA	NM_024667.2	NP_078943.1	Q9H9H4	VP37B_HUMAN	vacuolar protein sorting 37 homolog B (S. cerevisiae)	213	Pro-rich.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)		p.P211fs*>76(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|skin(1)|urinary_tract(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)		CGGGGGTGGTGGGGGGGGGAT	0.716																																																	1	Insertion - Frameshift(1)	large_intestine(1)								71,200,3595		4,0,63,8,184,1674	8.0	10.0	9.0			-9.5	0.0	12		9	91,347,7060		7,0,77,16,315,3334	no	codingComplex	VPS37B	NM_024667.2		11,0,140,24,499,5008	A1A1,A1A2,A1R,A2A2,A2R,RR		5.8416,7.0098,6.239			123351892	162,547,10655	2086	4079	6165	SO:0001589	frameshift_variant	0			AK022812	CCDS9239.1	12q24.31	2008-02-05	2006-04-04		ENSG00000139722	ENSG00000139722			25754	protein-coding gene	gene with protein product		610037	"""vacuolar protein sorting 37B (yeast)"""			15218037	Standard	NM_024667		Approved	FLJ12750	uc001udl.3	Q9H9H4	OTTHUMG00000168767	ENST00000267202.2:c.629delC	12.37:g.123351892delG	ENSP00000267202:p.Pro213fs			Frame_Shift_Del	DEL	pfam_Mod_r	p.P210fs	ENST00000267202.2	37	c.629	CCDS9239.1	12																																																																																			VPS37B	-	NULL	ENSG00000139722		0.716	VPS37B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37B	HGNC	protein_coding	OTTHUMT00000400946.1		0.00	13	0	G	NM_024667		123351892	-1			no_errors	ENST00000267202	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.609	0
VSTM2B	342865	genome.wustl.edu	37	19	30018291	30018291	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:30018291G>A	ENST00000335523.7	+	2	341	c.256G>A	c.(256-258)Gcc>Acc	p.A86T	CTC-525D6.1_ENST00000582581.1_RNA|CTC-525D6.2_ENST00000579268.1_RNA	NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	86	Ig-like V-type.					integral component of membrane (GO:0016021)				breast(2)	2						CGTGCCGGGCGCCCGGAGCAA	0.726																																																	0													15.0	17.0	16.0					19																	30018291		692	1591	2283	SO:0001583	missense	0				CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.256G>A	19.37:g.30018291G>A	ENSP00000335038:p.Ala86Thr			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.A86T	ENST00000335523.7	37	c.256	CCDS46034.1	19	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443785	0.25987	.	.	ENSG00000187135	ENST00000335523	T	0.63417	-0.04	4.45	3.35	0.38373	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.455157	0.21035	N	0.081274	T	0.41719	0.1171	L	0.28400	0.85	0.26823	N	0.96876	P	0.43750	0.816	B	0.38880	0.284	T	0.21177	-1.0253	10	0.14656	T	0.56	-19.7783	6.951	0.24546	0.2589:0.0:0.7411:0.0	.	86	A6NLU5	VTM2B_HUMAN	T	86	ENSP00000335038:A86T	ENSP00000335038:A86T	A	+	1	0	VSTM2B	34710131	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.892000	0.56235	2.311000	0.77944	0.543000	0.68304	GCC	VSTM2B	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000187135		0.726	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM2B	HGNC	protein_coding	OTTHUMT00000458601.1	-	0.00	52	0	G	NM_001146339		30018291	+1	tier1	-	no_errors	ENST00000335523	ensembl	human	known	74_37	missense	13.95	36	6	SNP	1.000	A
WDR34	89891	genome.wustl.edu	37	9	131397627	131397627	+	Intron	DEL	A	A	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:131397627delA	ENST00000372715.2	-	6	874				WDR34_ENST00000483181.1_Intron	NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34							axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						CTCTTCCAGGAAAAAAAAAAA	0.622											OREG0019522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.814-89T>-	9.37:g.131397627delA		1587	Q5VXV4|Q9BV46	RNA	DEL	-	NULL	ENST00000372715.2	37	NULL	CCDS6906.2	9																																																																																			WDR34	-	-	ENSG00000119333		0.622	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR34	HGNC	protein_coding	OTTHUMT00000054463.1		0.00	12	0	A	NM_052844		131397627	-1	tier1		no_errors	ENST00000473486	ensembl	human	known	74_37	rna	30.00	7	3	DEL	0.002	-
WSB1	26118	genome.wustl.edu	37	17	25637196	25637196	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:25637196G>A	ENST00000262394.2	+	7	1310	c.994G>A	c.(994-996)Gat>Aat	p.D332N	WSB1_ENST00000348811.2_Missense_Mutation_p.D186N	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	332					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CCTTGCTGATGATAAGTAAGT	0.408																																																	0													195.0	163.0	174.0					17																	25637196		2203	4300	6503	SO:0001583	missense	0			AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.994G>A	17.37:g.25637196G>A	ENSP00000262394:p.Asp332Asn		Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SOCS_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D332N	ENST00000262394.2	37	c.994	CCDS11220.