#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA1	19	genome.wustl.edu	37	9	107651454	107651454	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:107651454G>A	ENST00000374736.3	-	3	483	c.89C>T	c.(88-90)gCc>gTc	p.A30V	ABCA1_ENST00000374733.1_5'UTR|ABCA1_ENST00000423487.2_Missense_Mutation_p.A30V	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	30					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	TAGAGGCCAGGCCACTTCCAG	0.438																																																	0													65.0	67.0	66.0					9																	107651454		2203	4300	6503	SO:0001583	missense	0			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.89C>T	9.37:g.107651454G>A	ENSP00000363868:p.Ala30Val		Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A30V	ENST00000374736.3	37	c.89	CCDS6762.1	9	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205401	0.39003	.	.	ENSG00000165029	ENST00000374736;ENST00000423487	T;T	0.47177	0.85;0.85	6.01	6.01	0.97437	.	0.204140	0.52532	D	0.000071	T	0.32734	0.0839	N	0.16098	0.37	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.23048	-1.0199	10	0.07813	T	0.8	.	20.5259	0.99229	0.0:0.0:1.0:0.0	.	30	O95477	ABCA1_HUMAN	V	30	ENSP00000363868:A30V;ENSP00000416623:A30V	ENSP00000363868:A30V	A	-	2	0	ABCA1	106691275	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.542000	0.67218	2.845000	0.97973	0.643000	0.83706	GCC	ABCA1	-	NULL	ENSG00000165029		0.438	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1		0.00	45	0	G	NM_005502		107651454	-1			no_errors	ENST00000374736	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	A
ABTB2	25841	genome.wustl.edu	37	11	34186322	34186322	+	Silent	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:34186322G>A	ENST00000435224.2	-	9	2323	c.1899C>T	c.(1897-1899)ccC>ccT	p.P633P	ABTB2_ENST00000298992.2_Silent_p.P447P	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	633					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				TGCTGAGGAGGGGGTCGGCGC	0.637																																																	0													57.0	52.0	54.0					11																	34186322		2202	4298	6500	SO:0001819	synonymous_variant	0			AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.1899C>T	11.37:g.34186322G>A			A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Silent	SNP	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Histone-fold,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.P633	ENST00000435224.2	37	c.1899	CCDS7890.2	11																																																																																			ABTB2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt	ENSG00000166016		0.637	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	HGNC	protein_coding	OTTHUMT00000388703.3	-	0.00	38	0	G	NM_145804		34186322	-1	tier1	-	no_errors	ENST00000435224	ensembl	human	known	74_37	silent	64.52	22	40	SNP	0.896	A
ACSM5	54988	genome.wustl.edu	37	16	20439186	20439186	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:20439186C>A	ENST00000331849.4	+	7	1145	c.998C>A	c.(997-999)aCc>aAc	p.T333N		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	333					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GAGGATCTGACCAGGTACAGC	0.468																																																	0													193.0	169.0	177.0					16																	20439186		2203	4300	6503	SO:0001583	missense	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.998C>A	16.37:g.20439186C>A	ENSP00000327916:p.Thr333Asn		Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.T333N	ENST00000331849.4	37	c.998	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636898	0.47049	.	.	ENSG00000183549	ENST00000331849	T	0.39997	1.05	5.01	2.93	0.34026	AMP-dependent synthetase/ligase (1);	0.444612	0.20979	N	0.082245	T	0.32071	0.0817	L	0.38649	1.16	0.28381	N	0.919547	P	0.34699	0.464	B	0.35182	0.197	T	0.28490	-1.0042	10	0.62326	D	0.03	-22.1545	9.1741	0.37100	0.0:0.6826:0.2334:0.084	.	333	Q6NUN0	ACSM5_HUMAN	N	333	ENSP00000327916:T333N	ENSP00000327916:T333N	T	+	2	0	ACSM5	20346687	0.014000	0.17966	1.000000	0.80357	0.956000	0.61745	0.110000	0.15437	1.223000	0.43536	0.555000	0.69702	ACC	ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.468	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	-	0.00	29	0	C	NM_017888		20439186	+1	tier1	-	no_errors	ENST00000331849	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.999	A
ACTN4	81	genome.wustl.edu	37	19	39218932	39218932	+	Intron	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:39218932G>T	ENST00000252699.2	+	19	2494				ACTN4_ENST00000424234.2_Intron|ACTN4_ENST00000497637.1_Intron|ACTN4_ENST00000390009.3_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4						actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGCCTCCTCTGCTATGCCTGC	0.632																																					Colon(168;199 1940 10254 46213 46384)												0																																										SO:0001627	intron_variant	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.2418+266G>T	19.37:g.39218932G>T			A4K467|D6PXK4|O76048	RNA	SNP	-	NULL	ENST00000252699.2	37	NULL	CCDS12518.1	19																																																																																			ACTN4	-	-	ENSG00000130402		0.632	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	-	0.00	30	0	G			39218932	+1	tier1	-	no_errors	ENST00000477174	ensembl	human	putative	74_37	rna	11.11	32	4	SNP	1.000	T
ADAM30	11085	genome.wustl.edu	37	1	120438761	120438761	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:120438761G>A	ENST00000369400.1	-	1	357	c.199C>T	c.(199-201)Cag>Tag	p.Q67*		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	67					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		CCTTTTAACTGCAGTAGGTAG	0.542																																																	0													86.0	79.0	81.0					1																	120438761		2203	4300	6503	SO:0001587	stop_gained	0			AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.199C>T	1.37:g.120438761G>A	ENSP00000358407:p.Gln67*		A8K8W8|Q5T3X6|Q9UKF1	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q67*	ENST00000369400.1	37	c.199	CCDS907.1	1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245449	0.39697	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	.	.	.	4.75	0.53	0.17102	.	1.252050	0.05968	N	0.641867	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	7.8727	0.29576	0.0:0.1469:0.428:0.4251	.	.	.	.	X	67	.	ENSP00000358407:Q67X	Q	-	1	0	ADAM30	120240284	0.000000	0.05858	0.019000	0.16419	0.006000	0.05464	-0.277000	0.08502	-0.048000	0.13401	-0.519000	0.04390	CAG	ADAM30	-	pfam_Peptidase_M12B_N	ENSG00000134249		0.542	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM30	HGNC	protein_coding	OTTHUMT00000033678.1		0.00	20	0	G	NM_021794		120438761	-1			no_errors	ENST00000369400	ensembl	human	known	74_37	nonsense	13.79	25	4	SNP	0.058	A
ALPP	250	genome.wustl.edu	37	2	233244328	233244328	+	Missense_Mutation	SNP	C	C	A	rs374101037		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:233244328C>A	ENST00000392027.2	+	4	684	c.415C>A	c.(415-417)Cgc>Agc	p.R139S	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	139					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TGCAGCCGCCCGCTTTAACCA	0.607																																																	0													48.0	43.0	45.0					2																	233244328		2202	4277	6479	SO:0001583	missense	0			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.415C>A	2.37:g.233244328C>A	ENSP00000375881:p.Arg139Ser		P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.R139S	ENST00000392027.2	37	c.415	CCDS2490.1	2	.	.	.	.	.	.	.	.	.	.	.	0.667	-0.803575	0.02841	.	.	ENSG00000163283	ENST00000392027	D	0.95622	-3.76	2.31	2.31	0.28768	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.728428	0.13701	N	0.368842	D	0.93177	0.7827	L	0.43554	1.36	0.32234	N	0.573602	P	0.48294	0.908	P	0.52189	0.692	D	0.90033	0.4136	10	0.22109	T	0.4	.	4.9408	0.13965	0.2179:0.5245:0.2576:0.0	.	139	P05187	PPB1_HUMAN	S	139	ENSP00000375881:R139S	ENSP00000375881:R139S	R	+	1	0	ALPP	232952572	0.000000	0.05858	0.087000	0.20705	0.140000	0.21249	0.146000	0.16180	1.289000	0.44618	0.298000	0.19748	CGC	ALPP	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase	ENSG00000163283		0.607	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	HGNC	protein_coding	OTTHUMT00000257032.3		0.00	52	0	C	NM_001632		233244328	+1			no_errors	ENST00000392027	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.973	A
ALPI	248	genome.wustl.edu	37	2	233322349	233322349	+	Silent	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:233322349C>T	ENST00000295463.3	+	6	800	c.723C>T	c.(721-723)agC>agT	p.S241S		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	241					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CTGATGCCAGCCAGAATGGAA	0.622																																																	0													62.0	63.0	63.0					2																	233322349		2203	4300	6503	SO:0001819	synonymous_variant	0			M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.723C>T	2.37:g.233322349C>T			B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Silent	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.S241	ENST00000295463.3	37	c.723	CCDS2492.1	2																																																																																			ALPI	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase	ENSG00000163295		0.622	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPI	HGNC	protein_coding	OTTHUMT00000257035.2		0.00	110	0	C	NM_001631		233322349	+1			no_errors	ENST00000295463	ensembl	human	known	74_37	silent	5.77	49	3	SNP	0.000	T
AMH	268	genome.wustl.edu	37	19	2250424	2250424	+	Silent	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:2250424C>T	ENST00000221496.4	+	2	523	c.501C>T	c.(499-501)taC>taT	p.Y167Y	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	167			Y -> C (in PMDS1). {ECO:0000269|PubMed:8162013}.		aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTGCTGTACCCTGGGCCTG	0.726									Persistant Mullerian Duct Syndrome (type I and II)																																								0													10.0	12.0	11.0					19																	2250424		2146	4238	6384	SO:0001819	synonymous_variant	0	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.501C>T	19.37:g.2250424C>T			O75246|Q6GTN3	Silent	SNP	pfam_AMH_N,pfam_TGF-b_C,smart_TGF-b_C,pirsf_Muellerian-inhibiting_factor	p.Y167	ENST00000221496.4	37	c.501	CCDS12085.1	19																																																																																			AMH	-	pfam_AMH_N,pirsf_Muellerian-inhibiting_factor	ENSG00000104899		0.726	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMH	HGNC	protein_coding	OTTHUMT00000451276.3	-	0.00	44	0	C	NM_000479		2250424	+1	tier1	-	no_errors	ENST00000221496	ensembl	human	known	74_37	silent	32.69	35	17	SNP	0.988	T
GMPPB	29925	genome.wustl.edu	37	3	49755552	49755552	+	3'UTR	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:49755552G>A	ENST00000480687.1	-	0	4832				AMIGO3_ENST00000535833.1_Silent_p.S449S|AMIGO3_ENST00000320431.7_Silent_p.S449S|RNF123_ENST00000327697.6_Intron|RNF123_ENST00000497099.1_3'UTR|RNF123_ENST00000433785.1_Intron			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCTTGTGGACGCTGGCCTTGC	0.647																																																	0													86.0	81.0	82.0					3																	49755552		2203	4299	6502	SO:0001624	3_prime_UTR_variant	0			AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*3633C>T	3.37:g.49755552G>A			A8K6N5|Q9H7U3	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S449	ENST00000480687.1	37	c.1347	CCDS2803.1	3																																																																																			AMIGO3	-	NULL	ENSG00000176020		0.647	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO3	HGNC	protein_coding	OTTHUMT00000350291.1	-	0.00	55	0	G	NM_013334		49755552	-1	tier1	-	no_errors	ENST00000320431	ensembl	human	known	74_37	silent	12.00	22	3	SNP	0.913	A
APEX2	27301	genome.wustl.edu	37	X	55030234	55030234	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chrX:55030234A>T	ENST00000374987.3	+	5	638	c.572A>T	c.(571-573)cAt>cTt	p.H191L	APEX2_ENST00000471758.1_3'UTR	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	191					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						TTTTTCAGCCATGTGATCATT	0.552								Other BER factors																																									0													120.0	86.0	97.0					X																	55030234		2203	4300	6503	SO:0001583	missense	0			AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.572A>T	X.37:g.55030234A>T	ENSP00000364126:p.His191Leu		Q9Y5X7	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Znf_GRF,superfamily_Endo/exonuclease/phosphatase,tigrfam_AP_endonuc_1	p.H191L	ENST00000374987.3	37	c.572	CCDS14365.1	X	.	.	.	.	.	.	.	.	.	.	A	24.7	4.560794	0.86335	.	.	ENSG00000169188	ENST00000374987	T	0.80738	-1.41	4.86	4.86	0.63082	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	D	0.87724	0.6249	M	0.76574	2.34	0.80722	D	1	D	0.67145	0.996	D	0.64410	0.925	D	0.88857	0.3323	10	0.62326	D	0.03	-19.8984	12.9858	0.58592	1.0:0.0:0.0:0.0	.	191	Q9UBZ4	APEX2_HUMAN	L	191	ENSP00000364126:H191L	ENSP00000364126:H191L	H	+	2	0	APEX2	55046959	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.666000	0.83877	1.869000	0.54173	0.441000	0.28932	CAT	APEX2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_AP_endonuc_1	ENSG00000169188		0.552	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX2	HGNC	protein_coding	OTTHUMT00000056845.1	-	0.00	25	0	A			55030234	+1	tier1	-	no_errors	ENST00000374987	ensembl	human	known	74_37	missense	75.00	5	15	SNP	1.000	T
APOBEC3F	200316	genome.wustl.edu	37	22	39448625	39448625	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr22:39448625G>T	ENST00000308521.5	+	7	1404	c.1047G>T	c.(1045-1047)gaG>gaT	p.E349D	APOBEC3G_ENST00000452957.2_Intron	NM_145298.5	NP_660341.2	Q8IUX4	ABC3F_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F	349					base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|skin(2)	16	Melanoma(58;0.04)					ATGATGATGAGCCATTCAAGC	0.473																																																	0													185.0	186.0	185.0					22																	39448625		2203	4300	6503	SO:0001583	missense	0			BC038808	CCDS33648.1, CCDS33649.1	22q13.1-q13.2	2008-05-15			ENSG00000128394	ENSG00000128394		"""Apolipoprotein B mRNA editing enzymes"""	17356	protein-coding gene	gene with protein product		608993				11863358, 17121840	Standard	NM_145298		Approved	ARP8, BK150C2.4.MRNA, KA6	uc003aww.3	Q8IUX4	OTTHUMG00000151080	ENST00000308521.5:c.1047G>T	22.37:g.39448625G>T	ENSP00000309749:p.Glu349Asp		B0QYD4|Q45F03|Q6ICH3|Q7Z2N2|Q7Z2N5	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.E349D	ENST00000308521.5	37	c.1047	CCDS33648.1	22	.	.	.	.	.	.	.	.	.	.	.	12.79	2.044618	0.36085	.	.	ENSG00000128394	ENST00000308521	T	0.64085	-0.08	2.79	-4.78	0.03209	APOBEC-like, C-terminal (1);Cytidine deaminase-like (1);	.	.	.	.	T	0.44052	0.1275	L	0.52759	1.655	0.09310	N	1	P	0.44521	0.837	B	0.40066	0.318	T	0.37337	-0.9710	9	0.23302	T	0.38	.	1.3834	0.02235	0.3049:0.1441:0.4046:0.1464	.	349	Q8IUX4	ABC3F_HUMAN	D	349	ENSP00000309749:E349D	ENSP00000309749:E349D	E	+	3	2	APOBEC3F	37778571	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.158000	0.10070	-0.816000	0.04340	-0.526000	0.04340	GAG	APOBEC3F	-	pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	ENSG00000128394		0.473	APOBEC3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3F	HGNC	protein_coding	OTTHUMT00000321216.1	-	0.00	47	0	G	NM_145298		39448625	+1	tier1	-	no_errors	ENST00000308521	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.000	T
APPBP2	10513	genome.wustl.edu	37	17	58524943	58524943	+	Nonstop_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:58524943C>A	ENST00000083182.3	-	13	2044	c.1757G>T	c.(1756-1758)tGa>tTa	p.*586L		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	0					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)	p.*586*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			GGTCCTCCCTCAGCAGCTCGG	0.493																																																	1	Substitution - coding silent(1)	lung(1)											94.0	96.0	95.0					17																	58524943		2203	4300	6503	SO:0001578	stop_lost	0			AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.1757G>T	17.37:g.58524943C>A			A8K862|O95095|Q8WVC9	Nonstop_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.*586L	ENST00000083182.3	37	c.1757	CCDS32699.1	17	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190056	0.38707	.	.	ENSG00000062725	ENST00000083182	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5648	0.27872	0.0:0.8061:0.0:0.1939	.	.	.	.	L	586	.	.	X	-	2	2	APPBP2	55879725	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.600000	0.46240	2.730000	0.93505	0.655000	0.94253	TGA	APPBP2	-	NULL	ENSG00000062725		0.493	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPBP2	HGNC	protein_coding	OTTHUMT00000449465.1	-	0.00	79	0	C	NM_006380		58524943	-1	tier1	-	no_errors	ENST00000083182	ensembl	human	known	74_37	nonstop	9.20	79	8	SNP	1.000	A
ARL6IP6	151188	genome.wustl.edu	37	2	153616651	153616651	+	3'UTR	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:153616651C>A	ENST00000326446.5	+	0	1689				ARL6IP6_ENST00000463690.1_3'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						TTGTAGGAAACATTTTAATGG	0.289																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901	ENST00000326446.5:c.*297C>A	2.37:g.153616651C>A			B2RDS6|Q7Z4G7	RNA	SNP	-	NULL	ENST00000326446.5	37	NULL	CCDS2197.1	2																																																																																			ARL6IP6	-	-	ENSG00000177917		0.289	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP6	HGNC	protein_coding	OTTHUMT00000254852.3	-	0.00	73	0	C	NM_152522		153616651	+1	tier1	-	no_errors	ENST00000495469	ensembl	human	known	74_37	rna	32.61	31	15	SNP	0.012	A
ARPC4	10093	genome.wustl.edu	37	3	9845219	9845219	+	Intron	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:9845219G>A	ENST00000397261.3	+	5	894				ARPC4_ENST00000433034.1_Intron|ARPC4_ENST00000498623.2_Intron|ARPC4-TTLL3_ENST00000397256.1_Intron|ARPC4_ENST00000287613.7_Intron	NM_005718.4	NP_005709.1	P59998	ARPC4_HUMAN	actin related protein 2/3 complex, subunit 4, 20kDa						actin filament polymerization (GO:0030041)|actin nucleation (GO:0045010)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|lung(1)	2	Medulloblastoma(99;0.227)					tgtttgattagattattctgt	0.428																																																	0																																										SO:0001627	intron_variant	0			AF019888	CCDS43047.1, CCDS46743.1, CCDS56238.1	3p25	2011-07-06	2002-08-29		ENSG00000241553	ENSG00000241553		"""Actin related protein 2/3 complex subunits"""	707	protein-coding gene	gene with protein product	"""Arp2/3 protein complex subunit p20"", ""actin related protein 2/3 complex, subunit 4 (20 kD)"""	604226	"""actin related protein 2/3 complex, subunit 4 (20 kD)"""			9230079, 9359840	Standard	NM_005718		Approved	p20-Arc, ARC20		P59998	OTTHUMG00000133768	ENST00000397261.3:c.331-308G>A	3.37:g.9845219G>A			C9JWM7|E7ETI0|F6TTL5|O15509|Q6P0W5|Q96QJ3	Splice_Site	SNP	-	e5-1	ENST00000397261.3	37	c.331-1	CCDS43047.1	3																																																																																			ARPC4	-	-	ENSG00000241553		0.428	ARPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC4	HGNC	protein_coding	OTTHUMT00000258275.2	-	0.00	51	0	G	NM_001024959		9845219	+1	tier1	-	no_errors	ENST00000440787	ensembl	human	known	74_37	splice_site	15.65	124	23	SNP	0.000	A
ASH1L	55870	genome.wustl.edu	37	1	155319190	155319190	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:155319190C>A	ENST00000368346.3	-	19	8136	c.7497G>T	c.(7495-7497)caG>caT	p.Q2499H	ASH1L_ENST00000392403.3_Missense_Mutation_p.Q2494H|MIR555_ENST00000384987.1_RNA			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2499	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CAGTGAGGATCTGCTTCTCTA	0.418																																																	0													98.0	96.0	96.0					1																	155319190		2203	4300	6503	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.7497G>T	1.37:g.155319190C>A	ENSP00000357330:p.Gln2499His		Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.Q2499H	ENST00000368346.3	37	c.7497		1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.999023	0.35226	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	T;T	0.18502	2.21;2.21	4.8	1.88	0.25563	Bromodomain (5);	0.189033	0.48767	D	0.000175	T	0.10465	0.0256	L	0.29908	0.895	0.80722	D	1	P;P	0.51933	0.949;0.937	P;P	0.55999	0.789;0.684	T	0.05616	-1.0874	10	0.56958	D	0.05	.	7.6748	0.28480	0.0:0.7132:0.1353:0.1515	.	2499;2494	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	H	2499;2494	ENSP00000357330:Q2499H;ENSP00000376204:Q2494H	ENSP00000357330:Q2499H	Q	-	3	2	ASH1L	153585814	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	2.162000	0.42367	0.236000	0.21180	0.555000	0.69702	CAG	ASH1L	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000116539		0.418	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	-	0.00	59	0	C	NM_018489		155319190	-1	tier1	-	no_errors	ENST00000368346	ensembl	human	known	74_37	missense	64.71	18	33	SNP	1.000	A
ASPN	54829	genome.wustl.edu	37	9	95237021	95237021	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:95237021G>C	ENST00000375544.3	-	2	402	c.159C>G	c.(157-159)gaC>gaG	p.D53E	CENPP_ENST00000375587.3_Intron|ASPN_ENST00000450139.2_Missense_Mutation_p.D25E|ASPN_ENST00000375543.1_Missense_Mutation_p.D53E|ASPN_ENST00000395538.3_Missense_Mutation_p.D53E	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	53	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						AAAGAGAGTTGTCCtcatcat	0.403																																																	0													111.0	104.0	106.0					9																	95237021		2203	4300	6503	SO:0001583	missense	0			AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.159C>G	9.37:g.95237021G>C	ENSP00000364694:p.Asp53Glu		Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pirsf_SLRP_I_decor/aspor/byglycan	p.D53E	ENST00000375544.3	37	c.159		9	.	.	.	.	.	.	.	.	.	.	G	0.370	-0.934729	0.02340	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538;ENST00000450139	T;T;T	0.53640	0.61;1.12;1.12	5.02	-1.45	0.08828	.	0.516121	0.18712	N	0.133276	T	0.36608	0.0973	M	0.61703	1.905	0.21841	N	0.999514	B;B	0.17465	0.001;0.022	B;B	0.09377	0.001;0.004	T	0.25257	-1.0137	10	0.23302	T	0.38	.	7.0645	0.25143	0.3097:0.1088:0.5815:0.0	.	53;53	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	E	53;53;53;25	ENSP00000364694:D53E;ENSP00000364693:D53E;ENSP00000378909:D53E	ENSP00000364693:D53E	D	-	3	2	ASPN	94276842	0.447000	0.25673	0.003000	0.11579	0.040000	0.13550	0.244000	0.18124	-0.502000	0.06596	-0.122000	0.15005	GAC	ASPN	-	pirsf_SLRP_I_decor/aspor/byglycan	ENSG00000106819		0.403	ASPN-001	KNOWN	basic|appris_principal	protein_coding	ASPN	HGNC	protein_coding	OTTHUMT00000053094.1		0.00	44	0	G	NM_017680		95237021	-1			no_errors	ENST00000375544	ensembl	human	known	74_37	missense	13.95	37	6	SNP	0.936	C
ATP2B2	491	genome.wustl.edu	37	3	10377897	10377897	+	Intron	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:10377897C>T	ENST00000352432.4	-	21	3490				ATP2B2_ENST00000360273.2_Intron|ATP2B2_ENST00000343816.4_Intron|ATP2B2_ENST00000467702.2_5'UTR|ATP2B2_ENST00000397077.1_Intron|ATP2B2_ENST00000383800.4_Intron			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2						auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						AGATTGGCTACATCCTGGCTC	0.582																																					Ovarian(125;1619 1709 15675 19819 38835)												0																																										SO:0001627	intron_variant	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.3420+1962G>A	3.37:g.10377897C>T			O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATP_Ca_trans_C,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.V1125I	ENST00000352432.4	37	c.3373	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410442	0.83340	.	.	ENSG00000157087	ENST00000342354	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	T	0.66327	0.2778	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60880	-0.7175	5	0.19147	T	0.46	.	17.9956	0.89182	0.0:1.0:0.0:0.0	.	.	.	.	I	1170	.	ENSP00000342954:V1170I	V	-	1	0	ATP2B2	10352897	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.814000	0.86154	2.234000	0.73211	0.561000	0.74099	GTA	ATP2B2	-	pfam_ATP_Ca_trans_C	ENSG00000157087		0.582	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	-	0.00	96	0	C	NM_001683		10377897	-1	tier1	-	no_errors	ENST00000460129	ensembl	human	known	74_37	missense	34.02	159	82	SNP	1.000	T
ATP8A1	10396	genome.wustl.edu	37	4	42457409	42457409	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:42457409G>T	ENST00000381668.5	-	29	2953	c.2722C>A	c.(2722-2724)Ctt>Att	p.L908I	ATP8A1_ENST00000264449.10_Missense_Mutation_p.L893I	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	908					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.L908V(1)|p.L893V(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	AATATTCCAAGAGTTAAAGGA	0.403																																																	2	Substitution - Missense(2)	lung(2)											150.0	142.0	145.0					4																	42457409		2203	4300	6503	SO:0001583	missense	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.2722C>A	4.37:g.42457409G>T	ENSP00000371084:p.Leu908Ile		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L908I	ENST00000381668.5	37	c.2722	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723234	0.30503	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	D;D	0.93547	-3.24;-3.24	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000015	D	0.89326	0.6683	N	0.21142	0.635	0.80722	D	1	B;B;B	0.21606	0.058;0.018;0.018	B;B;B	0.29077	0.098;0.021;0.021	D	0.84809	0.0789	10	0.24483	T	0.36	.	18.8625	0.92278	0.0:0.0:1.0:0.0	.	893;908;900	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	I	908;893	ENSP00000371084:L908I;ENSP00000264449:L893I	ENSP00000264449:L893I	L	-	1	0	ATP8A1	42152166	1.000000	0.71417	0.984000	0.44739	0.938000	0.57974	6.155000	0.71833	2.509000	0.84616	0.557000	0.71058	CTT	ATP8A1	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.403	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2		0.00	35	0	G	NM_006095		42457409	-1			no_errors	ENST00000381668	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
B3GNT1	11041	genome.wustl.edu	37	11	66114717	66114717	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:66114717G>T	ENST00000311181.4	-	1	446	c.300C>A	c.(298-300)caC>caA	p.H100Q	BRMS1_ENST00000359957.3_5'Flank|BRMS1_ENST00000425825.2_5'Flank|RP11-867G23.8_ENST00000531602.1_5'Flank	NM_006876.2	NP_006867.1	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1	100					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			breast(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	12						CCACGCTGGCGTGCGTGGCCA	0.677																																																	0													26.0	20.0	22.0					11																	66114717		2179	4278	6457	SO:0001583	missense	0			AF029893	CCDS8136.1	11q13.2	2014-07-08	2006-04-12	2006-04-12	ENSG00000174684	ENSG00000174684	2.4.1.149	"""Beta 3-glycosyltransferases"""	15685	protein-coding gene	gene with protein product	"""N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase"""	605517	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6"""	B3GNT6		9405606	Standard	NM_006876		Approved	iGNT, iGAT, iGnT, BETA3GNTI, B3GN-T1	uc001ohr.3	O43505	OTTHUMG00000167082	ENST00000311181.4:c.300C>A	11.37:g.66114717G>T	ENSP00000309096:p.His100Gln		Q4TTN0	Missense_Mutation	SNP	NULL	p.H100Q	ENST00000311181.4	37	c.300	CCDS8136.1	11	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172657	0.38413	.	.	ENSG00000174684	ENST00000311181	T	0.23950	1.88	5.18	1.14	0.20703	.	0.000000	0.85682	D	0.000000	T	0.10423	0.0255	N	0.02665	-0.54	0.54753	D	0.999986	P	0.35242	0.492	B	0.43658	0.426	T	0.24548	-1.0157	10	0.02654	T	1	-38.7949	8.6889	0.34254	0.3281:0.0:0.6719:0.0	.	100	O43505	B3GN1_HUMAN	Q	100	ENSP00000309096:H100Q	ENSP00000309096:H100Q	H	-	3	2	B3GNT1	65871293	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	1.391000	0.34475	0.020000	0.15106	0.462000	0.41574	CAC	B3GNT1	-	NULL	ENSG00000174684		0.677	B3GNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT1	HGNC	protein_coding	OTTHUMT00000392959.1		0.00	71	0	G	NM_006876		66114717	-1			no_errors	ENST00000311181	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
B4GALT7	11285	genome.wustl.edu	37	5	177035912	177035912	+	Splice_Site	DEL	T	T	-			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:177035912delT	ENST00000029410.5	+	5	836	c.725delT	c.(724-726)ctt>ct	p.L242fs	RP11-1277A3.1_ENST00000499900.2_RNA	NM_007255.2	NP_009186.1	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7	242					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|chondroitin sulfate metabolic process (GO:0030204)|extracellular fibril organization (GO:0043206)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of fibroblast proliferation (GO:0048147)|protein N-linked glycosylation (GO:0006487)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|manganese ion binding (GO:0030145)|xylosylprotein 4-beta-galactosyltransferase activity (GO:0046525)			endometrium(2)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	7	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTCCCTAGCTTTTCCGCCCC	0.622																																																	0													68.0	67.0	68.0					5																	177035912		2203	4300	6503	SO:0001630	splice_region_variant	0			AB028600	CCDS4429.1	5q35.1-q35.3	2013-02-19	2012-07-18		ENSG00000027847	ENSG00000027847		"""Beta 4-glycosyltransferases"""	930	protein-coding gene	gene with protein product	"""galactosyltransferase I"""	604327				10438455, 10473568	Standard	NM_007255		Approved	XGALT-1, beta4Gal-T7	uc003mhy.3	Q9UBV7	OTTHUMG00000130851	ENST00000029410.5:c.724-1T>-	5.37:g.177035912delT			B3KN39|Q9UHN2	Frame_Shift_Del	DEL	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.F243fs	ENST00000029410.5	37	c.725	CCDS4429.1	5																																																																																			B4GALT7	-	pfam_Galactosyl_T_C	ENSG00000027847		0.622	B4GALT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT7	HGNC	protein_coding	OTTHUMT00000253421.1		0.00	35	0	T	NM_007255	Frame_Shift_Del	177035912	+1	tier1		no_errors	ENST00000029410	ensembl	human	known	74_37	frame_shift_del	9.38	29	3	DEL	1.000	-
BAHD1	22893	genome.wustl.edu	37	15	40750706	40750706	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:40750706G>T	ENST00000416165.1	+	2	114	c.43G>T	c.(43-45)Ggc>Tgc	p.G15C	BAHD1_ENST00000560846.1_Missense_Mutation_p.G15C|BAHD1_ENST00000561234.1_Missense_Mutation_p.G15C	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	15					heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		GCTGAGTTCGGGCCTCACTGG	0.607																																																	0													93.0	91.0	91.0					15																	40750706		2203	4300	6503	SO:0001583	missense	0			AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.43G>T	15.37:g.40750706G>T	ENSP00000396976:p.Gly15Cys		Q8NDF7|Q9Y2F4	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.G15C	ENST00000416165.1	37	c.43	CCDS10058.1	15	.	.	.	.	.	.	.	.	.	.	G	16.16	3.043739	0.55003	.	.	ENSG00000140320	ENST00000416165	T	0.20200	2.09	5.14	4.18	0.49190	.	0.091963	0.46758	D	0.000266	T	0.25901	0.0631	N	0.08118	0	0.30296	N	0.789906	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.72075	0.976;0.946;0.976	T	0.12400	-1.0549	10	0.56958	D	0.05	-23.0064	15.3115	0.74035	0.0:0.1513:0.8487:0.0	.	15;15;15	Q8TBE0-3;Q8TBE0;Q8TBE0-2	.;BAHD1_HUMAN;.	C	15	ENSP00000396976:G15C	ENSP00000396976:G15C	G	+	1	0	BAHD1	38537998	0.995000	0.38212	0.844000	0.33320	0.965000	0.64279	2.385000	0.44371	2.668000	0.90789	0.655000	0.94253	GGC	BAHD1	-	NULL	ENSG00000140320		0.607	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAHD1	HGNC	protein_coding	OTTHUMT00000252248.1	-	0.00	66	0	G	NM_014952		40750706	+1	tier1	-	no_errors	ENST00000416165	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.710	T
BCKDHB	594	genome.wustl.edu	37	6	80877472	80877472	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:80877472G>T	ENST00000320393.6	+	4	468	c.421G>T	c.(421-423)Gct>Tct	p.A141S	BCKDHB_ENST00000545529.1_Missense_Mutation_p.A141S|BCKDHB_ENST00000369760.4_Missense_Mutation_p.A141S|BCKDHB_ENST00000356489.5_Missense_Mutation_p.A141S	NM_183050.2	NP_898871.1	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1, beta polypeptide	141					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(1)	15		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		GGTCACTGGAGCTACTGCCAT	0.343																																																	0													101.0	100.0	100.0					6																	80877472		2203	4300	6503	SO:0001583	missense	0			M55575	CCDS4994.1	6q14.1	2008-07-31	2008-07-31		ENSG00000083123	ENSG00000083123			987	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	248611					Standard	NM_183050		Approved		uc003pje.2	P21953	OTTHUMG00000016430	ENST00000320393.6:c.421G>T	6.37:g.80877472G>T	ENSP00000318351:p.Ala141Ser		Q5T2J3|Q9BQL0	Missense_Mutation	SNP	pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.A141S	ENST00000320393.6	37	c.421	CCDS4994.1	6	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544657	0.45280	.	.	ENSG00000083123	ENST00000369760;ENST00000320393;ENST00000356489;ENST00000545529;ENST00000541767	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	4.81	4.81	0.61882	Transketolase-like, pyrimidine-binding domain (2);	0.047315	0.85682	D	0.000000	T	0.81978	0.4937	N	0.25380	0.74	0.80722	D	1	B	0.15930	0.015	B	0.19946	0.027	T	0.77560	-0.2542	10	0.29301	T	0.29	-22.4018	17.2392	0.87008	0.0:0.0:1.0:0.0	.	141	P21953	ODBB_HUMAN	S	141;141;141;141;71	ENSP00000358775:A141S;ENSP00000318351:A141S;ENSP00000348880:A141S;ENSP00000443564:A141S	ENSP00000318351:A141S	A	+	1	0	BCKDHB	80934191	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	9.458000	0.97634	2.377000	0.81083	0.585000	0.79938	GCT	BCKDHB	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd	ENSG00000083123		0.343	BCKDHB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BCKDHB	HGNC	protein_coding	OTTHUMT00000043911.2	-	0.00	46	0	G	NM_000056		80877472	+1	tier1	-	no_errors	ENST00000320393	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
BPTF	2186	genome.wustl.edu	37	17	65850689	65850689	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:65850689G>T	ENST00000321892.4	+	2	1308	c.1247G>T	c.(1246-1248)tGt>tTt	p.C416F	BPTF_ENST00000424123.3_Missense_Mutation_p.C277F|BPTF_ENST00000335221.5_Missense_Mutation_p.C416F|BPTF_ENST00000306378.6_Missense_Mutation_p.C416F			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	416					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CATTTGGAATGTGTGAAGCCA	0.483																																																	0													234.0	216.0	223.0					17																	65850689		2203	4300	6503	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.1247G>T	17.37:g.65850689G>T	ENSP00000315454:p.Cys416Phe		Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.C416F	ENST00000321892.4	37	c.1247		17	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191827	0.58017	.	.	ENSG00000171634	ENST00000544491;ENST00000306378;ENST00000335221;ENST00000321892;ENST00000544778	D;D;D	0.99981	-10.44;-10.44;-10.44	5.62	5.62	0.85841	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	.	.	.	.	D	0.99986	0.9997	H	0.99325	4.515	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.996;0.998	D	0.99965	1.1818	9	0.87932	D	0	.	19.6584	0.95853	0.0:0.0:1.0:0.0	.	416;416;416	Q12830;Q12830-2;Q12830-4	BPTF_HUMAN;.;.	F	321;416;416;416;277	ENSP00000307208:C416F;ENSP00000334351:C416F;ENSP00000315454:C416F	ENSP00000307208:C416F	C	+	2	0	BPTF	63281151	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.869000	0.99810	2.646000	0.89796	0.655000	0.94253	TGT	BPTF	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000171634		0.483	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding			0.00	37	0	G	NM_182641, NM_004459		65850689	+1			no_errors	ENST00000321892	ensembl	human	known	74_37	missense	6.94	67	5	SNP	1.000	T
C12orf40	283461	genome.wustl.edu	37	12	40077922	40077922	+	Intron	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:40077922G>T	ENST00000324616.5	+	9	1440				C12orf40_ENST00000398716.1_Splice_Site|C12orf40_ENST00000405531.3_Intron	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40											breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						TCTTCTTGCAGCTGGTGTACA	0.338																																																	0																																										SO:0001627	intron_variant	0			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1286+636G>T	12.37:g.40077922G>T			B7WNU1|Q8IXY6|Q8N818|V9HW02	Splice_Site	SNP	-	e7-1	ENST00000324616.5	37	c.1056-1	CCDS41770.1	12	.	.	.	.	.	.	.	.	.	.	G	4.270	0.049182	0.08243	.	.	ENSG00000180116	ENST00000398716	.	.	.	2.66	0.738	0.18319	.	.	.	.	.	.	.	.	.	.	.	0.27488	N	0.952375	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.8364	0.08896	0.1492:0.2537:0.5971:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C12orf40	38364189	0.003000	0.15002	0.001000	0.08648	0.016000	0.09150	0.451000	0.21779	0.172000	0.19760	0.563000	0.77884	.	C12orf40	-	-	ENSG00000180116		0.338	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	HGNC	protein_coding	OTTHUMT00000257664.2	-	0.00	44	0	G	NM_173599		40077922	+1	tier1	-	no_errors	ENST00000398716	ensembl	human	known	74_37	splice_site	27.27	24	9	SNP	0.002	T
B3GALT5	10317	genome.wustl.edu	37	21	40969497	40969497	+	Intron	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr21:40969497G>T	ENST00000380620.4	+	2	69				C21orf88_ENST00000489821.1_5'UTR|C21orf88_ENST00000380612.4_3'UTR			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5						protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				tttgcaggtagaattaaggct	0.458																																																	0																																										SO:0001627	intron_variant	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.-523-7524G>T	21.37:g.40969497G>T			A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	RNA	SNP	-	NULL	ENST00000380620.4	37	NULL	CCDS13667.1	21																																																																																			C21orf88	-	-	ENSG00000184809		0.458	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf88	HGNC	protein_coding	OTTHUMT00000195008.2	-	0.00	20	0	G	NM_033170		40969497	-1	tier1	-	no_errors	ENST00000489821	ensembl	human	known	74_37	rna	27.27	8	3	SNP	0.220	T