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.873549	0.97049	.	.	ENSG00000109046	ENST00000262394;ENST00000348811	D;D	0.88975	-2.45;-2.45	5.93	5.93	0.95920	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000001	D	0.95300	0.8475	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.95311	0.8412	10	0.87932	D	0	-11.2406	19.3347	0.94312	0.0:0.0:1.0:0.0	.	186;332	Q9Y6I7-2;Q9Y6I7	.;WSB1_HUMAN	N	332;186	ENSP00000262394:D332N;ENSP00000327055:D186N	ENSP00000262394:D332N	D	+	1	0	WSB1	22661323	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.580000	0.98207	2.798000	0.96311	0.655000	0.94253	GAT	WSB1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109046		0.408	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSB1	HGNC	protein_coding	OTTHUMT00000255391.4	-	0.00	33	0	G	NM_015626		25637196	+1	tier1	-	no_errors	ENST00000262394	ensembl	human	known	74_37	missense	35.48	20	11	SNP	1.000	A
XIRP2	129446	genome.wustl.edu	37	2	167992572	167992572	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr2:167992572G>T	ENST00000409728.1	+	3	651	c.562G>T	c.(562-564)Gca>Tca	p.A188S	XIRP2_ENST00000409043.1_Splice_Site_p.A188S|XIRP2_ENST00000420519.1_Splice_Site_p.A188S|XIRP2_ENST00000409195.1_Splice_Site_p.A188S|XIRP2_ENST00000295237.9_Splice_Site_p.A188S|XIRP2_ENST00000409756.2_Splice_Site_p.A188S|XIRP2-AS1_ENST00000525330.1_RNA	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	13					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.?(2)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CATCTTTGAAGGTTAGCATAA	0.363																																																	2	Unknown(2)	lung(2)											79.0	78.0	78.0					2																	167992572		1880	4113	5993	SO:0001630	splice_region_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.562+1G>T	2.37:g.167992572G>T			A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.A188S	ENST00000409728.1	37	c.562	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	G	13.96	2.391625	0.42410	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	T;T;T;T;T;T	0.77489	-1.1;-1.09;4.25;-1.1;-1.09;4.25	5.51	5.51	0.81932	.	0.951251	0.08587	U	0.923659	T	0.73536	0.3599	L	0.34521	1.04	0.29641	N	0.844739	B;P;B	0.49961	0.16;0.93;0.069	B;P;B	0.44732	0.059;0.459;0.037	T	0.64546	-0.6382	10	0.13108	T	0.6	1.6483	17.6029	0.88030	0.0:0.0:1.0:0.0	.	188;188;13	A4UGR9-4;A4UGR9-6;A4UGR9-3	.;.;.	S	188	ENSP00000386454:A188S;ENSP00000386619:A188S;ENSP00000386840:A188S;ENSP00000386724:A188S;ENSP00000415541:A188S;ENSP00000295237:A188S	ENSP00000295237:A188S	A	+	1	0	XIRP2	167700818	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	6.229000	0.72294	2.597000	0.87782	0.591000	0.81541	GCG;GCA;GCG;GCG;GCA;GCG	XIRP2	-	NULL	ENSG00000163092		0.363	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1		0.00	46	0	G	NM_152381	Missense_Mutation	167992572	+1			no_errors	ENST00000295237	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	T
YARS	8565	genome.wustl.edu	37	1	33276597	33276597	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr1:33276597C>G	ENST00000373477.4	-	2	1027	c.119G>C	c.(118-120)tGg>tCg	p.W40S		NM_003680.3	NP_003671.1	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase	40					apoptotic process (GO:0006915)|gene expression (GO:0010467)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)|tyrosyl-tRNA aminoacylation (GO:0006437)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|interleukin-8 receptor binding (GO:0005153)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)|tRNA binding (GO:0000049)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)	TGCCGTTCCCCAGTAAATTTT	0.468																																																	0													384.0	378.0	380.0					1																	33276597		2203	4300	6503	SO:0001583	missense	0			U89436	CCDS368.1	1p35.1	2014-09-17			ENSG00000134684	ENSG00000134684	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	12840	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 1, cytoplasmic"""	603623				8552597, 9162081	Standard	NM_003680		Approved	YTS, YRS, tyrRS	uc001bvy.1	P54577	OTTHUMG00000003933	ENST00000373477.4:c.119G>C	1.37:g.33276597C>G	ENSP00000362576:p.Trp40Ser		B3KWK4|D3DPQ4|O43276|Q53EN1	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ic,pfam_tRNA-bd_dom,superfamily_NA-bd_OB-fold,prints_Tyr-tRNA-ligase,pfscan_tRNA-bd_dom,tigrfam_Tyr-tRNA-ligase	p.W40S	ENST00000373477.4	37	c.119	CCDS368.1	1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750885	0.89753	.	.	ENSG00000134684	ENST00000373477	T	0.69926	-0.44	5.54	5.54	0.83059	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.87916	0.6298	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89923	0.4060	10	0.52906	T	0.07	-7.9056	19.8761	0.96870	0.0:1.0:0.0:0.0	.	40	P54577	SYYC_HUMAN	S	40	ENSP00000362576:W40S	ENSP00000362576:W40S	W	-	2	0	YARS	33049184	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.463000	0.80869	2.774000	0.95407	0.650000	0.86243	TGG	YARS	-	pfam_aa-tRNA-synth_Ic,tigrfam_Tyr-tRNA-ligase	ENSG00000134684		0.468	YARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS	HGNC	protein_coding	OTTHUMT00000011225.1	-	0.00	38	0	C	NM_003680		33276597	-1	tier1	-	no_errors	ENST00000373477	ensembl	human	known	74_37	missense	25.53	35	12	SNP	1.000	G