C4orf19	55286	genome.wustl.edu	37	4	37591834	37591834	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:37591834delA	ENST00000284437.6	+	3	335	c.157delA	c.(157-159)aaafs	p.K53fs	RP11-36B15.1_ENST00000503034.1_RNA|C4orf19_ENST00000381980.4_Frame_Shift_Del_p.K53fs|C4orf19_ENST00000508175.1_Intron	NM_018302.2	NP_060772.2	Q8IY42	CD019_HUMAN	chromosome 4 open reading frame 19	53										large_intestine(1)|lung(3)|skin(3)|stomach(1)|urinary_tract(1)	9						CTTGGTGCAGAAAAATGACCC	0.527																																																	0													138.0	147.0	144.0					4																	37591834		2203	4300	6503	SO:0001589	frameshift_variant	0			BC037906	CCDS3442.1	4p14	2008-02-05			ENSG00000154274	ENSG00000154274			25618	protein-coding gene	gene with protein product						12477932	Standard	NM_001104629		Approved	FLJ11017	uc003gsw.4	Q8IY42	OTTHUMG00000128580	ENST00000284437.6:c.157delA	4.37:g.37591834delA	ENSP00000284437:p.Lys53fs		Q9NV03	Frame_Shift_Del	DEL	NULL	p.N54fs	ENST00000284437.6	37	c.157	CCDS3442.1	4																																																																																			C4orf19	-	NULL	ENSG00000154274		0.527	C4orf19-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C4orf19	HGNC	protein_coding	OTTHUMT00000250432.1		0.00	50	0	A	NM_018302		37591834	+1	tier1		no_errors	ENST00000284437	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	0.000	-
CACNA1H	8912	genome.wustl.edu	37	16	1256131	1256131	+	Silent	SNP	C	C	T	rs59636120	byFrequency	TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:1256131C>T	ENST00000348261.5	+	12	2879	c.2631C>T	c.(2629-2631)gaC>gaT	p.D877D	CACNA1H_ENST00000565831.1_Silent_p.D877D|CACNA1H_ENST00000358590.4_Silent_p.D877D|RP11-616M22.3_ENST00000564700.1_RNA	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	877					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GGCAGGCGGACGGTGGCTTGT	0.692													C|||	34	0.00678914	0.0257	0.0	5008	,	,		14252	0.0		0.0	False		,,,				2504	0.0																0								C	,	72,4052		0,72,1990	15.0	22.0	20.0		2631,2631	-3.4	0.2	16	dbSNP_129	20	1,8355		0,1,4177	no	coding-synonymous,coding-synonymous	CACNA1H	NM_001005407.1,NM_021098.2	,	0,73,6167	TT,TC,CC		0.012,1.7459,0.5849	,	877/2348,877/2354	1256131	73,12407	2062	4178	6240	SO:0001819	synonymous_variant	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.2631C>T	16.37:g.1256131C>T			B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.D877	ENST00000348261.5	37	c.2631	CCDS45375.1	16																																																																																			CACNA1H	-	pfam_Ion_trans_dom	ENSG00000196557		0.692	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1		0.00	21	0	C	NM_001005407		1256131	+1			no_errors	ENST00000348261	ensembl	human	known	74_37	silent	7.89	35	3	SNP	0.975	T
CATSPERB	79820	genome.wustl.edu	37	14	92074645	92074645	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr14:92074645A>T	ENST00000256343.3	-	22	2858	c.2702T>A	c.(2701-2703)aTg>aAg	p.M901K		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	901					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TACCTTTGACATGTGAAACAT	0.303																																																	0													108.0	113.0	111.0					14																	92074645		2203	4299	6502	SO:0001583	missense	0			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2702T>A	14.37:g.92074645A>T	ENSP00000256343:p.Met901Lys		A0AV51	Missense_Mutation	SNP	superfamily_Sialidases	p.M901K	ENST00000256343.3	37	c.2702	CCDS32142.1	14	.	.	.	.	.	.	.	.	.	.	A	0	-2.694945	0.00098	.	.	ENSG00000133962	ENST00000256343	T	0.39056	1.1	5.28	-0.409	0.12378	.	0.871488	0.09944	N	0.735511	T	0.09158	0.0226	N	0.00368	-1.59	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34129	-0.9841	10	0.09338	T	0.73	-2.0981	3.7092	0.08413	0.4003:0.1588:0.0:0.4409	.	901	Q9H7T0	CTSRB_HUMAN	K	901	ENSP00000256343:M901K	ENSP00000256343:M901K	M	-	2	0	CATSPERB	91144398	0.000000	0.05858	0.216000	0.23742	0.102000	0.19082	-0.620000	0.05565	0.066000	0.16515	-1.158000	0.01797	ATG	CATSPERB	-	NULL	ENSG00000133962		0.303	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	HGNC	protein_coding	OTTHUMT00000411769.1	-	0.00	79	0	A	NM_024764		92074645	-1	tier1	-	no_errors	ENST00000256343	ensembl	human	known	74_37	missense	51.35	18	19	SNP	0.031	T
CCDC162P	221262	genome.wustl.edu	37	6	109630693	109630694	+	RNA	INS	-	-	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:109630693_109630694insT	ENST00000422819.1	+	0	854							A2VCL2	CC162_HUMAN	coiled-coil domain containing 162, pseudogene																		AGGTTTTTTTGTTTTTTTTTAG	0.416																																																	0																																												0					6q21	2011-04-28	2011-04-28	2011-04-28	ENSG00000203799	ENSG00000203799			21565	pseudogene	pseudogene			"""chromosome 6 open reading frame 184"", ""chromosome 6 open reading frame 185"""	C6orf184, C6orf185, CCDC162			Standard	NR_028595		Approved	bA425D10.7, bA425D10.3	uc003ptb.1	A2VCL2	OTTHUMG00000015342		6.37:g.109630702_109630702dupT			A1A4V1|A4QMU0|Q5JSU0|Q5JSU7	RNA	INS	-	NULL	ENST00000422819.1	37	NULL		6																																																																																			CCDC162P	-	-	ENSG00000203799		0.416	CCDC162P-002	KNOWN	basic	processed_transcript	CCDC162P	HGNC	pseudogene	OTTHUMT00000365631.1		0.00	30	0	-	NR_028595		109630694	+1	tier1		no_errors	ENST00000506861	ensembl	human	known	74_37	rna	9.68	28	3	INS	0.015:0.086	T
CD27	939	genome.wustl.edu	37	12	6559346	6559346	+	Silent	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:6559346C>A	ENST00000266557.3	+	3	505	c.276C>A	c.(274-276)ctC>ctA	p.L92L	TAPBPL_ENST00000544021.1_5'Flank|CD27-AS1_ENST00000399492.2_RNA|CD27-AS1_ENST00000545339.1_RNA|TAPBPL_ENST00000266556.7_5'Flank|CD27_ENST00000541233.1_3'UTR	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule	92					cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)	p.L92L(1)		kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						CAGGTCTTCTCGTTCGCAACT	0.587																																																	1	Substitution - coding silent(1)	large_intestine(1)											131.0	91.0	105.0					12																	6559346		2203	4300	6503	SO:0001819	synonymous_variant	0			M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.276C>A	12.37:g.6559346C>A			B2RDZ0	Silent	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_7,prints_Fas_rcpt	p.L92	ENST00000266557.3	37	c.276	CCDS8545.1	12																																																																																			CD27	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	ENSG00000139193		0.587	CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD27	HGNC	protein_coding	OTTHUMT00000399258.1		0.00	39	0	C			6559346	+1			no_errors	ENST00000266557	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.029	A
CDC42EP3	10602	genome.wustl.edu	37	2	37873326	37873326	+	Missense_Mutation	SNP	G	G	T	rs144871845		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:37873326G>T	ENST00000295324.3	-	2	1405	c.405C>A	c.(403-405)ttC>ttA	p.F135L	AC006369.2_ENST00000419425.1_RNA	NM_001270436.1|NM_001270437.1|NM_001270438.1|NM_006449.4	NP_001257365.1|NP_001257366.1|NP_001257367.1|NP_006440.2	Q9UKI2	BORG2_HUMAN	CDC42 effector protein (Rho GTPase binding) 3	135					regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	cytoskeletal regulatory protein binding (GO:0005519)			endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	11		all_hematologic(82;0.172)				TTGCTGGCCCGAAGGACTCCT	0.527																																																	0													48.0	49.0	49.0					2																	37873326		2203	4300	6503	SO:0001583	missense	0			AF094521	CCDS1791.1	2p21	2008-05-21			ENSG00000163171	ENSG00000163171			16943	protein-coding gene	gene with protein product		606133				9535835, 11035016	Standard	NM_001270436		Approved	CEP3, UB1, BORG2	uc031rnz.1	Q9UKI2	OTTHUMG00000100971	ENST00000295324.3:c.405C>A	2.37:g.37873326G>T	ENSP00000295324:p.Phe135Leu		B2R8S0|O95353|Q9UQJ0	Missense_Mutation	SNP	pfam_CRIB_dom,smart_CRIB_dom,pfscan_CRIB_dom	p.F135L	ENST00000295324.3	37	c.405	CCDS1791.1	2	.	.	.	.	.	.	.	.	.	.	G	0.026	-1.370632	0.01225	.	.	ENSG00000163171	ENST00000295324;ENST00000457889	T;T	0.28666	1.6;1.6	5.91	-9.21	0.00678	.	0.484899	0.22021	N	0.065725	T	0.09468	0.0233	N	0.16478	0.41	0.24729	N	0.993106	B	0.02656	0.0	B	0.01281	0.0	T	0.25082	-1.0142	10	0.11485	T	0.65	.	3.6558	0.08220	0.3191:0.2017:0.3808:0.0984	.	135	Q9UKI2	BORG2_HUMAN	L	135	ENSP00000295324:F135L;ENSP00000403298:F135L	ENSP00000295324:F135L	F	-	3	2	CDC42EP3	37726830	0.001000	0.12720	0.669000	0.29828	0.569000	0.35902	-1.151000	0.03175	-1.587000	0.01630	-1.140000	0.01884	TTC	CDC42EP3	-	NULL	ENSG00000163171		0.527	CDC42EP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP3	HGNC	protein_coding	OTTHUMT00000218581.3		0.00	22	0	G	NM_006449		37873326	-1			no_errors	ENST00000295324	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.146	T
CDK10	8558	genome.wustl.edu	37	16	89761401	89761401	+	Silent	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:89761401G>T	ENST00000353379.7	+	11	898	c.855G>T	c.(853-855)ctG>ctT	p.L285L	CDK10_ENST00000505473.1_Silent_p.L214L|CDK10_ENST00000331006.8_Silent_p.L238L	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	285	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		ACAACAACCTGAAGCACAAGT	0.622																																																	0													51.0	53.0	52.0					16																	89761401		2198	4300	6498	SO:0001819	synonymous_variant	0			L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.855G>T	16.37:g.89761401G>T			A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L285	ENST00000353379.7	37	c.855	CCDS10984.2	16																																																																																			CDK10	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000185324		0.622	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK10	HGNC	protein_coding	OTTHUMT00000269925.2		0.00	98	0	G			89761401	+1			no_errors	ENST00000353379	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.979	T
CDKL2	8999	genome.wustl.edu	37	4	76522219	76522219	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:76522219G>T	ENST00000429927.2	-	9	1925	c.1222C>A	c.(1222-1224)Cca>Aca	p.P408T	CDKL2_ENST00000307465.4_Missense_Mutation_p.P408T	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	408					sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GCCACGCTTGGATTCCTTGTG	0.483																																																	0													272.0	240.0	250.0					4																	76522219		2203	4300	6503	SO:0001583	missense	0			U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.1222C>A	4.37:g.76522219G>T	ENSP00000412365:p.Pro408Thr		B2R695	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P408T	ENST00000429927.2	37	c.1222	CCDS3570.1	4	.	.	.	.	.	.	.	.	.	.	G	4.824	0.153266	0.09185	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	T;T	0.71698	0.97;-0.59	4.74	1.89	0.25635	.	.	.	.	.	T	0.54127	0.1839	L	0.29908	0.895	0.09310	N	1	B;B	0.34181	0.376;0.44	B;B	0.30401	0.115;0.075	T	0.38308	-0.9667	9	0.42905	T	0.14	-3.0971	7.6162	0.28158	0.0885:0.3132:0.5983:0.0	.	408;408	B4DH08;Q92772	.;CDKL2_HUMAN	T	408	ENSP00000412365:P408T;ENSP00000306340:P408T	ENSP00000306340:P408T	P	-	1	0	CDKL2	76741243	0.339000	0.24784	0.004000	0.12327	0.003000	0.03518	1.295000	0.33377	0.157000	0.19338	0.591000	0.81541	CCA	CDKL2	-	NULL	ENSG00000138769		0.483	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKL2	HGNC	protein_coding	OTTHUMT00000252409.2		0.00	54	0	G	NM_003948		76522219	-1			no_errors	ENST00000429927	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.019	T
CELP	1057	genome.wustl.edu	37	9	135962555	135962556	+	RNA	INS	-	-	CTGC	rs370202675|rs58402826|rs112009079		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:135962555_135962556insCTGC	ENST00000411440.2	+	0	1062_1063					NR_001275.2				carboxyl ester lipase pseudogene																		TGACTCTGAGGCCCGTGCCCAC	0.624																																																	0																																												0			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962555_135962556insCTGC				RNA	INS	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-	ENSG00000170827		0.624	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1		0.00	13	0	-	NM_001808		135962556	+1	tier1		no_errors	ENST00000411440	ensembl	human	known	74_37	rna	38.46	8	5	INS	0.038:0.013	CTGC
CELSR2	1952	genome.wustl.edu	37	1	109814989	109814989	+	Silent	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:109814989G>T	ENST00000271332.3	+	29	8077	c.8016G>T	c.(8014-8016)tcG>tcT	p.S2672S	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2672					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S2672S(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCAGTCGCTCGGGCAAGAGTC	0.657																																					NSCLC(158;1285 2011 34800 34852 42084)												1	Substitution - coding silent(1)	endometrium(1)											73.0	80.0	77.0					1																	109814989		2203	4300	6503	SO:0001819	synonymous_variant	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.8016G>T	1.37:g.109814989G>T			Q5T2Y7|Q92566	Silent	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S2672	ENST00000271332.3	37	c.8016	CCDS796.1	1																																																																																			CELSR2	-	NULL	ENSG00000143126		0.657	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1		0.00	47	0	G	NM_001408		109814989	+1			no_errors	ENST00000271332	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.335	T
CUX1	1523	genome.wustl.edu	37	7	101844825	101844825	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:101844825C>T	ENST00000292535.7	+	18	2286	c.2248C>T	c.(2248-2250)Ccc>Tcc	p.P750S	CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Missense_Mutation_p.P761S|CUX1_ENST00000549414.2_Missense_Mutation_p.P728S|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.P592S|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000550008.2_Missense_Mutation_p.P694S|CUX1_ENST00000546411.2_Missense_Mutation_p.P648S	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	750					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GTCCACCTCGCCCATGCCCAC	0.657																																																	0													133.0	138.0	136.0					7																	101844825		2203	4300	6503	SO:0001583	missense	0			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2248C>T	7.37:g.101844825C>T	ENSP00000292535:p.Pro750Ser		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.P761S	ENST00000292535.7	37	c.2281	CCDS5721.1	7	.	.	.	.	.	.	.	.	.	.	C	9.700	1.154287	0.21371	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.60797	0.23;0.21;0.21;0.18;0.21;0.16	5.44	4.57	0.56435	.	0.276343	0.35677	N	0.003043	T	0.47021	0.1423	L	0.45581	1.43	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.36672	-0.9738	10	0.25751	T	0.34	-15.6025	9.1618	0.37028	0.0:0.655:0.2622:0.0828	.	750;761	P39880;P39880-3	CUX1_HUMAN;.	S	761;750;728;694;648;592	ENSP00000353401:P761S;ENSP00000292535:P750S;ENSP00000446630:P728S;ENSP00000447373:P694S;ENSP00000450125:P648S;ENSP00000451558:P592S	ENSP00000292535:P750S	P	+	1	0	CUX1	101631545	1.000000	0.71417	0.740000	0.30986	0.563000	0.35712	3.847000	0.55895	1.308000	0.44962	-0.140000	0.14226	CCC	CUX1	-	NULL	ENSG00000257923		0.657	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347535.1	-	0.00	43	0	C	NM_001913		101844825	+1	tier1	-	no_errors	ENST00000360264	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.466	T
CNPY1	285888	genome.wustl.edu	37	7	155301672	155301672	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:155301672C>A	ENST00000321736.5	-	2	223	c.61G>T	c.(61-63)Gct>Tct	p.A21S	AC008060.5_ENST00000415333.1_RNA|CNPY1_ENST00000406197.1_Missense_Mutation_p.A21S	NM_001103176.1	NP_001096646.1	Q3B7I2	CNPY1_HUMAN	canopy FGF signaling regulator 1	21								p.A21T(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		TTCCTAGGAGCGAATCTCTTG	0.403																																																	1	Substitution - Missense(1)	large_intestine(1)											79.0	77.0	78.0					7																	155301672		1807	4076	5883	SO:0001583	missense	0				CCDS43684.1	7q36.3	2014-02-12	2013-07-23		ENSG00000146910	ENSG00000146910			27786	protein-coding gene	gene with protein product		612493	"""canopy 1 homolog (zebrafish)"""			16488878	Standard	NM_001103176		Approved		uc003wmc.1	Q3B7I2	OTTHUMG00000151353	ENST00000321736.5:c.61G>T	7.37:g.155301672C>A	ENSP00000317439:p.Ala21Ser		A6NGX3	Missense_Mutation	SNP	pfam_DUF3456	p.A21S	ENST00000321736.5	37	c.61	CCDS43684.1	7	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648637	0.67358	.	.	ENSG00000146910	ENST00000406197;ENST00000321736	T;T	0.33865	1.39;1.39	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.56863	0.2014	.	.	.	0.41089	D	0.985587	D	0.67145	0.996	D	0.66979	0.948	T	0.61705	-0.7008	9	0.66056	D	0.02	-18.8207	11.9379	0.52884	0.0:0.9084:0.0:0.0916	.	21	Q3B7I2	CNPY1_HUMAN	S	21	ENSP00000384514:A21S;ENSP00000317439:A21S	ENSP00000317439:A21S	A	-	1	0	CNPY1	154994433	1.000000	0.71417	0.641000	0.29422	0.676000	0.39594	3.272000	0.51616	2.240000	0.73641	0.557000	0.71058	GCT	CNPY1	-	pfam_DUF3456	ENSG00000146910		0.403	CNPY1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CNPY1	HGNC	protein_coding	OTTHUMT00000322335.1		0.00	40	0	C	XM_001129537		155301672	-1			no_errors	ENST00000321736	ensembl	human	putative	74_37	missense	5.56	34	2	SNP	0.995	A
CYP27B1	1594	genome.wustl.edu	37	12	58158631	58158631	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:58158631C>A	ENST00000228606.4	-	5	1078	c.869G>T	c.(868-870)gGg>gTg	p.G290V	CYP27B1_ENST00000546496.1_5'Flank	NM_000785.3	NP_000776.1	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B, polypeptide 1	290					bone mineralization (GO:0030282)|calcitriol biosynthetic process from calciol (GO:0036378)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|decidualization (GO:0046697)|G1 to G0 transition (GO:0070314)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of bone mineralization (GO:0030500)|response to estrogen (GO:0043627)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	calcidiol 1-monooxygenase activity (GO:0004498)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.G290E(1)		central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|urinary_tract(1)	15	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Alfacalcidol(DB01436)|Calcidiol(DB00146)|Corticotropin(DB01285)|Ergocalciferol(DB00153)	CAGGTGCGCCCCAGACTCCAG	0.627																																																	1	Substitution - Missense(1)	central_nervous_system(1)											97.0	91.0	93.0					12																	58158631		2203	4300	6503	SO:0001583	missense	0			AB006987	CCDS8954.1	12q14.1	2013-11-13	2003-01-14		ENSG00000111012	ENSG00000111012		"""Cytochrome P450s"""	2606	protein-coding gene	gene with protein product	"""VDDR I"", ""1alpha(OH)ase"", ""25-Hydroxyvitamin D3 1alpha-hydroxylase"""	609506	"""cytochrome P450, subfamily XXVIIB (25-hydroxyvitamin D-1-alpha-hydroxylase), polypeptide 1"""	VDD1, PDDR		9295274, 9344864	Standard	NM_000785		Approved	CYP1, P450c1	uc001spz.1	O15528	OTTHUMG00000170457	ENST00000228606.4:c.869G>T	12.37:g.58158631C>A	ENSP00000228606:p.Gly290Val		B2RC61|Q548T3	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.G290V	ENST00000228606.4	37	c.869	CCDS8954.1	12	.	.	.	.	.	.	.	.	.	.	C	16.99	3.274056	0.59649	.	.	ENSG00000111012	ENST00000228606;ENST00000546567	T;T	0.66099	-0.19;-0.19	4.45	4.45	0.53987	.	0.055104	0.64402	D	0.000001	T	0.64605	0.2613	L	0.56396	1.775	0.80722	D	1	B	0.32467	0.372	B	0.41894	0.369	T	0.61456	-0.7059	10	0.23302	T	0.38	.	16.0093	0.80385	0.0:1.0:0.0:0.0	.	290	O15528	CP27B_HUMAN	V	290;55	ENSP00000228606:G290V;ENSP00000449472:G55V	ENSP00000228606:G290V	G	-	2	0	CYP27B1	56444898	0.976000	0.34144	0.627000	0.29227	0.387000	0.30353	2.618000	0.46393	2.319000	0.78375	0.561000	0.74099	GGG	CYP27B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000111012		0.627	CYP27B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP27B1	HGNC	protein_coding	OTTHUMT00000409248.1		0.00	43	0	C	NM_000785		58158631	-1			no_errors	ENST00000228606	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
DCC	1630	genome.wustl.edu	37	18	50918162	50918162	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr18:50918162G>T	ENST00000442544.2	+	17	3209	c.2593G>T	c.(2593-2595)Gca>Tca	p.A865S	DCC_ENST00000412726.1_Missense_Mutation_p.A693S|DCC_ENST00000581580.1_Missense_Mutation_p.A500S	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	865	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GGTCAGCTGGGCAGACAACTC	0.537																																																	0													144.0	129.0	134.0					18																	50918162		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.2593G>T	18.37:g.50918162G>T	ENSP00000389140:p.Ala865Ser			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A865S	ENST00000442544.2	37	c.2593	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009713	0.54361	.	.	ENSG00000187323	ENST00000442544;ENST00000412726	T;T	0.51574	0.7;0.7	5.42	5.42	0.78866	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.62221	0.2410	L	0.58810	1.83	0.58432	D	0.999995	P;P;P	0.51057	0.941;0.941;0.888	D;D;P	0.65874	0.939;0.939;0.892	T	0.54302	-0.8314	10	0.10636	T	0.68	.	18.0078	0.89214	0.0:0.0:1.0:0.0	.	693;693;865	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	S	865;693	ENSP00000389140:A865S;ENSP00000397322:A693S	ENSP00000397322:A693S	A	+	1	0	DCC	49172160	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.682000	0.98655	2.531000	0.85337	0.557000	0.71058	GCA	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187323		0.537	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	33	0	G	NM_005215		50918162	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
DCHS2	54798	genome.wustl.edu	37	4	155244405	155244405	+	Intron	SNP	G	G	T	rs199840326|rs140019361		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:155244405G>T	ENST00000357232.4	-	13	2653				DCHS2_ENST00000339452.1_Missense_Mutation_p.N1365K	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		tCAGGATtttgtttgtttgtt	0.378																																																	0													78.0	42.0	53.0					4																	155244405		692	1591	2283	SO:0001627	intron_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.2654-765C>A	4.37:g.155244405G>T			B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N1365K	ENST00000357232.4	37	c.4095	CCDS3785.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.197|3.197	-0.164472|-0.164472	0.06502|0.06502	.|.	.|.	ENSG00000197410|ENSG00000197410	ENST00000339452|ENST00000544161	T|.	0.56275|.	0.47|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.18676|0.18676	0.0448|0.0448	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B|.	0.19200|.	0.034|.	B|.	0.06405|.	0.002|.	T|T	0.28364|0.28364	-1.0046|-1.0046	7|3	0.21540|.	T|.	0.41|.	.|.	.|.	.|.	.|.	.|.	1365|.	E9PC11|.	.|.	K|K	1365|1364	ENSP00000345062:N1365K|.	ENSP00000345062:N1365K|.	N|T	-|-	3|2	2|0	DCHS2|DCHS2	155463855|155463855	.|.	.|.	0.009000|0.009000	0.14445|0.14445	0.024000|0.024000	0.10985|0.10985	.|.	.|.	0.000000|0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	AAC|ACA	DCHS2	-	NULL	ENSG00000197410		0.378	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2		0.00	29	0	G	NM_001142552		155244405	-1			no_errors	ENST00000339452	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.009	T
DCP1A	55802	genome.wustl.edu	37	3	53326271	53326271	+	Missense_Mutation	SNP	T	T	C	rs375539952		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:53326271T>C	ENST00000607628.1	-	7	1320	c.1211A>G	c.(1210-1212)cAt>cGt	p.H404R	Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000606822.1_Missense_Mutation_p.H366R|DCP1A_ENST00000294241.6_Missense_Mutation_p.H404R	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	404					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		TATTTGGTCATGCTGTGGGGT	0.542																																																	0								T	ARG/HIS	0,4112		0,0,2056	239.0	239.0	239.0		1211	3.9	1.0	3		239	1,8429		0,1,4214	no	missense	DCP1A	NM_018403.5	29	0,1,6270	CC,CT,TT		0.0119,0.0,0.0080	possibly-damaging	404/585	53326271	1,12541	2056	4215	6271	SO:0001583	missense	0			AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.1211A>G	3.37:g.53326271T>C	ENSP00000475920:p.His404Arg		B4DHN9|U3KQM8	Missense_Mutation	SNP	pfam_DCP1	p.H404R	ENST00000607628.1	37	c.1211		3																																																																																			DCP1A	-	NULL	ENSG00000162290		0.542	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	DCP1A	HGNC	protein_coding		-	0.00	47	0	T	NM_018403		53326271	-1	tier1	-	no_errors	ENST00000607628	ensembl	human	known	74_37	missense	58.33	20	28	SNP	1.000	C
DEF8	54849	genome.wustl.edu	37	16	90021666	90021666	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:90021666C>T	ENST00000268676.7	+	4	486	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C	DEF8_ENST00000567874.1_Missense_Mutation_p.R12C|DEF8_ENST00000563594.1_Missense_Mutation_p.R72C|DEF8_ENST00000569453.1_Missense_Mutation_p.R72C|DEF8_ENST00000563795.1_Missense_Mutation_p.R72C|DEF8_ENST00000570182.1_Missense_Mutation_p.R72C|DEF8_ENST00000418391.2_Missense_Mutation_p.R72C	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	133					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		CCACTTCTCCCGCCCTGTGGT	0.632																																																	0													86.0	82.0	83.0					16																	90021666		2198	4300	6498	SO:0001583	missense	0			AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.397C>T	16.37:g.90021666C>T	ENSP00000268676:p.Arg133Cys		B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Missense_Mutation	SNP	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.R133C	ENST00000268676.7	37	c.397	CCDS10989.1	16	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143339	0.77888	.	.	ENSG00000140995	ENST00000268676;ENST00000418391	T;T	0.52295	0.67;0.7	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.68595	0.3018	M	0.74258	2.255	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.72338	0.967;0.977;0.927;0.977	T	0.73783	-0.3874	10	0.87932	D	0	-16.1584	16.717	0.85399	0.0:1.0:0.0:0.0	.	72;72;133;72	Q6ZN54-5;Q6ZN54-3;Q6ZN54;Q6ZN54-2	.;.;DEFI8_HUMAN;.	C	133;72	ENSP00000268676:R133C;ENSP00000412784:R72C	ENSP00000268676:R133C	R	+	1	0	DEF8	88549167	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	4.986000	0.63851	2.293000	0.77203	0.561000	0.74099	CGC	DEF8	-	NULL	ENSG00000140995		0.632	DEF8-001	KNOWN	basic|CCDS	protein_coding	DEF8	HGNC	protein_coding	OTTHUMT00000272878.1	-	0.00	60	0	C	NM_207514		90021666	+1	tier1	-	no_errors	ENST00000268676	ensembl	human	known	74_37	missense	39.53	26	17	SNP	1.000	T
DESI2	51029	genome.wustl.edu	37	1	244816601	244816601	+	5'UTR	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:244816601G>T	ENST00000302550.11	+	0	365				DESI2_ENST00000484738.1_3'UTR|DESI2_ENST00000263831.7_5'UTR	NM_016076.3	NP_057160.2	Q9BSY9	DESI2_HUMAN	desumoylating isopeptidase 2							cytoplasm (GO:0005737)	peptidase activity (GO:0008233)										CGAGGCGGCGGCCGCGGGGAG	0.736																																																	0													20.0	27.0	24.0					1																	244816601		2173	4271	6444	SO:0001623	5_prime_UTR_variant	0			AK025651	CCDS1626.1, CCDS73055.1	1q44	2012-05-16	2012-05-16	2012-05-16	ENSG00000121644	ENSG00000121644			24264	protein-coding gene	gene with protein product		614638	"""chromosome 1 open reading frame 121"", ""family with sequence similarity 152, member A"", ""PPPDE peptidase domain containing 1"""	C1orf121, FAM152A, PPPDE1		10810093, 22370726	Standard	XM_005273154		Approved	CGI-146, FLJ21998	uc001iao.3	Q9BSY9	OTTHUMG00000040398	ENST00000302550.11:c.-15G>T	1.37:g.244816601G>T			B1APK6|Q5VVC6|Q9NYS2|Q9Y3E4	RNA	SNP	-	NULL	ENST00000302550.11	37	NULL	CCDS1626.1	1																																																																																			DESI2	-	-	ENSG00000121644		0.736	DESI2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DESI2	HGNC	protein_coding	OTTHUMT00000097168.1	-	0.00	13	0	G	NM_016076		244816601	+1	tier1	-	no_errors	ENST00000484738	ensembl	human	known	74_37	rna	41.67	7	5	SNP	1.000	T
DICER1	23405	genome.wustl.edu	37	14	95570306	95570306	+	Missense_Mutation	SNP	G	G	T	rs375211466		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr14:95570306G>T	ENST00000526495.1	-	23	3718	c.3427C>A	c.(3427-3429)Cta>Ata	p.L1143I	DICER1_ENST00000541352.1_Missense_Mutation_p.L1143I|DICER1_ENST00000393063.1_Missense_Mutation_p.L1143I|DICER1_ENST00000343455.3_Missense_Mutation_p.L1143I|DICER1_ENST00000556045.1_Missense_Mutation_p.L41I|DICER1_ENST00000527414.1_Missense_Mutation_p.L1143I			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1143					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TGATTTTCTAGAGAGGAGGTT	0.418			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0								G	ILE/LEU,ILE/LEU,ILE/LEU	1,4405	2.1+/-5.4	0,1,2202	50.0	54.0	53.0		3427,3427,3427	2.6	1.0	14		53	0,8600		0,0,4300	no	missense,missense,missense	DICER1	NM_177438.2,NM_030621.3,NM_001195573.1	5,5,5	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	benign,benign,benign	1143/1923,1143/1923,1143/1830	95570306	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.3427C>A	14.37:g.95570306G>T	ENSP00000437256:p.Leu1143Ile		A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ_dom,pfam_Dicer_dimerisation_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_P-loop_NTPase,superfamily_PAZ_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_PAZ_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.L1143I	ENST00000526495.1	37	c.3427	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	G	9.910	1.209148	0.22205	2.27E-4	0.0	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	T;T;T;T;D;T	0.86366	0.44;0.44;0.44;0.44;-2.11;0.75	4.71	2.64	0.31445	.	1.390360	0.04192	N	0.328455	T	0.76521	0.3999	N	0.08118	0	0.22666	N	0.998875	B;B	0.13145	0.007;0.002	B;B	0.14023	0.01;0.003	T	0.64158	-0.6473	10	0.44086	T	0.13	-0.3692	8.8127	0.34976	0.0:0.3102:0.5686:0.1212	.	41;1143	B3KRG4;Q9UPY3	.;DICER_HUMAN	I	1143;1143;1143;1143;41;1143	ENSP00000343745:L1143I;ENSP00000437256:L1143I;ENSP00000376783:L1143I;ENSP00000435681:L1143I;ENSP00000451041:L41I;ENSP00000444719:L1143I	ENSP00000343745:L1143I	L	-	1	2	DICER1	94640059	0.991000	0.36638	0.991000	0.47740	0.990000	0.78478	0.672000	0.25187	2.165000	0.68154	0.561000	0.74099	CTA	DICER1	-	NULL	ENSG00000100697		0.418	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1		0.00	44	0	G			95570306	-1			no_errors	ENST00000343455	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.976	T
DOCK11	139818	genome.wustl.edu	37	X	117819759	117819759	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chrX:117819759G>A	ENST00000276202.7	+	53	6274	c.6211G>A	c.(6211-6213)Gct>Act	p.A2071T	DOCK11_ENST00000276204.6_Missense_Mutation_p.A2075T	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	2071					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CCCAAGATACGCTGAAGTGTG	0.393													G|||	1	0.000264901	0.0008	0.0	3775	,	,		15365	0.0		0.0	False		,,,				2504	0.0																0													198.0	165.0	176.0					X																	117819759		2203	4300	6503	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.6211G>A	X.37:g.117819759G>A	ENSP00000276202:p.Ala2071Thr		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A2071T	ENST00000276202.7	37	c.6211	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	8.494	0.862656	0.17178	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.18174	2.23;2.23	6.17	-5.1	0.02911	.	1.026890	0.07718	N	0.943122	T	0.08088	0.0202	N	0.12182	0.205	0.09310	N	1	B;B	0.15719	0.014;0.014	B;B	0.06405	0.002;0.002	T	0.37337	-0.9710	10	0.31617	T	0.26	-40.6616	7.9987	0.30284	0.5978:0.0:0.2057:0.1965	.	2075;2071	A6NIW2;Q5JSL3	.;DOC11_HUMAN	T	2075;2071	ENSP00000276204:A2075T;ENSP00000276202:A2071T	ENSP00000276202:A2071T	A	+	1	0	DOCK11	117703787	0.645000	0.27286	0.005000	0.12908	0.402000	0.30811	0.273000	0.18662	-1.484000	0.01856	-0.994000	0.02522	GCT	DOCK11	-	NULL	ENSG00000147251		0.393	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	-	0.00	35	0	G	NM_144658		117819759	+1	tier1	-	no_errors	ENST00000276202	ensembl	human	known	74_37	missense	72.41	8	21	SNP	0.000	A
DPP10	57628	genome.wustl.edu	37	2	116548752	116548752	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:116548752T>A	ENST00000410059.1	+	18	2107	c.1627T>A	c.(1627-1629)Tat>Aat	p.Y543N	DPP10_ENST00000409163.1_Missense_Mutation_p.Y493N|DPP10_ENST00000310323.8_Missense_Mutation_p.Y536N|DPP10_ENST00000393147.2_Missense_Mutation_p.Y547N	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	543						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TATTGACGACTATGGTAAAAT	0.323																																																	0													77.0	80.0	79.0					2																	116548752		2201	4299	6500	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1627T>A	2.37:g.116548752T>A	ENSP00000386565:p.Tyr543Asn		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.Y547N	ENST00000410059.1	37	c.1639	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	T	18.41	3.617114	0.66672	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.54	5.54	0.83059	.	0.351565	0.31134	N	0.008199	T	0.54967	0.1891	M	0.66297	2.02	0.46317	D	0.998985	P;D;P;P	0.64830	0.935;0.994;0.893;0.893	P;P;P;B	0.55161	0.473;0.77;0.453;0.281	T	0.56535	-0.7963	10	0.48119	T	0.1	-17.4871	13.5512	0.61734	0.0:0.0:0.0:1.0	.	536;547;539;543	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	N	543;493;547;536;493	ENSP00000386565:Y543N;ENSP00000387038:Y493N;ENSP00000376855:Y547N;ENSP00000309066:Y536N	ENSP00000309066:Y536N	Y	+	1	0	DPP10	116265222	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.396000	0.66297	2.323000	0.78572	0.528000	0.53228	TAT	DPP10	-	NULL	ENSG00000175497		0.323	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	-	0.00	21	0	T	NM_020868		116548752	+1	tier1	-	no_errors	ENST00000393147	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	A
ECI2	10455	genome.wustl.edu	37	6	4117631	4117631	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:4117631G>T	ENST00000380118.3	-	9	976	c.940C>A	c.(940-942)Caa>Aaa	p.Q314K	ECI2_ENST00000413766.2_Missense_Mutation_p.Q147K|C6orf201_ENST00000380175.4_Intron|ECI2_ENST00000361538.2_Missense_Mutation_p.Q284K|C6orf201_ENST00000430835.2_Intron|C6orf201_ENST00000333388.5_Intron|ECI2_ENST00000465828.1_Missense_Mutation_p.Q284K|ECI2_ENST00000380125.2_Missense_Mutation_p.Q284K			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	314	ECH-like.				fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						ACAAGTCCTTGAGCACATGCC	0.398																																																	0													115.0	119.0	118.0					6																	4117631		2203	4300	6503	SO:0001583	missense	0			AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.940C>A	6.37:g.4117631G>T	ENSP00000369461:p.Gln314Lys		Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,pfam_Crotonase_core_superfam,superfamily_Acyl-CoA-binding_protein,prints_Acyl-CoA-binding_protein	p.Q314K	ENST00000380118.3	37	c.940	CCDS43420.2	6	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116166	0.37339	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000413766;ENST00000361538;ENST00000465828	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24	6.16	3.22	0.36961	Crotonase, core (1);	0.656621	0.16059	N	0.231578	T	0.34193	0.0889	L	0.43701	1.375	0.24898	N	0.992123	B	0.29136	0.234	B	0.31751	0.135	T	0.15521	-1.0434	10	0.29301	T	0.29	.	4.8139	0.13356	0.0711:0.1342:0.5168:0.2778	.	314	O75521	ECI2_HUMAN	K	314;284;147;284;284	ENSP00000369461:Q314K;ENSP00000369468:Q284K;ENSP00000406969:Q147K;ENSP00000354737:Q284K;ENSP00000420309:Q284K	ENSP00000354737:Q284K	Q	-	1	0	ECI2	4062630	1.000000	0.71417	0.998000	0.56505	0.864000	0.49448	3.306000	0.51881	0.890000	0.36211	-0.188000	0.12872	CAA	ECI2	-	pfam_Crotonase_core_superfam	ENSG00000198721		0.398	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ECI2	HGNC	protein_coding	OTTHUMT00000039716.4	-	0.00	74	0	G	NM_006117		4117631	-1	tier1	-	no_errors	ENST00000380118	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.998	T
ECM2	1842	genome.wustl.edu	37	9	95277146	95277148	+	In_Frame_Del	DEL	TCC	TCC	-	rs137929518	byFrequency	TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:95277146_95277148delTCC	ENST00000344604.5	-	4	968_970	c.819_821delGGA	c.(817-822)gaggat>gat	p.E273del	ECM2_ENST00000444490.2_In_Frame_Del_p.E251del|CENPP_ENST00000375587.3_Intron	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	273	Poly-Glu.				cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						ctcctcctcatcctcctcctcct	0.606																																																	0																																										SO:0001651	inframe_deletion	0			AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.819_821delGGA	9.37:g.95277155_95277157delTCC	ENSP00000344758:p.Glu273del		B2R730|E2PU11|Q5T9F2|Q7Z3D0	In_Frame_Del	DEL	pfam_Leu-rich_rpt,pfam_VWF_C,smart_VWF_C,smart_Leu-rich_rpt_typical-subtyp,pfscan_VWF_C	p.E273in_frame_del	ENST00000344604.5	37	c.821_819	CCDS6698.1	9																																																																																			ECM2	-	NULL	ENSG00000106823		0.606	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM2	HGNC	protein_coding	OTTHUMT00000053091.1		0.00	34	0	TCC	NM_001393		95277148	-1			no_errors	ENST00000344604	ensembl	human	known	74_37	in_frame_del	5.77	98	6	DEL	0.117:0.088:0.005	0
ENPP4	22875	genome.wustl.edu	37	6	46107802	46107802	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:46107802A>G	ENST00000321037.4	+	2	712	c.482A>G	c.(481-483)gAg>gGg	p.E161G		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	161					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						GTGTCATTTGAGGAAAGACTA	0.408																																																	0													133.0	130.0	131.0					6																	46107802		2203	4300	6503	SO:0001583	missense	0			AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.482A>G	6.37:g.46107802A>G	ENSP00000318066:p.Glu161Gly		A8K5G1|Q7L2N1	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.E161G	ENST00000321037.4	37	c.482	CCDS34468.1	6	.	.	.	.	.	.	.	.	.	.	A	11.42	1.632238	0.29068	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	T	0.73152	-0.72	5.97	-0.564	0.11774	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.920925	0.09585	N	0.782327	T	0.39784	0.1091	L	0.48935	1.535	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.40757	-0.9546	10	0.52906	T	0.07	0.2926	6.6636	0.23029	0.4719:0.3599:0.1682:0.0	.	161	Q9Y6X5	ENPP4_HUMAN	G	161	ENSP00000318066:E161G	ENSP00000318066:E161G	E	+	2	0	ENPP4	46215761	0.087000	0.21565	0.561000	0.28357	0.840000	0.47671	0.698000	0.25571	-0.299000	0.08909	-0.313000	0.08912	GAG	ENPP4	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000001561		0.408	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP4	HGNC	protein_coding	OTTHUMT00000040777.2	-	0.00	25	0	A			46107802	+1	tier1	-	no_errors	ENST00000321037	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.030	G