ZBTB4	57659	genome.wustl.edu	37	17	7366573	7366573	+	Silent	SNP	G	G	A	rs373767560		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr17:7366573G>A	ENST00000311403.4	-	4	2067	c.1728C>T	c.(1726-1728)ggC>ggT	p.G576G	ZBTB4_ENST00000380599.4_Silent_p.G576G	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	576					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		CACCAATCCCGCCCACTGGCT	0.677																																																	0								G	,	0,4394		0,0,2197	11.0	13.0	13.0		1728,1728	-8.7	0.0	17		13	1,8581		0,1,4290	no	coding-synonymous,coding-synonymous	ZBTB4	NM_001128833.1,NM_020899.3	,	0,1,6487	AA,AG,GG		0.0117,0.0,0.0077	,	576/1014,576/1014	7366573	1,12975	2197	4291	6488	SO:0001819	synonymous_variant	0			AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.1728C>T	17.37:g.7366573G>A			B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G576	ENST00000311403.4	37	c.1728	CCDS11107.1	17																																																																																			ZBTB4	-	NULL	ENSG00000174282		0.677	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB4	HGNC	protein_coding	OTTHUMT00000226940.2	-	0.00	75	0	G	NM_020899		7366573	-1	tier1	-	no_errors	ENST00000311403	ensembl	human	known	74_37	silent	8.33	55	5	SNP	0.000	A
ZC3HAV1L	92092	genome.wustl.edu	37	7	138713558	138713558	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:138713558G>T	ENST00000275766.1	-	3	661	c.650C>A	c.(649-651)gCa>gAa	p.A217E		NM_080660.3	NP_542391.2	Q96H79	ZCCHL_HUMAN	zinc finger CCCH-type, antiviral 1-like	217										NS(2)|endometrium(2)|large_intestine(1)|lung(4)|skin(1)	10						CTTCAAAGATGCAGCATGGAT	0.413																																																	0													112.0	102.0	105.0					7																	138713558		2203	4300	6503	SO:0001583	missense	0			BC008842	CCDS5850.1	7q34	2006-07-03	2006-07-03	2006-07-03	ENSG00000146858	ENSG00000146858			22423	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 39"""	C7orf39			Standard	NM_080660		Approved	MGC14289	uc003vum.1	Q96H79	OTTHUMG00000157229	ENST00000275766.1:c.650C>A	7.37:g.138713558G>T	ENSP00000275766:p.Ala217Glu		Q8WUD9	Missense_Mutation	SNP	NULL	p.A217E	ENST00000275766.1	37	c.650	CCDS5850.1	7	.	.	.	.	.	.	.	.	.	.	G	0.922	-0.715542	0.03206	.	.	ENSG00000146858	ENST00000275766	T	0.28454	1.61	5.62	3.71	0.42584	.	1.962480	0.02272	N	0.068558	T	0.22627	0.0546	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.24693	-1.0153	10	0.05525	T	0.97	.	12.5259	0.56085	0.0:0.0:0.609:0.3909	.	217	Q96H79	ZCCHL_HUMAN	E	217	ENSP00000275766:A217E	ENSP00000275766:A217E	A	-	2	0	ZC3HAV1L	138364098	0.000000	0.05858	0.002000	0.10522	0.126000	0.20510	0.356000	0.20181	1.509000	0.48786	0.650000	0.86243	GCA	ZC3HAV1L	-	NULL	ENSG00000146858		0.413	ZC3HAV1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1L	HGNC	protein_coding	OTTHUMT00000348090.1	-	0.00	92	0	G	NM_080660		138713558	-1	tier1	-	no_errors	ENST00000275766	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.000	T
ZCCHC16	340595	genome.wustl.edu	37	X	111698082	111698082	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chrX:111698082A>C	ENST00000340433.2	+	1	356	c.126A>C	c.(124-126)caA>caC	p.Q42H		NM_001004308.2	NP_001004308.2	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	42							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27						AAAGGGGCCAAGTCATGCCTG	0.522																																																	0													120.0	88.0	99.0					X																	111698082		2203	4300	6503	SO:0001583	missense	0			AK128465	CCDS35369.1	Xq23	2008-05-02			ENSG00000187823	ENSG00000187823		"""Zinc fingers, CCHC domain containing"""	25214	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_001004308		Approved	Mart4, Mar4, FLJ46608	uc004epo.1	Q6ZR62	OTTHUMG00000159706	ENST00000340433.2:c.126A>C	X.37:g.111698082A>C	ENSP00000340590:p.Gln42His		B2RPG1	Missense_Mutation	SNP	superfamily_Znf_CCHC,pfscan_Znf_CCHC	p.Q42H	ENST00000340433.2	37	c.126	CCDS35369.1	X	.	.	.	.	.	.	.	.	.	.	A	10.87	1.471716	0.26423	.	.	ENSG00000187823	ENST00000340433	T	0.47869	0.83	4.19	1.74	0.24563	.	0.289155	0.23215	N	0.050628	T	0.46870	0.1415	L	0.34521	1.04	0.09310	N	1	D	0.69078	0.997	D	0.64410	0.925	T	0.24941	-1.0146	10	0.44086	T	0.13	-3.0E-4	3.4759	0.07585	0.6448:0.2318:0.1235:0.0	.	42	Q6ZR62	ZCH16_HUMAN	H	42	ENSP00000340590:Q42H	ENSP00000340590:Q42H	Q	+	3	2	ZCCHC16	111584738	0.001000	0.12720	0.001000	0.08648	0.028000	0.11728	0.078000	0.14761	0.241000	0.21283	0.486000	0.48141	CAA	ZCCHC16	-	NULL	ENSG00000187823		0.522	ZCCHC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC16	HGNC	protein_coding	OTTHUMT00000356964.1	-	0.00	39	0	A	NM_001004308		111698082	+1	tier1	-	no_errors	ENST00000340433	ensembl	human	known	74_37	missense	35.29	11	6	SNP	0.001	C
ZFP2	80108	genome.wustl.edu	37	5	178358975	178358975	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:178358975delA	ENST00000361362.2	+	5	1191	c.661delA	c.(661-663)aaafs	p.K221fs	ZFP2_ENST00000520301.1_Frame_Shift_Del_p.K221fs|ZFP2_ENST00000503510.2_Frame_Shift_Del_p.K221fs|ZFP2_ENST00000523286.1_Frame_Shift_Del_p.K221fs	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		TGAATGTGGTAAAGCTTTTAC	0.373																																																	0													46.0	49.0	48.0					5																	178358975		2203	4299	6502	SO:0001589	frameshift_variant	0			AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.661delA	5.37:g.178358975delA	ENSP00000354453:p.Lys221fs		A5PLN5|B7ZM23|Q9H6Z6	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A222fs	ENST00000361362.2	37	c.661	CCDS4440.1	5																																																																																			ZFP2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198939		0.373	ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP2	HGNC	protein_coding	OTTHUMT00000253470.2		0.00	54	0	A	NM_030613		178358975	+1	tier1		no_errors	ENST00000361362	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	1.000	-
ZFP2	80108	genome.wustl.edu	37	5	178359054	178359054	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:178359054G>A	ENST00000361362.2	+	5	1270	c.740G>A	c.(739-741)tGt>tAt	p.C247Y	ZFP2_ENST00000520301.1_Missense_Mutation_p.C247Y|ZFP2_ENST00000503510.2_Missense_Mutation_p.C247Y|ZFP2_ENST00000523286.1_Missense_Mutation_p.C247Y	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	247					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		TGTAATGAATGTGGAAAAGCC	0.368																																																	0													63.0	65.0	64.0					5																	178359054		2203	4300	6503	SO:0001583	missense	0			AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.740G>A	5.37:g.178359054G>A	ENSP00000354453:p.Cys247Tyr		A5PLN5|B7ZM23|Q9H6Z6	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C247Y	ENST00000361362.2	37	c.740	CCDS4440.1	5	.	.	.	.	.	.	.	.	.	.	g	18.44	3.624431	0.66901	.	.	ENSG00000198939	ENST00000361362;ENST00000520301;ENST00000523286;ENST00000503510	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	4.94	4.94	0.65067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34932	N	0.003568	D	0.95149	0.8428	H	0.97491	4.015	0.51233	D	0.999911	D	0.89917	1.0	D	0.97110	1.0	D	0.96647	0.9478	10	0.87932	D	0	-5.4427	15.707	0.77592	0.0:0.0:1.0:0.0	.	247	Q6ZN57	ZFP2_HUMAN	Y	247	ENSP00000354453:C247Y;ENSP00000430980:C247Y;ENSP00000430531:C247Y;ENSP00000438114:C247Y	ENSP00000354453:C247Y	C	+	2	0	ZFP2	178291660	1.000000	0.71417	0.897000	0.35233	0.971000	0.66376	7.581000	0.82535	2.549000	0.85964	0.650000	0.86243	TGT	ZFP2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198939		0.368	ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP2	HGNC	protein_coding	OTTHUMT00000253470.2	-	0.00	53	0	G	NM_030613		178359054	+1	tier1	-	no_errors	ENST00000361362	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
ZNF184	7738	genome.wustl.edu	37	6	27419796	27419796	+	Silent	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr6:27419796G>T	ENST00000211936.6	-	6	1826	c.1542C>A	c.(1540-1542)ctC>ctA	p.L514L	ZNF184_ENST00000377419.1_Silent_p.L514L	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TAAGGTTTGAGAGATAACTGA	0.403																																																	0													78.0	77.0	77.0					6																	27419796		2203	4299	6502	SO:0001819	synonymous_variant	0			U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1542C>A	6.37:g.27419796G>T			B2R715|O60792|Q8TBA9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L514	ENST00000211936.6	37	c.1542	CCDS4624.1	6																																																																																			ZNF184	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000096654		0.403	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF184	HGNC	protein_coding	OTTHUMT00000040146.1	-	0.00	59	0	G	NM_007149		27419796	-1	tier1	-	no_errors	ENST00000211936	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.004	T