ENPP6	133121	genome.wustl.edu	37	4	185012359	185012359	+	Missense_Mutation	SNP	C	C	T	rs146403093		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:185012359C>T	ENST00000296741.2	-	8	1435	c.1294G>A	c.(1294-1296)Gca>Aca	p.A432T		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	432					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		AGAATCAGTGCCAGGGCACAG	0.552																																																	0								C	THR/ALA	5,4401	9.9+/-24.2	0,5,2198	68.0	72.0	71.0		1294	3.2	0.8	4	dbSNP_134	71	0,8600		0,0,4300	no	missense	ENPP6	NM_153343.3	58	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	possibly-damaging	432/441	185012359	5,13001	2203	4300	6503	SO:0001583	missense	0			AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.1294G>A	4.37:g.185012359C>T	ENSP00000296741:p.Ala432Thr		Q4W5Q1|Q96M57	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.A432T	ENST00000296741.2	37	c.1294	CCDS3834.1	4	.	.	.	.	.	.	.	.	.	.	C	14.65	2.598520	0.46318	0.001135	0.0	ENSG00000164303	ENST00000296741	T	0.75477	-0.94	5.98	3.2	0.36748	.	3.750420	0.01065	N	0.004711	T	0.64768	0.2628	L	0.28274	0.84	0.21499	N	0.999668	B	0.14012	0.009	B	0.09377	0.004	T	0.47560	-0.9108	10	0.25751	T	0.34	-13.8217	8.5822	0.33634	0.0:0.6318:0.236:0.1321	.	432	Q6UWR7	ENPP6_HUMAN	T	432	ENSP00000296741:A432T	ENSP00000296741:A432T	A	-	1	0	ENPP6	185249353	0.889000	0.30405	0.828000	0.32881	0.005000	0.04900	0.617000	0.24359	0.842000	0.35045	-0.229000	0.12294	GCA	ENPP6	-	NULL	ENSG00000164303		0.552	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP6	HGNC	protein_coding	OTTHUMT00000361428.1		0.00	26	0	C	NM_153343		185012359	-1			no_errors	ENST00000296741	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.462	T
RP11-159F24.2	0	genome.wustl.edu	37	5	43348816	43348817	+	RNA	INS	-	-	A	rs553054916|rs574591852|rs140799200	byFrequency	TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:43348816_43348817insA	ENST00000511991.1	+	0	430_431																											ACCAAACTCTTAAAAAAAAAAA	0.337																																																	0																																												0																															5.37:g.43348827_43348827dupA				RNA	INS	-	NULL	ENST00000511991.1	37	NULL		5																																																																																			RP11-159F24.2	-	-	ENSG00000188850		0.337	RP11-159F24.2-001	KNOWN	basic	processed_transcript	ENSG00000188850	Clone_based_vega_gene	pseudogene	OTTHUMT00000367972.1		0.00	10	0	-			43348817	+1	tier1		no_errors	ENST00000511991	ensembl	human	known	74_37	rna	50.00	5	5	INS	0.001:0.000	A
CCT6A	908	genome.wustl.edu	37	7	56123143	56123143	+	Intron	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:56123143G>T	ENST00000275603.4	+	4	555				CCT6A_ENST00000540286.1_Intron|SNORA22_ENST00000383876.1_RNA|CCT6A_ENST00000335503.3_Intron	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)						'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CATCTGCTCTGCATTGAAAGG	0.398																																																	0																																										SO:0001627	intron_variant	0			M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842	ENST00000275603.4:c.337-174G>T	7.37:g.56123143G>T			A6NCD2|Q3KP28|Q75LP4|Q96S46	RNA	SNP	-	NULL	ENST00000275603.4	37	NULL	CCDS5523.1	7																																																																																			SNORA22	-	-	ENSG00000206603		0.398	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000206603	RFAM	protein_coding	OTTHUMT00000251526.2	-	0.00	50	0	G	NM_001762		56123143	+1	tier1	-	no_errors	ENST00000383876	ensembl	human	novel	74_37	rna	5.33	71	4	SNP	1.000	T
MBNL1	4154	genome.wustl.edu	37	3	152175739	152175740	+	Intron	DEL	AT	AT	-			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:152175739_152175740delAT	ENST00000463374.1	+	8	1621				MBNL1_ENST00000545754.1_Intron|MBNL1_ENST00000355460.2_Intron|MBNL1_ENST00000324210.5_Intron|MBNL1_ENST00000485509.1_Intron|MBNL1_ENST00000498502.1_Intron|MBNL1_ENST00000282486.6_Intron|MBNL1_ENST00000485910.1_Intron|MBNL1_ENST00000324196.5_Intron|MBNL1_ENST00000492948.1_Intron|MBNL1_ENST00000357472.3_Intron|MBNL1_ENST00000493459.1_Intron|RP11-362A9.3_ENST00000463255.1_RNA|MBNL1_ENST00000282488.7_Intron	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1						alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			AAGGGAATGGatatatatatac	0.337																																																	0																																										SO:0001627	intron_variant	0			Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.1111-1320AT>-	3.37:g.152175747_152175748delAT			E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	RNA	DEL	-	NULL	ENST00000463374.1	37	NULL	CCDS3165.1	3																																																																																			RP11-362A9.3	-	-	ENSG00000243305		0.337	MBNL1-006	KNOWN	basic|CCDS	protein_coding	ENSG00000243305	Clone_based_vega_gene	protein_coding	OTTHUMT00000353604.1		0.00	13	0	AT	NM_021038		152175740	-1	tier1		no_errors	ENST00000463255	ensembl	human	known	74_37	rna	56.67	13	17	DEL	0.999:0.999	-
IGLV2-18	28814	genome.wustl.edu	37	22	23077083	23077083	+	RNA	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr22:23077083G>A	ENST00000390310.2	+	0	0				D87007.1_ENST00000579613.1_RNA					immunoglobulin lambda variable 2-18																		ATCTCAGGAGGCAGCTCTCTC	0.632																																																	0																																												0			Z73642		22q11.2	2012-02-08			ENSG00000211664	ENSG00000211664		"""Immunoglobulins / IGL locus"""	5889	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151232		22.37:g.23077083G>A				RNA	SNP	-	NULL	ENST00000390310.2	37	NULL		22																																																																																			D87007.1	-	-	ENSG00000264629		0.632	IGLV2-18-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000264629	Clone_based_ensembl_gene	IG_V_gene	OTTHUMT00000321836.1	-	0.00	67	0	G	NG_000002		23077083	+1	tier1	-	no_errors	ENST00000579613	ensembl	human	novel	74_37	rna	35.29	66	36	SNP	0.112	A
ASIC2	40	genome.wustl.edu	37	17	31439098	31439099	+	Intron	DEL	AG	AG	-	rs140895516		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:31439098_31439099delAG	ENST00000359872.6	-	2	1317				ASIC2_ENST00000225823.2_Intron|RP11-40A13.1_ENST00000584688.1_RNA|ASIC2_ENST00000448983.1_Intron	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GAAGGAGAGAAGAGAGAGAGAG	0.53																																																	0																																										SO:0001627	intron_variant	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-13CT>-	17.37:g.31439108_31439109delAG			E9PBX2|Q13553|Q6DJU1|Q8N3E2	RNA	DEL	-	NULL	ENST00000359872.6	37	NULL	CCDS42296.1	17																																																																																			RP11-40A13.1	-	-	ENSG00000266535		0.530	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266535	Clone_based_vega_gene	protein_coding	OTTHUMT00000447552.1		0.00	23	0	AG	NM_183377, NM_001094		31439099	+1	tier1		no_errors	ENST00000584688	ensembl	human	known	74_37	rna	14.29	24	4	DEL	0.563:0.970	-
ERBB2IP	55914	genome.wustl.edu	37	5	65349797	65349797	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:65349797A>G	ENST00000284037.5	+	21	3040	c.2651A>G	c.(2650-2652)tAt>tGt	p.Y884C	ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.Y880C|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.Y884C|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.Y884C|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.Y884C|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.Y884C|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.Y884C|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.Y884C|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.Y884C	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	884					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		CTAAAAATCTATGATATTCTT	0.398																																																	0													452.0	448.0	449.0					5																	65349797		2203	4300	6503	SO:0001583	missense	0				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.2651A>G	5.37:g.65349797A>G	ENSP00000284037:p.Tyr884Cys		A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.Y884C	ENST00000284037.5	37	c.2651	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	A	17.45	3.393056	0.62066	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.75260	-0.71;-0.7;-0.67;-0.45;-0.92;-0.44;-0.7;-0.65;-0.92	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.80675	0.4668	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998;1.0;1.0	D;D;D;D;P;D;D	0.97110	1.0;0.999;0.999;0.998;0.87;1.0;0.999	T	0.82979	-0.0188	10	0.87932	D	0	.	15.9353	0.79698	1.0:0.0:0.0:0.0	.	884;884;884;880;884;884;884	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	C	884;884;884;884;884;884;880;884;884	ENSP00000284037:Y884C;ENSP00000370330:Y884C;ENSP00000370326:Y884C;ENSP00000370323:Y884C;ENSP00000370322:Y884C;ENSP00000370325:Y884C;ENSP00000422766:Y880C;ENSP00000426632:Y884C;ENSP00000422015:Y884C	ENSP00000284037:Y884C	Y	+	2	0	ERBB2IP	65385553	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.322000	0.52007	2.159000	0.67721	0.460000	0.39030	TAT	ERBB2IP	-	NULL	ENSG00000112851		0.398	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	-	0.00	45	0	A	NM_018695		65349797	+1	tier1	-	no_errors	ENST00000284037	ensembl	human	known	74_37	missense	37.21	27	16	SNP	1.000	G
ESPL1	9700	genome.wustl.edu	37	12	53663130	53663130	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:53663130C>A	ENST00000257934.4	+	3	495	c.404C>A	c.(403-405)gCt>gAt	p.A135D	ESPL1_ENST00000552462.1_Missense_Mutation_p.A135D	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	135					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						TCTCGCGAGGCTGCTCCCCAG	0.617																																					Colon(53;1069 1201 2587 5382)												0													49.0	47.0	48.0					12																	53663130		2203	4300	6503	SO:0001583	missense	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.404C>A	12.37:g.53663130C>A	ENSP00000257934:p.Ala135Asp			Missense_Mutation	SNP	pfam_Peptidase_C50,superfamily_DsrEFH-like	p.A135D	ENST00000257934.4	37	c.404	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937569	0.52972	.	.	ENSG00000135476	ENST00000257934;ENST00000552462	T;T	0.12039	2.72;2.72	4.89	1.89	0.25635	.	0.420058	0.25192	N	0.032448	T	0.17323	0.0416	M	0.70595	2.14	0.27836	N	0.941283	D	0.56035	0.974	P	0.46585	0.521	T	0.08953	-1.0697	10	0.62326	D	0.03	.	5.4832	0.16735	0.0:0.5893:0.1508:0.26	.	135	Q14674	ESPL1_HUMAN	D	135	ENSP00000257934:A135D;ENSP00000449831:A135D	ENSP00000257934:A135D	A	+	2	0	ESPL1	51949397	0.736000	0.28164	0.993000	0.49108	0.737000	0.42083	0.376000	0.20535	0.776000	0.33473	0.561000	0.74099	GCT	ESPL1	-	NULL	ENSG00000135476		0.617	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	-	0.00	13	0	C	NM_012291		53663130	+1	tier1	-	no_errors	ENST00000257934	ensembl	human	known	74_37	missense	40.00	9	6	SNP	0.878	A
FAM157B	100132403	genome.wustl.edu	37	9	141107532	141107533	+	lincRNA	INS	-	-	GGG	rs576173851		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:141107532_141107533insGGG	ENST00000446912.2	+	0	15_16							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		GAACCGgcagcggcggcagcag	0.55																																																	0																																												0					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107532_141107533insGGG				RNA	INS	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			FAM157B	-	-	ENSG00000233013		0.550	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2		0.00	72	0	-	NM_001145249		141107533	+1	tier1		no_errors	ENST00000446912	ensembl	human	known	74_37	rna	9.68	112	12	INS	0.051:0.039	GGG
FAM171A1	221061	genome.wustl.edu	37	10	15254987	15254989	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	TCA	TCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr10:15254987_15254989delTCA	ENST00000378116.4	-	8	2604_2606	c.2598_2600delTGA	c.(2596-2601)gatgac>gac	p.866_867DD>D	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	866						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TTCTCCTTGGTCATCATCATCAT	0.571																																																	0																																										SO:0001651	inframe_deletion	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2598_2600delTGA	10.37:g.15254996_15254998delTCA	ENSP00000367356:p.Asp867del		D3DRT9|Q32M49|Q8N4I0	In_Frame_Del	DEL	pfam_Uncharacterised_FAM171	p.D867in_frame_del	ENST00000378116.4	37	c.2600_2598	CCDS31154.1	10																																																																																			FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.571	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1		0.00	31	0	TCA	XM_167709		15254989	-1	tier1		no_errors	ENST00000378116	ensembl	human	known	74_37	in_frame_del	7.32	38	3	DEL	1.000:0.998:0.826	-
FAM86DP	692099	genome.wustl.edu	37	3	75471400	75471400	+	RNA	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:75471400C>T	ENST00000459803.1	-	0	1741					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		TGGCCAGAAGCTGAAATGACG	0.577																																																	0																																												0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75471400C>T				RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.577	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1		0.00	140	0	C	NR_024241		75471400	-1			no_errors	ENST00000459803	ensembl	human	known	74_37	rna	6.67	70	5	SNP	0.001	T
FAT4	79633	genome.wustl.edu	37	4	126370789	126370789	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:126370789G>T	ENST00000394329.3	+	9	8631	c.8618G>T	c.(8617-8619)aGc>aTc	p.S2873I	FAT4_ENST00000335110.5_Missense_Mutation_p.S1171I	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2873	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S2873N(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCAAGATTTAGCAGAACTTCC	0.403																																																	2	Substitution - Missense(2)	large_intestine(2)											86.0	84.0	84.0					4																	126370789		2203	4299	6502	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.8618G>T	4.37:g.126370789G>T	ENSP00000377862:p.Ser2873Ile		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S2873I	ENST00000394329.3	37	c.8618	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	7.383	0.629210	0.14257	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.02656	4.21;4.21	5.51	3.71	0.42584	Cadherin (2);Cadherin-like (1);	0.248852	0.21060	U	0.080842	T	0.04182	0.0116	L	0.57536	1.79	0.39252	D	0.964056	P;P;P	0.48089	0.773;0.756;0.905	B;B;B	0.39419	0.246;0.221;0.299	T	0.46843	-0.9162	10	0.59425	D	0.04	.	11.004	0.47622	0.0747:0.3032:0.6221:0.0	.	1171;2873;2873	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	I	2873;1171	ENSP00000377862:S2873I;ENSP00000335169:S1171I	ENSP00000335169:S1171I	S	+	2	0	FAT4	126590239	1.000000	0.71417	0.990000	0.47175	0.153000	0.21895	4.172000	0.58243	1.418000	0.47098	0.655000	0.94253	AGC	FAT4	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000196159		0.403	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2		0.00	33	0	G	NM_024582		126370789	+1			no_errors	ENST00000394329	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
FIGF	2277	genome.wustl.edu	37	X	15364158	15364159	+	3'UTR	INS	-	-	T	rs377695936		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chrX:15364158_15364159insT	ENST00000297904.3	-	0	1590_1591				FIGF_ENST00000488351.1_5'UTR	NM_004469.4	NP_004460.1	O43915	VEGFD_HUMAN	c-fos induced growth factor (vascular endothelial growth factor D)						angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|induction of positive chemotaxis (GO:0050930)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell chemotaxis (GO:0060754)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor binding (GO:0005172)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17	Hepatocellular(33;0.183)					TGTAAAATGGATTTTTTTTTTA	0.446																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ000185	CCDS14166.1	Xp22.31	2008-02-05			ENSG00000165197	ENSG00000165197			3708	protein-coding gene	gene with protein product		300091		VEGFD		9479493	Standard	NM_004469		Approved	VEGF-D	uc004cwt.2	O43915	OTTHUMG00000021175	ENST00000297904.3:c.*97->A	X.37:g.15364168_15364168dupT			B2R7Z3	RNA	INS	-	NULL	ENST00000297904.3	37	NULL	CCDS14166.1	X																																																																																			FIGF	-	-	ENSG00000165197		0.446	FIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGF	HGNC	protein_coding	OTTHUMT00000055859.1		0.00	23	0	-	NM_004469		15364159	-1	tier1		no_errors	ENST00000488351	ensembl	human	known	74_37	rna	9.68	28	3	INS	0.000:0.000	T
FKBP5	2289	genome.wustl.edu	37	6	35547893	35547893	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:35547893G>T	ENST00000539068.1	-	9	1148	c.946C>A	c.(946-948)Ctc>Atc	p.L316I	FKBP5_ENST00000536438.1_Missense_Mutation_p.L316I|FKBP5_ENST00000540787.1_Missense_Mutation_p.L137I|FKBP5_ENST00000357266.4_Missense_Mutation_p.L316I	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	316					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						GCAGCAAGGAGAAATGATTCA	0.438																																																	0													185.0	167.0	173.0					6																	35547893		2203	4300	6503	SO:0001583	missense	0			U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.946C>A	6.37:g.35547893G>T	ENSP00000441205:p.Leu316Ile		F5H7R1|Q59EB8|Q5TGM6	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.L316I	ENST00000539068.1	37	c.946	CCDS4808.1	6	.	.	.	.	.	.	.	.	.	.	G	11.63	1.697349	0.30142	.	.	ENSG00000096060	ENST00000536438;ENST00000357266;ENST00000539068;ENST00000337746;ENST00000540787;ENST00000543400	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.93	5.93	0.95920	Elongated TPR repeat-containing domain (1);	0.092126	0.45606	D	0.000346	T	0.51126	0.1656	L	0.33485	1.01	0.80722	D	1	B	0.26577	0.153	B	0.30782	0.12	T	0.53592	-0.8417	10	0.38643	T	0.18	-13.6099	9.4175	0.38530	0.0713:0.0:0.7847:0.1441	.	316	Q13451	FKBP5_HUMAN	I	316;316;316;316;137;279	ENSP00000444810:L316I;ENSP00000349811:L316I;ENSP00000441205:L316I;ENSP00000445412:L137I	ENSP00000338160:L316I	L	-	1	0	FKBP5	35655871	0.581000	0.26741	0.996000	0.52242	0.343000	0.28985	1.524000	0.35942	2.798000	0.96311	0.655000	0.94253	CTC	FKBP5	-	NULL	ENSG00000096060		0.438	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP5	HGNC	protein_coding	OTTHUMT00000040309.2	-	0.00	64	0	G			35547893	-1	tier1	-	no_errors	ENST00000357266	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
FLJ36000	284124	genome.wustl.edu	37	17	21911549	21911549	+	lincRNA	SNP	G	G	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:21911549G>C	ENST00000581223.2	+	0	2274					NR_027084.1																						TCAGTCCCGGGGCAATTGAAA	0.527																																																	0																																												0																															17.37:g.21911549G>C				RNA	SNP	-	NULL	ENST00000581223.2	37	NULL		17																																																																																			RP11-744K17.9	-	-	ENSG00000266795		0.527	RP11-744K17.9-001	KNOWN	basic	lincRNA	FLJ36000	Clone_based_vega_gene	lincRNA	OTTHUMT00000451067.1	-	0.00	32	0	G			21911549	+1	tier1	-	no_errors	ENST00000581223	ensembl	human	known	74_37	rna	21.74	18	5	SNP	0.006	C
FMN2	56776	genome.wustl.edu	37	1	240494009	240494009	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:240494009G>T	ENST00000319653.9	+	11	4774	c.4544G>T	c.(4543-4545)gGa>gTa	p.G1515V	FMN2_ENST00000545751.1_Missense_Mutation_p.G111V	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1515	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GATGGCTTTGGATTAGACATT	0.418																																																	0													142.0	130.0	134.0					1																	240494009		2203	4300	6503	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4544G>T	1.37:g.240494009G>T	ENSP00000318884:p.Gly1515Val		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.G1515V	ENST00000319653.9	37	c.4544	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117290	0.56505	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355	T;T	0.45276	0.9;0.9	5.67	5.67	0.87782	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.104888	0.41712	D	0.000837	T	0.64832	0.2634	M	0.73962	2.25	0.80722	D	1	P;P;D;D	0.76494	0.473;0.83;0.999;0.999	B;P;D;D	0.79784	0.265;0.586;0.961;0.993	T	0.67292	-0.5707	10	0.72032	D	0.01	.	15.2751	0.73737	0.0:0.1396:0.8604:0.0	.	111;161;144;1515	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	V	1515;111;142	ENSP00000318884:G1515V;ENSP00000437918:G111V	ENSP00000318884:G1515V	G	+	2	0	FMN2	238560632	0.980000	0.34600	1.000000	0.80357	0.982000	0.71751	2.008000	0.40893	2.666000	0.90696	0.655000	0.94253	GGA	FMN2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000155816		0.418	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2		0.00	99	0	G	XM_371352		240494009	+1			no_errors	ENST00000319653	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.999	T
FSTL5	56884	genome.wustl.edu	37	4	162697208	162697208	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:162697208G>T	ENST00000306100.5	-	5	864	c.428C>A	c.(427-429)aCt>aAt	p.T143N	FSTL5_ENST00000536695.1_Missense_Mutation_p.T142N|FSTL5_ENST00000427802.2_Missense_Mutation_p.T142N|FSTL5_ENST00000379164.4_Missense_Mutation_p.T142N	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	143						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		GCTGTATTCAGTAGTCTTGCA	0.264																																																	0													39.0	38.0	39.0					4																	162697208		2200	4290	6490	SO:0001583	missense	0			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.428C>A	4.37:g.162697208G>T	ENSP00000305334:p.Thr143Asn		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Kazal_dom,pfam_Ig_V-set,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.T143N	ENST00000306100.5	37	c.428	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	G	9.960	1.222451	0.22457	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.72615	-0.65;-0.64;-0.67;-0.64	5.3	2.53	0.30540	.	0.464087	0.25469	N	0.030441	T	0.62122	0.2402	L	0.57536	1.79	0.33597	D	0.601827	B;B;B	0.18166	0.026;0.0;0.0	B;B;B	0.18263	0.021;0.001;0.0	T	0.60732	-0.7205	10	0.33141	T	0.24	.	7.7176	0.28712	0.144:0.0:0.7236:0.1324	.	142;142;143	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	N	143;142;142;142	ENSP00000305334:T143N;ENSP00000368462:T142N;ENSP00000389270:T142N;ENSP00000440409:T142N	ENSP00000305334:T143N	T	-	2	0	FSTL5	162916658	1.000000	0.71417	0.645000	0.29479	0.947000	0.59692	1.603000	0.36794	0.269000	0.21961	0.650000	0.86243	ACT	FSTL5	-	NULL	ENSG00000168843		0.264	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	HGNC	protein_coding	OTTHUMT00000364773.2	-	0.00	14	0	G	NM_020116		162697208	-1	tier1	-	no_errors	ENST00000306100	ensembl	human	known	74_37	missense	42.86	16	12	SNP	0.910	T
FUT6	2528	genome.wustl.edu	37	19	5831513	5831513	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:5831513C>T	ENST00000318336.4	-	3	2260	c.1066G>A	c.(1066-1068)Gct>Act	p.A356T	FUT6_ENST00000524754.1_Missense_Mutation_p.A356T|FUT6_ENST00000286955.5_Missense_Mutation_p.A356T|FUT6_ENST00000527106.1_Missense_Mutation_p.A356T|FUT6_ENST00000592563.1_Intron	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	356					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						GTGAACCAAGCCGCTATGCCG	0.622																																																	0													69.0	80.0	77.0					19																	5831513		2203	4300	6503	SO:0001583	missense	0				CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.1066G>A	19.37:g.5831513C>T	ENSP00000313398:p.Ala356Thr		A6NEX0|D6W637|Q9UND8	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.A356T	ENST00000318336.4	37	c.1066	CCDS12152.1	19	.	.	.	.	.	.	.	.	.	.	C	4.323	0.059263	0.08339	.	.	ENSG00000156413	ENST00000524754;ENST00000527106;ENST00000318336;ENST00000286955	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	2.66	-5.32	0.02722	.	.	.	.	.	T	0.14056	0.0340	L	0.35249	1.045	0.09310	N	1	B	0.10296	0.003	B	0.15870	0.014	T	0.29640	-1.0005	9	0.20519	T	0.43	.	5.5168	0.16912	0.1778:0.4493:0.0:0.3729	.	356	P51993	FUT6_HUMAN	T	356	ENSP00000431708:A356T;ENSP00000432954:A356T;ENSP00000313398:A356T;ENSP00000286955:A356T	ENSP00000286955:A356T	A	-	1	0	FUT6	5782513	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.773000	0.01786	-1.820000	0.01215	-0.477000	0.04895	GCT	FUT6	-	pfam_Glyco_trans_10	ENSG00000156413		0.622	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT6	HGNC	protein_coding	OTTHUMT00000394218.2		0.00	121	0	C	NM_000150		5831513	-1			no_errors	ENST00000286955	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.000	T
GOLGB1	2804	genome.wustl.edu	37	3	121383785	121383785	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:121383785G>T	ENST00000340645.5	-	21	9758	c.9633C>A	c.(9631-9633)aaC>aaA	p.N3211K	GOLGB1_ENST00000393667.3_Missense_Mutation_p.N3221K	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	3211					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTCGACAACTGTTGCTTGTAA	0.488																																																	0													143.0	132.0	136.0					3																	121383785		2203	4300	6503	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.9633C>A	3.37:g.121383785G>T	ENSP00000341848:p.Asn3211Lys		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.N3211K	ENST00000340645.5	37	c.9633	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	9.734	1.163131	0.21538	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.13538	2.58;2.58	5.53	2.56	0.30785	.	0.561531	0.19284	N	0.118091	T	0.06508	0.0167	N	0.14661	0.345	0.09310	N	1	B;B;B	0.27068	0.167;0.167;0.063	B;B;B	0.24394	0.053;0.053;0.031	T	0.37197	-0.9716	10	0.21014	T	0.42	.	6.0446	0.19752	0.3243:0.0:0.6757:0.0	.	3221;3221;3211	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	K	3211;3221	ENSP00000341848:N3211K;ENSP00000377275:N3221K	ENSP00000341848:N3211K	N	-	3	2	GOLGB1	122866475	0.001000	0.12720	0.487000	0.27428	0.953000	0.61014	0.650000	0.24858	0.871000	0.35750	0.655000	0.94253	AAC	GOLGB1	-	NULL	ENSG00000173230		0.488	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	-	0.00	48	0	G	NM_004487		121383785	-1	tier1	-	no_errors	ENST00000340645	ensembl	human	known	74_37	missense	16.95	97	20	SNP	0.056	T
GPLD1	2822	genome.wustl.edu	37	6	24448365	24448365	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:24448365G>T	ENST00000230036.1	-	16	1628	c.1518C>A	c.(1516-1518)tgC>tgA	p.C506*		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	506					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						AACATACCTGGCAAGAAATGG	0.453																																																	0													136.0	130.0	132.0					6																	24448365		2203	4300	6503	SO:0001587	stop_gained	0			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.1518C>A	6.37:g.24448365G>T	ENSP00000230036:p.Cys506*		Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Nonsense_Mutation	SNP	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Gprt_PLipase_D	p.C506*	ENST00000230036.1	37	c.1518	CCDS4553.1	6	.	.	.	.	.	.	.	.	.	.	G	38	6.663908	0.97743	.	.	ENSG00000112293	ENST00000230036	.	.	.	4.91	2.15	0.27550	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-26.8858	8.5142	0.33235	0.3306:0.0:0.6694:0.0	.	.	.	.	X	506	.	ENSP00000230036:C506X	C	-	3	2	GPLD1	24556344	1.000000	0.71417	0.999000	0.59377	0.945000	0.59286	3.275000	0.51639	0.219000	0.20840	-0.142000	0.14014	TGC	GPLD1	-	NULL	ENSG00000112293		0.453	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPLD1	HGNC	protein_coding	OTTHUMT00000043315.1		0.00	69	0	G	NM_001503		24448365	-1			no_errors	ENST00000230036	ensembl	human	known	74_37	nonsense	6.67	28	2	SNP	1.000	T
GPR21	2844	genome.wustl.edu	37	9	125797216	125797216	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:125797216G>T	ENST00000373642.1	+	1	411	c.371G>T	c.(370-372)aGc>aTc	p.S124I	RABGAP1_ENST00000373647.4_Intron|RABGAP1_ENST00000373643.5_Intron|RABGAP1_ENST00000493854.1_Intron	NM_005294.1	NP_005285.1	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	124					G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|negative regulation of insulin receptor signaling pathway (GO:0046627)|positive regulation of multicellular organism growth (GO:0040018)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	15						GCCTGTATCAGCATTGATAGA	0.438																																																	0													113.0	103.0	107.0					9																	125797216		2203	4300	6503	SO:0001583	missense	0			BC066885	CCDS6849.1	9q33	2012-08-21			ENSG00000188394	ENSG00000188394		"""GPCR / Class A : Orphans"""	4476	protein-coding gene	gene with protein product		601909					Standard	NM_005294		Approved		uc011lzk.3	Q99679	OTTHUMG00000020631	ENST00000373642.1:c.371G>T	9.37:g.125797216G>T	ENSP00000362746:p.Ser124Ile		B2R8W9|Q6NXU2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S124I	ENST00000373642.1	37	c.371	CCDS6849.1	9	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618182	0.66787	.	.	ENSG00000188394	ENST00000373642;ENST00000412269	T	0.81330	-1.48	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	U	0.000000	D	0.92388	0.7584	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94059	0.7325	10	0.87932	D	0	-11.5883	18.8506	0.92227	0.0:0.0:1.0:0.0	.	124	Q99679	GPR21_HUMAN	I	124	ENSP00000362746:S124I	ENSP00000362746:S124I	S	+	2	0	GPR21	124837037	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.457000	0.83068	0.563000	0.77884	AGC	GPR21	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000188394		0.438	GPR21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR21	HGNC	protein_coding	OTTHUMT00000053965.1		0.00	25	0	G	NM_005294		125797216	+1			no_errors	ENST00000373642	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
GPR83	10888	genome.wustl.edu	37	11	94134267	94134267	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:94134267G>T	ENST00000243673.2	-	1	318	c.147C>A	c.(145-147)ttC>ttA	p.F49L	GPR83_ENST00000539203.2_Missense_Mutation_p.F49L	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	49					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GCCAGTCGGAGAAGGTGTAGT	0.632																																																	0													69.0	73.0	72.0					11																	94134267		2201	4298	6499	SO:0001583	missense	0			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.147C>A	11.37:g.94134267G>T	ENSP00000243673:p.Phe49Leu		B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.F49L	ENST00000243673.2	37	c.147	CCDS8297.1	11	.	.	.	.	.	.	.	.	.	.	G	4.897	0.166667	0.09339	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.59772	0.24;0.28	4.68	2.48	0.30137	.	0.136171	0.50627	N	0.000119	T	0.26412	0.0645	N	0.10733	0.035	0.28647	N	0.906861	B	0.06786	0.001	B	0.06405	0.002	T	0.17107	-1.0380	10	0.06891	T	0.86	.	4.1221	0.10109	0.2748:0.362:0.3632:0.0	.	49	Q9NYM4	GPR83_HUMAN	L	49	ENSP00000243673:F49L;ENSP00000441550:F49L	ENSP00000243673:F49L	F	-	3	2	GPR83	93773915	0.857000	0.29778	1.000000	0.80357	0.990000	0.78478	-0.167000	0.09940	0.965000	0.38133	0.462000	0.41574	TTC	GPR83	-	NULL	ENSG00000123901		0.632	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	HGNC	protein_coding	OTTHUMT00000396232.1	-	0.00	45	0	G	NM_016540		94134267	-1	tier1	-	no_errors	ENST00000243673	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.967	T
GRAP	10750	genome.wustl.edu	37	17	18925357	18925357	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:18925357C>T	ENST00000284154.5	-	5	1279	c.569G>A	c.(568-570)cGc>cAc	p.R190H	GRAP_ENST00000395635.1_Missense_Mutation_p.R161H|GRAP_ENST00000573099.1_Missense_Mutation_p.A134T|SLC5A10_ENST00000317977.6_3'UTR	NM_006613.3	NP_006604.1	Q13588	GRAP_HUMAN	GRB2-related adaptor protein	190	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|urinary_tract(1)	2	all_cancers(12;0.0183)					GGGGTCTGGGCGCTCCAGGAC	0.692																																																	0													12.0	14.0	14.0					17																	18925357		2192	4294	6486	SO:0001583	missense	0			U52518	CCDS11202.1	17p11.2	2013-02-14			ENSG00000154016	ENSG00000154016		"""SH2 domain containing"""	4562	protein-coding gene	gene with protein product		604330				8647802, 8995379	Standard	NM_006613		Approved		uc002guy.3	Q13588	OTTHUMG00000059436	ENST00000284154.5:c.569G>A	17.37:g.18925357C>T	ENSP00000284154:p.Arg190His			Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain,prints_p67phox	p.R190H	ENST00000284154.5	37	c.569	CCDS11202.1	17	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313732	0.40996	.	.	ENSG00000154016	ENST00000284154;ENST00000395635	T;T	0.08720	3.06;3.06	4.77	1.05	0.20165	Src homology-3 domain (3);Variant SH3 (1);	0.474289	0.24820	N	0.035336	T	0.08133	0.0203	L	0.49571	1.57	0.27850	N	0.940771	B	0.06786	0.001	B	0.08055	0.003	T	0.17137	-1.0379	10	0.54805	T	0.06	.	8.2007	0.31424	0.0:0.5992:0.2418:0.159	.	190	Q13588	GRAP_HUMAN	H	190;161	ENSP00000284154:R190H;ENSP00000378997:R161H	ENSP00000284154:R190H	R	-	2	0	GRAP	18866082	0.981000	0.34729	0.214000	0.23707	0.771000	0.43674	0.647000	0.24812	0.408000	0.25621	0.491000	0.48974	CGC	GRAP	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox	ENSG00000154016		0.692	GRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAP	HGNC	protein_coding	OTTHUMT00000132176.2	-	0.00	93	0	C	NM_006613		18925357	-1	tier1	-	no_errors	ENST00000284154	ensembl	human	known	74_37	missense	46.67	24	21	SNP	0.701	T
GSPT1	2935	genome.wustl.edu	37	16	11969646	11969646	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:11969646C>A	ENST00000563468.1	-	12	1445	c.1419G>T	c.(1417-1419)caG>caT	p.Q473H	GSPT1_ENST00000420576.2_Missense_Mutation_p.Q473H|GSPT1_ENST00000439887.2_Missense_Mutation_p.Q610H|RP11-166B2.8_ENST00000574364.1_RNA|GSPT1_ENST00000434724.2_Missense_Mutation_p.Q611H			P15170	ERF3A_HUMAN	G1 to S phase transition 1	473					G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						AACGACCCATCTGAGGGAAGT	0.443																																																	0													84.0	84.0	84.0					16																	11969646		2124	4273	6397	SO:0001583	missense	0			BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000563468.1:c.1419G>T	16.37:g.11969646C>A	ENSP00000454351:p.Gln473His		J3KQG6|Q96GF2	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_P-loop_NTPase,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_B-barrel,prints_EF_GTP-bd_dom	p.Q611H	ENST00000563468.1	37	c.1833	CCDS45414.1	16	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613492	0.46631	.	.	ENSG00000103342	ENST00000434724;ENST00000439887;ENST00000420576	T;T;T	0.47528	1.33;1.32;0.84	5.26	1.1	0.20463	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.000000	0.85682	U	0.000000	T	0.45875	0.1364	M	0.76002	2.32	0.58432	D	0.999994	P;P;B	0.35107	0.484;0.484;0.098	B;B;B	0.38616	0.216;0.277;0.129	T	0.40664	-0.9551	10	0.72032	D	0.01	-8.9455	6.099	0.20037	0.0:0.6297:0.1374:0.2329	.	610;607;473	E7EQZ3;Q96GF2;P15170	.;.;ERF3A_HUMAN	H	611;610;473	ENSP00000398131:Q611H;ENSP00000408399:Q610H;ENSP00000399539:Q473H	ENSP00000399539:Q473H	Q	-	3	2	GSPT1	11877147	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.557000	0.36299	0.222000	0.20900	0.467000	0.42956	CAG	GSPT1	-	pfam_Transl_elong_EFTu/EF1A_C,superfamily_Transl_elong_EF1A/Init_IF2_C	ENSG00000103342		0.443	GSPT1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	GSPT1	HGNC	protein_coding	OTTHUMT00000421513.1	-	0.00	84	0	C	NM_002094		11969646	-1	tier1	-	no_errors	ENST00000434724	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	A
GUCA1B	2979	genome.wustl.edu	37	6	42153445	42153445	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:42153445A>G	ENST00000230361.3	-	3	543	c.448T>C	c.(448-450)Ttc>Ctc	p.F150L		NM_002098.5	NP_002089.4	Q9UMX6	GUC1B_HUMAN	guanylate cyclase activator 1B (retina)	150	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				body fluid secretion (GO:0007589)|cell-cell signaling (GO:0007267)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			large_intestine(3)|lung(3)|skin(2)	8	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)			ACCAGGAGGAAGATCCTGTCC	0.572																																																	0													114.0	86.0	96.0					6																	42153445		2203	4300	6503	SO:0001583	missense	0			AF173227	CCDS4865.1	6p21.1	2013-02-14			ENSG00000112599	ENSG00000112599		"""EF-hand domain containing"""	4679	protein-coding gene	gene with protein product		602275				9119368	Standard	NM_002098		Approved	GCAP2, RP48	uc003orz.3	Q9UMX6	OTTHUMG00000014697	ENST00000230361.3:c.448T>C	6.37:g.42153445A>G	ENSP00000230361:p.Phe150Leu		Q9NU15	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.F150L	ENST00000230361.3	37	c.448	CCDS4865.1	6	.	.	.	.	.	.	.	.	.	.	A	28.2	4.899359	0.91962	.	.	ENSG00000112599	ENST00000230361;ENST00000372949	T	0.75821	-0.97	4.96	4.96	0.65561	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.65260	0.2674	N	0.21240	0.645	0.80722	D	1	P	0.36171	0.541	P	0.50490	0.642	T	0.73007	-0.4118	10	0.72032	D	0.01	.	13.241	0.59997	1.0:0.0:0.0:0.0	.	150	Q9UMX6	GUC1B_HUMAN	L	150;142	ENSP00000230361:F150L	ENSP00000230361:F150L	F	-	1	0	GUCA1B	42261423	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.759000	0.91667	2.165000	0.68154	0.528000	0.53228	TTC	GUCA1B	-	smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000112599		0.572	GUCA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1B	HGNC	protein_coding	OTTHUMT00000040550.1	-	0.00	35	0	A	NM_002098		42153445	-1	tier1	-	no_errors	ENST00000230361	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	G
HID1	283987	genome.wustl.edu	37	17	72956020	72956020	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:72956020C>A	ENST00000425042.2	-	8	1041	c.964G>T	c.(964-966)Gag>Tag	p.E322*	HID1_ENST00000532900.1_5'Flank	NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	322					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											AACAGGTTCTCAGGGCCTGGA	0.622																																																	0													102.0	96.0	98.0					17																	72956020		2203	4300	6503	SO:0001587	stop_gained	0				CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.964G>T	17.37:g.72956020C>A	ENSP00000413520:p.Glu322*		Q8N5L6|Q8TE83|Q9NT34	Nonsense_Mutation	SNP	pfam_Dymeclin	p.E322*	ENST00000425042.2	37	c.964	CCDS32726.1	17	.	.	.	.	.	.	.	.	.	.	C	38	7.091829	0.98059	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565;ENST00000530857	.	.	.	5.0	5.0	0.66597	.	0.111144	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-26.975	17.9002	0.88901	0.0:1.0:0.0:0.0	.	.	.	.	X	94;322;94;214	.	ENSP00000317795:E94X	E	-	1	0	C17orf28	70467615	1.000000	0.71417	0.954000	0.39281	0.718000	0.41266	5.974000	0.70465	2.291000	0.77112	0.561000	0.74099	GAG	HID1	-	NULL	ENSG00000167861		0.622	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HID1	HGNC	protein_coding	OTTHUMT00000390011.2		0.00	36	0	C	NM_030630		72956020	-1			no_errors	ENST00000425042	ensembl	human	known	74_37	nonsense	11.43	31	4	SNP	0.995	A