ZNF248	57209	genome.wustl.edu	37	10	38121298	38121298	+	Missense_Mutation	SNP	C	C	T	rs74723700		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr10:38121298C>T	ENST00000395867.3	-	6	1535	c.985G>A	c.(985-987)Gtg>Atg	p.V329M	AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000374648.3_Intron|ZNF248_ENST00000357328.4_Missense_Mutation_p.V329M|ZNF248_ENST00000494133.1_Intron	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	329					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						TTGTCACTCACTTTATATTCA	0.358																																																	0													107.0	106.0	106.0					10																	38121298		2203	4300	6503	SO:0001583	missense	0			AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.985G>A	10.37:g.38121298C>T	ENSP00000379208:p.Val329Met		Q8NDV8|Q9UMP3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V329M	ENST00000395867.3	37	c.985	CCDS7194.1	10	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055045	0.36277	.	.	ENSG00000198105	ENST00000395867;ENST00000357328	T;T	0.04917	3.53;3.53	4.61	2.62	0.31277	.	0.159466	0.29783	N	0.011210	T	0.07007	0.0178	L	0.41961	1.31	0.29635	N	0.845135	P	0.45902	0.868	B	0.43052	0.406	T	0.09207	-1.0685	10	0.87932	D	0	.	7.375	0.26823	0.1926:0.6212:0.1861:0.0	.	329	Q8NDW4	ZN248_HUMAN	M	329	ENSP00000379208:V329M;ENSP00000349882:V329M	ENSP00000349882:V329M	V	-	1	0	ZNF248	38161304	0.000000	0.05858	0.998000	0.56505	0.810000	0.45777	0.042000	0.13949	0.593000	0.29745	0.563000	0.77884	GTG	ZNF248	-	NULL	ENSG00000198105		0.358	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF248	HGNC	protein_coding	OTTHUMT00000047609.1	-	0.00	54	0	C	NM_021045		38121298	-1	tier1	-	no_errors	ENST00000357328	ensembl	human	known	74_37	missense	17.39	57	12	SNP	0.996	T
ZNF280B	140883	genome.wustl.edu	37	22	22843122	22843122	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr22:22843122G>T	ENST00000406426.1	-	4	1344	c.602C>A	c.(601-603)gCt>gAt	p.A201D	ZNF280B_ENST00000360412.2_Missense_Mutation_p.A201D			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		AGGGAACGAAGCTGAAGAATT	0.393																																																	0													111.0	108.0	109.0					22																	22843122		2203	4300	6503	SO:0001583	missense	0			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.602C>A	22.37:g.22843122G>T	ENSP00000385998:p.Ala201Asp			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A201D	ENST00000406426.1	37	c.602	CCDS13799.1	22	.	.	.	.	.	.	.	.	.	.	G	8.773	0.926284	0.18056	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.25579	1.79;1.79	4.43	-0.532	0.11890	.	.	.	.	.	T	0.39545	0.1082	M	0.66939	2.045	0.09310	N	1	D	0.63880	0.993	D	0.67103	0.949	T	0.18681	-1.0329	9	0.54805	T	0.06	-4.4463	3.8665	0.09018	0.3439:0.1793:0.4767:0.0	.	201	Q86YH2	Z280B_HUMAN	D	201	ENSP00000385998:A201D;ENSP00000353586:A201D	ENSP00000353586:A201D	A	-	2	0	ZNF280B	21173122	0.204000	0.23447	0.019000	0.16419	0.050000	0.14768	1.615000	0.36922	-0.084000	0.12595	0.655000	0.94253	GCT	ZNF280B	-	NULL	ENSG00000198477		0.393	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280B	HGNC	protein_coding	OTTHUMT00000321170.2		0.00	65	0	G	NM_080764		22843122	-1			no_errors	ENST00000360412	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.010	T
ZNF317	57693	genome.wustl.edu	37	19	9271408	9271408	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:9271408G>T	ENST00000247956.6	+	7	1392	c.1087G>T	c.(1087-1089)Gcg>Tcg	p.A363S	ZNF317_ENST00000360385.3_Missense_Mutation_p.A331S	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	363					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						GAAGCCCTACGCGTGCACGCA	0.552																																																	0													39.0	39.0	39.0					19																	9271408		2203	4300	6503	SO:0001583	missense	0			AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.1087G>T	19.37:g.9271408G>T	ENSP00000247956:p.Ala363Ser		Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A363S	ENST00000247956.6	37	c.1087	CCDS12210.1	19	.	.	.	.	.	.	.	.	.	.	G	7.104	0.574725	0.13623	.	.	ENSG00000130803	ENST00000247956;ENST00000360385	T;T	0.36340	1.26;1.26	3.04	0.857	0.19025	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.346348	0.20914	N	0.083413	T	0.20941	0.0504	L	0.27944	0.81	0.09310	N	1	B;B	0.23650	0.001;0.089	B;B	0.26310	0.001;0.068	T	0.16247	-1.0409	10	0.66056	D	0.02	-9.2635	2.8602	0.05584	0.2505:0.0:0.5319:0.2176	.	331;363	Q96PQ6-2;Q96PQ6	.;ZN317_HUMAN	S	363;331	ENSP00000247956:A363S;ENSP00000353554:A331S	ENSP00000247956:A363S	A	+	1	0	ZNF317	9132408	0.000000	0.05858	0.007000	0.13788	0.442000	0.32017	-0.709000	0.05030	0.337000	0.23665	0.491000	0.48974	GCG	ZNF317	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000130803		0.552	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF317	HGNC	protein_coding	OTTHUMT00000448995.1	-	0.00	42	0	G	NM_020933		9271408	+1	tier1	-	no_errors	ENST00000247956	ensembl	human	known	74_37	missense	21.43	11	3	SNP	0.000	T
ZNF354C	30832	genome.wustl.edu	37	5	178505852	178505852	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr5:178505852A>C	ENST00000315475.6	+	5	725	c.419A>C	c.(418-420)aAg>aCg	p.K140T		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		GAGCAAGAGAAGAAACCTCTT	0.378																																																	0													93.0	98.0	96.0					5																	178505852		2203	4300	6503	SO:0001583	missense	0				CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.419A>C	5.37:g.178505852A>C	ENSP00000324064:p.Lys140Thr		Q6P4P9|Q8NFX1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K140T	ENST00000315475.6	37	c.419	CCDS4443.1	5	.	.	.	.	.	.	.	.	.	.	A	12.96	2.094855	0.36952	.	.	ENSG00000177932	ENST00000315475	T	0.05786	3.39	3.7	1.29	0.21616	.	.	.	.	.	T	0.05547	0.0146	L	0.29908	0.895	0.09310	N	1	P	0.41313	0.745	B	0.43623	0.425	T	0.40459	-0.9562	9	0.17832	T	0.49	-5.1667	6.4472	0.21883	0.7839:0.0:0.2161:0.0	.	140	Q86Y25	Z354C_HUMAN	T	140	ENSP00000324064:K140T	ENSP00000324064:K140T	K	+	2	0	ZNF354C	178438458	0.011000	0.17503	0.056000	0.19401	0.059000	0.15707	1.956000	0.40382	0.156000	0.19299	-0.326000	0.08463	AAG	ZNF354C	-	NULL	ENSG00000177932		0.378	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354C	HGNC	protein_coding	OTTHUMT00000253473.2	-	0.00	42	0	A			178505852	+1	tier1	-	no_errors	ENST00000315475	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.186	C
ZNF521	25925	genome.wustl.edu	37	18	22669454	22669454	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr18:22669454T>G	ENST00000361524.3	-	7	4029	c.3881A>C	c.(3880-3882)aAg>aCg	p.K1294T	ZNF521_ENST00000538137.2_Missense_Mutation_p.K1294T|ZNF521_ENST00000584787.1_Missense_Mutation_p.K1074T	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1294					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GAAGAAAAACTTCTGTGGACA	0.403			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													173.0	161.0	165.0					18																	22669454		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3881A>C	18.37:g.22669454T>G	ENSP00000354794:p.Lys1294Thr		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K1294T	ENST00000361524.3	37	c.3881	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	T	14.33	2.501824	0.44455	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T	0.27104	1.69	5.96	5.96	0.96718	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.64402	D	0.000001	T	0.35970	0.0950	N	0.24115	0.695	0.58432	D	0.999991	D	0.76494	0.999	D	0.85130	0.997	T	0.09796	-1.0658	10	0.16420	T	0.52	-32.35	16.42	0.83755	0.0:0.0:0.0:1.0	.	1294	Q96K83	ZN521_HUMAN	T	1294;1328;1294	ENSP00000354794:K1294T	ENSP00000354794:K1294T	K	-	2	0	ZNF521	20923452	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.694000	0.84235	2.270000	0.75569	0.528000	0.53228	AAG	ZNF521	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198795		0.403	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	69	0	T	NM_015461		22669454	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	12.86	61	9	SNP	1.000	G
ZNF521	25925	genome.wustl.edu	37	18	22805957	22805957	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr18:22805957T>G	ENST00000361524.3	-	4	2073	c.1925A>C	c.(1924-1926)aAg>aCg	p.K642T	ZNF521_ENST00000538137.2_Missense_Mutation_p.K642T|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.K422T	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	642					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GGATGTGTACTTAGCACCACA	0.473			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													163.0	149.0	154.0					18																	22805957		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1925A>C	18.37:g.22805957T>G	ENSP00000354794:p.Lys642Thr		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K642T	ENST00000361524.3	37	c.1925	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	T	10.13	1.266099	0.23136	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.75260	-0.92;-0.92	5.86	5.86	0.93980	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.72358	0.3450	N	0.10618	0.0049999999999999	0.45056	D	0.998072	D	0.76494	0.999	D	0.75484	0.986	T	0.70788	-0.4777	10	0.15952	T	0.53	-31.3086	16.5602	0.84551	0.0:0.0:0.0:1.0	.	642	Q96K83	ZN521_HUMAN	T	642;676;642	ENSP00000354794:K642T;ENSP00000382352:K642T	ENSP00000354794:K642T	K	-	2	0	ZNF521	21059955	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.896000	0.69822	2.367000	0.80283	0.528000	0.53228	AAG	ZNF521	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198795		0.473	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	19	0	T	NM_015461		22805957	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	40.00	12	8	SNP	1.000	G