HPR	3250	genome.wustl.edu	37	16	72107693	72107694	+	Intron	DEL	GT	GT	-	rs575118944|rs146688744	byFrequency	TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:72107693_72107694delGT	ENST00000540303.2	+	2	37				HPR_ENST00000356967.5_Intron|HPR_ENST00000228226.8_Frame_Shift_Del_p.V7fs|HPR_ENST00000561690.1_Intron	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein							blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				gtgtgtgtgcgtgtgtgtgtgt	0.5																																																	0																																										SO:0001627	intron_variant	0			BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.6-97GT>-	16.37:g.72107703_72107704delGT			Q7LE20|Q92658|Q92659|Q9ULB0	Frame_Shift_Del	DEL	pirsf_Haptoglobin,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,superfamily_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.C10fs	ENST00000540303.2	37	c.19_20	CCDS42193.1	16																																																																																			HPR	-	NULL	ENSG00000261701		0.500	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPR	HGNC	protein_coding	OTTHUMT00000421696.1		0.00	20	0	GT	NM_020995		72107694	+1	tier1		no_errors	ENST00000228226	ensembl	human	known	74_37	frame_shift_del	9.68	28	3	DEL	0.010:0.011	-
IBTK	25998	genome.wustl.edu	37	6	82950160	82950160	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:82950160A>G	ENST00000306270.7	-	2	593	c.44T>C	c.(43-45)cTg>cCg	p.L15P	IBTK_ENST00000510291.1_Missense_Mutation_p.L15P|IBTK_ENST00000503631.1_Missense_Mutation_p.L15P	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	15					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)	p.L15R(1)		central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		AGCATGCTTCAGGGATCGACA	0.403																																																	1	Substitution - Missense(1)	lung(1)											141.0	135.0	137.0					6																	82950160		2203	4300	6503	SO:0001583	missense	0			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.44T>C	6.37:g.82950160A>G	ENSP00000305721:p.Leu15Pro		Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_RCC1/BLIP-II,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.L15P	ENST00000306270.7	37	c.44	CCDS34490.1	6	.	.	.	.	.	.	.	.	.	.	A	13.12	2.143769	0.37825	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.28255	1.92;1.62;1.93	5.33	4.17	0.49024	.	0.364206	0.29515	N	0.011935	T	0.23572	0.0570	M	0.63428	1.95	0.80722	D	1	P;P;D;P	0.54397	0.855;0.944;0.966;0.944	B;P;P;P	0.50708	0.36;0.462;0.648;0.462	T	0.03524	-1.1028	10	0.33141	T	0.24	-6.0603	6.7375	0.23417	0.7884:0.0:0.0747:0.1369	.	15;15;15;15	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	P	15	ENSP00000305721:L15P;ENSP00000422762:L15P;ENSP00000426405:L15P	ENSP00000305721:L15P	L	-	2	0	IBTK	83006879	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	2.250000	0.43178	2.144000	0.66660	0.459000	0.35465	CTG	IBTK	-	NULL	ENSG00000005700		0.403	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBTK	HGNC	protein_coding	OTTHUMT00000041337.2		0.00	46	0	A	NM_015525		82950160	-1			no_errors	ENST00000306270	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.949	G
IL1R2	7850	genome.wustl.edu	37	2	102632364	102632364	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:102632364G>T	ENST00000332549.3	+	4	593	c.364G>T	c.(364-366)Gag>Tag	p.E122*	IL1R2_ENST00000393414.2_Nonsense_Mutation_p.E122*|IL1R2_ENST00000441002.1_Nonsense_Mutation_p.E122*	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	122	Ig-like C2-type 1.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						AATGTCCATTGAGCTCAGAGT	0.363																																					Pancreas(106;189 1628 2302 5133 12295)												0													89.0	89.0	89.0					2																	102632364		2203	4300	6503	SO:0001587	stop_gained	0			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.364G>T	2.37:g.102632364G>T	ENSP00000330959:p.Glu122*		D3DVJ5|Q6LCE6|Q9UE68	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom,prints_IL-1_rcpt_II-typ,prints_IL-1_rcpt_I/II-typ	p.E122*	ENST00000332549.3	37	c.364	CCDS2054.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.964719	0.97151	.	.	ENSG00000115590	ENST00000332549;ENST00000393414;ENST00000457817;ENST00000441002	.	.	.	5.39	4.45	0.53987	.	0.738854	0.12985	N	0.422912	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	11.7125	0.51633	0.0:0.2742:0.7258:0.0	.	.	.	.	X	122	.	ENSP00000330959:E122X	E	+	1	0	IL1R2	101998796	0.997000	0.39634	0.777000	0.31699	0.996000	0.88848	3.504000	0.53347	2.511000	0.84671	0.655000	0.94253	GAG	IL1R2	-	smart_Ig_sub,pfscan_Ig-like_dom,prints_IL-1_rcpt_II-typ	ENSG00000115590		0.363	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1R2	HGNC	protein_coding	OTTHUMT00000253191.1	-	0.00	49	0	G	NM_004633		102632364	+1	tier1	-	no_errors	ENST00000332549	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	0.724	T
IMPG1	3617	genome.wustl.edu	37	6	76660728	76660728	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:76660728G>T	ENST00000369950.3	-	13	1564	c.1375C>A	c.(1375-1377)Ctg>Atg	p.L459M	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TGATCAGTCAGAGAGAAGATG	0.498																																					Pancreas(37;839 1141 2599 26037)												0													153.0	149.0	151.0					6																	76660728		2203	4300	6503	SO:0001583	missense	0			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1375C>A	6.37:g.76660728G>T	ENSP00000358966:p.Leu459Met			Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.L459M	ENST00000369950.3	37	c.1375	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	G	10.04	1.240643	0.22711	.	.	ENSG00000112706	ENST00000369950	T	0.21191	2.02	5.74	3.97	0.46021	.	0.584779	0.15520	N	0.258112	T	0.13970	0.0338	L	0.53249	1.67	0.09310	N	0.999995	D	0.53151	0.958	P	0.51016	0.656	T	0.07635	-1.0762	10	0.36615	T	0.2	.	8.9002	0.35490	0.2268:0.0:0.7732:0.0	.	459	Q17R60	IMPG1_HUMAN	M	459	ENSP00000358966:L459M	ENSP00000358966:L459M	L	-	1	2	IMPG1	76717448	0.409000	0.25368	0.731000	0.30826	0.013000	0.08279	2.824000	0.48088	0.784000	0.33661	-0.142000	0.14014	CTG	IMPG1	-	NULL	ENSG00000112706		0.498	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	-	0.00	53	0	G	NM_001563		76660728	-1	tier1	-	no_errors	ENST00000369950	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.007	T
INPP1	3628	genome.wustl.edu	37	2	191235631	191235631	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:191235631C>A	ENST00000322522.4	+	6	1159	c.703C>A	c.(703-705)Ctc>Atc	p.L235I	INPP1_ENST00000392329.2_Missense_Mutation_p.L235I|INPP1_ENST00000541441.1_Missense_Mutation_p.L235I	NM_002194.3	NP_002185.1	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	235					dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-1,3,4-trisphosphate 1-phosphatase activity (GO:0052829)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|metal ion binding (GO:0046872)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)			TTCACTACAGCTCACCATCTC	0.448																																					Melanoma(130;184 1743 2185 19805 38428)												0													181.0	187.0	185.0					2																	191235631		2203	4300	6503	SO:0001583	missense	0				CCDS2305.1	2q32	2008-02-07			ENSG00000151689	ENSG00000151689	3.1.3.57		6071	protein-coding gene	gene with protein product		147263				8390685	Standard	NM_002194		Approved		uc010fsb.3	P49441	OTTHUMG00000132672	ENST00000322522.4:c.703C>A	2.37:g.191235631C>A	ENSP00000325423:p.Leu235Ile			Missense_Mutation	SNP	pfam_Inositol_monophosphatase	p.L235I	ENST00000322522.4	37	c.703	CCDS2305.1	2	.	.	.	.	.	.	.	.	.	.	C	6.591	0.477316	0.12521	.	.	ENSG00000151689	ENST00000392329;ENST00000322522;ENST00000541441	T;T;T	0.56103	0.48;0.48;0.48	5.34	4.46	0.54185	.	1.411020	0.04311	N	0.348957	T	0.44850	0.1313	L	0.38838	1.175	0.09310	N	1	B	0.15930	0.015	B	0.12837	0.008	T	0.27226	-1.0080	10	0.22109	T	0.4	5.2621	7.9537	0.30029	0.0:0.8211:0.0:0.1789	.	235	P49441	INPP_HUMAN	I	235	ENSP00000376142:L235I;ENSP00000325423:L235I;ENSP00000440650:L235I	ENSP00000325423:L235I	L	+	1	0	INPP1	190943876	0.000000	0.05858	0.064000	0.19789	0.009000	0.06853	-0.312000	0.08113	1.491000	0.48482	0.449000	0.29647	CTC	INPP1	-	pfam_Inositol_monophosphatase	ENSG00000151689		0.448	INPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP1	HGNC	protein_coding	OTTHUMT00000255932.2	-	0.00	63	0	C			191235631	+1	tier1	-	no_errors	ENST00000322522	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.022	A
IQGAP1	8826	genome.wustl.edu	37	15	90931587	90931587	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:90931587A>G	ENST00000268182.5	+	1	138	c.14A>G	c.(13-15)gAc>gGc	p.D5G	IQGAP1_ENST00000560738.1_Missense_Mutation_p.D5G	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	5					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TCCGCCGCAGACGAGGTTGAC	0.706																																																	0													11.0	14.0	13.0					15																	90931587		2111	4155	6266	SO:0001583	missense	0			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.14A>G	15.37:g.90931587A>G	ENSP00000268182:p.Asp5Gly		A7MBM3	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,pfam_WW_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_WW_dom,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_dom,pfscan_RasGAP	p.D5G	ENST00000268182.5	37	c.14	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	A	14.34	2.504959	0.44558	.	.	ENSG00000140575	ENST00000268182	T	0.02395	4.31	3.36	3.36	0.38483	.	1.074220	0.07120	N	0.843763	T	0.02970	0.0088	N	0.22421	0.69	0.23747	N	0.996958	B	0.23058	0.079	B	0.19391	0.025	T	0.40021	-0.9585	10	0.66056	D	0.02	-7.2639	8.0581	0.30617	1.0:0.0:0.0:0.0	.	5	P46940	IQGA1_HUMAN	G	5	ENSP00000268182:D5G	ENSP00000268182:D5G	D	+	2	0	IQGAP1	88732591	0.998000	0.40836	0.901000	0.35422	0.436000	0.31835	4.535000	0.60629	1.405000	0.46838	0.260000	0.18958	GAC	IQGAP1	-	NULL	ENSG00000140575		0.706	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1	-	0.00	15	0	A	NM_003870		90931587	+1	tier1	-	no_errors	ENST00000268182	ensembl	human	known	74_37	missense	31.82	15	7	SNP	0.997	G
ITGA1	3672	genome.wustl.edu	37	5	52194096	52194096	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:52194096G>T	ENST00000282588.6	+	11	1650	c.1192G>T	c.(1192-1194)Gcc>Tcc	p.A398S		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	398					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				AGCAGTAGGAGCCTATGATTG	0.343																																																	0													78.0	71.0	73.0					5																	52194096		2202	4300	6502	SO:0001583	missense	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.1192G>T	5.37:g.52194096G>T	ENSP00000282588:p.Ala398Ser		B2RNU0	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A398S	ENST00000282588.6	37	c.1192	CCDS3955.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.406956	0.96051	.	.	ENSG00000213949	ENST00000282588	T	0.68181	-0.31	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.73305	0.3570	L	0.33753	1.03	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.64373	-0.6423	10	0.13470	T	0.59	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	398	P56199	ITA1_HUMAN	S	398	ENSP00000282588:A398S	ENSP00000282588:A398S	A	+	1	0	ITGA1	52229853	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.149000	0.94659	2.873000	0.98535	0.561000	0.74099	GCC	ITGA1	-	NULL	ENSG00000213949		0.343	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3	-	0.00	47	0	G	NM_181501		52194096	+1	tier1	-	no_errors	ENST00000282588	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
ITGB5	3693	genome.wustl.edu	37	3	124538659	124538659	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:124538659A>G	ENST00000296181.4	-	7	1261	c.965T>C	c.(964-966)cTt>cCt	p.L322P		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	322	VWFA.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TTTCTCTCCAAGCAAGGCAAG	0.478																																																	0													206.0	181.0	190.0					3																	124538659		2203	4300	6503	SO:0001583	missense	0			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.965T>C	3.37:g.124538659A>G	ENSP00000296181:p.Leu322Pro		B0LPF8|B2RD70	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_VWF_A,prints_Integrin_bsu	p.L322P	ENST00000296181.4	37	c.965	CCDS3030.1	3	.	.	.	.	.	.	.	.	.	.	A	23.3	4.399068	0.83120	.	.	ENSG00000082781	ENST00000296181	D	0.99319	-5.74	5.38	5.38	0.77491	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.134374	0.52532	D	0.000078	D	0.99444	0.9803	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98604	1.0660	10	0.87932	D	0	.	15.5495	0.76137	1.0:0.0:0.0:0.0	.	322	P18084	ITB5_HUMAN	P	322	ENSP00000296181:L322P	ENSP00000296181:L322P	L	-	2	0	ITGB5	126021349	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.107000	0.94261	2.248000	0.74166	0.460000	0.39030	CTT	ITGB5	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,smart_VWF_A,prints_Integrin_bsu	ENSG00000082781		0.478	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB5	HGNC	protein_coding	OTTHUMT00000355286.3	-	0.00	51	0	A	NM_002213		124538659	-1	tier1	-	no_errors	ENST00000296181	ensembl	human	known	74_37	missense	18.46	106	24	SNP	1.000	G
KHDC3L	154288	genome.wustl.edu	37	6	74072967	74072967	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:74072967G>A	ENST00000370367.3	+	2	372	c.319G>A	c.(319-321)Gct>Act	p.A107T		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	107							RNA binding (GO:0003723)										CATGAACCTGGCTGACTATCA	0.552																																																	0													96.0	91.0	93.0					6																	74072967		2203	4300	6503	SO:0001583	missense	0			AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	ENST00000370367.3:c.319G>A	6.37:g.74072967G>A	ENSP00000359392:p.Ala107Thr		B2RNW7	Missense_Mutation	SNP	NULL	p.A107T	ENST00000370367.3	37	c.319	CCDS34484.1	6	.	.	.	.	.	.	.	.	.	.	G	15.55	2.868245	0.51588	.	.	ENSG00000203908	ENST00000370367	T	0.42513	0.97	3.52	2.65	0.31530	.	0.162920	0.29348	N	0.012416	T	0.44746	0.1308	M	0.72118	2.19	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.19257	-1.0311	10	0.66056	D	0.02	-17.3412	6.8679	0.24104	0.1259:0.0:0.8741:0.0	.	107	Q587J8	ECAT1_HUMAN	T	107	ENSP00000359392:A107T	ENSP00000359392:A107T	A	+	1	0	C6orf221	74129688	0.995000	0.38212	0.046000	0.18839	0.011000	0.07611	2.481000	0.45215	1.072000	0.40860	-0.136000	0.14681	GCT	KHDC3L	-	NULL	ENSG00000203908		0.552	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDC3L	HGNC	protein_coding	OTTHUMT00000041202.3	-	0.00	44	0	G	NM_001017361		74072967	+1	tier1	-	no_errors	ENST00000370367	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.061	A
KIF18B	146909	genome.wustl.edu	37	17	43013493	43013493	+	Silent	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:43013493G>T	ENST00000593135.1	-	2	317	c.220C>A	c.(220-222)Cgg>Agg	p.R74R	KIF18B_ENST00000590129.1_Silent_p.R83R|KIF18B_ENST00000438933.2_Silent_p.R74R|KIF18B_ENST00000339151.4_Silent_p.R74R|KIF18B_ENST00000587309.1_Silent_p.R74R	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	83	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				CCAAAGACCCGGTCAAAGACA	0.597																																																	0													41.0	48.0	46.0					17																	43013493		2103	4226	6329	SO:0001819	synonymous_variant	0				CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.220C>A	17.37:g.43013493G>T			A6NJI2|B7ZM49|B9EGM8|D5L6I1	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R74	ENST00000593135.1	37	c.220	CCDS45709.2	17																																																																																			KIF18B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000186185		0.597	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	KIF18B	HGNC	protein_coding	OTTHUMT00000448724.1		0.00	79	0	G	NM_001080443		43013493	-1			no_errors	ENST00000339151	ensembl	human	known	74_37	silent	5.26	72	4	SNP	1.000	T
KIF1B	23095	genome.wustl.edu	37	1	10333085	10333085	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:10333085G>T	ENST00000377086.1	+	10	1080	c.878G>T	c.(877-879)aGc>aTc	p.S293I	KIF1B_ENST00000377093.4_Intron|KIF1B_ENST00000377083.1_Intron|KIF1B_ENST00000263934.6_Intron|KIF1B_ENST00000377081.1_Missense_Mutation_p.S293I			O60333	KIF1B_HUMAN	kinesin family member 1B	293	Interaction with KBP.|Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AACTGCACTAGCAAGGTACAG	0.353																																																	0																																										SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.878G>T	1.37:g.10333085G>T	ENSP00000366290:p.Ser293Ile		A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S293I	ENST00000377086.1	37	c.878		1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.980717	0.74474	.	.	ENSG00000054523	ENST00000377086;ENST00000377081	D;D	0.88277	-2.36;-2.36	5.53	5.53	0.82687	Kinesin, motor domain (3);	2.852280	0.02050	N	0.049984	D	0.92825	0.7718	.	.	.	0.45129	D	0.998141	P;B;B;P;P	0.45396	0.857;0.034;0.311;0.647;0.507	P;B;B;P;B	0.48770	0.589;0.044;0.144;0.516;0.433	T	0.81106	-0.1083	9	0.52906	T	0.07	.	19.5205	0.95183	0.0:0.0:1.0:0.0	.	293;293;293;293;293	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333	.;.;.;.;KIF1B_HUMAN	I	293	ENSP00000366290:S293I;ENSP00000366284:S293I	ENSP00000366284:S293I	S	+	2	0	KIF1B	10255672	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	3.853000	0.55941	2.623000	0.88846	0.558000	0.71614	AGC	KIF1B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom	ENSG00000054523		0.353	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	-	0.00	58	0	G			10333085	+1	tier1	-	no_errors	ENST00000377081	ensembl	human	putative	74_37	missense	8.70	42	4	SNP	1.000	T
L3MBTL3	84456	genome.wustl.edu	37	6	130415449	130415449	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:130415449G>T	ENST00000529410.1	+	20	2152	c.1673G>T	c.(1672-1674)tGc>tTc	p.C558F	L3MBTL3_ENST00000526019.1_Missense_Mutation_p.C533F|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.C558F|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.C533F|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.C533F|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.C558F			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	558					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		CATGGTGGATGCTCAACCCCG	0.448																																																	0													82.0	80.0	80.0					6																	130415449		2203	4300	6503	SO:0001583	missense	0			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1673G>T	6.37:g.130415449G>T	ENSP00000431962:p.Cys558Phe		Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.C558F	ENST00000529410.1	37	c.1673	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226662	0.79576	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.28255	1.62;1.66;1.62;1.66;1.66;1.62	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.996;1.0	T	0.61337	-0.7083	10	0.62326	D	0.03	.	16.9999	0.86378	0.0:0.0:1.0:0.0	.	533;558	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	F	558;533;558;533;533;558	ENSP00000431962:C558F;ENSP00000437185:C533F;ENSP00000354526:C558F;ENSP00000357121:C533F;ENSP00000436706:C533F;ENSP00000357118:C558F	ENSP00000354526:C558F	C	+	2	0	L3MBTL3	130457142	1.000000	0.71417	0.970000	0.41538	0.840000	0.47671	7.816000	0.86201	2.751000	0.94390	0.650000	0.86243	TGC	L3MBTL3	-	NULL	ENSG00000198945		0.448	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2	-	0.00	50	0	G	XM_027074		130415449	+1	tier1	-	no_errors	ENST00000361794	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
LEO1	123169	genome.wustl.edu	37	15	52244058	52244058	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:52244058G>A	ENST00000299601.5	-	9	1654	c.1594C>T	c.(1594-1596)Cgc>Tgc	p.R532C	LEO1_ENST00000315141.5_Missense_Mutation_p.R472C	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	532					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		ATTTCTGTGCGTTGGCATTCA	0.418																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0													203.0	166.0	179.0					15																	52244058		2195	4293	6488	SO:0001583	missense	0			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1594C>T	15.37:g.52244058G>A	ENSP00000299601:p.Arg532Cys		Q96N99	Missense_Mutation	SNP	pfam_Leo1	p.R532C	ENST00000299601.5	37	c.1594	CCDS10146.1	15	.	.	.	.	.	.	.	.	.	.	.	23.5	4.428363	0.83667	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.63	5.63	0.86233	.	0.047340	0.85682	D	0.000000	T	0.72431	0.3459	M	0.66439	2.03	0.80722	D	1	P;B	0.51933	0.949;0.216	P;B	0.51415	0.669;0.044	T	0.74506	-0.3643	9	0.59425	D	0.04	.	19.6961	0.96026	0.0:0.0:1.0:0.0	.	472;532	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	C	532;510;472	.	ENSP00000299601:R532C	R	-	1	0	LEO1	50031350	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.638000	0.83328	2.654000	0.90174	0.650000	0.86243	CGC	LEO1	-	pfam_Leo1	ENSG00000166477		0.418	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	HGNC	protein_coding	OTTHUMT00000254791.2	-	0.00	51	0	G	NM_138792		52244058	-1	tier1	-	no_errors	ENST00000299601	ensembl	human	known	74_37	missense	36.17	30	17	SNP	1.000	A
LGI1	9211	genome.wustl.edu	37	10	95537161	95537161	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr10:95537161G>T	ENST00000371418.4	+	3	573	c.313G>T	c.(313-315)Gtg>Ttg	p.V105L	LGI1_ENST00000542308.1_Intron|LGI1_ENST00000371413.3_Missense_Mutation_p.V105L	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	105					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				CTCCTTTGATGTGATCAGTGA	0.353																																																	0													122.0	111.0	115.0					10																	95537161		2203	4300	6503	SO:0001583	missense	0			AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.313G>T	10.37:g.95537161G>T	ENSP00000360472:p.Val105Leu		A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	pfam_EPTP,pfam_Leu-rich_rpt,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.V105L	ENST00000371418.4	37	c.313	CCDS7431.1	10	.	.	.	.	.	.	.	.	.	.	G	13.74	2.328390	0.41197	.	.	ENSG00000108231	ENST00000371418;ENST00000371413	D;D	0.90069	-2.61;-2.61	6.17	6.17	0.99709	.	0.295570	0.35708	N	0.003040	D	0.82893	0.5136	N	0.26162	0.8	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.12837	0.005;0.008	T	0.76841	-0.2810	10	0.07325	T	0.83	-6.2332	20.8794	0.99867	0.0:0.0:1.0:0.0	.	105;105	O95970-2;O95970	.;LGI1_HUMAN	L	105	ENSP00000360472:V105L;ENSP00000360467:V105L	ENSP00000360467:V105L	V	+	1	0	LGI1	95527151	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.511000	0.60462	2.941000	0.99782	0.655000	0.94253	GTG	LGI1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000108231		0.353	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI1	HGNC	protein_coding	OTTHUMT00000049445.1	-	0.00	47	0	G	NM_005097		95537161	+1	tier1	-	no_errors	ENST00000371418	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
LINC00693	645206	genome.wustl.edu	37	3	28616545	28616545	+	RNA	SNP	C	C	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:28616545C>G	ENST00000432518.2	+	0	264				LINC00693_ENST00000445077.1_RNA|LINC00693_ENST00000443912.1_RNA	NR_038840.1				long intergenic non-protein coding RNA 693																		CTCGCCATCTCTATTTAAATT	0.512																																																	0																																												0					3p24.1	2012-11-14			ENSG00000228214	ENSG00000228214		"""Long non-coding RNAs"""	44526	non-coding RNA	RNA, long non-coding							Standard	NR_038840		Approved		uc021wur.1		OTTHUMG00000155718		3.37:g.28616545C>G				RNA	SNP	-	NULL	ENST00000432518.2	37	NULL		3																																																																																			LINC00693	-	-	ENSG00000228214		0.512	LINC00693-001	KNOWN	basic	antisense	LINC00693	HGNC	antisense	OTTHUMT00000341375.2	-	0.00	23	0	C			28616545	+1	tier1	-	no_errors	ENST00000432518	ensembl	human	known	74_37	rna	40.00	12	8	SNP	0.001	G
LIPN	643418	genome.wustl.edu	37	10	90528642	90528642	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr10:90528642G>A	ENST00000404459.1	+	5	629	c.629G>A	c.(628-630)gGc>gAc	p.G210D		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	210					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		TATCCCACGGGCATTTTTACC	0.398																																																	0													102.0	96.0	98.0					10																	90528642		1805	4066	5871	SO:0001583	missense	0				CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.629G>A	10.37:g.90528642G>A	ENSP00000383923:p.Gly210Asp		A7KIH9	Missense_Mutation	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.G210D	ENST00000404459.1	37	c.629	CCDS44456.1	10	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841116	0.51057	.	.	ENSG00000204020	ENST00000404459	T	0.70282	-0.47	4.6	4.6	0.57074	Alpha/beta hydrolase fold-1 (1);	0.355674	0.24590	N	0.037235	T	0.75561	0.3866	M	0.67700	2.07	0.09310	N	1	P	0.40731	0.728	P	0.47603	0.551	T	0.71570	-0.4553	10	0.87932	D	0	-2.6343	14.4421	0.67325	0.0:0.0:1.0:0.0	.	210	Q5VXI9	LIPN_HUMAN	D	210	ENSP00000383923:G210D	ENSP00000383923:G210D	G	+	2	0	LIPN	90518622	0.220000	0.23631	0.027000	0.17364	0.762000	0.43233	3.397000	0.52572	2.374000	0.81015	0.585000	0.79938	GGC	LIPN	-	pfam_AB_hydrolase_1	ENSG00000204020		0.398	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPN	HGNC	protein_coding	OTTHUMT00000049254.2	-	0.00	50	0	G	XM_926751		90528642	+1	tier1	-	no_errors	ENST00000404459	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.014	A
LMX1A	4009	genome.wustl.edu	37	1	165218762	165218762	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:165218762G>A	ENST00000342310.3	-	4	761	c.379C>T	c.(379-381)Cga>Tga	p.R127*	LMX1A_ENST00000367893.4_Nonsense_Mutation_p.R127*|LMX1A_ENST00000294816.2_Nonsense_Mutation_p.R127*	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	127	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					TGAAGCTGTCGCTCGCAGACA	0.582																																																	0													65.0	63.0	64.0					1																	165218762		2203	4300	6503	SO:0001587	stop_gained	0			AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.379C>T	1.37:g.165218762G>A	ENSP00000340226:p.Arg127*		B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Nonsense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.R127*	ENST00000342310.3	37	c.379	CCDS1247.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.879041	0.97904	.	.	ENSG00000162761	ENST00000342310;ENST00000294816;ENST00000367893	.	.	.	4.61	4.61	0.57282	.	0.253247	0.39985	N	0.001219	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1081	0.53823	0.0:0.0:0.8277:0.1723	.	.	.	.	X	127	.	ENSP00000294816:R127X	R	-	1	2	LMX1A	163485386	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.889000	0.56212	2.395000	0.81488	0.585000	0.79938	CGA	LMX1A	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000162761		0.582	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMX1A	HGNC	protein_coding	OTTHUMT00000083668.2	-	0.00	43	0	G	NM_177398		165218762	-1	tier1	-	no_errors	ENST00000294816	ensembl	human	known	74_37	nonsense	46.67	16	14	SNP	1.000	A
TENM4	26011	genome.wustl.edu	37	11	78807960	78807961	+	Intron	INS	-	-	GC	rs376867043|rs66695606|rs369257696|rs398016808		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:78807960_78807961insGC	ENST00000278550.7	-	5	398				CTD-2337I7.1_ENST00000526091.1_lincRNA	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4						cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TGcacgcacatgcgcgcgcgcg	0.485																																																	0																																										SO:0001627	intron_variant	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.65-26906->GC	11.37:g.78807969_78807970dupGC			A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	RNA	INS	-	NULL	ENST00000278550.7	37	NULL	CCDS44688.1	11																																																																																			CTD-2337I7.1	-	-	ENSG00000255345		0.485	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928921	Clone_based_vega_gene	protein_coding	OTTHUMT00000391406.2		0.00	20	0	-			78807961	+1	tier1		no_errors	ENST00000526091	ensembl	human	known	74_37	rna	15.38	11	2	INS	0.000:0.000	GC
LOC202181	202181	genome.wustl.edu	37	5	177099071	177099071	+	RNA	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:177099071A>G	ENST00000515045.1	-	0	139					NR_026921.1																						ggcccggcgcagcctccgcga	0.746																																																	0																																												0																															5.37:g.177099071A>G				RNA	SNP	-	NULL	ENST00000515045.1	37	NULL		5																																																																																			RP11-1277A3.2	-	-	ENSG00000246596		0.746	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	LOC202181	Clone_based_vega_gene	pseudogene	OTTHUMT00000373167.1		0.00	10	0	A			177099071	-1			no_errors	ENST00000515045	ensembl	human	known	74_37	rna	33.33	6	3	SNP	0.988	G
LPAR5	57121	genome.wustl.edu	37	12	6729479	6729479	+	Silent	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:6729479G>T	ENST00000329858.4	-	2	1692	c.936C>A	c.(934-936)ggC>ggA	p.G312G	LPAR5_ENST00000431922.1_Silent_p.G312G|LPAR5_ENST00000540335.1_5'Flank	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						GGTGCGGAGTGCCCAGGCCGC	0.706																																					NSCLC(74;891 2312 37538)												0													12.0	16.0	15.0					12																	6729479		2195	4282	6477	SO:0001819	synonymous_variant	0			AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0		ENST00000329858.4:c.936C>A	12.37:g.6729479G>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.G312	ENST00000329858.4	37	c.936	CCDS8553.1	12																																																																																			LPAR5	-	NULL	ENSG00000184574		0.706	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR5	HGNC	protein_coding	OTTHUMT00000400699.1		0.00	12	0	G	NM_020400		6729479	-1			no_errors	ENST00000329858	ensembl	human	known	74_37	silent	6.67	28	2	SNP	0.002	T
MALAT1	378938	genome.wustl.edu	37	11	65271780	65271780	+	lincRNA	DEL	T	T	-	rs36002528		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:65271780delT	ENST00000534336.1	+	0	6548					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTGTTGTAGCTTTTTTTTTTT	0.433																																																	0													25.0	28.0	27.0					11																	65271780		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271780delT				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.433	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	30	0	T	NR_002819		65271780	+1	tier1		no_errors	ENST00000534336	ensembl	human	known	74_37	rna	19.05	17	4	DEL	0.994	-
MAN1B1	11253	genome.wustl.edu	37	9	139998105	139998105	+	Intron	SNP	C	C	A	rs563560301	byFrequency	TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:139998105C>A	ENST00000371589.4	+	8	1327				MAN1B1_ENST00000474902.1_Intron|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		TACACACATTCACACTTGCAG	0.552													-|||	4	0.000798722	0.0	0.0058	5008	,	,		26494	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1254+1981C>A	9.37:g.139998105C>A			Q5VSG3|Q9BRS9|Q9Y5K7	RNA	SNP	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			MAN1B1	-	-	ENSG00000177239		0.552	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	-	0.00	74	0	C	NM_016219		139998105	+1	tier1	-	no_errors	ENST00000540391	ensembl	human	known	74_37	rna	6.16	132	9	SNP	0.453	A
MAP1B	4131	genome.wustl.edu	37	5	71493451	71493451	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:71493451A>T	ENST00000296755.7	+	5	4567	c.4269A>T	c.(4267-4269)agA>agT	p.R1423S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1423					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CTTCTGGCAGAGGTGCCGAAA	0.438																																					Melanoma(17;367 822 11631 31730 47712)												0													45.0	47.0	46.0					5																	71493451		2203	4299	6502	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4269A>T	5.37:g.71493451A>T	ENSP00000296755:p.Arg1423Ser		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.R1423S	ENST00000296755.7	37	c.4269	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	A	3.789	-0.044143	0.07452	.	.	ENSG00000131711	ENST00000296755	T	0.03717	3.83	5.15	2.72	0.32119	.	0.087877	0.49916	D	0.000133	T	0.02342	0.0072	N	0.24115	0.695	0.21697	N	0.99958	B;P	0.35328	0.255;0.495	B;B	0.24974	0.057;0.057	T	0.49153	-0.8969	10	0.29301	T	0.29	-10.2232	9.1202	0.36782	0.8488:0.0:0.1512:0.0	.	1297;1423	A2BDK6;P46821	.;MAP1B_HUMAN	S	1423	ENSP00000296755:R1423S	ENSP00000296755:R1423S	R	+	3	2	MAP1B	71529207	0.999000	0.42202	0.013000	0.15412	0.149000	0.21700	4.120000	0.57897	0.777000	0.33496	0.454000	0.30748	AGA	MAP1B	-	NULL	ENSG00000131711		0.438	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	-	0.00	45	0	A	NM_005909		71493451	+1	tier1	-	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.228	T
MICALL1	85377	genome.wustl.edu	37	22	38328811	38328811	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr22:38328811G>A	ENST00000215957.6	+	12	2276	c.2150G>A	c.(2149-2151)cGt>cAt	p.R717H	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	717	Necessary and sufficient to associate with tubular recycling endosome membranes, mediate phosphatidic acid- binding and membrane tubulation.|RAB-binding domain (RBD); mediates the interaction with RAB13 and RAB35 and intramolecular interaction with the CH domain.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					CCAGAGGGCCGTGAGGATGAC	0.637																																																	0													75.0	63.0	67.0					22																	38328811		2203	4300	6503	SO:0001583	missense	0			BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.2150G>A	22.37:g.38328811G>A	ENSP00000215957:p.Arg717His		Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.R717H	ENST00000215957.6	37	c.2150	CCDS13961.1	22	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984883	0.53934	.	.	ENSG00000100139	ENST00000215957;ENST00000402631;ENST00000424008	T;T;T	0.44083	0.93;0.93;0.93	5.17	2.92	0.33932	Domain of unknown function DUF3585 (1);	0.580733	0.17003	N	0.190850	T	0.25005	0.0607	N	0.25647	0.755	0.40785	D	0.983209	B	0.16603	0.018	B	0.15484	0.013	T	0.21655	-1.0239	10	0.56958	D	0.05	.	2.2797	0.04111	0.1741:0.1963:0.4955:0.1341	.	717	Q8N3F8	MILK1_HUMAN	H	717;144;31	ENSP00000215957:R717H;ENSP00000384608:R144H;ENSP00000416766:R31H	ENSP00000215957:R717H	R	+	2	0	MICALL1	36658757	0.286000	0.24305	0.998000	0.56505	0.982000	0.71751	0.836000	0.27545	1.302000	0.44855	0.591000	0.81541	CGT	MICALL1	-	pfam_DUF3585	ENSG00000100139		0.637	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL1	HGNC	protein_coding	OTTHUMT00000319545.4	-	0.00	87	0	G	NM_033386		38328811	+1	tier1	-	no_errors	ENST00000215957	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.995	A
MIR720	0	genome.wustl.edu	37	3	164059129	164059129	+	RNA	SNP	C	C	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:164059129C>G	ENST00000408828.1	+	0	1																											tggagcgagaccggatctcac	0.572																																																	0													18.0	19.0	19.0					3																	164059129		1560	3552	5112			0																															3.37:g.164059129C>G				RNA	SNP	-	NULL	ENST00000408828.1	37	NULL		3																																																																																			MIR720	-	-	ENSG00000221755		0.572	MIR720-201	KNOWN	basic	miRNA	MIR720	HGNC	miRNA		-	0.00	92	0	C			164059129	+1	tier1	-	no_errors	ENST00000408828	ensembl	human	known	74_37	rna	11.39	179	23	SNP	0.049	G
MLKL	197259	genome.wustl.edu	37	16	74729477	74729477	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:74729477G>T	ENST00000308807.7	-	2	642	c.179C>A	c.(178-180)aCa>aAa	p.T60K	MLKL_ENST00000306247.7_Missense_Mutation_p.T60K	NM_152649.2	NP_689862.1			mixed lineage kinase domain-like											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(6)|skin(1)|stomach(2)	19						GTTCATGGCTGTGGTTAACTT	0.562																																																	0													99.0	96.0	97.0					16																	74729477		2198	4300	6498	SO:0001583	missense	0			AK091708	CCDS32487.1, CCDS45528.1	16q22.3	2008-02-05				ENSG00000168404			26617	protein-coding gene	gene with protein product		615153				12477932	Standard	NM_152649		Approved	FLJ34389	uc002fdb.2	Q8NB16		ENST00000308807.7:c.179C>A	16.37:g.74729477G>T	ENSP00000308351:p.Thr60Lys			Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T60K	ENST00000308807.7	37	c.179	CCDS32487.1	16	.	.	.	.	.	.	.	.	.	.	G	10.34	1.324292	0.24080	.	.	ENSG00000168404	ENST00000308807;ENST00000306247	T;T	0.77358	-1.09;2.88	4.42	-3.79	0.04320	.	1.499060	0.03646	N	0.240367	T	0.60379	0.2264	N	0.24115	0.695	0.09310	N	1	B;B	0.30236	0.274;0.022	B;B	0.25405	0.06;0.006	T	0.45948	-0.9226	10	0.19147	T	0.46	0.9441	8.0105	0.30351	0.0884:0.0:0.234:0.6776	.	60;60	Q8NB16-2;Q8NB16	.;MLKL_HUMAN	K	60	ENSP00000308351:T60K;ENSP00000303118:T60K	ENSP00000303118:T60K	T	-	2	0	MLKL	73286978	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.020000	0.03618	-0.350000	0.08262	-0.188000	0.12872	ACA	MLKL	-	NULL	ENSG00000168404		0.562	MLKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLKL	HGNC	protein_coding	OTTHUMT00000436403.3		0.00	53	0	G	NM_152649		74729477	-1			no_errors	ENST00000308807	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.000	T
MLLT1	4298	genome.wustl.edu	37	19	6230661	6230661	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:6230661C>T	ENST00000252674.7	-	4	503	c.340G>A	c.(340-342)Gtg>Atg	p.V114M		NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	114					negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)	p.V114M(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						AGGTGGTTCACGGGCGGGTTG	0.612			T	MLL	AL																																			Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	1	Substitution - Missense(1)	endometrium(1)											169.0	169.0	169.0					19																	6230661		2203	4300	6503	SO:0001583	missense	0				CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.340G>A	19.37:g.6230661C>T	ENSP00000252674:p.Val114Met		Q14768	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.V114M	ENST00000252674.7	37	c.340	CCDS12160.1	19	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869774	0.72065	.	.	ENSG00000130382	ENST00000252674	.	.	.	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.78509	0.4294	M	0.81802	2.56	0.80722	D	1	D	0.65815	0.995	D	0.63381	0.914	T	0.82364	-0.0494	9	0.87932	D	0	-28.3179	16.3961	0.83605	0.0:1.0:0.0:0.0	.	114	Q03111	ENL_HUMAN	M	114	.	ENSP00000252674:V114M	V	-	1	0	MLLT1	6181661	1.000000	0.71417	0.511000	0.27724	0.409000	0.31022	7.514000	0.81750	2.427000	0.82271	0.655000	0.94253	GTG	MLLT1	-	NULL	ENSG00000130382		0.612	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLLT1	HGNC	protein_coding	OTTHUMT00000452909.1	-	0.00	51	0	C	NM_005934		6230661	-1	tier1	-	no_errors	ENST00000252674	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
MLLT3	4300	genome.wustl.edu	37	9	20414280	20414280	+	Silent	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:20414280G>A	ENST00000380338.4	-	5	850	c.564C>T	c.(562-564)agC>agT	p.S188S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S185S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	188	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S188S(1)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TGGTActactgctgctgctgc	0.502			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	1	Substitution - coding silent(1)	large_intestine(1)											77.0	84.0	82.0					9																	20414280		2203	4300	6503	SO:0001819	synonymous_variant	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.564C>T	9.37:g.20414280G>A			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	pfam_YEATS,pfscan_YEATS	p.S188	ENST00000380338.4	37	c.564	CCDS6494.1	9																																																																																			MLLT3	-	NULL	ENSG00000171843		0.502	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1		0.00	37	0	G	NM_004529		20414280	-1			no_errors	ENST00000380338	ensembl	human	known	74_37	silent	7.14	26	2	SNP	1.000	A