ZNF595	152687	genome.wustl.edu	37	4	85996	85997	+	3'UTR	INS	-	-	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr4:85996_85997insC	ENST00000339368.6	+	0	805_806							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GAAACCCTACAATGTGAAAAAT	0.406																																																	0										3582,324		1641,300,12						-0.1	0.1		dbSNP_129	12	7311,695		3331,649,23	no	frameshift	ZNF595	NM_182524.2		4972,949,35	A1A1,A1R,RR		8.681,8.2949,8.5544				10893,1019				SO:0001624	3_prime_UTR_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*803->C	4.37:g.85996_85997insC				RNA	INS	-	NULL	ENST00000339368.6	37	NULL		4																																																																																			ZNF595	-	-	ENSG00000197701		0.406	ZNF595-001	KNOWN	basic	processed_transcript	ZNF595	HGNC	protein_coding	OTTHUMT00000357814.2		0.00	35	0	-	NM_182524		85997	+1	tier1		no_errors	ENST00000339368	ensembl	human	known	74_37	rna	33.33	10	5	INS	0.001:0.009	C
ZNF658	26149	genome.wustl.edu	37	9	40789482	40789483	+	Splice_Site	INS	-	-	A			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr9:40789482_40789483insA	ENST00000602553.1	-	2	94		c.e2-2		ZNF658_ENST00000441795.1_Splice_Site|ZNF658_ENST00000377626.3_Intron			Q5TYW1	ZN658_HUMAN	zinc finger protein 658						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTCATGTGCCTAAAAAAAAAAA	0.426																																																	0																																										SO:0001630	splice_region_variant	0			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.201-2->T	9.37:g.40789493_40789493dupA			Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Splice_Site	INS	-	e1-2	ENST00000602553.1	37	c.1-3_4	CCDS35023.1	9																																																																																			ZNF658	-	-	ENSG00000196409		0.426	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	HGNC	protein_coding	OTTHUMT00000467800.1		0.00	23	0	0	NM_033160	Intron	40789483	-1			no_errors	ENST00000602553	ensembl	human	known	74_37	splice_site_ins	33.33	10	5	INS	0.023:0.023	A
ZNF716	441234	genome.wustl.edu	37	7	57529025	57529025	+	Silent	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:57529025C>T	ENST00000420713.1	+	4	970	c.858C>T	c.(856-858)taC>taT	p.Y286Y		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	286					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						TTACTAACTACAAGAGAATTC	0.408																																																	0													41.0	41.0	41.0					7																	57529025		692	1591	2283	SO:0001819	synonymous_variant	0			AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.858C>T	7.37:g.57529025C>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y286	ENST00000420713.1	37	c.858	CCDS55112.1	7																																																																																			ZNF716	-	pfscan_Znf_C2H2	ENSG00000182111		0.408	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	HGNC	protein_coding	OTTHUMT00000345309.1	-	0.00	71	0	C	NM_001159279		57529025	+1	tier1	-	no_errors	ENST00000420713	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.407	T
ZNF783	100289678	genome.wustl.edu	37	7	148991029	148991029	+	IGR	SNP	C	C	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:148991029C>T	ENST00000489518.1	+	0	763				RP4-800G7.2_ENST00000416232.1_RNA			Q6ZMS7	ZN783_HUMAN	zinc finger family member 783						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)	22	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.0014)			CATATGCTTACGATGTGCAAA	0.502																																																	0																																										SO:0001628	intergenic_variant	0			AK131504	CCDS56519.1	7q36.1	2013-01-08	2008-05-28		ENSG00000204946	ENSG00000204946		"""Zinc fingers, C2H2-type"", ""-"""	27222	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001195220		Approved	DKFZp667J212	uc011kuo.2	Q6ZMS7	OTTHUMG00000158969		7.37:g.148991029C>T			C9J9J2	Nonsense_Mutation	SNP	NULL	p.R244*	ENST00000489518.1	37	c.730		7																																																																																			ZNF783	-	NULL	ENSG00000204946		0.502	ZNF783-005	KNOWN	basic	processed_transcript	ZNF783	HGNC	protein_coding	OTTHUMT00000352719.2	-	0.00	20	0	C	NM_001195220		148991029	+1	tier1	-	no_errors	ENST00000481519	ensembl	human	known	74_37	nonsense	22.22	14	4	SNP	0.000	T
ZNF790	388536	genome.wustl.edu	37	19	37309758	37309758	+	Silent	SNP	G	G	A	rs144986787		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:37309758G>A	ENST00000356725.4	-	5	1608	c.1488C>T	c.(1486-1488)caC>caT	p.H496H	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	496					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GAATTTTCTGGTGTCGATTAA	0.388																																																	0													96.0	91.0	92.0					19																	37309758		2203	4300	6503	SO:0001819	synonymous_variant	0			BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.1488C>T	19.37:g.37309758G>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H496	ENST00000356725.4	37	c.1488	CCDS12496.1	19																																																																																			ZNF790	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197863		0.388	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790	HGNC	protein_coding	OTTHUMT00000385341.2	-	0.00	58	0	G	NM_206894		37309758	-1	tier1	-	no_errors	ENST00000356725	ensembl	human	known	74_37	silent	10.64	42	5	SNP	0.996	A