MMP9	4318	genome.wustl.edu	37	20	44637670	44637670	+	Silent	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr20:44637670G>T	ENST00000372330.3	+	1	124	c.105G>T	c.(103-105)ctG>ctT	p.L35L		NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	35					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L35L(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	CTGGAGACCTGAGAACCAATC	0.627																																																	1	Substitution - coding silent(1)	ovary(1)											48.0	40.0	43.0					20																	44637670		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.105G>T	20.37:g.44637670G>T			B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin-like_repeat,pfam_PT,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin-like_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A	p.L35	ENST00000372330.3	37	c.105	CCDS13390.1	20																																																																																			MMP9	-	superfamily_Peptidoglycan-bd-like	ENSG00000100985		0.627	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP9	HGNC	protein_coding	OTTHUMT00000080337.1		0.00	36	0	G			44637670	+1			no_errors	ENST00000372330	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.003	T
MON2	23041	genome.wustl.edu	37	12	62887805	62887805	+	Missense_Mutation	SNP	C	C	A	rs375291950		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:62887805C>A	ENST00000393632.2	+	3	677	c.286C>A	c.(286-288)Cat>Aat	p.H96N	MON2_ENST00000552738.1_Missense_Mutation_p.H96N|MON2_ENST00000393629.2_Missense_Mutation_p.H96N|MON2_ENST00000552115.1_Missense_Mutation_p.H96N|MON2_ENST00000549378.1_Intron|MON2_ENST00000393630.3_Missense_Mutation_p.H96N|MON2_ENST00000280379.6_Missense_Mutation_p.H96N|MON2_ENST00000546600.1_Missense_Mutation_p.H96N	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	96					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		ACTCATGTCACATGAAGTCGT	0.388																																																	0													102.0	90.0	94.0					12																	62887805		2203	4300	6503	SO:0001583	missense	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.286C>A	12.37:g.62887805C>A	ENSP00000377252:p.His96Asn		A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold	p.H96N	ENST00000393632.2	37	c.286	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034279	0.75617	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.65916	-0.09;-0.18;-0.18;-0.09;-0.09;-0.18;1.51	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.70107	0.3186	M	0.73598	2.24	0.80722	D	1	P;P;P;P	0.52316	0.952;0.725;0.508;0.846	P;P;B;P	0.47299	0.475;0.543;0.173;0.452	T	0.72110	-0.4389	9	.	.	.	-14.4243	19.4482	0.94857	0.0:1.0:0.0:0.0	.	96;96;96;96	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	N	96;96;96;96;24;96;96;96	ENSP00000377252:H96N;ENSP00000377250:H96N;ENSP00000280379:H96N;ENSP00000447407:H96N;ENSP00000449215:H96N;ENSP00000377249:H96N;ENSP00000446635:H96N	.	H	+	1	0	MON2	61174072	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.677000	0.91161	0.591000	0.81541	CAT	MON2	-	superfamily_ARM-type_fold	ENSG00000061987		0.388	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	-	0.00	50	0	C	NM_015026		62887805	+1	tier1	-	no_errors	ENST00000393630	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	A
MPEG1	219972	genome.wustl.edu	37	11	58979273	58979273	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:58979273G>T	ENST00000361050.3	-	1	1151	c.1066C>A	c.(1066-1068)Ccc>Acc	p.P356T	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	356						integral component of membrane (GO:0016021)		p.P356A(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				TTGAAGTTGGGAGAATTGAGA	0.502																																																	1	Substitution - Missense(1)	NS(1)											95.0	92.0	93.0					11																	58979273		1924	4131	6055	SO:0001583	missense	0			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1066C>A	11.37:g.58979273G>T	ENSP00000354335:p.Pro356Thr		Q2M1T6|Q8TEF8	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.P356T	ENST00000361050.3	37	c.1066	CCDS41650.1	11	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711878	0.48517	.	.	ENSG00000197629	ENST00000361050	T	0.25085	1.82	5.73	5.73	0.89815	.	0.122641	0.53938	D	0.000047	T	0.53302	0.1788	M	0.78049	2.395	0.43321	D	0.995346	D	0.76494	0.999	D	0.72075	0.976	T	0.54748	-0.8247	10	0.66056	D	0.02	-29.4381	16.8192	0.85741	0.0:0.0:1.0:0.0	.	356	Q2M385	MPEG1_HUMAN	T	356	ENSP00000354335:P356T	ENSP00000354335:P356T	P	-	1	0	MPEG1	58735849	0.997000	0.39634	0.937000	0.37676	0.540000	0.34992	2.436000	0.44819	2.722000	0.93159	0.655000	0.94253	CCC	MPEG1	-	NULL	ENSG00000197629		0.502	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPEG1	HGNC	protein_coding	OTTHUMT00000370027.1		0.00	69	0	G	NM_001039396		58979273	-1			no_errors	ENST00000361050	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.991	T
MTF2	22823	genome.wustl.edu	37	1	93599533	93599533	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:93599533A>G	ENST00000370298.4	+	13	1604	c.1315A>G	c.(1315-1317)Ata>Gta	p.I439V	MTF2_ENST00000540243.1_Missense_Mutation_p.I337V|MTF2_ENST00000545708.1_Missense_Mutation_p.I337V|MTF2_ENST00000370303.4_Missense_Mutation_p.I382V|MTF2_ENST00000471953.1_3'UTR	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	439					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		ACCTTGTTCTATAGGGTAAAT	0.264																																																	0													85.0	91.0	89.0					1																	93599533		2189	4293	6482	SO:0001583	missense	0			AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.1315A>G	1.37:g.93599533A>G	ENSP00000359321:p.Ile439Val		A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.I439V	ENST00000370298.4	37	c.1315	CCDS742.1	1	.	.	.	.	.	.	.	.	.	.	A	5.659	0.306208	0.10733	.	.	ENSG00000143033	ENST00000545708;ENST00000540243;ENST00000370298;ENST00000370303	T;T;T;T	0.28255	1.62;1.62;2.04;2.01	5.18	3.98	0.46160	.	0.498041	0.23347	N	0.049169	T	0.06600	0.0169	N	0.19112	0.55	0.24160	N	0.995661	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.17592	-1.0364	10	0.27082	T	0.32	-1.3495	6.4454	0.21873	0.75:0.1596:0.0905:0.0	.	382;439;337	B1AKT6;Q9Y483;B4DZG1	.;MTF2_HUMAN;.	V	337;337;439;382	ENSP00000444962:I337V;ENSP00000443295:I337V;ENSP00000359321:I439V;ENSP00000359326:I382V	ENSP00000359321:I439V	I	+	1	0	MTF2	93372121	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.447000	0.35101	2.080000	0.62538	0.533000	0.62120	ATA	MTF2	-	NULL	ENSG00000143033		0.264	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF2	HGNC	protein_coding	OTTHUMT00000028075.3	-	0.00	36	0	A	NM_007358		93599533	+1	tier1	-	no_errors	ENST00000370298	ensembl	human	known	74_37	missense	44.44	10	8	SNP	1.000	G
MYO5C	55930	genome.wustl.edu	37	15	52510733	52510733	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:52510733G>T	ENST00000261839.7	-	32	4098	c.3937C>A	c.(3937-3939)Ctc>Atc	p.L1313I		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1313						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TCCAAAGTGAGCCGGGATGCT	0.448																																																	0													80.0	76.0	77.0					15																	52510733		1897	4123	6020	SO:0001583	missense	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3937C>A	15.37:g.52510733G>T	ENSP00000261839:p.Leu1313Ile		Q6P1W8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1313I	ENST00000261839.7	37	c.3937	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	G	15.33	2.800658	0.50315	.	.	ENSG00000128833	ENST00000261839	T	0.38401	1.14	5.66	5.66	0.87406	.	0.075522	0.51477	D	0.000095	T	0.36413	0.0966	N	0.19112	0.55	0.80722	D	1	D	0.56968	0.978	P	0.50590	0.645	T	0.09058	-1.0692	10	0.44086	T	0.13	.	17.9318	0.88999	0.0:0.0:1.0:0.0	.	1313	Q9NQX4	MYO5C_HUMAN	I	1313	ENSP00000261839:L1313I	ENSP00000261839:L1313I	L	-	1	0	MYO5C	50298025	1.000000	0.71417	0.015000	0.15790	0.405000	0.30901	3.595000	0.54016	2.682000	0.91365	0.655000	0.94253	CTC	MYO5C	-	NULL	ENSG00000128833		0.448	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1		0.00	46	0	G	NM_018728		52510733	-1			no_errors	ENST00000261839	ensembl	human	known	74_37	missense	6.41	73	5	SNP	0.882	T
NAA16	79612	genome.wustl.edu	37	13	41894959	41894959	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr13:41894959G>T	ENST00000379406.3	+	4	725	c.401G>T	c.(400-402)cGa>cTa	p.R134L	NAA16_ENST00000403412.3_Splice_Site_p.R134L|NAA16_ENST00000379367.3_Splice_Site_p.R134L	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	134					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						GAAGGTTACCGAGTAAGTACT	0.358																																																	0													49.0	48.0	48.0					13																	41894959		2203	4300	6503	SO:0001630	splice_region_variant	0			AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.402+1G>T	13.37:g.41894959G>T			B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	pfam_TPR_2,pfam_NatA_aux_su,pfam_TPR_1,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R134L	ENST00000379406.3	37	c.401	CCDS9379.1	13	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748174	0.69533	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	T;T;T	0.53640	0.61;0.61;0.61	4.99	4.99	0.66335	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.224873	0.29253	N	0.012684	T	0.50103	0.1596	N	0.16130	0.375	0.58432	D	0.999996	P;D;P	0.76494	0.659;0.999;0.91	P;D;P	0.74023	0.642;0.982;0.618	T	0.39292	-0.9621	10	0.12103	T	0.63	-6.7463	18.4393	0.90660	0.0:0.0:1.0:0.0	.	134;134;134	Q6N069;Q6N069-4;Q6N069-5	NAA16_HUMAN;.;.	L	134	ENSP00000368674:R134L;ENSP00000368716:R134L;ENSP00000386103:R134L	ENSP00000368674:R134L	R	+	2	0	NAA16	40792959	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.196000	0.77805	2.588000	0.87417	0.655000	0.94253	CGA	NAA16	-	pirsf_NatA_aux_su,pfscan_TPR-contain_dom	ENSG00000172766		0.358	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA16	HGNC	protein_coding	OTTHUMT00000044672.2		0.00	47	0	G	NM_018527	Missense_Mutation	41894959	+1			no_errors	ENST00000379406	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
NBEAL1	65065	genome.wustl.edu	37	2	203972214	203972214	+	Silent	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:203972214G>T	ENST00000449802.1	+	12	1587	c.1254G>T	c.(1252-1254)ctG>ctT	p.L418L		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	418										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AGCCACCACTGGAATTACTTA	0.303																																																	0													81.0	73.0	76.0					2																	203972214		692	1588	2280	SO:0001819	synonymous_variant	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.1254G>T	2.37:g.203972214G>T			A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L418	ENST00000449802.1	37	c.1254	CCDS46495.1	2																																																																																			NBEAL1	-	superfamily_ARM-type_fold	ENSG00000144426		0.303	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4		0.00	65	0	G			203972214	+1			no_errors	ENST00000449802	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.933	T
NCEH1	57552	genome.wustl.edu	37	3	172428680	172428680	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:172428680T>C	ENST00000475381.1	-	1	328	c.95A>G	c.(94-96)aAg>aGg	p.K32R	NCEH1_ENST00000543711.1_5'UTR|NCEH1_ENST00000273512.3_Missense_Mutation_p.K64R|NCEH1_ENST00000538775.1_Missense_Mutation_p.K64R			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1	32					lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						CAGCATCAGCTTCCAGGGGTC	0.617											OREG0015927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													49.0	46.0	47.0					3																	172428680		2203	4300	6503	SO:0001583	missense	0			AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.95A>G	3.37:g.172428680T>C	ENSP00000418571:p.Lys32Arg	1900	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	pfam_AB_hydrolase_3,pirsf_Arylacetamide_deacetylase	p.K64R	ENST00000475381.1	37	c.191		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	13.83|13.83	2.355603|2.355603	0.41700|0.41700	.|.	.|.	ENSG00000144959|ENSG00000144959	ENST00000475381;ENST00000538775;ENST00000273512|ENST00000424772	T;T;T|.	0.05319|.	3.47;3.46;3.46|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.146507|.	0.64402|.	N|.	0.000011|.	T|T	0.53126|0.53126	0.1777|0.1777	L|L	0.37850|0.37850	1.14|1.14	0.80722|0.80722	D|D	1|1	B;B|.	0.24368|.	0.102;0.015|.	B;B|.	0.24541|.	0.054;0.012|.	T|T	0.50482|0.50482	-0.8823|-0.8823	10|5	0.35671|.	T|.	0.21|.	-24.9913|-24.9913	9.2917|9.2917	0.37791|0.37791	0.0:0.0833:0.0:0.9167|0.0:0.0833:0.0:0.9167	.|.	64;32|.	F5H7K4;Q6PIU2|.	.;NCEH1_HUMAN|.	R|G	32;64;64|55	ENSP00000418571:K32R;ENSP00000442464:K64R;ENSP00000273512:K64R|.	ENSP00000273512:K64R|.	K|S	-|-	2|1	0|0	NCEH1|NCEH1	173911374|173911374	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.479000|0.479000	0.33129|0.33129	3.830000|3.830000	0.55768|0.55768	2.217000|2.217000	0.71921|0.71921	0.448000|0.448000	0.29417|0.29417	AAG|AGC	NCEH1	-	pirsf_Arylacetamide_deacetylase	ENSG00000144959		0.617	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	NCEH1	HGNC	protein_coding	OTTHUMT00000346367.3	-	0.00	48	0	T	NM_020792		172428680	-1	tier1	-	no_errors	ENST00000538775	ensembl	human	known	74_37	missense	23.62	97	30	SNP	1.000	C
NFATC1	4772	genome.wustl.edu	37	18	77221366	77221366	+	Splice_Site	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr18:77221366G>A	ENST00000427363.2	+	7	1959	c.1959G>A	c.(1957-1959)ccG>ccA	p.P653P	NFATC1_ENST00000329101.4_Splice_Site_p.P640P|NFATC1_ENST00000545796.1_Splice_Site_p.P181P|NFATC1_ENST00000253506.5_Splice_Site_p.P653P|NFATC1_ENST00000318065.5_Splice_Site_p.P640P|NFATC1_ENST00000591814.1_Splice_Site_p.P653P|NFATC1_ENST00000586434.1_Splice_Site_p.P640P|NFATC1_ENST00000592223.1_Splice_Site_p.P640P|NFATC1_ENST00000397790.2_Splice_Site_p.P181P|NFATC1_ENST00000587635.1_Splice_Site_p.R625Q|NFATC1_ENST00000542384.1_Splice_Site_p.P653P			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	653					calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	TGTGCAAGCCGGTGAGTGCCT	0.632																																					GBM(151;1210 2593 28719 45011)												0													59.0	55.0	56.0					18																	77221366		2203	4300	6503	SO:0001630	splice_region_variant	0			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.1959+1G>A	18.37:g.77221366G>A			B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	p.R625Q	ENST00000427363.2	37	c.1874		18																																																																																			NFATC1	-	NULL	ENSG00000131196		0.632	NFATC1-007	KNOWN	basic	protein_coding	NFATC1	HGNC	protein_coding	OTTHUMT00000450507.1		0.00	100	0	G	NM_172390	Silent	77221366	+1			no_errors	ENST00000587635	ensembl	human	novel	74_37	missense	5.66	50	3	SNP	0.684	A
NFATC2	4773	genome.wustl.edu	37	20	50092014	50092014	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr20:50092014T>G	ENST00000396009.3	-	4	1735	c.1516A>C	c.(1516-1518)Aaa>Caa	p.K506Q	NFATC2_ENST00000609507.1_Missense_Mutation_p.K287Q|NFATC2_ENST00000609943.1_Missense_Mutation_p.K486Q|NFATC2_ENST00000414705.1_Missense_Mutation_p.K486Q|NFATC2_ENST00000610033.1_Missense_Mutation_p.K287Q|NFATC2_ENST00000371564.3_Missense_Mutation_p.K506Q	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	506	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K506Q(1)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					ATGTTGTTTTTGGGCTCCAAG	0.577																																																	1	Substitution - Missense(1)	prostate(1)											181.0	186.0	184.0					20																	50092014		2203	4300	6503	SO:0001583	missense	0			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1516A>C	20.37:g.50092014T>G	ENSP00000379330:p.Lys506Gln		B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	pfam_RHD,pfam_IPT,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.K506Q	ENST00000396009.3	37	c.1516	CCDS13437.1	20	.	.	.	.	.	.	.	.	.	.	T	18.32	3.597747	0.66332	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.45276	0.9;0.9;0.9	5.26	5.26	0.73747	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.57344	0.2047	L	0.43152	1.355	0.45528	D	0.998486	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.87578	0.998;0.988;0.998;0.998	T	0.60500	-0.7251	10	0.72032	D	0.01	-14.8818	15.1948	0.73078	0.0:0.0:0.0:1.0	.	486;486;506;506	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	Q	506;506;486	ENSP00000360619:K506Q;ENSP00000379330:K506Q;ENSP00000396471:K486Q	ENSP00000360619:K506Q	K	-	1	0	NFATC2	49525421	1.000000	0.71417	0.982000	0.44146	0.941000	0.58515	3.350000	0.52224	1.982000	0.57802	0.477000	0.44152	AAA	NFATC2	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000101096		0.577	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	HGNC	protein_coding	OTTHUMT00000079730.2	-	0.00	76	0	T	NM_012340		50092014	-1	tier1	-	no_errors	ENST00000396009	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.987	G
NFE2L2	4780	genome.wustl.edu	37	2	178098960	178098960	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:178098960C>G	ENST00000397062.3	-	2	639	c.85G>C	c.(85-87)Gat>Cat	p.D29H	NFE2L2_ENST00000446151.2_Missense_Mutation_p.D13H|NFE2L2_ENST00000464747.1_Missense_Mutation_p.D13H|NFE2L2_ENST00000397063.4_Missense_Mutation_p.D13H|NFE2L2_ENST00000423513.1_Missense_Mutation_p.D13H	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	29					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D29H(11)|p.D29N(2)|p.D29Y(2)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTCCAAGATCTATATCTTGC	0.363			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	15	Substitution - Missense(15)	lung(9)|upper_aerodigestive_tract(3)|cervix(1)|liver(1)|kidney(1)											66.0	59.0	61.0					2																	178098960		1843	4100	5943	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.85G>C	2.37:g.178098960C>G	ENSP00000380252:p.Asp29His		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.D29H	ENST00000397062.3	37	c.85	CCDS42782.1	2	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072800	0.76415	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.69087	-0.5238	10	0.87932	D	0	.	19.9976	0.97389	0.0:1.0:0.0:0.0	.	13;13;13;29	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	H	13;29;13;13;13;13;13	ENSP00000380253:D13H;ENSP00000380252:D29H;ENSP00000411575:D13H;ENSP00000391590:D13H;ENSP00000400073:D13H;ENSP00000412191:D13H;ENSP00000410015:D13H	ENSP00000380252:D29H	D	-	1	0	NFE2L2	177807206	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.487000	0.81328	2.737000	0.93849	0.563000	0.77884	GAT	NFE2L2	-	NULL	ENSG00000116044		0.363	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	-	0.00	20	0	C	NM_006164		178098960	-1	tier1	-	no_errors	ENST00000397062	ensembl	human	known	74_37	missense	24.19	47	15	SNP	1.000	G
NHSL2	340527	genome.wustl.edu	37	X	71359849	71359849	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chrX:71359849G>T	ENST00000373677.1	+	2	2615	c.1353G>T	c.(1351-1353)caG>caT	p.Q451H	NHSL2_ENST00000535692.1_Missense_Mutation_p.Q451H|NHSL2_ENST00000540800.1_Missense_Mutation_p.Q817H|NHSL2_ENST00000510661.1_Missense_Mutation_p.Q586H			Q5HYW2	NHSL2_HUMAN	NHS-like 2	451										NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					ATCCCAACCAGCCAATCATGC	0.507																																																	0													74.0	63.0	67.0					X																	71359849		2203	4300	6503	SO:0001583	missense	0					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.1353G>T	X.37:g.71359849G>T	ENSP00000362781:p.Gln451His		B2RN94	Missense_Mutation	SNP	NULL	p.Q817H	ENST00000373677.1	37	c.2451		X	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638335	0.29157	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.48201	1.44;0.82;0.82;0.82	5.41	3.62	0.41486	.	0.161601	0.42172	D	0.000741	T	0.55862	0.1947	L	0.45581	1.43	0.36916	D	0.891134	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71870	0.975;0.975;0.975	T	0.58132	-0.7690	10	0.38643	T	0.18	-8.0351	8.3466	0.32277	0.1953:0.0:0.8047:0.0	.	817;586;451	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	H	817;451;586;451	ENSP00000444617:Q817H;ENSP00000362781:Q451H;ENSP00000424079:Q586H;ENSP00000444914:Q451H	ENSP00000362781:Q451H	Q	+	3	2	NHSL2	71276574	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	0.960000	0.29253	0.625000	0.30304	0.600000	0.82982	CAG	NHSL2	-	NULL	ENSG00000204131		0.507	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	-	0.00	32	0	G	NM_001013627		71359849	+1	tier1	-	no_errors	ENST00000540800	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.999	T
NID1	4811	genome.wustl.edu	37	1	236189263	236189263	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:236189263G>T	ENST00000264187.6	-	8	1999	c.1917C>A	c.(1915-1917)ttC>ttA	p.F639L	NID1_ENST00000366595.3_Missense_Mutation_p.F639L	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	639	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	TGTACAGGACGAACACGCTGT	0.602																																																	0													190.0	170.0	177.0					1																	236189263		2203	4300	6503	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1917C>A	1.37:g.236189263G>T	ENSP00000264187:p.Phe639Leu		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.F639L	ENST00000264187.6	37	c.1917	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837356	0.50951	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.22539	1.95;1.95	5.02	-5.26	0.02772	G2 nidogen/fibulin G2F (2);Green fluorescent protein-like (1);	0.095178	0.64402	D	0.000001	T	0.16981	0.0408	M	0.63843	1.955	0.42444	D	0.99272	P;P	0.46656	0.882;0.735	B;B	0.38264	0.269;0.172	T	0.07009	-1.0795	10	0.48119	T	0.1	.	12.5501	0.56222	0.53:0.0:0.47:0.0	.	639;639	P14543-2;P14543	.;NID1_HUMAN	L	639	ENSP00000264187:F639L;ENSP00000355554:F639L	ENSP00000264187:F639L	F	-	3	2	NID1	234255886	0.938000	0.31826	0.901000	0.35422	0.939000	0.58152	0.146000	0.16180	-1.181000	0.02730	-1.105000	0.02106	TTC	NID1	-	superfamily_GFP,smart_G2_nidogen/fibulin_G2F,pfscan_G2_nidogen/fibulin_G2F	ENSG00000116962		0.602	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2		0.00	20	0	G	NM_002508		236189263	-1			no_errors	ENST00000264187	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.958	T
NLRC5	84166	genome.wustl.edu	37	16	57079388	57079388	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:57079388G>T	ENST00000262510.6	+	21	3457	c.3232G>T	c.(3232-3234)Ggg>Tgg	p.G1078W	NLRC5_ENST00000436936.1_Missense_Mutation_p.G1078W|NLRC5_ENST00000539144.1_Missense_Mutation_p.G1078W|NLRC5_ENST00000308149.7_Missense_Mutation_p.G1078W	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1078					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.G1078>?(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CCTCCTGAGAGGGGACAAGAC	0.597																																																	1	Complex(1)	NS(1)											58.0	54.0	56.0					16																	57079388		2198	4300	6498	SO:0001583	missense	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3232G>T	16.37:g.57079388G>T	ENSP00000262510:p.Gly1078Trp		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.G1078W	ENST00000262510.6	37	c.3232	CCDS10773.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.85|11.85	1.762885|1.762885	0.31228|0.31228	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|T	0.74315|0.78126	-0.65;-0.67;-0.83;-0.67;2.28;2.13|-1.15	3.64|3.64	0.526|0.526	0.17078|0.17078	.|.	0.502419|.	0.14979|.	N|.	0.287359|.	T|T	0.80308|0.80308	0.4599|0.4599	M|M	0.82323|0.82323	2.585|2.585	0.09310|0.09310	N|N	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;0.999;0.998|.	D;D;D;D|.	0.77557|.	0.99;0.988;0.981;0.963|.	T|T	0.71454|0.71454	-0.4588|-0.4588	10|7	0.87932|0.72032	D|D	0|0.01	.|.	3.6283|3.6283	0.08121|0.08121	0.2373:0.2108:0.5519:0.0|0.2373:0.2108:0.5519:0.0	.|.	1078;1078;1078;1078|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	W|M	1078;1078;1078;552;1078;585;377|830	ENSP00000262510:G1078W;ENSP00000308886:G1078W;ENSP00000389739:G1078W;ENSP00000441727:G1078W;ENSP00000441597:G585W;ENSP00000440153:G377W|ENSP00000442906:R830M	ENSP00000262510:G1078W|ENSP00000437583:R18M	G|R	+|+	1|2	0|0	NLRC5|NLRC5	55636889|55636889	0.996000|0.996000	0.38824|0.38824	0.007000|0.007000	0.13788|0.13788	0.010000|0.010000	0.07245|0.07245	2.167000|2.167000	0.42415|0.42415	0.155000|0.155000	0.19261|0.19261	0.457000|0.457000	0.33378|0.33378	GGG|AGG	NLRC5	-	NULL	ENSG00000140853		0.597	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1		0.00	18	0	G	NM_032206		57079388	+1			no_errors	ENST00000262510	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.009	T
NPC1L1	29881	genome.wustl.edu	37	7	44573140	44573140	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:44573140G>T	ENST00000289547.4	-	8	2354	c.2299C>A	c.(2299-2301)Cca>Aca	p.P767T	NPC1L1_ENST00000546276.1_Missense_Mutation_p.P767T|NPC1L1_ENST00000423141.1_3'UTR|NPC1L1_ENST00000381160.3_Missense_Mutation_p.P767T	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	767	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CGCACAGCTGGCATGGGGGTC	0.627																																																	0													58.0	59.0	58.0					7																	44573140		2203	4300	6503	SO:0001583	missense	0				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2299C>A	7.37:g.44573140G>T	ENSP00000289547:p.Pro767Thr		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.P767T	ENST00000289547.4	37	c.2299	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	g	24.2	4.500334	0.85176	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.96830	-4.14;-4.14;-4.14	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.98448	0.9483	M	0.92784	3.345	0.58432	D	0.999999	D;D;D	0.89917	0.998;1.0;0.993	D;D;D	0.78314	0.991;0.991;0.936	D	0.99659	1.0993	10	0.87932	D	0	-14.2544	15.2998	0.73940	0.0:0.0:1.0:0.0	.	767;767;767	B7ZLE6;Q17RV5;D3DVK9	.;.;.	T	767	ENSP00000289547:P767T;ENSP00000370552:P767T;ENSP00000438033:P767T	ENSP00000289547:P767T	P	-	1	0	NPC1L1	44539665	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.079000	0.94032	2.197000	0.70478	0.511000	0.50034	CCA	NPC1L1	-	pfam_Patched,pfscan_SSD	ENSG00000015520		0.627	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	HGNC	protein_coding	OTTHUMT00000251256.1		0.00	24	0	G	NM_013389		44573140	-1			no_errors	ENST00000289547	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	T
NR1D1	9572	genome.wustl.edu	37	17	38253410	38253410	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:38253410G>T	ENST00000246672.3	-	2	908	c.278C>A	c.(277-279)tCc>tAc	p.S93Y		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	93	Crucial for activation of GJA1. {ECO:0000250}.|Modulating.|Poly-Ser.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					ATTATagaaggaggaggagga	0.592																																																	0													51.0	52.0	52.0					17																	38253410		2203	4300	6503	SO:0001583	missense	0			X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.278C>A	17.37:g.38253410G>T	ENSP00000246672:p.Ser93Tyr		Q0P5Z4|Q15304	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S93Y	ENST00000246672.3	37	c.278	CCDS11361.1	17	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399802	0.25291	.	.	ENSG00000126368	ENST00000246672	D	0.91464	-2.85	1.87	1.87	0.25490	.	0.281783	0.29572	N	0.011772	D	0.87188	0.6115	L	0.43152	1.355	0.33796	D	0.626102	D	0.54964	0.969	P	0.50490	0.642	D	0.86533	0.1823	10	0.34782	T	0.22	.	6.379	0.21523	0.0:0.3131:0.6869:0.0	.	93	P20393	NR1D1_HUMAN	Y	93	ENSP00000246672:S93Y	ENSP00000246672:S93Y	S	-	2	0	NR1D1	35506936	1.000000	0.71417	0.996000	0.52242	0.343000	0.28985	0.785000	0.26830	1.072000	0.40860	0.297000	0.19635	TCC	NR1D1	-	NULL	ENSG00000126368		0.592	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D1	HGNC	protein_coding	OTTHUMT00000257135.1		0.00	72	0	G			38253410	-1			no_errors	ENST00000246672	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.983	T
NRAP	4892	genome.wustl.edu	37	10	115364652	115364652	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr10:115364652C>T	ENST00000359988.3	-	35	4187	c.3943G>A	c.(3943-3945)Gag>Aag	p.E1315K	NRAP_ENST00000369360.3_Missense_Mutation_p.E1288K|NRAP_ENST00000369358.4_Missense_Mutation_p.E1323K|NRAP_ENST00000360478.3_Missense_Mutation_p.E1280K	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TTCCCTCGCTCCTTCACAAAG	0.527																																																	0													67.0	71.0	69.0					10																	115364652		2203	4300	6503	SO:0001583	missense	0				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3943G>A	10.37:g.115364652C>T	ENSP00000353078:p.Glu1315Lys			Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,smart_Znf_LIM,smart_Nebulin_35r-motif,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,prints_Nebulin	p.E1323K	ENST00000359988.3	37	c.3967	CCDS7579.1	10	.	.	.	.	.	.	.	.	.	.	C	31	5.093249	0.94149	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350	T;T;T;T	0.18016	2.48;2.49;2.33;2.24	5.68	5.68	0.88126	.	0.102462	0.64402	D	0.000003	T	0.37128	0.0992	L	0.61218	1.895	0.53688	D	0.999978	B;D;D;D	0.65815	0.004;0.995;0.994;0.99	B;P;D;P	0.64687	0.005;0.849;0.928;0.849	T	0.03852	-1.0998	10	0.12103	T	0.63	.	19.7905	0.96454	0.0:1.0:0.0:0.0	.	473;1315;1280;1315	B1ANW7;A0AVL2;Q86VF7-4;Q86VF7	.;.;.;NRAP_HUMAN	K	1323;1288;1315;1280;473	ENSP00000358365:E1323K;ENSP00000358367:E1288K;ENSP00000353078:E1315K;ENSP00000353666:E1280K	ENSP00000353078:E1315K	E	-	1	0	NRAP	115354642	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.786000	0.85741	2.691000	0.91804	0.650000	0.86243	GAG	NRAP	-	NULL	ENSG00000197893		0.527	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAP	HGNC	protein_coding	OTTHUMT00000050425.2	-	0.00	31	0	C	NM_006175		115364652	-1	tier1	-	no_errors	ENST00000369358	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
NTPCR	84284	genome.wustl.edu	37	1	233113960	233113960	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:233113960C>T	ENST00000366628.5	+	5	643	c.556C>T	c.(556-558)Cag>Tag	p.Q186*	NTPCR_ENST00000490098.1_3'UTR	NM_032324.1	NP_115700.1	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase, cancer-related	186						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|nucleoside-triphosphatase activity (GO:0017111)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(1)|ovary(1)	4						GACGTGCGTGCAGAGCAGCAG	0.542																																																	0													108.0	86.0	93.0					1																	233113960		2203	4300	6503	SO:0001587	stop_gained	0			BC005102	CCDS1597.1	1q42.2	2010-12-20	2010-12-20	2010-12-20	ENSG00000135778	ENSG00000135778	3.6.1.15		28204	protein-coding gene	gene with protein product	"""human cancer-related NTPase"""		"""chromosome 1 open reading frame 57"""	C1orf57		17291528	Standard	NM_032324		Approved	MGC13186, HCR-NTPase	uc001hvj.1	Q9BSD7	OTTHUMG00000037822	ENST00000366628.5:c.556C>T	1.37:g.233113960C>T	ENSP00000355587:p.Gln186*			Nonsense_Mutation	SNP	pfam_Nuc-triphosphatase_THEP1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Q186*	ENST00000366628.5	37	c.556	CCDS1597.1	1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.862632	0.51482	.	.	ENSG00000135778	ENST00000366628	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	13.241	0.59997	0.0:0.8391:0.1609:0.0	.	.	.	.	X	186	.	ENSP00000355587:Q186X	Q	+	1	0	NTPCR	231180583	1.000000	0.71417	0.798000	0.32154	0.361000	0.29550	3.543000	0.53633	2.486000	0.83907	0.563000	0.77884	CAG	NTPCR	-	superfamily_P-loop_NTPase	ENSG00000135778		0.542	NTPCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTPCR	HGNC	protein_coding	OTTHUMT00000092324.2		0.00	54	0	C	NM_032324		233113960	+1			no_errors	ENST00000366628	ensembl	human	known	74_37	nonsense	5.88	32	2	SNP	0.955	T
OR4C6	219432	genome.wustl.edu	37	11	55432949	55432949	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:55432949C>G	ENST00000314259.3	+	1	336	c.307C>G	c.(307-309)Cat>Gat	p.H103D		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H103N(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						GTTTGTGGAGCATTTCTTTGG	0.532																																																	1	Substitution - Missense(1)	lung(1)											115.0	105.0	108.0					11																	55432949		2200	4296	6496	SO:0001583	missense	0			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.307C>G	11.37:g.55432949C>G	ENSP00000324769:p.His103Asp		B2RP11|Q6IFD2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H103D	ENST00000314259.3	37	c.307	CCDS31506.1	11	.	.	.	.	.	.	.	.	.	.	C	8.864	0.947528	0.18356	.	.	ENSG00000181903	ENST00000314259	T	0.00551	6.65	3.3	2.39	0.29439	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39544	N	0.001323	T	0.01800	0.0057	M	0.84156	2.68	0.24227	N	0.995414	D	0.64830	0.994	D	0.66847	0.947	T	0.23976	-1.0173	10	0.87932	D	0	.	8.4299	0.32750	0.0:0.8818:0.0:0.1182	.	103	Q8NH72	OR4C6_HUMAN	D	103	ENSP00000324769:H103D	ENSP00000324769:H103D	H	+	1	0	OR4C6	55189525	0.000000	0.05858	0.045000	0.18777	0.004000	0.04260	-1.616000	0.02053	0.568000	0.29311	-0.406000	0.06334	CAT	OR4C6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181903		0.532	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C6	HGNC	protein_coding	OTTHUMT00000391504.1	-	0.00	23	0	C	NM_001004704		55432949	+1	tier1	-	no_errors	ENST00000314259	ensembl	human	known	74_37	missense	43.75	9	7	SNP	0.713	G
OR1S1	219959	genome.wustl.edu	37	11	57982677	57982677	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:57982677G>T	ENST00000309433.6	+	1	461	c.461G>T	c.(460-462)gGc>gTc	p.G154V		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				CCCAGGTTCGGCATTTTGCTC	0.468																																																	0													203.0	194.0	197.0					11																	57982677		2201	4296	6497	SO:0001583	missense	0			BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.461G>T	11.37:g.57982677G>T	ENSP00000311688:p.Gly154Val		Q6IFG3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G154V	ENST00000309433.6	37	c.461	CCDS31546.1	11	.	.	.	.	.	.	.	.	.	.	G	6.789	0.514607	0.12944	.	.	ENSG00000172774	ENST00000309433	T	0.35421	1.31	3.45	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	0.118214	0.38548	N	0.001648	T	0.22551	0.0544	N	0.08118	0	0.28351	N	0.920888	B	0.22080	0.064	B	0.27170	0.077	T	0.32241	-0.9914	10	0.87932	D	0	.	14.1	0.65049	0.0:0.0:1.0:0.0	.	154	Q8NH92	OR1S1_HUMAN	V	154	ENSP00000311688:G154V	ENSP00000311688:G154V	G	+	2	0	OR1S1	57739253	0.983000	0.35010	0.064000	0.19789	0.156000	0.22039	4.630000	0.61297	1.770000	0.52166	0.479000	0.44913	GGC	OR1S1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000172774		0.468	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S1	HGNC	protein_coding	OTTHUMT00000394705.1		0.00	33	0	G	NM_001004458		57982677	+1			no_errors	ENST00000309433	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.332	T
OR5H1	26341	genome.wustl.edu	37	3	97851821	97851821	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:97851821C>G	ENST00000354565.2	+	1	280	c.280C>G	c.(280-282)Ctc>Gtc	p.L94V	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						GATGATATCTCTCTCTGAATG	0.398																																																	0													159.0	157.0	157.0					3																	97851821		2203	4299	6502	SO:0001583	missense	0			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.280C>G	3.37:g.97851821C>G	ENSP00000346575:p.Leu94Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L94V	ENST00000354565.2	37	c.280	CCDS33797.1	3	.	.	.	.	.	.	.	.	.	.	C	1.797	-0.478151	0.04414	.	.	ENSG00000231192	ENST00000354565	T	0.00478	7.13	3.48	-1.63	0.08345	GPCR, rhodopsin-like superfamily (1);	1.009930	0.07969	N	0.983766	T	0.00328	0.0010	L	0.33485	1.01	0.09310	N	1	B	0.12630	0.006	B	0.17433	0.018	T	0.38067	-0.9678	10	0.56958	D	0.05	.	3.753	0.08573	0.1893:0.2493:0.0:0.5614	.	94	A6NKK0	OR5H1_HUMAN	V	94	ENSP00000346575:L94V	ENSP00000346575:L94V	L	+	1	0	OR5H1	99334511	0.000000	0.05858	0.031000	0.17742	0.028000	0.11728	0.746000	0.26275	0.028000	0.15324	0.195000	0.17529	CTC	OR5H1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000231192		0.398	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H1	HGNC	protein_coding	OTTHUMT00000359100.2	-	0.00	71	0	C	NM_001005338		97851821	+1	tier1	-	no_errors	ENST00000354565	ensembl	human	known	74_37	missense	15.32	105	19	SNP	0.009	G
OTOP2	92736	genome.wustl.edu	37	17	72926446	72926446	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:72926446G>T	ENST00000580223.1	+	5	746	c.716G>T	c.(715-717)gGg>gTg	p.G239V	OTOP2_ENST00000331427.4_Missense_Mutation_p.G239V			Q7RTS6	OTOP2_HUMAN	otopetrin 2	239						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					TTCCAGCAGGGGTACTTCTAC	0.562																																																	0													173.0	164.0	167.0					17																	72926446		2203	4300	6503	SO:0001583	missense	0			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.716G>T	17.37:g.72926446G>T	ENSP00000463837:p.Gly239Val			Missense_Mutation	SNP	pfam_Otopetrin	p.G239V	ENST00000580223.1	37	c.716	CCDS11708.1	17	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213106	0.58452	.	.	ENSG00000183034	ENST00000331427	T	0.20332	2.08	5.56	5.56	0.83823	.	0.051771	0.85682	D	0.000000	T	0.48241	0.1489	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.31081	-0.9956	10	0.19147	T	0.46	-5.822	19.5904	0.95508	0.0:0.0:1.0:0.0	.	239	Q7RTS6	OTOP2_HUMAN	V	239	ENSP00000332528:G239V	ENSP00000332528:G239V	G	+	2	0	OTOP2	70438041	1.000000	0.71417	0.992000	0.48379	0.655000	0.38815	6.143000	0.71756	2.638000	0.89438	0.558000	0.71614	GGG	OTOP2	-	pfam_Otopetrin	ENSG00000183034		0.562	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	HGNC	protein_coding	OTTHUMT00000445306.1		0.00	39	0	G	NM_178160		72926446	+1			no_errors	ENST00000331427	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
PELI1	57162	genome.wustl.edu	37	2	64322157	64322157	+	Silent	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:64322157G>T	ENST00000358912.4	-	7	1378	c.936C>A	c.(934-936)ggC>ggA	p.G312G		NM_020651.3	NP_065702.2	Q96FA3	PELI1_HUMAN	pellino E3 ubiquitin protein ligase 1	312					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|protein K48-linked ubiquitination (GO:0070936)|response to dsRNA (GO:0043331)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	19						CATGTACATGGCCGCAGTTTA	0.438																																																	0													232.0	199.0	210.0					2																	64322157		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1876.1	2p13.3	2012-02-23	2012-02-23		ENSG00000197329	ENSG00000197329		"""Pellino homologs"""	8827	protein-coding gene	gene with protein product		614797	"""pellino (Drosophila) homolog 1"", ""pellino homolog 1 (Drosophila)"""			11306823, 16951688	Standard	NM_020651		Approved		uc002sct.4	Q96FA3	OTTHUMG00000129511	ENST00000358912.4:c.936C>A	2.37:g.64322157G>T			Q96SM0|Q9GZY5|Q9HCX0	Silent	SNP	pfam_Pellino_fam	p.G312	ENST00000358912.4	37	c.936	CCDS1876.1	2																																																																																			PELI1	-	pfam_Pellino_fam	ENSG00000197329		0.438	PELI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PELI1	HGNC	protein_coding	OTTHUMT00000251686.1	-	0.00	28	0	G	NM_020651		64322157	-1	tier1	-	no_errors	ENST00000358912	ensembl	human	known	74_37	silent	9.76	36	4	SNP	0.998	T