ZNF853	54753	genome.wustl.edu	37	7	6656836	6656836	+	Missense_Mutation	SNP	C	C	T	rs561723875		TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:6656836C>T	ENST00000457543.3	+	2	586	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	10							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						TCCCGGGAATCGGGGTCTGAC	0.637													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18945	0.0		0.0	False		,,,				2504	0.0																0													26.0	33.0	31.0					7																	6656836		692	1591	2283	SO:0001583	missense	0			AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.28C>T	7.37:g.6656836C>T	ENSP00000455585:p.Arg10Trp			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R10W	ENST00000457543.3	37	c.28	CCDS59048.1	7																																																																																			ZNF853	-	NULL	ENSG00000236609		0.637	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF853	HGNC	protein_coding	OTTHUMT00000324169.2	-	0.00	160	0	C	NM_017560		6656836	+1	tier1	-	no_errors	ENST00000457543	ensembl	human	known	74_37	missense	17.86	46	10	SNP	0.000	T
ZNF98	148198	genome.wustl.edu	37	19	22575277	22575277	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr19:22575277T>C	ENST00000357774.5	-	4	881	c.760A>G	c.(760-762)Act>Gct	p.T254A		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TTATGTGTAGTAAGGTGTGAG	0.388																																																	0													2.0	2.0	2.0					19																	22575277		1182	2748	3930	SO:0001583	missense	0				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.760A>G	19.37:g.22575277T>C	ENSP00000350418:p.Thr254Ala			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T254A	ENST00000357774.5	37	c.760	CCDS46031.1	19	.	.	.	.	.	.	.	.	.	.	.	4.873	0.162206	0.09287	.	.	ENSG00000197360	ENST00000357774	T	0.35605	1.3	1.41	-2.82	0.05787	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18045	0.0433	N	0.16790	0.44	0.09310	N	1	B	0.15141	0.012	B	0.17433	0.018	T	0.17228	-1.0376	9	0.39692	T	0.17	.	3.7978	0.08746	0.0:0.2768:0.3443:0.3788	.	254	A6NK75	ZNF98_HUMAN	A	254	ENSP00000350418:T254A	ENSP00000350418:T254A	T	-	1	0	ZNF98	22367117	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	0.447000	0.21710	-1.038000	0.03279	0.254000	0.18369	ACT	ZNF98	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197360		0.388	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF98	HGNC	protein_coding	OTTHUMT00000464398.1	-	0.00	28	0	T	NM_001098626		22575277	-1	tier1	-	no_errors	ENST00000357774	ensembl	human	known	74_37	missense	39.29	17	11	SNP	0.000	C
ZPBP	11055	genome.wustl.edu	37	7	50121489	50121489	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EQ-01A-11D-A36J-09	TCGA-VR-A8EQ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	331f86e1-29ff-42c6-bd8e-773984894438	bbb323d3-ba48-46f1-b6f5-8174dadc4287	g.chr7:50121489G>T	ENST00000046087.2	-	3	284	c.215C>A	c.(214-216)gCg>gAg	p.A72E	ZPBP_ENST00000419417.1_Missense_Mutation_p.A72E	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	72					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.A72V(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					CATGACATACGCTTTCACTGA	0.353																																																	1	Substitution - Missense(1)	large_intestine(1)											109.0	101.0	103.0					7																	50121489		2202	4299	6501	SO:0001583	missense	0			D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.215C>A	7.37:g.50121489G>T	ENSP00000046087:p.Ala72Glu		A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Missense_Mutation	SNP	pfam_Sp38-bd,pfscan_Ig-like_dom	p.A72E	ENST00000046087.2	37	c.215	CCDS5509.1	7	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240697	0.39598	.	.	ENSG00000042813	ENST00000046087;ENST00000419417;ENST00000450231	T;T;T	0.52295	0.67;0.67;1.49	5.1	3.94	0.45596	Immunoglobulin-like (1);	0.285266	0.24334	N	0.039436	T	0.24198	0.0586	N	0.08118	0	0.19575	N	0.999965	B;B	0.24368	0.102;0.102	B;B	0.21151	0.033;0.033	T	0.16188	-1.0411	9	.	.	.	-9.817	8.829	0.35072	0.9121:0.0:0.0879:0.0	.	72;72	C9JPU1;Q9BS86	.;ZPBP1_HUMAN	E	72;72;33	ENSP00000046087:A72E;ENSP00000402071:A72E;ENSP00000390054:A33E	.	A	-	2	0	ZPBP	50092035	0.981000	0.34729	0.929000	0.37066	0.793000	0.44817	3.398000	0.52579	0.780000	0.33566	-0.606000	0.04082	GCG	ZPBP	-	pfscan_Ig-like_dom	ENSG00000042813		0.353	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZPBP	HGNC	protein_coding	OTTHUMT00000251374.1		0.00	45	0	G	NM_007009		50121489	-1			no_errors	ENST00000046087	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.897	T