PEX3	8504	genome.wustl.edu	37	6	143800301	143800301	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:143800301G>T	ENST00000367591.4	+	10	970	c.907G>T	c.(907-909)Gaa>Taa	p.E303*		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	303					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)			endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		TCGACCTACTGAACAGGACCT	0.338																																																	0													96.0	93.0	94.0					6																	143800301		2203	4300	6503	SO:0001587	stop_gained	0			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.907G>T	6.37:g.143800301G>T	ENSP00000356563:p.Glu303*		Q6FGP5	Nonsense_Mutation	SNP	pfam_Peroxin-3	p.E303*	ENST00000367591.4	37	c.907	CCDS5199.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.399395	0.97537	.	.	ENSG00000034693	ENST00000367591	.	.	.	5.65	5.65	0.86999	.	0.279156	0.40908	D	0.000992	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-6.5709	20.1057	0.97893	0.0:0.0:1.0:0.0	.	.	.	.	X	303	.	ENSP00000356563:E303X	E	+	1	0	PEX3	143841994	1.000000	0.71417	0.886000	0.34754	0.978000	0.69477	4.776000	0.62354	2.827000	0.97445	0.650000	0.86243	GAA	PEX3	-	pfam_Peroxin-3	ENSG00000034693		0.338	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX3	HGNC	protein_coding	OTTHUMT00000042525.1	-	0.00	57	0	G			143800301	+1	tier1	-	no_errors	ENST00000367591	ensembl	human	known	74_37	nonsense	10.00	36	4	SNP	1.000	T
PHLDB2	90102	genome.wustl.edu	37	3	111603468	111603468	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:111603468G>T	ENST00000431670.2	+	2	955	c.544G>T	c.(544-546)Gga>Tga	p.G182*	PHLDB2_ENST00000393925.3_Nonsense_Mutation_p.G182*|PHLDB2_ENST00000478922.1_Nonsense_Mutation_p.G182*|PHLDB2_ENST00000412622.1_Nonsense_Mutation_p.G182*|PHLDB2_ENST00000477695.1_Nonsense_Mutation_p.G182*|PHLDB2_ENST00000393923.3_Nonsense_Mutation_p.G209*|PHLDB2_ENST00000481953.1_Nonsense_Mutation_p.G182*	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	182						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						CATGTGGAATGGAAGTTCCCT	0.532																																																	0													59.0	59.0	59.0					3																	111603468		2203	4300	6503	SO:0001587	stop_gained	0				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.544G>T	3.37:g.111603468G>T	ENSP00000405405:p.Gly182*		A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G182*	ENST00000431670.2	37	c.544	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.368942	0.97511	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	.	.	.	5.61	5.61	0.85477	.	0.113648	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.9138	0.86146	0.0:0.0:1.0:0.0	.	.	.	.	X	209;209;182;182;182;182;182;182;182	.	ENSP00000352764:G209X	G	+	1	0	PHLDB2	113086158	1.000000	0.71417	0.867000	0.34043	0.989000	0.77384	7.070000	0.76763	2.813000	0.96785	0.655000	0.94253	GGA	PHLDB2	-	NULL	ENSG00000144824		0.532	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1		0.00	27	0	G	NM_145753		111603468	+1			no_errors	ENST00000393925	ensembl	human	known	74_37	nonsense	6.15	61	4	SNP	1.000	T
PHYHD1	254295	genome.wustl.edu	37	9	131702968	131702968	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:131702968T>C	ENST00000372592.3	+	11	1610	c.677T>C	c.(676-678)cTc>cCc	p.L226P	PHYHD1_ENST00000487504.1_3'UTR|PHYHD1_ENST00000353176.5_Missense_Mutation_p.L205P|RP11-101E3.5_ENST00000482796.1_5'Flank|PHYHD1_ENST00000308941.5_Missense_Mutation_p.S219P|PHYHD1_ENST00000421063.2_Missense_Mutation_p.L205P	NM_001100876.1	NP_001094346.1	Q5SRE7	PHYD1_HUMAN	phytanoyl-CoA dioxygenase domain containing 1	226							dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(1)|stomach(3)	10						GATAACAGCCTCTTTGTGCCC	0.627																																																	0													52.0	48.0	49.0					9																	131702968		2203	4300	6503	SO:0001583	missense	0			BC051300	CCDS6914.1, CCDS43885.1, CCDS43886.1	9q34.13	2010-08-13			ENSG00000175287	ENSG00000175287			23396	protein-coding gene	gene with protein product						12477932	Standard	NM_174933		Approved	MGC16638	uc004bwp.2	Q5SRE7	OTTHUMG00000020764	ENST00000372592.3:c.677T>C	9.37:g.131702968T>C	ENSP00000361673:p.Leu226Pro		A6PWN9|A6PWP0|B3KT57|B4E3X8|Q5SRE9|Q5SRF0|Q7Z623|Q7Z7P9|Q96GM4	Missense_Mutation	SNP	pfam_Phytyl_CoA_dOase	p.S219P	ENST00000372592.3	37	c.655	CCDS43885.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.07|12.07	1.827757|1.827757	0.32329|0.32329	.|.	.|.	ENSG00000175287|ENSG00000175287	ENST00000372592;ENST00000353176;ENST00000421063|ENST00000308941	D;D;D|.	0.89343|.	-2.5;-2.5;-2.5|.	4.74|4.74	2.38|2.38	0.29361|0.29361	.|.	.|3.152210	.|0.00812	.|N	.|0.001511	T|T	0.33614|0.33614	0.0869|0.0869	.|.	.|.	.|.	0.26332|0.26332	N|N	0.977504|0.977504	P;P|P	0.41232|0.50528	0.713;0.743|0.936	P;B|P	0.45343|0.44990	0.477;0.392|0.466	T|T	0.31916|0.31916	-0.9926|-0.9926	7|8	.|0.51188	.|T	.|0.08	.|.	4.2512|4.2512	0.10695|0.10695	0.3797:0.0:0.1598:0.4605|0.3797:0.0:0.1598:0.4605	.|.	205;226|219	Q5SRE7-2;Q5SRE7|Q5SRE7-3	.;PHYD1_HUMAN|.	P|P	226;205;205|219	ENSP00000361673:L226P;ENSP00000340945:L205P;ENSP00000409928:L205P|.	.|ENSP00000309515:S219P	L|S	+|+	2|1	0|0	PHYHD1|PHYHD1	130742789|130742789	1.000000|1.000000	0.71417|0.71417	0.901000|0.901000	0.35422|0.35422	0.506000|0.506000	0.33950|0.33950	3.449000|3.449000	0.52950|0.52950	1.794000|1.794000	0.52575|0.52575	0.449000|0.449000	0.29647|0.29647	CTC|TCT	PHYHD1	-	NULL	ENSG00000175287		0.627	PHYHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYHD1	HGNC	protein_coding	OTTHUMT00000054506.2	-	0.00	75	0	T	NM_174933		131702968	+1	tier1	-	no_errors	ENST00000308941	ensembl	human	known	74_37	missense	70.00	21	49	SNP	0.199	C
PILRB	29990	genome.wustl.edu	37	7	99956495	99956495	+	Missense_Mutation	SNP	A	A	G	rs200935118		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:99956495A>G	ENST00000452089.1	+	7	1306	c.247A>G	c.(247-249)Agc>Ggc	p.S83G	PILRB_ENST00000448382.1_Intron|PILRB_ENST00000609309.1_Missense_Mutation_p.S83G|PILRB_ENST00000610247.1_Missense_Mutation_p.S83G|PILRB_ENST00000444073.1_Missense_Mutation_p.S83G|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta	83	Ig-like V-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTCCTTCTACAGCACAAGGCC	0.542																																																	0													115.0	117.0	116.0					7																	99956495		2203	4300	6503	SO:0001583	missense	0			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.247A>G	7.37:g.99956495A>G	ENSP00000391748:p.Ser83Gly		Q69YF9|Q9HBS0	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.S83G	ENST00000452089.1	37	c.247	CCDS43622.1	7	.	.	.	.	.	.	.	.	.	.	A	9.754	1.168331	0.21621	.	.	ENSG00000121716	ENST00000310771;ENST00000420688;ENST00000452089;ENST00000457519;ENST00000443526;ENST00000419749;ENST00000422808;ENST00000444073;ENST00000413850;ENST00000438231	T;T;T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97	2.48	-0.577	0.11727	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.736452	0.12125	N	0.497291	T	0.08179	0.0204	N	0.08118	0	0.09310	N	1	P	0.34864	0.473	B	0.32342	0.144	T	0.34700	-0.9818	9	.	.	.	.	6.2897	0.21053	0.4677:0.5323:0.0:0.0	.	83	Q9UKJ0	PILRB_HUMAN	G	83;83;83;83;83;83;83;83;188;83	ENSP00000311153:S83G;ENSP00000391748:S83G;ENSP00000411261:S83G;ENSP00000403757:S83G;ENSP00000404321:S83G;ENSP00000389856:S83G;ENSP00000410764:S83G;ENSP00000408425:S83G	.	S	+	1	0	PILRB	99794431	0.016000	0.18221	0.060000	0.19600	0.003000	0.03518	0.696000	0.25541	0.156000	0.19299	-0.439000	0.05793	AGC	PILRB	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000121716		0.542	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PILRB	HGNC	protein_coding	OTTHUMT00000339923.2		0.00	46	0	A	NM_178238		99956495	+1			no_errors	ENST00000444073	ensembl	human	known	74_37	missense	9.80	46	5	SNP	0.026	G
PIP4K2B	8396	genome.wustl.edu	37	17	36935734	36935734	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:36935734T>C	ENST00000269554.3	-	5	1036	c.556A>G	c.(556-558)Atg>Gtg	p.M186V	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	186	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						AGGCGGTACATGCCCAGGAAC	0.517																																																	0													151.0	107.0	122.0					17																	36935734		2203	4300	6503	SO:0001583	missense	0			U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.556A>G	17.37:g.36935734T>C	ENSP00000269554:p.Met186Val		Q5U0E8|Q8TBP2	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.M186V	ENST00000269554.3	37	c.556	CCDS11329.1	17	.	.	.	.	.	.	.	.	.	.	T	18.44	3.624014	0.66901	.	.	ENSG00000141720	ENST00000269554;ENST00000311500	T	0.32515	1.45	5.17	5.17	0.71159	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	L	0.49640	1.575	0.80722	D	1	P;P;B	0.36616	0.561;0.505;0.281	B;B;B	0.42798	0.358;0.288;0.398	T	0.26395	-1.0104	10	0.87932	D	0	-10.9249	13.9639	0.64196	0.0:0.0:0.0:1.0	.	186;186;186	C9JMM2;P78356-2;P78356	.;.;PI42B_HUMAN	V	186	ENSP00000269554:M186V	ENSP00000269554:M186V	M	-	1	0	PIP4K2B	34189260	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.522000	0.81844	2.168000	0.68352	0.533000	0.62120	ATG	PIP4K2B	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000141720		0.517	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2B	HGNC	protein_coding	OTTHUMT00000256791.1	-	0.00	51	0	T	NM_003559		36935734	-1	tier1	-	no_errors	ENST00000269554	ensembl	human	known	74_37	missense	31.75	43	20	SNP	1.000	C
PKHD1L1	93035	genome.wustl.edu	37	8	110492355	110492355	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr8:110492355A>C	ENST00000378402.5	+	55	9418	c.9314A>C	c.(9313-9315)tAc>tCc	p.Y3105S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3105	G8 2. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATGCTACCTACATATCACTG	0.333										HNSCC(38;0.096)																																							0													47.0	46.0	46.0					8																	110492355		1825	4079	5904	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9314A>C	8.37:g.110492355A>C	ENSP00000367655:p.Tyr3105Ser		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.Y3105S	ENST00000378402.5	37	c.9314	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	A	18.53	3.644408	0.67244	.	.	ENSG00000205038	ENST00000378402	D	0.88277	-2.36	5.25	5.25	0.73442	G8 domain (2);	0.000000	0.64402	D	0.000001	D	0.87989	0.6317	M	0.62154	1.92	0.38124	D	0.937951	B	0.29766	0.256	B	0.34346	0.18	D	0.88064	0.2796	10	0.48119	T	0.1	.	13.4085	0.60929	1.0:0.0:0.0:0.0	.	3105	Q86WI1	PKHL1_HUMAN	S	3105	ENSP00000367655:Y3105S	ENSP00000367655:Y3105S	Y	+	2	0	PKHD1L1	110561531	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.320000	0.72876	2.105000	0.64084	0.528000	0.53228	TAC	PKHD1L1	-	pfam_G8_domain	ENSG00000205038		0.333	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1		0.00	27	0	A	NM_177531		110492355	+1			no_errors	ENST00000378402	ensembl	human	known	74_37	missense	24.00	19	6	SNP	1.000	C
PRDM9	56979	genome.wustl.edu	37	5	23509631	23509631	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:23509631C>A	ENST00000296682.3	+	3	304	c.122C>A	c.(121-123)gCa>gAa	p.A41E		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	41	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.A41E(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GAAGAATGGGCAGAGATGGGA	0.423										HNSCC(3;0.000094)																																							1	Substitution - Missense(1)	lung(1)											211.0	196.0	201.0					5																	23509631		1867	4117	5984	SO:0001583	missense	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.122C>A	5.37:g.23509631C>A	ENSP00000296682:p.Ala41Glu		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.A41E	ENST00000296682.3	37	c.122	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	C	8.631	0.893627	0.17613	.	.	ENSG00000164256	ENST00000502755;ENST00000296682	T;T	0.01505	4.82;4.82	2.76	1.85	0.25348	Krueppel-associated box-related (1);Krueppel-associated box (3);	.	.	.	.	T	0.01387	0.0045	N	0.13327	0.33	0.22975	N	0.998484	B	0.24920	0.114	B	0.25506	0.061	T	0.48692	-0.9013	9	0.39692	T	0.17	.	6.8651	0.24088	0.2759:0.7241:0.0:0.0	.	41	Q9NQV7	PRDM9_HUMAN	E	41	ENSP00000425471:A41E;ENSP00000296682:A41E	ENSP00000296682:A41E	A	+	2	0	PRDM9	23545388	0.993000	0.37304	0.953000	0.39169	0.882000	0.50991	0.030000	0.13688	0.686000	0.31488	0.609000	0.83330	GCA	PRDM9	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	ENSG00000164256		0.423	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1		0.00	89	0	C	NM_020227		23509631	+1			no_errors	ENST00000296682	ensembl	human	known	74_37	missense	6.12	45	3	SNP	0.958	A
PSMD2	5708	genome.wustl.edu	37	3	184024572	184024572	+	Missense_Mutation	SNP	A	A	G	rs562725422	byFrequency	TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:184024572A>G	ENST00000310118.4	+	16	2542	c.1984A>G	c.(1984-1986)Atg>Gtg	p.M662V	PSMD2_ENST00000439383.1_Missense_Mutation_p.M532V|PSMD2_ENST00000435761.1_Missense_Mutation_p.M503V|EIF2B5_ENST00000444495.1_Intron	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	662					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	CCTTATTGCTATGGGGGAGGA	0.463													A|||	7	0.00139776	0.0	0.0	5008	,	,		16957	0.0		0.0	False		,,,				2504	0.0072				Colon(24;313 636 6917 9932 15554)												0													181.0	177.0	178.0					3																	184024572		2203	4300	6503	SO:0001583	missense	0			AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.1984A>G	3.37:g.184024572A>G	ENSP00000310129:p.Met662Val		B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Missense_Mutation	SNP	pfam_Proteasome/cyclosome_rpt,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn1	p.M662V	ENST00000310118.4	37	c.1984	CCDS3258.1	3	.	.	.	.	.	.	.	.	.	.	A	18.18	3.566234	0.65651	.	.	ENSG00000175166	ENST00000310118;ENST00000538096;ENST00000435761;ENST00000439383	T;T;T	0.30448	1.53;1.53;1.53	5.36	5.36	0.76844	Armadillo-type fold (1);	0.067709	0.85682	D	0.000000	T	0.50735	0.1633	M	0.88640	2.97	0.80722	D	1	B;B	0.31435	0.128;0.323	B;B	0.41332	0.114;0.354	T	0.58470	-0.7631	10	0.87932	D	0	-26.827	15.5211	0.75866	1.0:0.0:0.0:0.0	.	503;662	E9PCS3;Q13200	.;PSMD2_HUMAN	V	662;654;503;532	ENSP00000310129:M662V;ENSP00000402618:M503V;ENSP00000416028:M532V	ENSP00000310129:M662V	M	+	1	0	PSMD2	185507266	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.679000	0.91220	2.245000	0.73994	0.454000	0.30748	ATG	PSMD2	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn1	ENSG00000175166		0.463	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD2	HGNC	protein_coding	OTTHUMT00000345843.1	-	0.00	76	0	A	NM_002808		184024572	+1	tier1	-	no_errors	ENST00000310118	ensembl	human	known	74_37	missense	17.00	166	34	SNP	1.000	G
PXDNL	137902	genome.wustl.edu	37	8	52323921	52323921	+	Missense_Mutation	SNP	G	G	T	rs202110442		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr8:52323921G>T	ENST00000356297.4	-	16	2051	c.1951C>A	c.(1951-1953)Cgt>Agt	p.R651S	PXDNL_ENST00000543296.1_Missense_Mutation_p.R651S	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	651					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AGTGGGTCACGCGGGTAATGA	0.493																																																	0													51.0	52.0	52.0					8																	52323921		1962	4140	6102	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1951C>A	8.37:g.52323921G>T	ENSP00000348645:p.Arg651Ser		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.R651S	ENST00000356297.4	37	c.1951	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	0.094	-1.162620	0.01673	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.63580	-0.04;-0.05	4.46	-1.24	0.09435	.	.	.	.	.	T	0.43166	0.1235	L	0.31120	0.905	0.09310	N	1	B	0.25007	0.116	B	0.27608	0.081	T	0.24621	-1.0155	9	0.25751	T	0.34	.	4.3491	0.11146	0.0835:0.1207:0.2315:0.5643	.	651	A1KZ92	PXDNL_HUMAN	S	651	ENSP00000348645:R651S;ENSP00000444865:R651S	ENSP00000348645:R651S	R	-	1	0	PXDNL	52486474	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.119000	0.15626	-0.761000	0.04670	-0.136000	0.14681	CGT	PXDNL	-	NULL	ENSG00000147485		0.493	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1		0.00	43	0	G	NM_144651		52323921	-1			no_errors	ENST00000356297	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.003	T
R3HDM2	22864	genome.wustl.edu	37	12	57663120	57663120	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:57663120G>T	ENST00000347140.3	-	16	2048	c.1658C>A	c.(1657-1659)cCa>cAa	p.P553Q	R3HDM2_ENST00000358907.2_Missense_Mutation_p.P553Q|R3HDM2_ENST00000413953.2_Missense_Mutation_p.P280Q|R3HDM2_ENST00000403821.2_Missense_Mutation_p.P587Q|R3HDM2_ENST00000546843.1_5'Flank|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000402412.1_Missense_Mutation_p.P567Q|R3HDM2_ENST00000441731.2_Missense_Mutation_p.P248Q			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	553	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CTGCTGGGATGGCTGAGGCAG	0.502																																																	0													79.0	84.0	83.0					12																	57663120		2203	4300	6503	SO:0001583	missense	0			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1658C>A	12.37:g.57663120G>T	ENSP00000317903:p.Pro553Gln		Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.P553Q	ENST00000347140.3	37	c.1658	CCDS8937.2	12	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965786	0.53507	.	.	ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821	T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.0	5.0	0.66597	.	0.116551	0.64402	D	0.000020	T	0.39655	0.1086	L	0.54323	1.7	0.44227	D	0.997064	B;B;B;B	0.11235	0.001;0.004;0.004;0.003	B;B;B;B	0.12156	0.001;0.004;0.004;0.007	T	0.22417	-1.0217	10	0.49607	T	0.09	-2.3519	13.1777	0.59637	0.0:0.0:0.8398:0.1602	.	587;567;553;280	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	Q	280;280;553;567;553;248;318;587	ENSP00000409146:P280Q;ENSP00000377400:P280Q;ENSP00000317903:P553Q;ENSP00000385839:P567Q;ENSP00000351784:P553Q;ENSP00000408536:P248Q;ENSP00000394676:P318Q;ENSP00000385169:P587Q	ENSP00000317903:P553Q	P	-	2	0	R3HDM2	55949387	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.557000	0.60782	2.753000	0.94483	0.655000	0.94253	CCA	R3HDM2	-	NULL	ENSG00000179912		0.502	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	HGNC	protein_coding	OTTHUMT00000326570.2	-	0.00	70	0	G	NM_014925		57663120	-1	tier1	-	no_errors	ENST00000347140	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
RAB2A	5862	genome.wustl.edu	37	8	61496838	61496838	+	Silent	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr8:61496838C>T	ENST00000262646.7	+	4	609	c.258C>T	c.(256-258)taC>taT	p.Y86Y	RAB2A_ENST00000529579.1_Silent_p.Y86Y|RAB2A_ENST00000531289.1_Silent_p.Y62Y|RAB2A_ENST00000530071.1_3'UTR	NM_002865.2	NP_002856.1	P61019	RAB2A_HUMAN	RAB2A, member RAS oncogene family	86					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|lung(4)	6			BRCA - Breast invasive adenocarcinoma(89;0.0805)			TACTAGTTTACGATATTACAC	0.373																																																	0													136.0	133.0	134.0					8																	61496838		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6175.1, CCDS56537.1	8q12.1	2007-01-15	2007-01-15	2007-01-15	ENSG00000104388	ENSG00000104388		"""RAB, member RAS oncogene"""	9763	protein-coding gene	gene with protein product		179509	"""RAB2, member RAS oncogene family"""	RAB2			Standard	NM_002865		Approved		uc003xud.2	P61019	OTTHUMG00000134298	ENST00000262646.7:c.258C>T	8.37:g.61496838C>T			B2R5W8|B4DMQ5|P08886	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Y86	ENST00000262646.7	37	c.258	CCDS6175.1	8																																																																																			RAB2A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000104388		0.373	RAB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB2A	HGNC	protein_coding	OTTHUMT00000259145.2	-	0.00	76	0	C			61496838	+1	tier1	-	no_errors	ENST00000262646	ensembl	human	known	74_37	silent	47.76	35	32	SNP	1.000	T
RAB3GAP1	22930	genome.wustl.edu	37	2	135920326	135920326	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:135920326G>T	ENST00000264158.8	+	21	2438	c.2395G>T	c.(2395-2397)Gaa>Taa	p.E799*	RAB3GAP1_ENST00000442034.1_Nonsense_Mutation_p.E799*|RAB3GAP1_ENST00000487003.1_3'UTR|RAB3GAP1_ENST00000539493.1_Nonsense_Mutation_p.E755*|ZRANB3_ENST00000412849.1_Intron	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	799					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		AGAAAGTCTCGAAAACATTTC	0.303																																																	0													71.0	82.0	79.0					2																	135920326		2194	4297	6491	SO:0001587	stop_gained	0			D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.2395G>T	2.37:g.135920326G>T	ENSP00000264158:p.Glu799*		A6H8Z3|C9J837|Q659F5|Q8TBB4	Nonsense_Mutation	SNP	NULL	p.E799*	ENST00000264158.8	37	c.2395	CCDS33294.1	2	.	.	.	.	.	.	.	.	.	.	G	38	7.071473	0.98044	.	.	ENSG00000115839	ENST00000264158;ENST00000539493;ENST00000442034	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-24.6108	20.6208	0.99490	0.0:0.0:1.0:0.0	.	.	.	.	X	799;755;799	.	ENSP00000264158:E799X	E	+	1	0	RAB3GAP1	135636796	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.839000	0.92120	2.882000	0.98803	0.655000	0.94253	GAA	RAB3GAP1	-	NULL	ENSG00000115839		0.303	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP1	HGNC	protein_coding	OTTHUMT00000337514.2	-	0.00	31	0	G	NM_012233		135920326	+1	tier1	-	no_errors	ENST00000264158	ensembl	human	known	74_37	nonsense	13.64	19	3	SNP	1.000	T
RBAK	57786	genome.wustl.edu	37	7	5103473	5103473	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:5103473C>A	ENST00000353796.3	+	6	710	c.386C>A	c.(385-387)cCt>cAt	p.P129H	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.P129H	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	129					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		AGCCTTGTTCCTTCAAGCATA	0.353																																																	0													109.0	104.0	106.0					7																	5103473		2203	4300	6503	SO:0001583	missense	0			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.386C>A	7.37:g.5103473C>A	ENSP00000275423:p.Pro129His		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P129H	ENST00000353796.3	37	c.386	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	C	10.12	1.263457	0.23051	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.07216	3.21;3.21	3.91	3.91	0.45181	.	0.313457	0.23439	N	0.048178	T	0.06050	0.0157	N	0.11651	0.15	0.28496	N	0.914222	D	0.56287	0.975	P	0.46543	0.52	T	0.37244	-0.9714	8	.	.	.	.	11.5809	0.50891	0.0:1.0:0.0:0.0	.	129	Q9NYW8	RBAK_HUMAN	H	129	ENSP00000275423:P129H;ENSP00000380120:P129H	.	P	+	2	0	RBAK	5069999	0.959000	0.32827	0.110000	0.21437	0.867000	0.49689	0.750000	0.26334	2.181000	0.69327	0.555000	0.69702	CCT	RBAK	-	NULL	ENSG00000146587		0.353	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	HGNC	protein_coding	OTTHUMT00000241640.2	-	0.00	72	0	C	NM_021163		5103473	+1	tier1	-	no_errors	ENST00000353796	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.016	A
RBM14	10432	genome.wustl.edu	37	11	66391808	66391808	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:66391808G>T	ENST00000310137.4	+	2	600	c.461G>T	c.(460-462)gGg>gTg	p.G154V	RBM14_ENST00000461478.1_3'UTR|RBM14_ENST00000443702.1_3'UTR|RBM14_ENST00000393979.3_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM14_ENST00000409738.4_Intron|RBM4_ENST00000514361.3_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM4_ENST00000503028.2_Intron|RBM14_ENST00000409372.1_3'UTR|RBM14-RBM4_ENST00000511114.1_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	154					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CAGAAGAAGGGGCCTGGCCTG	0.587																																																	0													59.0	60.0	60.0					11																	66391808		2200	4295	6495	SO:0001583	missense	0			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.461G>T	11.37:g.66391808G>T	ENSP00000311747:p.Gly154Val		B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G154V	ENST00000310137.4	37	c.461	CCDS8147.1	11	.	.	.	.	.	.	.	.	.	.	G	15.83	2.947860	0.53186	.	.	ENSG00000239306	ENST00000310137	T	0.74737	-0.87	5.44	5.44	0.79542	Nucleotide-binding, alpha-beta plait (1);	0.137450	0.47852	D	0.000210	T	0.70298	0.3208	N	0.14661	0.345	0.80722	D	1	D	0.54601	0.967	P	0.52424	0.698	T	0.75938	-0.3141	10	0.72032	D	0.01	-2.5152	16.7728	0.85543	0.0:0.0:1.0:0.0	.	154	Q96PK6	RBM14_HUMAN	V	154	ENSP00000311747:G154V	ENSP00000311747:G154V	G	+	2	0	RBM14	66148384	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.235000	0.65348	2.560000	0.86352	0.655000	0.94253	GGG	RBM14	-	NULL	ENSG00000239306		0.587	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	HGNC	protein_coding	OTTHUMT00000277128.1	-	0.00	94	0	G	NM_006328		66391808	+1	tier1	-	no_errors	ENST00000310137	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
RBM5	10181	genome.wustl.edu	37	3	50150892	50150892	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:50150892C>T	ENST00000347869.3	+	18	1707	c.1532C>T	c.(1531-1533)tCt>tTt	p.S511F	RBM5_ENST00000441812.2_3'UTR|RP11-493K19.3_ENST00000437204.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	511	Required for interaction with U2AF2.|Sufficient for interaction with ACIN1, PRPF8, SFRS3, SNRPB, SNRPN, SNRNP70 and SNRNP200.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCTGCAGAGTCTAGCTCCCAC	0.488																																																	0													88.0	104.0	99.0					3																	50150892		2203	4300	6503	SO:0001583	missense	0			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1532C>T	3.37:g.50150892C>T	ENSP00000343054:p.Ser511Phe		B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.S511F	ENST00000347869.3	37	c.1532	CCDS2810.1	3	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321372	0.60634	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	T	0.15952	2.38	5.56	4.67	0.58626	.	0.602089	0.16374	N	0.217218	T	0.11367	0.0277	N	0.08118	0	0.22851	N	0.99866	B;P	0.44478	0.158;0.836	B;B	0.42738	0.089;0.396	T	0.12785	-1.0534	10	0.62326	D	0.03	-4.9011	12.8027	0.57594	0.0:0.596:0.404:0.0	.	201;511	Q59HE6;P52756	.;RBM5_HUMAN	F	511;510;201	ENSP00000343054:S511F	ENSP00000343054:S511F	S	+	2	0	RBM5	50125896	0.709000	0.27886	0.250000	0.24296	0.948000	0.59901	4.009000	0.57110	2.608000	0.88229	0.563000	0.77884	TCT	RBM5	-	NULL	ENSG00000003756		0.488	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	HGNC	protein_coding	OTTHUMT00000345797.3	-	0.00	55	0	C	NM_005778		50150892	+1	tier1	-	no_errors	ENST00000347869	ensembl	human	known	74_37	missense	53.33	21	24	SNP	0.008	T
RGS22	26166	genome.wustl.edu	37	8	101018284	101018284	+	Silent	SNP	T	T	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr8:101018284T>A	ENST00000360863.6	-	16	2609	c.2415A>T	c.(2413-2415)ctA>ctT	p.L805L	RGS22_ENST00000519421.1_5'UTR|RGS22_ENST00000523437.1_Silent_p.L793L|RGS22_ENST00000523287.1_Silent_p.L624L|SNORD77_ENST00000391112.1_RNA	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	805					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GCAAAGCCTGTAGCTTTCTGA	0.363																																																	0													107.0	102.0	104.0					8																	101018284		1832	4090	5922	SO:0001819	synonymous_variant	0			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.2415A>T	8.37:g.101018284T>A			A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Silent	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	p.L805	ENST00000360863.6	37	c.2415	CCDS43758.1	8																																																																																			RGS22	-	NULL	ENSG00000132554		0.363	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS22	HGNC	protein_coding	OTTHUMT00000380365.1		0.00	28	0	T	NM_015668		101018284	-1			no_errors	ENST00000360863	ensembl	human	known	74_37	silent	13.51	32	5	SNP	0.984	A
RUFY2	55680	genome.wustl.edu	37	10	70154087	70154087	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr10:70154087G>T	ENST00000602465.1	-	5	620	c.520C>A	c.(520-522)Caa>Aaa	p.Q174K	RUFY2_ENST00000399200.2_Missense_Mutation_p.Q140K|RUFY2_ENST00000454950.2_Missense_Mutation_p.Q116K|RUFY2_ENST00000472394.2_5'UTR|RUFY2_ENST00000388768.2_Missense_Mutation_p.Q209K|RUFY2_ENST00000342616.4_Missense_Mutation_p.Q174K			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	223	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.Q209E(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						TCACTTACTTGTGAGTCTAAA	0.423																																																	1	Substitution - Missense(1)	lung(1)											183.0	175.0	177.0					10																	70154087		2042	4203	6245	SO:0001583	missense	0			AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.520C>A	10.37:g.70154087G>T	ENSP00000473462:p.Gln174Lys		B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Missense_Mutation	SNP	pfam_Run,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Run,smart_Znf_FYVE,pfscan_Run,pfscan_Znf_FYVE-rel	p.Q209K	ENST00000602465.1	37	c.625		10	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427813	0.83667	.	.	ENSG00000204130	ENST00000388768;ENST00000399200;ENST00000454950;ENST00000342616	T;T;T;T	0.55413	0.52;1.7;1.28;1.45	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.75042	0.3796	M	0.82823	2.61	0.80722	D	1	P;P;P;P;P	0.52577	0.71;0.781;0.809;0.954;0.916	P;B;P;D;P	0.67900	0.563;0.204;0.747;0.954;0.813	T	0.74463	-0.3657	10	0.42905	T	0.14	.	19.3116	0.94189	0.0:0.0:1.0:0.0	.	116;174;174;140;209	B4DFR0;Q5TC51;Q8WXA3-2;Q8WXA3-4;Q8WXA3-3	.;.;.;.;.	K	209;140;116;174	ENSP00000373420:Q209K;ENSP00000382151:Q140K;ENSP00000404986:Q116K;ENSP00000341727:Q174K	ENSP00000341727:Q174K	Q	-	1	0	RUFY2	69824093	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.646000	0.98474	2.808000	0.96608	0.650000	0.86243	CAA	RUFY2	-	NULL	ENSG00000204130		0.423	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	RUFY2	HGNC	protein_coding	OTTHUMT00000467567.1		0.00	74	0	G	NM_017987		70154087	-1			no_errors	ENST00000388768	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
RUNX2	860	genome.wustl.edu	37	6	45514591	45514591	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:45514591A>T	ENST00000371438.1	+	8	1473	c.1115A>T	c.(1114-1116)gAc>gTc	p.D372V	RUNX2_ENST00000352853.5_Missense_Mutation_p.D440V|RUNX2_ENST00000359524.5_Missense_Mutation_p.D358V|RUNX2_ENST00000465038.2_Missense_Mutation_p.D372V|RUNX2_ENST00000371436.6_Missense_Mutation_p.D350V|RUNX2_ENST00000371432.3_Missense_Mutation_p.D336V|RUNX2_ENST00000541979.1_Missense_Mutation_p.D418V|RUNX2_ENST00000576263.1_Intron	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	372	Interaction with KAT6A. {ECO:0000250}.|Pro/Ser/Thr-rich.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CCTTTTTCAGACCCCAGGCAG	0.438																																																	0													92.0	93.0	93.0					6																	45514591		2203	4300	6503	SO:0001583	missense	0			AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.1115A>T	6.37:g.45514591A>T	ENSP00000360493:p.Asp372Val		O14614|O14615|O95181	Missense_Mutation	SNP	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_DNA-bd,pfscan_Runt_dom,prints_AML1_Runt	p.D440V	ENST00000371438.1	37	c.1319	CCDS43467.2	6	.	.	.	.	.	.	.	.	.	.	A	14.48	2.547964	0.45383	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9;-0.9;-0.9;-0.9	5.77	4.62	0.57501	.	0.052883	0.64402	D	0.000001	T	0.79673	0.4486	M	0.74467	2.265	0.80722	D	1	D;D;D	0.76494	0.975;0.999;0.999	P;D;D	0.78314	0.743;0.979;0.991	T	0.80233	-0.1467	10	0.41790	T	0.15	-9.0114	11.7488	0.51837	0.9314:0.0:0.0686:0.0	.	418;372;358	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	V	372;440;418;372;350;358;336	ENSP00000420707:D372V;ENSP00000319087:D440V;ENSP00000446290:D418V;ENSP00000360493:D372V;ENSP00000360491:D350V;ENSP00000352514:D358V;ENSP00000360486:D336V	ENSP00000319087:D440V	D	+	2	0	RUNX2	45622569	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.875000	0.63072	1.128000	0.42052	0.533000	0.62120	GAC	RUNX2	-	NULL	ENSG00000124813		0.438	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	RUNX2	HGNC	protein_coding	OTTHUMT00000040755.2	-	0.00	32	0	A	NM_004348		45514591	+1	tier1	-	no_errors	ENST00000352853	ensembl	human	known	74_37	missense	32.56	29	14	SNP	1.000	T
RYR3	6263	genome.wustl.edu	37	15	34105086	34105086	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:34105086G>A	ENST00000389232.4	+	73	10350	c.10280G>A	c.(10279-10281)tGg>tAg	p.W3427*	RYR3_ENST00000415757.3_Nonsense_Mutation_p.W3422*	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3427					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCTGTAAAATGGCAACTGAAC	0.428																																																	0													89.0	86.0	87.0					15																	34105086		1883	4121	6004	SO:0001587	stop_gained	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10280G>A	15.37:g.34105086G>A	ENSP00000373884:p.Trp3427*		O15175|Q15412	Nonsense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.W3427*	ENST00000389232.4	37	c.10280	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	52	19.253078	0.99917	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	.	.	.	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1742	0.89756	0.0:0.0:1.0:0.0	.	.	.	.	X	3427;3427;3422	.	ENSP00000354735:W3422X	W	+	2	0	RYR3	31892378	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	9.569000	0.98170	2.581000	0.87130	0.655000	0.94253	TGG	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.428	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	83	0	G			34105086	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	nonsense	34.69	32	17	SNP	1.000	A
SASS6	163786	genome.wustl.edu	37	1	100568546	100568546	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:100568546C>T	ENST00000287482.5	-	14	1779	c.1639G>A	c.(1639-1641)Gcc>Acc	p.A547T	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Missense_Mutation_p.A380T	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	547					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		GTATTTTTGGCAGATATCGAA	0.398																																																	0													116.0	115.0	115.0					1																	100568546		2203	4300	6503	SO:0001583	missense	0			AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1639G>A	1.37:g.100568546C>T	ENSP00000287482:p.Ala547Thr		D3DT55|Q8N3K0	Missense_Mutation	SNP	NULL	p.A547T	ENST00000287482.5	37	c.1639	CCDS764.1	1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.737994	0.30774	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.46451	0.89;0.87	4.62	1.73	0.24493	.	1.063270	0.07247	N	0.865278	T	0.12902	0.0313	L	0.36672	1.1	0.21256	N	0.999747	B	0.09022	0.002	B	0.14578	0.011	T	0.33111	-0.9881	10	0.15499	T	0.54	1.5273	8.7564	0.34648	0.0:0.7469:0.0:0.2531	.	547	Q6UVJ0	SAS6_HUMAN	T	547;520;380	ENSP00000287482:A547T;ENSP00000440169:A380T	ENSP00000287482:A547T	A	-	1	0	SASS6	100341134	0.010000	0.17322	0.998000	0.56505	0.802000	0.45316	-0.228000	0.09114	0.681000	0.31386	0.549000	0.68633	GCC	SASS6	-	NULL	ENSG00000156876		0.398	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASS6	HGNC	protein_coding	OTTHUMT00000029656.2	-	0.00	46	0	C	NM_194292		100568546	-1	tier1	-	no_errors	ENST00000287482	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.951	T
SCAF4	57466	genome.wustl.edu	37	21	33063188	33063188	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr21:33063188G>A	ENST00000286835.7	-	15	2189	c.1807C>T	c.(1807-1809)Cca>Tca	p.P603S	SCAF4_ENST00000399804.1_Missense_Mutation_p.P603S|SCAF4_ENST00000434667.3_Missense_Mutation_p.P588S	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	603						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TTGTCCCATGGAATATAAGTA	0.388																																																	0													196.0	189.0	191.0					21																	33063188		2203	4300	6503	SO:0001583	missense	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.1807C>T	21.37:g.33063188G>A	ENSP00000286835:p.Pro603Ser		C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_CID_dom,smart_RRM_dom,pfscan_RRM_dom	p.P603S	ENST00000286835.7	37	c.1807	CCDS33537.1	21	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484317	0.84854	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.72942	-0.65;-0.7;-0.44	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000004	D	0.86003	0.5829	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.998;0.996	D	0.86672	0.1911	10	0.87932	D	0	-10.1012	20.2033	0.98269	0.0:0.0:1.0:0.0	.	588;603;603;603	C9JLZ0;C9J1W7;O95104-2;O95104	.;.;.;SFR15_HUMAN	S	588;603;603	ENSP00000402377:P588S;ENSP00000286835:P603S;ENSP00000382703:P603S	ENSP00000286835:P603S	P	-	1	0	SCAF4	31985059	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.779000	0.95612	0.655000	0.94253	CCA	SCAF4	-	NULL	ENSG00000156304		0.388	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCAF4	HGNC	protein_coding	OTTHUMT00000192659.1	-	0.00	49	0	G	XM_047889		33063188	-1	tier1	-	no_errors	ENST00000286835	ensembl	human	known	74_37	missense	42.11	33	24	SNP	1.000	A
SCN7A	6332	genome.wustl.edu	37	2	167262253	167262253	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:167262253G>T	ENST00000409855.1	-	25	5012	c.4886C>A	c.(4885-4887)gCa>gAa	p.A1629E		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1629					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.A1629E(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AATGATGGTTGCTGAAACTGC	0.368																																																	1	Substitution - Missense(1)	prostate(1)											166.0	158.0	161.0					2																	167262253		1875	4107	5982	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.4886C>A	2.37:g.167262253G>T	ENSP00000386796:p.Ala1629Glu			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.A1629E	ENST00000409855.1	37	c.4886	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461920	0.84425	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.98105	-4.72	4.51	4.51	0.55191	.	0.000000	0.56097	D	0.000040	D	0.98807	0.9598	M	0.91354	3.2	0.54753	D	0.999983	D	0.89917	1.0	D	0.66716	0.946	D	0.99316	1.0905	10	0.87932	D	0	.	15.1081	0.72336	0.0:0.0:1.0:0.0	.	1629	Q01118	SCN7A_HUMAN	E	1629	ENSP00000386796:A1629E	ENSP00000259060:A1629E	A	-	2	0	SCN7A	166970499	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.601000	0.98297	2.514000	0.84764	0.655000	0.94253	GCA	SCN7A	-	NULL	ENSG00000136546		0.368	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1		0.00	31	0	G			167262253	-1			no_errors	ENST00000409855	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
SCUBE3	222663	genome.wustl.edu	37	6	35205712	35205712	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:35205712G>A	ENST00000274938.7	+	7	746	c.746G>A	c.(745-747)aGt>aAt	p.S249N	SCUBE3_ENST00000394681.1_Missense_Mutation_p.S265N	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						GGCTGTGACAGTAAGTGCCAT	0.557																																																	0													134.0	113.0	120.0					6																	35205712		2203	4300	6503	SO:0001583	missense	0			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.746G>A	6.37:g.35205712G>A	ENSP00000274938:p.Ser249Asn			Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.S265N	ENST00000274938.7	37	c.794	CCDS4800.1	6	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466242	0.84425	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.96334	-3.98;-3.98	5.38	4.46	0.54185	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.93070	0.7794	N	0.03000	-0.44	0.58432	D	0.999995	D;D	0.69078	0.997;0.993	D;D	0.77557	0.99;0.968	D	0.95348	0.8444	10	0.59425	D	0.04	.	14.8611	0.70382	0.0:0.0:0.8557:0.1443	.	265;249	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	N	265;249	ENSP00000378174:S265N;ENSP00000274938:S249N	ENSP00000274938:S249N	S	+	2	0	SCUBE3	35313690	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	6.616000	0.74205	2.523000	0.85059	0.491000	0.48974	AGT	SCUBE3	-	smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,prints_Thrombomodulin	ENSG00000146197		0.557	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE3	HGNC	protein_coding	OTTHUMT00000040275.1	-	0.00	84	0	G	NM_152753		35205712	+1	tier1	-	no_errors	ENST00000394681	ensembl	human	known	74_37	missense	33.85	43	22	SNP	1.000	A
SEMA4F	10505	genome.wustl.edu	37	2	74902937	74902937	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:74902937G>A	ENST00000357877.2	+	12	1693	c.1544G>A	c.(1543-1545)cGt>cAt	p.R515H	SEMA4F_ENST00000339773.5_Missense_Mutation_p.R360H|SEMA4F_ENST00000473350.1_3'UTR	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	515	PSI.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.R515H(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						AACTGTGGCCGTCTCCAGAGC	0.592																																																	1	Substitution - Missense(1)	endometrium(1)											95.0	90.0	92.0					2																	74902937		2203	4300	6503	SO:0001583	missense	0			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1544G>A	2.37:g.74902937G>A	ENSP00000350547:p.Arg515His		Q542Y7|Q9NS35	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.R515H	ENST00000357877.2	37	c.1544	CCDS1955.1	2	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896539	0.33442	.	.	ENSG00000135622	ENST00000357877;ENST00000339773	T;T	0.18657	2.2;2.2	4.26	4.26	0.50523	.	0.091418	0.46758	D	0.000269	T	0.25158	0.0611	L	0.52905	1.665	0.21105	N	0.999787	B;P	0.52061	0.443;0.95	B;P	0.48552	0.253;0.581	T	0.08889	-1.0700	10	0.37606	T	0.19	.	9.4559	0.38753	0.0:0.0:0.7887:0.2113	.	360;515	O95754-2;O95754	.;SEM4F_HUMAN	H	515;360	ENSP00000350547:R515H;ENSP00000342675:R360H	ENSP00000342675:R360H	R	+	2	0	SEMA4F	74756445	0.000000	0.05858	0.999000	0.59377	0.884000	0.51177	-0.034000	0.12225	2.216000	0.71823	0.467000	0.42956	CGT	SEMA4F	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like_fold	ENSG00000135622		0.592	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4F	HGNC	protein_coding	OTTHUMT00000252214.2	-	0.00	39	0	G	NM_004263		74902937	+1	tier1	-	no_errors	ENST00000357877	ensembl	human	known	74_37	missense	35.29	33	18	SNP	0.429	A
SERPINA6	866	genome.wustl.edu	37	14	94780486	94780486	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr14:94780486C>T	ENST00000341584.3	-	2	646	c.500G>A	c.(499-501)aGc>aAc	p.S167N		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	167					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)	p.S167N(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	GATCTGTCTGCTGGCTGTTGC	0.493																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											133.0	133.0	133.0					14																	94780486		2203	4300	6503	SO:0001583	missense	0			J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.500G>A	14.37:g.94780486C>T	ENSP00000342850:p.Ser167Asn		A8K456|Q7Z2Q9	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S167N	ENST00000341584.3	37	c.500	CCDS9924.1	14	.	.	.	.	.	.	.	.	.	.	C	7.367	0.626119	0.14257	.	.	ENSG00000170099	ENST00000341584	D	0.84370	-1.84	5.05	3.16	0.36331	Serpin domain (3);	0.851133	0.10423	N	0.676453	D	0.84097	0.5397	M	0.74258	2.255	0.09310	N	1	B	0.27166	0.17	B	0.35859	0.212	T	0.75093	-0.3439	10	0.46703	T	0.11	.	3.4587	0.07524	0.0:0.4549:0.225:0.3201	.	167	P08185	CBG_HUMAN	N	167	ENSP00000342850:S167N	ENSP00000342850:S167N	S	-	2	0	SERPINA6	93850239	0.000000	0.05858	0.498000	0.27564	0.434000	0.31775	0.106000	0.15354	1.365000	0.46057	0.655000	0.94253	AGC	SERPINA6	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000170099		0.493	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA6	HGNC	protein_coding	OTTHUMT00000413065.1		0.00	49	0	C	NM_001756		94780486	-1			no_errors	ENST00000341584	ensembl	human	known	74_37	missense	6.98	39	3	SNP	0.076	T
SKIDA1	387640	genome.wustl.edu	37	10	21805720	21805720	+	Silent	SNP	A	A	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr10:21805720A>G	ENST00000449193.2	-	4	3284	c.1032T>C	c.(1030-1032)caT>caC	p.H344H	SKIDA1_ENST00000444772.3_Silent_p.H265H|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	263	Glu-rich.|Ser-rich.					nucleus (GO:0005634)											ggtggtggtgatggtggtggt	0.716																																																	0													4.0	6.0	5.0					10																	21805720		1658	3602	5260	SO:0001819	synonymous_variant	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1032T>C	10.37:g.21805720A>G			B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.H344	ENST00000449193.2	37	c.1032	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.716	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2		0.00	14	0	A	NM_207371		21805720	-1			no_errors	ENST00000449193	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.972	G
SLC22A24	283238	genome.wustl.edu	37	11	62886317	62886317	+	Silent	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr11:62886317C>T	ENST00000326192.5	-	4	1338	c.897G>A	c.(895-897)ctG>ctA	p.L299L	SLC22A24_ENST00000417740.1_Intron			Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	299					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						TCCCAGGTGTCAGAATTTTCC	0.448																																																	0																																										SO:0001819	synonymous_variant	0				CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000326192.5:c.897G>A	11.37:g.62886317C>T				Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L299	ENST00000326192.5	37	c.897		11																																																																																			SLC22A24	-	pfscan_MFS_dom	ENSG00000197658		0.448	SLC22A24-001	KNOWN	non_canonical_conserved|basic	protein_coding	SLC22A24	HGNC	protein_coding	OTTHUMT00000383749.1	-	0.00	62	0	C	NM_173586		62886317	-1	tier1	-	no_errors	ENST00000326192	ensembl	human	known	74_37	silent	56.10	18	23	SNP	0.001	T
SLC30A5	64924	genome.wustl.edu	37	5	68423939	68423939	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:68423939G>C	ENST00000396591.3	+	15	2717	c.2107G>C	c.(2107-2109)Gaa>Caa	p.E703Q	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	703					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TGATGTGCTAGAACAAAGAAT	0.348																																																	0													125.0	131.0	129.0					5																	68423939		2203	4300	6503	SO:0001583	missense	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.2107G>C	5.37:g.68423939G>C	ENSP00000379836:p.Glu703Gln		B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.E703Q	ENST00000396591.3	37	c.2107	CCDS3996.1	5	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118766	0.77323	.	.	ENSG00000145740	ENST00000396591;ENST00000438236	T	0.65364	-0.15	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.69269	0.3092	L	0.41236	1.265	0.80722	D	1	P	0.45569	0.861	P	0.55667	0.781	T	0.69544	-0.5117	10	0.52906	T	0.07	.	18.4567	0.90722	0.0:0.0:1.0:0.0	.	703	Q8TAD4	ZNT5_HUMAN	Q	703;298	ENSP00000379836:E703Q	ENSP00000379836:E703Q	E	+	1	0	SLC30A5	68459695	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.411000	0.97342	2.689000	0.91719	0.491000	0.48974	GAA	SLC30A5	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000145740		0.348	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	-	0.00	65	0	G			68423939	+1	tier1	-	no_errors	ENST00000396591	ensembl	human	known	74_37	missense	22.00	39	11	SNP	1.000	C
SLC51B	123264	genome.wustl.edu	37	15	65342383	65342383	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:65342383C>T	ENST00000334287.2	+	2	362	c.41C>T	c.(40-42)aCt>aTt	p.T14I		NM_178859.3	NP_849190.2	Q86UW2	OSTB_HUMAN	solute carrier family 51, beta subunit	14					bile acid and bile salt transport (GO:0015721)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein glycosylation (GO:0060050)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of protein stability (GO:0031647)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	CCAGCCGGTACTGTGGTACCC	0.612																																																	0													94.0	86.0	89.0					15																	65342383		2109	4101	6210	SO:0001583	missense	0				CCDS10199.1	15q22.31	2013-05-22			ENSG00000186198	ENSG00000186198		"""Solute carriers"""	29956	protein-coding gene	gene with protein product	"""organic solute transporter beta subunit"""	612085				12719432, 20538072	Standard	NM_178859		Approved	OSTbeta	uc002aog.3	Q86UW2	OTTHUMG00000133116	ENST00000334287.2:c.41C>T	15.37:g.65342383C>T	ENSP00000335292:p.Thr14Ile		Q3SYF5	Missense_Mutation	SNP	NULL	p.T14I	ENST00000334287.2	37	c.41	CCDS10199.1	15	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646068	0.67358	.	.	ENSG00000186198	ENST00000334287	.	.	.	4.61	3.68	0.42216	.	0.836117	0.11062	N	0.603813	T	0.50684	0.1630	L	0.57536	1.79	0.09310	N	1	P	0.51351	0.944	P	0.52957	0.714	T	0.37709	-0.9694	9	0.62326	D	0.03	-2.8454	10.0473	0.42195	0.0:0.9005:0.0:0.0995	.	14	Q86UW2	OSTB_HUMAN	I	14	.	ENSP00000335292:T14I	T	+	2	0	AC013553.1	63129436	0.002000	0.14202	0.006000	0.13384	0.280000	0.26924	1.479000	0.35453	2.502000	0.84385	0.591000	0.81541	ACT	SLC51B	-	NULL	ENSG00000186198		0.612	SLC51B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC51B	HGNC	protein_coding	OTTHUMT00000256783.1	-	0.00	51	0	C	NM_178859		65342383	+1	tier1	-	no_errors	ENST00000334287	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.004	T
SMAD2	4087	genome.wustl.edu	37	18	45395775	45395775	+	Missense_Mutation	SNP	C	C	A	rs374809046		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr18:45395775C>A	ENST00000402690.2	-	4	753	c.359G>T	c.(358-360)cGa>cTa	p.R120L	SMAD2_ENST00000586040.1_Missense_Mutation_p.R90L|SMAD2_ENST00000591214.1_Missense_Mutation_p.R90L|SMAD2_ENST00000262160.6_Missense_Mutation_p.R120L|SMAD2_ENST00000356825.4_Missense_Mutation_p.R90L|SMAD2_ENST00000587353.1_5'UTR	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	120	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.R120Q(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						CAATCCTTTTCGATGGGATAC	0.403																																																	1	Substitution - Missense(1)	large_intestine(1)											79.0	72.0	75.0					18																	45395775		2203	4300	6503	SO:0001583	missense	0			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.359G>T	18.37:g.45395775C>A	ENSP00000384449:p.Arg120Leu			Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.R120L	ENST00000402690.2	37	c.359	CCDS11934.1	18	.	.	.	.	.	.	.	.	.	.	C	26.8	4.775738	0.90195	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	T;T;T	0.78126	-1.15;-1.15;-1.15	5.17	5.17	0.71159	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.86159	0.5866	M	0.74467	2.265	0.80722	D	1	P;P;P	0.51147	0.942;0.936;0.898	P;P;P	0.56343	0.647;0.735;0.796	D	0.87793	0.2620	10	0.87932	D	0	.	19.0248	0.92929	0.0:1.0:0.0:0.0	.	90;90;120	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	L	120;90;120	ENSP00000262160:R120L;ENSP00000349282:R90L;ENSP00000384449:R120L	ENSP00000262160:R120L	R	-	2	0	SMAD2	43649773	1.000000	0.71417	0.917000	0.36280	0.983000	0.72400	7.776000	0.85560	2.566000	0.86566	0.591000	0.81541	CGA	SMAD2	-	pfam_MAD_homology1_Dwarfin-type,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,pfscan_MAD_homology_MH1	ENSG00000175387		0.403	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD2	HGNC	protein_coding	OTTHUMT00000450571.1		0.00	42	0	C	NM_005901		45395775	-1			no_errors	ENST00000262160	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
TEX2	55852	genome.wustl.edu	37	17	62223820	62223820	+	IGR	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:62223820C>T	ENST00000583097.1	-	0	4852				SNORA76_ENST00000408535.2_lincRNA|SNORD104_ENST00000362883.1_RNA			Q8IWB9	TEX2_HUMAN	testis expressed 2						signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TTTTTAACCGCGAGCGACAAG	0.602																																																	0													120.0	127.0	125.0					17																	62223820		876	1991	2867	SO:0001628	intergenic_variant	0			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9			17.37:g.62223820C>T			Q6AHZ5|Q8N3L0|Q9C0C5	RNA	SNP	-	NULL	ENST00000583097.1	37	NULL		17																																																																																			SNORA76	-	-	ENSG00000266402		0.602	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	SNORA76	HGNC	protein_coding	OTTHUMT00000443745.1		0.00	58	0	C	NM_018469		62223820	+1			no_errors	ENST00000408535	ensembl	human	known	74_37	rna	5.56	68	4	SNP	1.000	T
SNTG2	54221	genome.wustl.edu	37	2	1371139	1371139	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:1371139G>T	ENST00000308624.5	+	17	1642	c.1513G>T	c.(1513-1515)Gct>Tct	p.A505S	SNTG2_ENST00000407292.1_Missense_Mutation_p.A378S	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	505					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GGACCTGAGGGCTGTCCTGCA	0.458																																																	0													32.0	29.0	30.0					2																	1371139		692	1591	2283	SO:0001583	missense	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1513G>T	2.37:g.1371139G>T	ENSP00000311837:p.Ala505Ser		Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A505S	ENST00000308624.5	37	c.1513	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	G	3.524	-0.097061	0.07010	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.69306	1.19;-0.39	4.91	3.04	0.35103	.	0.127499	0.52532	N	0.000068	T	0.53610	0.1807	L	0.56396	1.775	0.24325	N	0.99503	P;B	0.35628	0.513;0.379	B;B	0.34093	0.175;0.033	T	0.41998	-0.9477	10	0.07325	T	0.83	.	8.5982	0.33729	0.0808:0.0:0.766:0.1533	.	378;505	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	S	505;378	ENSP00000311837:A505S;ENSP00000385020:A378S	ENSP00000311837:A505S	A	+	1	0	SNTG2	1350146	1.000000	0.71417	0.002000	0.10522	0.001000	0.01503	4.496000	0.60360	0.999000	0.39023	0.655000	0.94253	GCT	SNTG2	-	NULL	ENSG00000172554		0.458	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1		0.00	28	0	G	NM_018968		1371139	+1			no_errors	ENST00000308624	ensembl	human	known	74_37	missense	9.80	46	5	SNP	0.239	T
SNX29P2	440352	genome.wustl.edu	37	16	29376056	29376056	+	RNA	SNP	T	T	A	rs375054637		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:29376056T>A	ENST00000507381.1	+	0	795				SNX29P2_ENST00000398878.3_lincRNA			Q8IUI4	S29P2_HUMAN	sorting nexin 29 pseudogene 2									p.I114N(3)									ACCAACATTATCTCATTTGAT	0.403																																																	3	Substitution - Missense(3)	prostate(3)											63.0	68.0	66.0					16																	29376056		2192	4295	6487			0			BX648280		16p11.2	2014-03-21	2011-08-16	2011-08-16	ENSG00000198106	ENSG00000198106			31914	pseudogene	pseudogene			"""RUN domain containing 2C"""	RUNDC2C			Standard	NR_002939		Approved		uc021tfw.1	Q8IUI4			16.37:g.29376056T>A				RNA	SNP	-	NULL	ENST00000507381.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	t	14.29	2.491282	0.44249	.	.	ENSG00000198106	ENST00000398878;ENST00000507381;ENST00000356328	.	.	.	1.53	1.53	0.23141	.	0.056386	0.64402	D	0.000002	T	0.56601	0.1996	.	.	.	0.37024	D	0.89637	D;D	0.61080	0.989;0.989	P;P	0.55087	0.768;0.768	T	0.62286	-0.6886	8	0.54805	T	0.06	-0.344	7.1343	0.25519	0.0:0.0:0.0:1.0	.	114;133	Q8IUI4;E9PDE2	RUN2B_HUMAN;.	N	114;133;114	.	ENSP00000348682:I114N	I	+	2	0	RUNDC2C	29283557	1.000000	0.71417	0.999000	0.59377	0.563000	0.35712	5.194000	0.65125	0.956000	0.37904	0.327000	0.21459	ATC	SNX29P2	-	-	ENSG00000198106		0.403	SNX29P2-001	KNOWN	basic	processed_transcript	SNX29P2	HGNC	pseudogene	OTTHUMT00000361855.1		0.00	57	0	T	NR_002939		29376056	+1			no_errors	ENST00000356328	ensembl	human	known	74_37	rna	9.09	50	5	SNP	1.000	A
SPAG1	6674	genome.wustl.edu	37	8	101203620	101203620	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr8:101203620C>A	ENST00000388798.2	+	9	1026	c.835C>A	c.(835-837)Ctt>Att	p.L279I	SPAG1_ENST00000520643.1_Missense_Mutation_p.L279I|SPAG1_ENST00000520508.1_Missense_Mutation_p.L279I|SPAG1_ENST00000251809.3_Missense_Mutation_p.L279I	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	279					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		ATTTTCAGCTCTTCTGCGTCG	0.353																																																	0													107.0	105.0	105.0					8																	101203620		2203	4300	6503	SO:0001583	missense	0			AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.835C>A	8.37:g.101203620C>A	ENSP00000373450:p.Leu279Ile		A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L279I	ENST00000388798.2	37	c.835	CCDS34930.1	8	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895305	0.72639	.	.	ENSG00000104450	ENST00000520643;ENST00000251809;ENST00000520508;ENST00000388798	T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42	5.09	4.19	0.49359	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.152578	0.45126	D	0.000399	T	0.80093	0.4560	M	0.83384	2.64	0.42513	D	0.992979	D;D	0.69078	0.997;0.978	D;P	0.66351	0.943;0.756	T	0.82137	-0.0606	10	0.56958	D	0.05	-16.988	11.6423	0.51240	0.0:0.9092:0.0:0.0908	.	279;279	Q07617;G3XAM3	SPAG1_HUMAN;.	I	279	ENSP00000427716:L279I;ENSP00000251809:L279I;ENSP00000428070:L279I;ENSP00000373450:L279I	ENSP00000251809:L279I	L	+	1	0	SPAG1	101272796	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.842000	0.39250	2.529000	0.85273	0.555000	0.69702	CTT	SPAG1	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000104450		0.353	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG1	HGNC	protein_coding	OTTHUMT00000379853.2		0.00	45	0	C	NM_172218		101203620	+1			no_errors	ENST00000251809	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	A
SPATA31D1	389763	genome.wustl.edu	37	9	84606906	84606906	+	Silent	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr9:84606906C>T	ENST00000344803.2	+	4	1568	c.1521C>T	c.(1519-1521)ctC>ctT	p.L507L		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	507					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCTGGGGTCTCCCATCTTTGC	0.438																																																	0													75.0	70.0	71.0					9																	84606906		1962	4167	6129	SO:0001819	synonymous_variant	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1521C>T	9.37:g.84606906C>T				Silent	SNP	NULL	p.L507	ENST00000344803.2	37	c.1521	CCDS47986.1	9																																																																																			SPATA31D1	-	NULL	ENSG00000214929		0.438	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	90	0	C	NM_001001670		84606906	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	silent	15.43	148	27	SNP	0.684	T
SPATA9	83890	genome.wustl.edu	37	5	95018554	95018554	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:95018554G>T	ENST00000274432.8	-	1	146	c.5C>A	c.(4-6)cCa>cAa	p.P2Q	SPATA9_ENST00000395899.3_Missense_Mutation_p.P2Q|RFESD_ENST00000508206.1_Intron|SPATA9_ENST00000477047.2_5'UTR	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	2					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		AGGTTTGATTGGCATGGTGAG	0.463																																																	0													150.0	144.0	146.0					5																	95018554		2203	4300	6503	SO:0001583	missense	0			AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.5C>A	5.37:g.95018554G>T	ENSP00000274432:p.Pro2Gln		A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	NULL	p.P2Q	ENST00000274432.8	37	c.5	CCDS4076.1	5	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957262	0.53400	.	.	ENSG00000145757	ENST00000274432;ENST00000395899	T	0.45668	0.89	4.8	2.94	0.34122	.	0.485483	0.17410	N	0.175226	T	0.27832	0.0685	N	0.19112	0.55	0.23210	N	0.998113	P	0.37207	0.587	B	0.40066	0.318	T	0.11842	-1.0571	10	0.56958	D	0.05	-1.0216	5.6401	0.17559	0.1011:0.0:0.6986:0.2003	.	2	Q9BWV2	SPAT9_HUMAN	Q	2	ENSP00000274432:P2Q	ENSP00000274432:P2Q	P	-	2	0	SPATA9	95044310	0.915000	0.31059	0.733000	0.30861	0.919000	0.55068	1.171000	0.31896	0.565000	0.29255	0.563000	0.77884	CCA	SPATA9	-	NULL	ENSG00000145757		0.463	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA9	HGNC	protein_coding	OTTHUMT00000304036.1		0.00	54	0	G	NM_031952		95018554	-1			no_errors	ENST00000274432	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.955	T
SPG11	80208	genome.wustl.edu	37	15	44887495	44887495	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:44887495T>A	ENST00000261866.7	-	26	4613	c.4597A>T	c.(4597-4599)Agc>Tgc	p.S1533C	SPG11_ENST00000427534.2_Missense_Mutation_p.S1533C|SPG11_ENST00000535302.2_Missense_Mutation_p.S1533C|SPG11_ENST00000558319.1_Missense_Mutation_p.S1533C	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1533					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AGAGTTTTGCTCTTTTGTCTT	0.403																																																	0													113.0	110.0	111.0					15																	44887495		2198	4298	6496	SO:0001583	missense	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.4597A>T	15.37:g.44887495T>A	ENSP00000261866:p.Ser1533Cys		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.S1533C	ENST00000261866.7	37	c.4597	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	T	13.86	2.364366	0.41902	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.79845	-1.31;-1.31;-1.31	5.53	5.53	0.82687	.	0.341466	0.35291	N	0.003319	T	0.71829	0.3386	L	0.35723	1.085	0.80722	D	1	B;B;B	0.18461	0.009;0.028;0.009	B;B;B	0.20955	0.016;0.032;0.016	T	0.67542	-0.5644	10	0.38643	T	0.18	.	10.7346	0.46117	0.1413:0.0:0.0:0.8587	.	1533;1533;1533	C4B7M2;F5H3N6;Q96JI7	.;.;SPTCS_HUMAN	C	1533	ENSP00000261866:S1533C;ENSP00000445278:S1533C;ENSP00000396110:S1533C	ENSP00000261866:S1533C	S	-	1	0	SPG11	42674787	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	1.880000	0.39628	2.101000	0.63845	0.533000	0.62120	AGC	SPG11	-	NULL	ENSG00000104133		0.403	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1	-	0.00	40	0	T			44887495	-1	tier1	-	no_errors	ENST00000261866	ensembl	human	known	74_37	missense	19.64	45	11	SNP	0.999	A
SPTBN4	57731	genome.wustl.edu	37	19	41008712	41008712	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:41008712G>T	ENST00000352632.3	+	11	1320	c.1234G>T	c.(1234-1236)Gag>Tag	p.E412*	SPTBN4_ENST00000598249.1_Nonsense_Mutation_p.E412*|SPTBN4_ENST00000344104.3_Nonsense_Mutation_p.E412*|SPTBN4_ENST00000338932.3_Nonsense_Mutation_p.E412*|SPTBN4_ENST00000595535.1_Nonsense_Mutation_p.E412*			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	412					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGCTGAGCATGAGCGGGAGGC	0.577																																																	0													80.0	86.0	84.0					19																	41008712		2203	4300	6503	SO:0001587	stop_gained	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.1234G>T	19.37:g.41008712G>T	ENSP00000263373:p.Glu412*		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Nonsense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E412*	ENST00000352632.3	37	c.1234	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	G	39	7.617180	0.98393	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	.	.	.	4.2	4.2	0.49525	.	0.000000	0.64402	U	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	15.4668	0.75406	0.0:0.0:1.0:0.0	.	.	.	.	X	412	.	ENSP00000340345:E412X	E	+	1	0	SPTBN4	45700552	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.602000	0.98312	2.168000	0.68352	0.563000	0.77884	GAG	SPTBN4	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat	ENSG00000160460		0.577	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	-	0.00	20	0	G			41008712	+1	tier1	-	no_errors	ENST00000352632	ensembl	human	known	74_37	nonsense	16.67	15	3	SNP	1.000	T
PMS2P4	5382	genome.wustl.edu	37	7	66767623	66767623	+	RNA	SNP	T	T	C	rs200770839|rs71897997|rs533615862	byFrequency	TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:66767623T>C	ENST00000414507.1	-	0	0				STAG3L4_ENST00000416602.2_RNA					postmeiotic segregation increased 2 pseudogene 4																		TTTTTTTTTTTCCCGAACGAC	0.567													-|||	11	0.00219649	0.0	0.0014	5008	,	,		14263	0.006		0.0	False		,,,				2504	0.0041																0																																												0			D38438		7q11.22	2010-10-26	2010-10-26	2010-10-26	ENSG00000067601	ENSG00000067601			9129	pseudogene	pseudogene	"""PMS2 pseudogene"""		"""postmeiotic segregation increased 2-like 4"", ""postmeiotic segregation increased 2-like 4 pseudogene"""	PMS2L4		8586419	Standard	NR_046297		Approved	PMS6	uc003tvo.3		OTTHUMG00000156923		7.37:g.66767623T>C				RNA	SNP	-	NULL	ENST00000414507.1	37	NULL		7																																																																																			STAG3L4	-	-	ENSG00000106610		0.567	PMS2P4-002	KNOWN	basic	processed_transcript	STAG3L4	HGNC	pseudogene	OTTHUMT00000346632.1	-	0.00	78	0	T	NR_022007		66767623	+1	tier1	-	no_errors	ENST00000416602	ensembl	human	known	74_37	rna	6.90	79	6	SNP	0.016	C
SRRM3	222183	genome.wustl.edu	37	7	75890892	75890892	+	Missense_Mutation	SNP	C	C	T	rs563897360		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:75890892C>T	ENST00000326382.8	+	8	874	c.667C>T	c.(667-669)Cgg>Tgg	p.R223W	SRRM3_ENST00000388802.4_Missense_Mutation_p.R223W	NM_001110199.1	NP_001103669.1	A6NNA2	SRRM3_HUMAN	serine/arginine repetitive matrix 3	223	Arg-rich.|Lys-rich.|Ser-rich.									NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)	8						GAGGAAGAGACGGCACAGGTG	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		16602	0.0		0.0	False		,,,				2504	0.001																0													47.0	48.0	48.0					7																	75890892		1568	3582	5150	SO:0001583	missense	0			AK092590		7q11.23	2014-02-12			ENSG00000177679	ENSG00000177679			26729	protein-coding gene	gene with protein product							Standard	NM_001291831		Approved	FLJ37078	uc010ldi.2	A6NNA2	OTTHUMG00000130489	ENST00000326382.8:c.667C>T	7.37:g.75890892C>T	ENSP00000325298:p.Arg223Trp		A6ND75	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R223W	ENST00000326382.8	37	c.667		7	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698364	0.48307	.	.	ENSG00000177679	ENST00000388802;ENST00000326382	T	0.02579	4.24	4.08	2.03	0.26663	.	0.481828	0.16941	N	0.193300	T	0.06325	0.0163	M	0.64404	1.975	0.36657	D	0.877711	D	0.76494	0.999	P	0.50082	0.63	T	0.38200	-0.9672	10	0.72032	D	0.01	-14.0555	9.0157	0.36168	0.4949:0.5051:0.0:0.0	.	223	A6NNA2	SRRM3_HUMAN	W	223	ENSP00000373454:R223W	ENSP00000325298:R223W	R	+	1	2	SRRM3	75728828	0.975000	0.34042	1.000000	0.80357	0.974000	0.67602	0.002000	0.13061	1.032000	0.39892	0.655000	0.94253	CGG	SRRM3	-	NULL	ENSG00000177679		0.602	SRRM3-001	KNOWN	basic	protein_coding	SRRM3	HGNC	protein_coding	OTTHUMT00000252889.2	-	0.00	51	0	C	NM_001110199		75890892	+1	tier1	-	no_errors	ENST00000388802	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
STK4	6789	genome.wustl.edu	37	20	43623730	43623730	+	Splice_Site	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr20:43623730G>A	ENST00000372806.3	+	6	620		c.e6-1		STK4_ENST00000372801.1_Splice_Site|STK4_ENST00000499879.2_Splice_Site|STK4_ENST00000396731.4_Splice_Site	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4						apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				TTCTATTTTAGGATACCATGG	0.393																																					GBM(187;1039 2137 11798 21916 33213)												0													123.0	121.0	122.0					20																	43623730		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.526-1G>A	20.37:g.43623730G>A			B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Splice_Site	SNP	-	e6-1	ENST00000372806.3	37	c.526-1	CCDS13341.1	20	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574498	0.86542	.	.	ENSG00000101109	ENST00000372806;ENST00000396731;ENST00000372801;ENST00000499879	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2822	0.98520	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STK4	43057144	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.338000	0.96553	2.806000	0.96561	0.655000	0.94253	.	STK4	-	-	ENSG00000101109		0.393	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK4	HGNC	protein_coding	OTTHUMT00000080401.4	-	0.00	110	0	G	NM_006282	Intron	43623730	+1	tier1	-	no_errors	ENST00000372806	ensembl	human	known	74_37	splice_site	5.19	73	4	SNP	1.000	A
TCHH	7062	genome.wustl.edu	37	1	152084720	152084720	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:152084720G>C	ENST00000368804.1	-	2	972	c.973C>G	c.(973-975)Cag>Gag	p.Q325E		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	325	5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cgcctctcctgctgctcgcgc	0.687																																																	0													20.0	23.0	22.0					1																	152084720		2079	4194	6273	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.973C>G	1.37:g.152084720G>C	ENSP00000357794:p.Gln325Glu		Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.Q325E	ENST00000368804.1	37	c.973	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	g	9.541	1.113458	0.20795	.	.	ENSG00000159450	ENST00000368804	T	0.05199	3.48	4.0	-5.01	0.02991	.	.	.	.	.	T	0.00815	0.0027	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48269	-0.9050	9	0.02654	T	1	.	17.5805	0.87966	0.0:0.1345:0.7857:0.0798	.	325	Q07283	TRHY_HUMAN	E	325	ENSP00000357794:Q325E	ENSP00000357794:Q325E	Q	-	1	0	TCHH	150351344	0.007000	0.16637	0.000000	0.03702	0.041000	0.13682	0.223000	0.17719	-0.765000	0.04645	-1.609000	0.00803	CAG	TCHH	-	NULL	ENSG00000159450		0.687	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	-	0.00	43	0	G	NM_007113		152084720	-1	tier1	-	no_errors	ENST00000368804	ensembl	human	known	74_37	missense	8.24	78	7	SNP	0.000	C
TENM2	57451	genome.wustl.edu	37	5	167420090	167420090	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr5:167420090G>T	ENST00000518659.1	+	5	1128	c.1089G>T	c.(1087-1089)aaG>aaT	p.K363N	TENM2_ENST00000545108.1_Missense_Mutation_p.K363N|TENM2_ENST00000403607.2_Missense_Mutation_p.K196N|TENM2_ENST00000519204.1_Missense_Mutation_p.K242N|TENM2_ENST00000520394.1_Missense_Mutation_p.K172N	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	363	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										AGGCTTTCAAGCTGAAGAAGC	0.567																																																	0													54.0	57.0	56.0					5																	167420090		1894	4118	6012	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1089G>T	5.37:g.167420090G>T	ENSP00000429430:p.Lys363Asn		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.K363N	ENST00000518659.1	37	c.1089		5	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252892	0.39797	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.74	4.87	0.63330	Teneurin intracellular, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.42426	0.1202	L	0.37630	1.12	0.41657	D	0.989169	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.91635	0.999;0.99;0.99	T	0.05550	-1.0878	10	0.17832	T	0.49	.	14.1841	0.65592	0.0712:0.0:0.9288:0.0	.	363;172;242	Q9NT68;F8VNQ3;G3V106	TEN2_HUMAN;.;.	N	363;363;242;172;196	ENSP00000429430:K363N;ENSP00000438635:K363N;ENSP00000428964:K242N;ENSP00000427874:K172N;ENSP00000384905:K196N	ENSP00000384905:K196N	K	+	3	2	ODZ2	167352668	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.189000	0.42621	2.712000	0.92718	0.650000	0.86243	AAG	TENM2	-	pfam_Ten_N	ENSG00000145934		0.567	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	-	0.00	59	0	G	NM_001122679		167420090	+1	tier1	-	no_errors	ENST00000518659	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
THSD4	79875	genome.wustl.edu	37	15	72050278	72050278	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:72050278C>T	ENST00000355327.3	+	15	2587	c.2453C>T	c.(2452-2454)tCg>tTg	p.S818L	THSD4_ENST00000261862.6_Missense_Mutation_p.S818L|THSD4_ENST00000357769.4_Missense_Mutation_p.S458L|THSD4_ENST00000567838.1_3'UTR			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	818	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CGGACACGCTCGGTGGTGTGC	0.642																																																	0													44.0	50.0	48.0					15																	72050278		2112	4210	6322	SO:0001583	missense	0			AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2453C>T	15.37:g.72050278C>T	ENSP00000347484:p.Ser818Leu		B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.S818L	ENST00000355327.3	37	c.2453	CCDS10238.2	15	.	.	.	.	.	.	.	.	.	.	C	17.98	3.519942	0.64634	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.60797	0.16;0.16;0.16	5.18	4.27	0.50696	.	.	.	.	.	T	0.51381	0.1671	L	0.51914	1.62	0.41581	D	0.988744	P;D	0.60160	0.95;0.987	B;P	0.46299	0.265;0.511	T	0.49224	-0.8962	9	0.12103	T	0.63	.	11.5429	0.50677	0.0:0.9134:0.0:0.0866	.	458;818	B4DR13;Q6ZMP0	.;THSD4_HUMAN	L	818;818;458	ENSP00000347484:S818L;ENSP00000261862:S818L;ENSP00000350413:S458L	ENSP00000261862:S818L	S	+	2	0	THSD4	69837332	0.984000	0.35163	1.000000	0.80357	0.566000	0.35808	3.902000	0.56310	1.422000	0.47177	-0.140000	0.14226	TCG	THSD4	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000187720		0.642	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THSD4	HGNC	protein_coding	OTTHUMT00000257253.2	-	0.00	24	0	C	NM_024817		72050278	+1	tier1	-	no_errors	ENST00000261862	ensembl	human	known	74_37	missense	37.04	17	10	SNP	0.969	T
TMEM150A	129303	genome.wustl.edu	37	2	85826346	85826346	+	Silent	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:85826346G>T	ENST00000409668.1	-	7	1136	c.669C>A	c.(667-669)ggC>ggA	p.G223G	TMEM150A_ENST00000306353.3_Silent_p.G170G|TMEM150A_ENST00000334462.5_Silent_p.G223G			Q86TG1	T150A_HUMAN	transmembrane protein 150A	223					catabolic process (GO:0009056)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|lung(1)|skin(1)	7						AGCTGAAGGTGCCATAGAAAA	0.562																																																	0													88.0	68.0	75.0					2																	85826346		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098152	CCDS33233.1	2p11.2	2009-06-12	2009-06-12	2009-06-12	ENSG00000168890	ENSG00000168890			24677	protein-coding gene	gene with protein product			"""transmembrane protein 150"""	TMEM150		10858565	Standard	NM_001031738		Approved	TM6P1, FLJ90024	uc002spy.2	Q86TG1	OTTHUMG00000130168	ENST00000409668.1:c.669C>A	2.37:g.85826346G>T			A8K764|B7WPQ9|D6W5L2|Q8N2R6	Silent	SNP	pfam_Frag1/DRAM/Sfk1	p.G223	ENST00000409668.1	37	c.669	CCDS33233.1	2																																																																																			TMEM150A	-	pfam_Frag1/DRAM/Sfk1	ENSG00000168890		0.562	TMEM150A-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM150A	HGNC	protein_coding	OTTHUMT00000329474.1	-	0.00	70	0	G	NM_153342		85826346	-1	tier1	-	no_errors	ENST00000334462	ensembl	human	known	74_37	silent	6.67	56	4	SNP	1.000	T
C20orf141	128653	genome.wustl.edu	37	20	2795992	2795992	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr20:2795992delG	ENST00000380589.4	+	1	336	c.162delG	c.(160-162)ctgfs	p.L54fs	TMEM239_ENST00000380585.1_5'Flank|TMEM239_ENST00000380593.4_Frame_Shift_Del_p.L54fs|TMEM239_ENST00000554164.1_Frame_Shift_Del_p.L54fs|C20orf141_ENST00000603872.1_Frame_Shift_Del_p.L54fs|TMEM239_ENST00000361033.1_5'Flank	NM_080739.2	NP_542777.1	Q9NUB4	CT141_HUMAN	chromosome 20 open reading frame 141	54	Leu-rich.					integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	10						TCCTATGGCTGGGGGCACTAG	0.627																																																	0													107.0	106.0	107.0					20																	2795992		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS13034.1	20p13	2012-10-30			ENSG00000258713	ENSG00000258713			16134	protein-coding gene	gene with protein product							Standard	NM_001256538		Approved	dJ860F19.4	uc002wgw.3	Q9NUB4	OTTHUMG00000031707	ENST00000380589.4:c.162delG	20.37:g.2795992delG	ENSP00000369963:p.Leu54fs			Frame_Shift_Del	DEL	NULL	p.A56fs	ENST00000380589.4	37	c.162	CCDS13034.1	20																																																																																			TMEM239	-	NULL	ENSG00000198326		0.627	C20orf141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM239	HGNC	protein_coding	OTTHUMT00000077644.2		0.00	33	0	G	NM_080739		2795992	+1	tier1		no_errors	ENST00000554164	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	0.954	-
TOMM70A	9868	genome.wustl.edu	37	3	100105093	100105093	+	Silent	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:100105093C>T	ENST00000284320.5	-	3	1042	c.594G>A	c.(592-594)gaG>gaA	p.E198E		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	198					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						TGTCTAGCTTCTCATGGGCTT	0.333																																																	0													177.0	172.0	174.0					3																	100105093		2203	4299	6502	SO:0001819	synonymous_variant	0			AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.594G>A	3.37:g.100105093C>T			D3DN48	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E198	ENST00000284320.5	37	c.594	CCDS33807.1	3																																																																																			TOMM70A	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000154174		0.333	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM70A	HGNC	protein_coding	OTTHUMT00000353141.2	-	0.00	61	0	C			100105093	-1	tier1	-	no_errors	ENST00000284320	ensembl	human	known	74_37	silent	22.88	91	27	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578223	7578223	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:7578223C>T	ENST00000269305.4	-	6	815	c.626G>A	c.(625-627)aGa>aAa	p.R209K	TP53_ENST00000359597.4_Missense_Mutation_p.R209K|TP53_ENST00000445888.2_Missense_Mutation_p.R209K|TP53_ENST00000420246.2_Missense_Mutation_p.R209K|TP53_ENST00000455263.2_Missense_Mutation_p.R209K|TP53_ENST00000413465.2_Missense_Mutation_p.R209K|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	209	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> I (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R209fs*6(38)|p.0?(8)|p.R209K(7)|p.?(5)|p.R209T(3)|p.R209fs*35(2)|p.D207fs*6(2)|p.R209fs*38(2)|p.R116fs*6(2)|p.R77fs*6(2)|p.D208fs*1(1)|p.R77K(1)|p.R209_R213delRNTFR(1)|p.D207_R213delDDRNTFR(1)|p.D207_V216del10(1)|p.R209I(1)|p.R116K(1)|p.R209fs*5(1)|p.R209fs*36(1)|p.E204_N210delEYLDDRN(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAAAGTGTTTCTGTCATCCAA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	82	Deletion - Frameshift(51)|Substitution - Missense(13)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)	biliary_tract(11)|breast(9)|upper_aerodigestive_tract(7)|oesophagus(7)|large_intestine(6)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|prostate(5)|lung(4)|bone(4)|stomach(3)|soft_tissue(3)|ovary(3)|pancreas(3)|salivary_gland(2)|skin(2)|cervix(1)|liver(1)|thyroid(1)											143.0	127.0	132.0					17																	7578223		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.626G>A	17.37:g.7578223C>T	ENSP00000269305:p.Arg209Lys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R209K	ENST00000269305.4	37	c.626	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416032	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99732	-6.57;-6.57;-6.57;-6.57;-6.57;-6.57;-6.57;-6.57	5.41	-10.8	0.00216	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	1.073180	0.07006	N	0.824273	D	0.96706	0.8925	N	0.20986	0.625	0.09310	N	1	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.08055	0.001;0.002;0.0;0.003;0.003;0.003;0.001	D	0.94466	0.7680	10	0.19147	T	0.46	0.8848	1.3926	0.02253	0.2446:0.1044:0.2419:0.409	.	170;209;209;116;209;209;209	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	K	209;209;209;209;209;209;198;116;77;116;77	ENSP00000410739:R209K;ENSP00000352610:R209K;ENSP00000269305:R209K;ENSP00000398846:R209K;ENSP00000391127:R209K;ENSP00000391478:R209K;ENSP00000425104:R77K;ENSP00000423862:R116K	ENSP00000269305:R209K	R	-	2	0	TP53	7518948	0.000000	0.05858	0.000000	0.03702	0.460000	0.32559	-2.156000	0.01283	-1.816000	0.01221	-0.794000	0.03295	AGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	101	0	C	NM_000546		7578223	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	55.32	21	26	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr17:7578265A>T	ENST00000269305.4	-	6	773	c.584T>A	c.(583-585)aTc>aAc	p.I195N	TP53_ENST00000359597.4_Missense_Mutation_p.I195N|TP53_ENST00000445888.2_Missense_Mutation_p.I195N|TP53_ENST00000420246.2_Missense_Mutation_p.I195N|TP53_ENST00000455263.2_Missense_Mutation_p.I195N|TP53_ENST00000413465.2_Missense_Mutation_p.I195N|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)											100.0	89.0	93.0					17																	7578265		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>A	17.37:g.7578265A>T	ENSP00000269305:p.Ile195Asn		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I195N	ENST00000269305.4	37	c.584	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	14.23	2.474490	0.43942	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99828	-6.99;-6.99;-6.99;-6.99;-6.99;-6.99;-6.99;-6.99	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	D	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.54753	D	0.999981	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.994;0.996;0.998;0.998;0.998	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195N;ENSP00000352610:I195N;ENSP00000269305:I195N;ENSP00000398846:I195N;ENSP00000391127:I195N;ENSP00000391478:I195N;ENSP00000425104:I63N;ENSP00000423862:I102N	ENSP00000269305:I195N	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	107	0	A	NM_000546		7578265	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	58.14	18	25	SNP	1.000	T
TRIB2	28951	genome.wustl.edu	37	2	12880890	12880890	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr2:12880890G>T	ENST00000155926.4	+	3	2421	c.1002G>T	c.(1000-1002)atG>atT	p.M334I	TRIB2_ENST00000381465.2_Missense_Mutation_p.M198I	NM_021643.3	NP_067675.1			tribbles pseudokinase 2									p.M334N(2)		breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(5)|prostate(1)|skin(1)|stomach(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACGTCAACATGGAAGAGAACT	0.512																																																	2	Substitution - Missense(2)	lung(2)											78.0	72.0	74.0					2																	12880890		2203	4300	6503	SO:0001583	missense	0			AY245544	CCDS1683.1	2p25.1	2013-10-03	2013-10-03		ENSG00000071575	ENSG00000071575			30809	protein-coding gene	gene with protein product		609462	"""tribbles homolog 2 (Drosophila)"""			12736262, 17097562, 16715410	Standard	NM_021643		Approved	TRB2, GS3955	uc002rbv.4	Q92519	OTTHUMG00000090575	ENST00000155926.4:c.1002G>T	2.37:g.12880890G>T	ENSP00000155926:p.Met334Ile			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.M334I	ENST00000155926.4	37	c.1002	CCDS1683.1	2	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597954	0.46318	.	.	ENSG00000071575	ENST00000155926;ENST00000381465	T;T	0.43688	0.99;0.94	5.94	5.94	0.96194	Protein kinase-like domain (1);	0.034920	0.85682	D	0.000000	T	0.36220	0.0959	L	0.29908	0.895	0.80722	D	1	B	0.14438	0.01	B	0.12837	0.008	T	0.04930	-1.0917	10	0.35671	T	0.21	-38.0385	19.354	0.94404	0.0:0.0:1.0:0.0	.	334	Q92519	TRIB2_HUMAN	I	334;198	ENSP00000155926:M334I;ENSP00000370874:M198I	ENSP00000155926:M334I	M	+	3	0	TRIB2	12798341	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.912000	0.87465	2.820000	0.97059	0.650000	0.86243	ATG	TRIB2	-	superfamily_Kinase-like_dom	ENSG00000071575		0.512	TRIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIB2	HGNC	protein_coding	OTTHUMT00000207114.2		0.00	35	0	G	NM_021643		12880890	+1			no_errors	ENST00000155926	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
TRPM1	4308	genome.wustl.edu	37	15	31325061	31325061	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:31325061G>T	ENST00000256552.6	-	22	2930	c.2783C>A	c.(2782-2784)gCc>gAc	p.A928D	TRPM1_ENST00000542188.1_Missense_Mutation_p.A945D|TRPM1_ENST00000397795.2_Missense_Mutation_p.A906D|RP11-348B17.1_ENST00000558755.1_RNA|RP11-348B17.1_ENST00000561299.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TGTGGAAATGGCCACGAGATC	0.468																																																	0													171.0	163.0	165.0					15																	31325061		1957	4144	6101	SO:0001583	missense	0			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.2783C>A	15.37:g.31325061G>T	ENSP00000256552:p.Ala928Asp			Missense_Mutation	SNP	pfam_Ion_trans_dom	p.A945D	ENST00000256552.6	37	c.2834	CCDS58346.1	15	.	.	.	.	.	.	.	.	.	.	G	29.6	5.022929	0.93462	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	D;D;D	0.98777	-5.13;-5.13;-5.13	5.59	5.59	0.84812	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99287	0.9751	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	D	0.99323	1.0907	10	0.87932	D	0	-27.6228	19.5857	0.95489	0.0:0.0:1.0:0.0	.	900;906	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	D	906;945;928;906	ENSP00000380897:A906D;ENSP00000437849:A945D;ENSP00000256552:A928D	ENSP00000256552:A928D	A	-	2	0	TRPM1	29112353	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.823000	0.86660	2.616000	0.88540	0.643000	0.83706	GCC	TRPM1	-	pfam_Ion_trans_dom	ENSG00000134160		0.468	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	-	0.00	75	0	G	NM_002420		31325061	-1	tier1	-	no_errors	ENST00000542188	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98579513	98579513	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr7:98579513G>A	ENST00000359863.4	+	58	8944	c.8735G>A	c.(8734-8736)aGc>aAc	p.S2912N	TRRAP_ENST00000355540.3_Missense_Mutation_p.S2894N|TRRAP_ENST00000446306.3_Missense_Mutation_p.S2894N	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2912	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GAGATGGCCAGCAGCCTGGCC	0.667																																																	0													16.0	16.0	16.0					7																	98579513		2194	4286	6480	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.8735G>A	7.37:g.98579513G>A	ENSP00000352925:p.Ser2912Asn		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S2912N	ENST00000359863.4	37	c.8735	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.4|29.4	5.004842|5.004842	0.93287|0.93287	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.69435	.|-0.4;-0.4	5.46|5.46	5.46|5.46	0.80206|0.80206	.|PIK-related kinase (1);PIK-related kinase, FAT (1);	.|0.098116	.|0.64402	.|D	.|0.000001	T|T	0.80706|0.80706	0.4674|0.4674	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.75020	.|0.982;0.985;0.985	T|T	0.81491|0.81491	-0.0909|-0.0909	5|10	.|0.62326	.|D	.|0.03	.|.	19.3216|19.3216	0.94243|0.94243	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2894;2633;2912	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	T|N	2634|2912;2894;2893	.|ENSP00000352925:S2912N;ENSP00000347733:S2894N	.|ENSP00000347733:S2894N	A|S	+|+	1|2	0|0	TRRAP|TRRAP	98417449|98417449	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.515000|7.515000	0.81761|0.81761	2.573000|2.573000	0.86826|0.86826	0.655000|0.655000	0.94253|0.94253	GCA|AGC	TRRAP	-	pfam_PIK-rel_kinase_FAT,pfscan_PIK_FAT	ENSG00000196367		0.667	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	26	0	G	NM_003496		98579513	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	A
TTC21A	199223	genome.wustl.edu	37	3	39172257	39172257	+	Silent	SNP	C	C	A	rs375866926		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:39172257C>A	ENST00000431162.2	+	18	2540	c.2406C>A	c.(2404-2406)ggC>ggA	p.G802G	TTC21A_ENST00000440121.1_Silent_p.G754G|TTC21A_ENST00000301819.6_Silent_p.G803G			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	802				G -> D (in Ref. 2; BAG63755). {ECO:0000305}.						NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GCGATCTGGGCAAACTGCTCC	0.433																																																	0													88.0	87.0	87.0					3																	39172257		1940	4151	6091	SO:0001819	synonymous_variant	0			AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.2406C>A	3.37:g.39172257C>A			A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Silent	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G803	ENST00000431162.2	37	c.2409	CCDS46800.1	3																																																																																			TTC21A	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000168026		0.433	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC21A	HGNC	protein_coding	OTTHUMT00000377829.1	-	0.00	56	0	C	NM_145755		39172257	+1	tier1	-	no_errors	ENST00000301819	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.861	A
TTC14	151613	genome.wustl.edu	37	3	180328087	180328087	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:180328087C>G	ENST00000296015.4	+	12	2202	c.2070C>G	c.(2068-2070)caC>caG	p.H690Q	TTC14_ENST00000412756.2_3'UTR|TTC14_ENST00000382584.4_Intron	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	690							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AATACGCTCACTCTGGATCAC	0.398																																																	0													74.0	77.0	76.0					3																	180328087		2203	4299	6502	SO:0001583	missense	0			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.2070C>G	3.37:g.180328087C>G	ENSP00000296015:p.His690Gln		G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	pfam_TPR_1,superfamily_NA-bd_OB-fold,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.H690Q	ENST00000296015.4	37	c.2070	CCDS3237.1	3	.	.	.	.	.	.	.	.	.	.	C	2.248	-0.372249	0.05034	.	.	ENSG00000163728	ENST00000296015	T	0.16457	2.34	6.04	-5.66	0.02451	.	0.770284	0.12549	N	0.459229	T	0.10337	0.0253	N	0.14661	0.345	0.09310	N	1	P	0.42078	0.77	B	0.40134	0.32	T	0.02581	-1.1138	10	0.27785	T	0.31	-2.4867	18.7937	0.91985	0.0:0.7801:0.0:0.2199	.	690	Q96N46	TTC14_HUMAN	Q	690	ENSP00000296015:H690Q	ENSP00000296015:H690Q	H	+	3	2	TTC14	181810781	0.000000	0.05858	0.000000	0.03702	0.112000	0.19704	-2.050000	0.01404	-1.084000	0.03092	-0.251000	0.11542	CAC	TTC14	-	NULL	ENSG00000163728		0.398	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC14	HGNC	protein_coding	OTTHUMT00000349786.1	-	0.00	47	0	C	NM_133462		180328087	+1	tier1	-	no_errors	ENST00000296015	ensembl	human	known	74_37	missense	20.00	60	15	SNP	0.000	G
UBR1	197131	genome.wustl.edu	37	15	43367261	43367261	+	Silent	SNP	G	G	A			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr15:43367261G>A	ENST00000290650.4	-	4	522	c.444C>T	c.(442-444)ttC>ttT	p.F148F	UBR1_ENST00000382177.2_Silent_p.F148F	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	148					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CACAGTCACAGAACCCTCCTC	0.373																																																	0													163.0	173.0	170.0					15																	43367261		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.444C>T	15.37:g.43367261G>A			O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Silent	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.F148	ENST00000290650.4	37	c.444	CCDS10091.1	15																																																																																			UBR1	-	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	ENSG00000159459		0.373	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	-	0.00	29	0	G	NM_174916		43367261	-1	tier1	-	no_errors	ENST00000290650	ensembl	human	known	74_37	silent	39.66	35	23	SNP	0.999	A
USP46	64854	genome.wustl.edu	37	4	53494205	53494205	+	Silent	SNP	C	C	T	rs531415307		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:53494205C>T	ENST00000441222.3	-	3	427	c.243G>A	c.(241-243)gcG>gcA	p.A81A	USP46_ENST00000451218.2_Silent_p.A54A|USP46_ENST00000508499.1_Silent_p.A74A	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	81	USP.		A -> V (in dbSNP:rs17475800).		adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			GGAAAAGGTCCGCCAGGCACG	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		21572	0.0		0.001	False		,,,				2504	0.0																0													102.0	98.0	99.0					4																	53494205		2008	4165	6173	SO:0001819	synonymous_variant	0			AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.243G>A	4.37:g.53494205C>T			B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.A81	ENST00000441222.3	37	c.243	CCDS47053.1	4																																																																																			USP46	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000109189		0.493	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP46	HGNC	protein_coding	OTTHUMT00000361516.2	-	0.00	71	0	C	NM_022832		53494205	-1	tier1	-	no_errors	ENST00000441222	ensembl	human	known	74_37	silent	27.06	62	23	SNP	0.988	T
USP9Y	8287	genome.wustl.edu	37	Y	14968773	14968773	+	Intron	DEL	A	A	-			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chrY:14968773delA	ENST00000338981.3	+	44	8379				USP9Y_ENST00000426564.2_Intron	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked						BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CAGAAGAGGTAAAAAAAAAAA	0.338																																																	0													15.0	15.0	15.0					Y																	14968773		573	1886	2459	SO:0001627	intron_variant	0			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.7434+3A>-	Y.37:g.14968773delA			O14601	RNA	DEL	-	NULL	ENST00000338981.3	37	NULL	CCDS14781.1	Y																																																																																			USP9Y	-	-	ENSG00000114374		0.338	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP9Y	HGNC	protein_coding	OTTHUMT00000088703.2		0.00	27	0	A	NM_004654		14968773	+1	tier1		no_errors	ENST00000471409	ensembl	human	known	74_37	rna	25.00	9	3	DEL	0.995	-
UTP14A	10813	genome.wustl.edu	37	X	129047355	129047356	+	Intron	INS	-	-	A	rs538026007		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chrX:129047355_129047356insA	ENST00000394422.3	+	6	565				UTP14A_ENST00000371042.3_Frame_Shift_Ins_p.RK6fs|UTP14A_ENST00000425117.2_Intron|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Intron	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)						rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						GGAGACTTTAGAAAAAAAAAAT	0.366																																																	0																																										SO:0001627	intron_variant	0			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.537+1458->A	X.37:g.129047365_129047365dupA			A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Frame_Shift_Ins	INS	pfam_SSU_processome_Utp14	p.K10fs	ENST00000394422.3	37	c.17_18	CCDS14615.1	X																																																																																			UTP14A	-	pfam_SSU_processome_Utp14	ENSG00000156697		0.366	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	HGNC	protein_coding	OTTHUMT00000058221.1		0.00	65	0	-	NM_006649		129047356	+1	tier1		no_errors	ENST00000371042	ensembl	human	known	74_37	frame_shift_ins	14.58	41	7	INS	0.814:0.011	A
VPS4A	27183	genome.wustl.edu	37	16	69349973	69349973	+	Silent	SNP	G	G	A	rs576996707		TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr16:69349973G>A	ENST00000254950.11	+	2	240	c.84G>A	c.(82-84)gcG>gcA	p.A28A	RP11-343C2.11_ENST00000570054.2_Silent_p.A52A	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				ACGAGGAGGCGCTGCGGCTGT	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19930	0.0		0.0	False		,,,				2504	0.0																0													73.0	80.0	78.0					16																	69349973		2114	4239	6353	SO:0001819	synonymous_variant	0			AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.84G>A	16.37:g.69349973G>A				Silent	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.A28	ENST00000254950.11	37	c.84	CCDS45517.1	16																																																																																			VPS4A	-	pfam_MIT,smart_MIT	ENSG00000132612		0.577	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	HGNC	protein_coding	OTTHUMT00000430563.3	-	0.00	47	0	G	NM_013245		69349973	+1	tier1	-	no_errors	ENST00000254950	ensembl	human	known	74_37	silent	10.42	43	5	SNP	0.222	A
WDFY4	57705	genome.wustl.edu	37	10	49996594	49996594	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr10:49996594A>T	ENST00000325239.5	+	20	3855	c.3828A>T	c.(3826-3828)gaA>gaT	p.E1276D	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1276						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TGGACAGTGAAGCCACGCCCT	0.413																																																	0													123.0	112.0	115.0					10																	49996594		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.3828A>T	10.37:g.49996594A>T	ENSP00000320563:p.Glu1276Asp		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1276D	ENST00000325239.5	37	c.3828	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.01|12.01	1.809536|1.809536	0.31961|0.31961	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002	T|.	0.59224|.	0.28|.	5.71|5.71	-0.719|-0.719	0.11201|0.11201	.|.	.|.	.|.	.|.	.|.	T|T	0.33847|0.33847	0.0877|0.0877	L|L	0.39898|0.39898	1.24|1.24	0.09310|0.09310	N|N	0.999997|0.999997	B|.	0.34200|.	0.441|.	B|.	0.32465|.	0.146|.	T|T	0.31613|0.31613	-0.9937|-0.9937	8|5	.|.	.|.	.|.	.|.	7.3203|7.3203	0.26523|0.26523	0.4501:0.0:0.434:0.1159|0.4501:0.0:0.434:0.1159	.|.	1276|.	Q6ZS81|.	WDFY4_HUMAN|.	D|C	1276|367	ENSP00000320563:E1276D|.	.|.	E|S	+|+	3|1	2|0	WDFY4|WDFY4	49666600|49666600	0.869000|0.869000	0.29996|0.29996	0.011000|0.011000	0.14972|0.14972	0.022000|0.022000	0.10575|0.10575	0.412000|0.412000	0.21131|0.21131	-0.376000|-0.376000	0.07943|0.07943	-0.297000|-0.297000	0.09499|0.09499	GAA|AGC	WDFY4	-	NULL	ENSG00000128815		0.413	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	93	0	A	XM_033379		49996594	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	25.00	63	21	SNP	0.002	T
WHSC1	7468	genome.wustl.edu	37	4	1959724	1959724	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr4:1959724G>T	ENST00000382895.3	+	18	3377	c.2946G>T	c.(2944-2946)caG>caT	p.Q982H	WHSC1_ENST00000508803.1_Missense_Mutation_p.Q982H|WHSC1_ENST00000382892.2_Missense_Mutation_p.Q982H|WHSC1_ENST00000382888.3_Missense_Mutation_p.Q330H|WHSC1_ENST00000382891.5_Missense_Mutation_p.Q982H|WHSC1_ENST00000482415.2_3'UTR	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	982					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GAGAAACACAGGAGAGCGAGC	0.527			T	IGH@	MM																																			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0													76.0	76.0	76.0					4																	1959724		2203	4300	6503	SO:0001583	missense	0			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.2946G>T	4.37:g.1959724G>T	ENSP00000372351:p.Gln982His		A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_box_dom,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_PWWP_dom,smart_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_box_dom	p.Q982H	ENST00000382895.3	37	c.2946	CCDS33940.1	4	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408502	0.42715	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51	5.16	2.32	0.28847	.	0.122032	0.36815	N	0.002395	T	0.76912	0.4054	L	0.31294	0.92	0.80722	D	1	B;P	0.40660	0.064;0.726	B;B	0.32583	0.052;0.148	T	0.69026	-0.5254	10	0.40728	T	0.16	.	5.9236	0.19096	0.2333:0.0:0.6342:0.1325	.	330;982	A2A2T2;O96028	.;NSD2_HUMAN	H	982;982;982;982;330	ENSP00000423972:Q982H;ENSP00000372347:Q982H;ENSP00000372348:Q982H;ENSP00000372351:Q982H;ENSP00000372344:Q330H	ENSP00000372344:Q330H	Q	+	3	2	WHSC1	1929522	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	1.514000	0.35834	0.214000	0.20742	0.655000	0.94253	CAG	WHSC1	-	NULL	ENSG00000109685		0.527	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	HGNC	protein_coding	OTTHUMT00000366269.2	-	0.00	47	0	G	NM_133330		1959724	+1	tier1	-	no_errors	ENST00000382891	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.999	T
WTAP	9589	genome.wustl.edu	37	6	160176201	160176201	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr6:160176201G>T	ENST00000358372.4	+	8	2506	c.749G>T	c.(748-750)aGt>aTt	p.S250I	SOD2_ENST00000546087.1_Intron	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	250					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		TCTGCCCCAAGTACCAGCAGG	0.537																																																	0													54.0	47.0	49.0					6																	160176201		2203	4300	6503	SO:0001583	missense	0			AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.749G>T	6.37:g.160176201G>T	ENSP00000351141:p.Ser250Ile		Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Missense_Mutation	SNP	NULL	p.S250I	ENST00000358372.4	37	c.749	CCDS5266.1	6	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523527	0.44866	.	.	ENSG00000146457	ENST00000358372	T	0.43688	0.94	6.17	6.17	0.99709	.	0.302821	0.41194	D	0.000926	T	0.24314	0.0589	N	0.14661	0.345	0.80722	D	1	P;B	0.40875	0.731;0.115	B;B	0.44224	0.444;0.1	T	0.03193	-1.1062	10	0.36615	T	0.2	-5.9215	19.0599	0.93085	0.0:0.0:1.0:0.0	.	250;250	A8K489;Q15007	.;FL2D_HUMAN	I	250	ENSP00000351141:S250I	ENSP00000351141:S250I	S	+	2	0	WTAP	160096191	0.999000	0.42202	0.074000	0.20217	0.936000	0.57629	6.181000	0.71988	2.941000	0.99782	0.655000	0.94253	AGT	WTAP	-	NULL	ENSG00000146457		0.537	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTAP	HGNC	protein_coding	OTTHUMT00000042905.1		0.00	25	0	G	NM_152857		160176201	+1			no_errors	ENST00000358372	ensembl	human	known	74_37	missense	7.14	25	2	SNP	0.516	T
XPR1	9213	genome.wustl.edu	37	1	180601390	180601390	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr1:180601390A>C	ENST00000367590.4	+	1	251	c.53A>C	c.(52-54)cAa>cCa	p.Q18P	XPR1_ENST00000367589.3_Missense_Mutation_p.Q18P	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	18	SPX. {ECO:0000255|PROSITE- ProRule:PRU00714}.				G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						TGGAGGAAGCAATACATCCAG	0.647																																																	0													61.0	51.0	54.0					1																	180601390		2203	4300	6503	SO:0001583	missense	0			AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.53A>C	1.37:g.180601390A>C	ENSP00000356562:p.Gln18Pro		O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Missense_Mutation	SNP	pfam_EXS_C,pfam_SPX_N	p.Q18P	ENST00000367590.4	37	c.53	CCDS1340.1	1	.	.	.	.	.	.	.	.	.	.	A	19.34	3.809045	0.70797	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	T	0.48522	0.81	4.95	4.95	0.65309	SPX, N-terminal (2);	0.000000	0.64402	D	0.000001	T	0.71728	0.3374	M	0.86805	2.84	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.984	T	0.77907	-0.2412	10	0.87932	D	0	-5.7025	13.9007	0.63802	1.0:0.0:0.0:0.0	.	18;18	Q9UBH6-2;Q9UBH6	.;XPR1_HUMAN	P	18	ENSP00000356562:Q18P	ENSP00000356561:Q18P	Q	+	2	0	XPR1	178868013	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	6.774000	0.75012	1.974000	0.57490	0.379000	0.24179	CAA	XPR1	-	pfam_SPX_N	ENSG00000143324		0.647	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPR1	HGNC	protein_coding	OTTHUMT00000084996.2	-	0.00	83	0	A	NM_004736		180601390	+1	tier1	-	no_errors	ENST00000367590	ensembl	human	known	74_37	missense	10.67	67	8	SNP	1.000	C
ZNF140	7699	genome.wustl.edu	37	12	133682650	133682650	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:133682650C>T	ENST00000355557.2	+	5	2070	c.787C>T	c.(787-789)Cat>Tat	p.H263Y	ZNF140_ENST00000440550.2_3'UTR|ZNF140_ENST00000544426.1_Missense_Mutation_p.H160Y	NM_003440.2	NP_003431.2	P52738	ZN140_HUMAN	zinc finger protein 140	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.114)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CCTCACTCGACATCAAAGAAT	0.418																																																	0													43.0	44.0	44.0					12																	133682650		2203	4300	6503	SO:0001583	missense	0			U09368	CCDS9282.1, CCDS73550.1	12q24.33	2013-01-08	2006-06-13		ENSG00000196387	ENSG00000196387		"""Zinc fingers, C2H2-type"", ""-"""	12925	protein-coding gene	gene with protein product		604082	"""zinc finger protein 140 (clone pHZ-39)"""			7557990	Standard	XR_245353		Approved	pHZ-39	uc001ulo.3	P52738	OTTHUMG00000167942	ENST00000355557.2:c.787C>T	12.37:g.133682650C>T	ENSP00000347755:p.His263Tyr		D3DXJ3|Q05CP6|Q8IV75	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H263Y	ENST00000355557.2	37	c.787	CCDS9282.1	12	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208246	0.39003	.	.	ENSG00000196387	ENST00000355557;ENST00000544426;ENST00000433577	D;D	0.86769	-2.17;-2.17	3.28	3.28	0.37604	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38778	N	0.001574	D	0.89798	0.6819	M	0.90082	3.085	0.80722	D	1	D	0.54772	0.968	P	0.44394	0.448	D	0.92649	0.6131	10	0.87932	D	0	.	14.4971	0.67698	0.0:1.0:0.0:0.0	.	263	P52738	ZN140_HUMAN	Y	263;160;82	ENSP00000347755:H263Y;ENSP00000445411:H160Y	ENSP00000347755:H263Y	H	+	1	0	ZNF140	132192723	1.000000	0.71417	0.993000	0.49108	0.203000	0.24098	6.937000	0.75898	2.134000	0.65973	0.557000	0.71058	CAT	ZNF140	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196387		0.418	ZNF140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF140	HGNC	protein_coding	OTTHUMT00000397169.1	-	0.00	33	0	C	NM_003440		133682650	+1	tier1	-	no_errors	ENST00000355557	ensembl	human	known	74_37	missense	24.32	28	9	SNP	1.000	T
ZNF257	113835	genome.wustl.edu	37	19	22271249	22271249	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:22271249G>T	ENST00000594947.1	+	4	841	c.697G>T	c.(697-699)Gag>Tag	p.E233*		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	233					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				CAAATGTGAAGAGTGTGGAAA	0.413																																																	0													38.0	42.0	41.0					19																	22271249		2166	4277	6443	SO:0001587	stop_gained	0			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.697G>T	19.37:g.22271249G>T	ENSP00000470209:p.Glu233*		B3KPS4|E9PG34|Q8NE34	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E233*	ENST00000594947.1	37	c.697	CCDS46030.1	19	.	.	.	.	.	.	.	.	.	.	G	20.4	3.980224	0.74474	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	1.11	-0.713	0.11223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	7.8668	0.29541	0.0:0.2579:0.7421:0.0	.	.	.	.	X	233;205	.	ENSP00000380312:E205X	E	+	1	0	ZNF257	22063089	0.000000	0.05858	0.330000	0.25442	0.880000	0.50808	-0.410000	0.07151	0.518000	0.28383	0.313000	0.20887	GAG	ZNF257	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197134		0.413	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF257	HGNC	protein_coding	OTTHUMT00000464382.1	-	0.00	57	0	G			22271249	+1	tier1	-	no_errors	ENST00000594947	ensembl	human	known	74_37	nonsense	22.22	35	10	SNP	0.066	T
ZNF254	9534	genome.wustl.edu	37	19	24309076	24309076	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:24309076C>G	ENST00000357002.4	+	4	389	c.274C>G	c.(274-276)Caa>Gaa	p.Q92E	ZNF254_ENST00000342944.6_Missense_Mutation_p.Q7E	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	92					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				TCATTTTGCTCAAGACCTTTG	0.308																																																	0													32.0	33.0	33.0					19																	24309076		2168	4279	6447	SO:0001583	missense	0			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.274C>G	19.37:g.24309076C>G	ENSP00000349494:p.Gln92Glu		A4QPC0|Q86XL7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q92E	ENST00000357002.4	37	c.274	CCDS32983.1	19	.	.	.	.	.	.	.	.	.	.	C	4.553	0.102703	0.08731	.	.	ENSG00000213096	ENST00000342944;ENST00000357002;ENST00000392281	T;T	0.08720	3.06;3.39	1.42	-0.124	0.13523	.	.	.	.	.	T	0.07818	0.0196	L	0.48174	1.505	0.09310	N	1	B	0.21147	0.052	B	0.17979	0.02	T	0.32025	-0.9922	9	0.48119	T	0.1	.	6.8441	0.23979	0.0:0.4613:0.5387:0.0	.	92	O75437	ZN254_HUMAN	E	7;92;92	ENSP00000445527:Q7E;ENSP00000349494:Q92E	ENSP00000445527:Q7E	Q	+	1	0	ZNF254	24100916	.	.	0.003000	0.11579	0.631000	0.37964	.	.	0.536000	0.28733	0.313000	0.20887	CAA	ZNF254	-	NULL	ENSG00000213096		0.308	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF254	HGNC	protein_coding	OTTHUMT00000466453.1	-	0.00	49	0	C	NM_004876		24309076	+1	tier1	-	no_errors	ENST00000357002	ensembl	human	known	74_37	missense	36.84	24	14	SNP	0.000	G
ZNF268	10795	genome.wustl.edu	37	12	133779243	133779243	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr12:133779243G>T	ENST00000536435.2	+	6	1301	c.971G>T	c.(970-972)aGa>aTa	p.R324I	ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000228289.5_Missense_Mutation_p.R324I|ZNF268_ENST00000537565.1_Missense_Mutation_p.R163I|ZNF268_ENST00000542986.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	324					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R324I(1)		NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GTACATCAGAGAATTCATACA	0.393																																																	1	Substitution - Missense(1)	large_intestine(1)											27.0	30.0	29.0					12																	133779243		2192	4291	6483	SO:0001583	missense	0			X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.971G>T	12.37:g.133779243G>T	ENSP00000444412:p.Arg324Ile		Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R324I	ENST00000536435.2	37	c.971	CCDS45012.1	12	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404982	0.42613	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.24908	1.83;1.83	4.65	0.51	0.16983	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22085	0.0532	M	0.66939	2.045	0.28908	N	0.892864	P;P	0.51057	0.917;0.941	B;B	0.39119	0.275;0.291	T	0.18493	-1.0335	8	.	.	.	.	5.3413	0.15984	0.2452:0.0:0.6136:0.1412	.	324;163	Q14587;Q14587-2	ZN268_HUMAN;.	I	324;324;163;163	ENSP00000228289:R324I;ENSP00000445713:R163I	.	R	+	2	0	ZNF268	132289316	0.000000	0.05858	0.005000	0.12908	0.040000	0.13550	0.057000	0.14279	0.198000	0.20407	0.650000	0.86243	AGA	ZNF268	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000090612		0.393	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2		0.00	42	0	G	NM_152943		133779243	+1			no_errors	ENST00000228289	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.631	T
ZNF548	147694	genome.wustl.edu	37	19	57910927	57910927	+	Silent	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:57910927C>T	ENST00000366197.5	+	3	1522	c.1272C>T	c.(1270-1272)agC>agT	p.S424S	AC003002.6_ENST00000596400.1_Intron|AC004076.7_ENST00000597410.1_Intron|ZNF548_ENST00000336128.7_Silent_p.S436S|AC003002.6_ENST00000600421.1_Intron	NM_152909.3	NP_690873.2	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S436S(1)		breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATGAGTGCAGCGAATGCGGGA	0.468																																																	1	Substitution - coding silent(1)	large_intestine(1)											58.0	60.0	59.0					19																	57910927		2200	4299	6499	SO:0001819	synonymous_variant	0			AK057494	CCDS46209.1, CCDS54324.1	19q13.43	2013-01-08				ENSG00000188785		"""Zinc fingers, C2H2-type"", ""-"""	26561	protein-coding gene	gene with protein product						12477932	Standard	NM_152909		Approved	FLJ32932	uc002qon.3	Q8NEK5		ENST00000366197.5:c.1272C>T	19.37:g.57910927C>T			Q96M05	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S436	ENST00000366197.5	37	c.1308	CCDS46209.1	19																																																																																			ZNF548	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188785		0.468	ZNF548-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF548	HGNC	protein_coding	OTTHUMT00000465937.1	-	0.00	70	0	C	NM_152909		57910927	+1	tier1	-	no_errors	ENST00000336128	ensembl	human	known	74_37	silent	27.08	35	13	SNP	0.000	T
ZNF274	10782	genome.wustl.edu	37	19	58723016	58723016	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr19:58723016G>T	ENST00000326804.4	+	8	1399	c.940G>T	c.(940-942)Gtg>Ttg	p.V314L	ZNF274_ENST00000424679.2_Missense_Mutation_p.V209L|ZNF274_ENST00000345813.3_Missense_Mutation_p.V282L|ZNF274_ENST00000597818.1_3'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	315	KRAB 2. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		GTACCGCGATGTGATGCTGGA	0.632																																																	0													100.0	116.0	111.0					19																	58723016		2197	4300	6497	SO:0001583	missense	0			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.940G>T	19.37:g.58723016G>T	ENSP00000321209:p.Val314Leu		Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.V314L	ENST00000326804.4	37	c.940		19	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747421	0.49257	.	.	ENSG00000171606	ENST00000326804;ENST00000345813;ENST00000424679	T;T;T	0.03801	3.8;3.8;3.8	5.17	4.14	0.48551	Krueppel-associated box (4);	0.000000	0.32444	N	0.006094	T	0.07234	0.0183	.	.	.	0.28836	N	0.89688	P;P;D	0.53312	0.95;0.95;0.959	B;B;P	0.46389	0.381;0.381;0.515	T	0.08027	-1.0742	9	0.54805	T	0.06	-9.2276	9.4679	0.38824	0.0957:0.0:0.9043:0.0	.	210;283;315	Q96GC6-3;Q96GC6-2;Q96GC6	.;.;ZN274_HUMAN	L	314;282;209	ENSP00000321209:V314L;ENSP00000321187:V282L;ENSP00000409872:V209L	ENSP00000321209:V314L	V	+	1	0	ZNF274	63414828	0.991000	0.36638	0.985000	0.45067	0.774000	0.43823	2.070000	0.41491	1.417000	0.47077	-0.251000	0.11542	GTG	ZNF274	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000171606		0.632	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF274	HGNC	protein_coding		-	0.00	52	0	G	NM_133502		58723016	+1	tier1	-	no_errors	ENST00000326804	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.998	T
ZNF660	285349	genome.wustl.edu	37	3	44636478	44636478	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr3:44636478delC	ENST00000322734.2	+	3	1126	c.793delC	c.(793-795)cagfs	p.Q265fs	RP11-944L7.4_ENST00000457331.1_RNA	NM_173658.2	NP_775929.2	Q6AZW8	ZN660_HUMAN	zinc finger protein 660	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		TGTTGATCATCAGAGAGTTCA	0.388																																																	0													53.0	55.0	54.0					3																	44636478		2203	4300	6503	SO:0001589	frameshift_variant	0			AK094189	CCDS2716.1	3p21.32	2013-01-08			ENSG00000144792	ENSG00000144792		"""Zinc fingers, C2H2-type"""	26720	protein-coding gene	gene with protein product							Standard	NM_173658		Approved	FLJ36870	uc003cnl.1	Q6AZW8	OTTHUMG00000133097	ENST00000322734.2:c.793delC	3.37:g.44636478delC	ENSP00000324605:p.Gln265fs		Q7Z331|Q8N9M8	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q265fs	ENST00000322734.2	37	c.793	CCDS2716.1	3																																																																																			ZNF660	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000144792		0.388	ZNF660-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF660	HGNC	protein_coding	OTTHUMT00000256756.4		0.00	57	0	C	NM_173658		44636478	+1	tier1		no_errors	ENST00000322734	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	0.996	-
ZNF831	128611	genome.wustl.edu	37	20	57770966	57770966	+	Missense_Mutation	SNP	G	G	T	rs148237595	byFrequency	TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chr20:57770966G>T	ENST00000371030.2	+	2	3781	c.3781G>T	c.(3781-3783)Gtg>Ttg	p.V1261L		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1261							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCAGCACCAGGTGTCTGAGCC	0.493																																																	0													182.0	181.0	181.0					20																	57770966		1936	4153	6089	SO:0001583	missense	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3781G>T	20.37:g.57770966G>T	ENSP00000360069:p.Val1261Leu		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V1261L	ENST00000371030.2	37	c.3781	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	G	10.77	1.442949	0.25987	.	.	ENSG00000124203	ENST00000371030	T	0.05786	3.39	4.69	-2.08	0.07254	.	2.088790	0.02161	N	0.058813	T	0.07728	0.0194	L	0.52573	1.65	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42258	-0.9462	10	0.72032	D	0.01	-0.1525	4.6516	0.12598	0.3349:0.2815:0.3836:0.0	.	1261	Q5JPB2	ZN831_HUMAN	L	1261	ENSP00000360069:V1261L	ENSP00000360069:V1261L	V	+	1	0	ZNF831	57204361	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.487000	0.22356	-0.423000	0.07394	-0.121000	0.15023	GTG	ZNF831	-	NULL	ENSG00000124203		0.493	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	-	0.00	67	0	G	NM_178457		57770966	+1	tier1	-	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	5.19	73	4	SNP	0.000	T
ZXDB	158586	genome.wustl.edu	37	X	57620063	57620063	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ER-01A-11D-A36J-09	TCGA-VR-A8ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4287c063-759e-4890-b9ae-7fd4d4024def	df77230e-6025-40d1-9b1a-862fdea0faeb	g.chrX:57620063C>T	ENST00000374888.1	+	1	1795	c.1582C>T	c.(1582-1584)Cgc>Tgc	p.R528C		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	528	Required for interaction with ZXDC. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						GTTCTCTGCTCGCAGTAGCCT	0.522																																																	0													26.0	24.0	25.0					X																	57620063		2202	4295	6497	SO:0001583	missense	0			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.1582C>T	X.37:g.57620063C>T	ENSP00000364023:p.Arg528Cys		A8K151|Q9UBB3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R528C	ENST00000374888.1	37	c.1582	CCDS35313.1	X	.	.	.	.	.	.	.	.	.	.	.	15.45	2.836844	0.50951	.	.	ENSG00000198455	ENST00000374888	T	0.36157	1.27	3.5	2.59	0.31030	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.49355	0.1552	L	0.49699	1.58	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.46345	-0.9198	10	0.87932	D	0	.	9.1837	0.37156	0.2184:0.7815:0.0:0.0	.	528	P98169	ZXDB_HUMAN	C	528	ENSP00000364023:R528C	ENSP00000364023:R528C	R	+	1	0	ZXDB	57636788	0.998000	0.40836	0.997000	0.53966	0.994000	0.84299	2.580000	0.46068	0.619000	0.30197	0.483000	0.47432	CGC	ZXDB	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198455		0.522	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZXDB	HGNC	protein_coding	OTTHUMT00000056922.1	-	0.00	23	0	C	NM_007157		57620063	+1	tier1	-	no_errors	ENST00000374888	ensembl	human	known	74_37	missense	62.96	10	17	SNP	1.000	T
