#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA6	23460	genome.wustl.edu	37	17	67092434	67092434	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:67092434T>C	ENST00000284425.2	-	25	3529	c.3355A>G	c.(3355-3357)Att>Gtt	p.I1119V	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1119					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TTGCGAAAAATAAATGATATC	0.264																																																	0													24.0	28.0	26.0					17																	67092434		2179	4243	6422	SO:0001583	missense	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.3355A>G	17.37:g.67092434T>C	ENSP00000284425:p.Ile1119Val		Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I1119V	ENST00000284425.2	37	c.3355	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	T	9.744	1.165613	0.21538	.	.	ENSG00000154262	ENST00000284425	D	0.87103	-2.21	4.61	1.21	0.21127	.	0.386696	0.21813	N	0.068729	T	0.81264	0.4786	L	0.55103	1.725	0.80722	D	1	B	0.14438	0.01	B	0.26864	0.074	T	0.68010	-0.5522	10	0.27785	T	0.31	.	6.1261	0.20180	0.0:0.319:0.0:0.681	.	1119	Q8N139	ABCA6_HUMAN	V	1119	ENSP00000284425:I1119V	ENSP00000284425:I1119V	I	-	1	0	ABCA6	64604029	0.856000	0.29760	0.917000	0.36280	0.740000	0.42216	0.026000	0.13599	0.082000	0.17018	0.528000	0.53228	ATT	ABCA6	-	NULL	ENSG00000154262		0.264	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	-	0.00	182	0	T	NM_080284		67092434	-1	tier1	-	no_errors	ENST00000284425	ensembl	human	known	74_37	missense	41.84	82	59	SNP	0.972	C
ABL1	25	genome.wustl.edu	37	9	133750256	133750256	+	Splice_Site	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:133750256G>C	ENST00000318560.5	+	7	1468	c.1087G>C	c.(1087-1089)Gat>Cat	p.D363H		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	363	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)	p.?(1)		breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CTTTCTTAGAGATCTTGCTGC	0.512			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																			Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											132.0	121.0	125.0					9																	133750256		2203	4300	6503	SO:0001630	splice_region_variant	0			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1086-1G>C	9.37:g.133750256G>C			A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	pfam_F-actin_binding,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.D382H	ENST00000318560.5	37	c.1144	CCDS35166.1	9	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724439	0.89298	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	T;T	0.80824	-1.42;-1.42	5.23	5.23	0.72850	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93871	0.8039	H	0.98178	4.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96124	0.9087	10	0.87932	D	0	.	17.802	0.88590	0.0:0.0:1.0:0.0	.	363;400	P00519;Q59FK4	ABL1_HUMAN;.	H	178;382;363	ENSP00000361423:D382H;ENSP00000323315:D363H	ENSP00000323315:D363H	D	+	1	0	ABL1	132740077	1.000000	0.71417	0.971000	0.41717	0.925000	0.55904	9.858000	0.99539	2.450000	0.82876	0.655000	0.94253	GAT	ABL1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000097007		0.512	ABL1-001	KNOWN	basic|CCDS	protein_coding	ABL1	HGNC	protein_coding	OTTHUMT00000054684.1	-	0.00	83	0	G	NM_007313	Missense_Mutation	133750256	+1	tier1	-	no_errors	ENST00000372348	ensembl	human	known	74_37	missense	15.38	55	10	SNP	1.000	C
ACAT1	38	genome.wustl.edu	37	11	108005929	108005930	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:108005929_108005930insCT	ENST00000265838.4	+	5	486_487	c.395_396insCT	c.(394-399)gccatcfs	p.I133fs	ACAT1_ENST00000299355.6_Frame_Shift_Ins_p.I133fs	NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	133					adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	GGAATGAAAGCCATCATGATGG	0.381																																																	0			GRCh37	CM041980	ACAT1	M																																				SO:0001589	frameshift_variant	0			D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	Exception_encountered	11.37:g.108005929_108005930insCT	ENSP00000265838:p.Ile133fs		B2R6H1|G3XAB4|Q96FG8	Frame_Shift_Ins	INS	pfam_Thiolase_N,pfam_Thiolase_C,pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.I133fs	ENST00000265838.4	37	c.395_396	CCDS8339.1	11																																																																																			ACAT1	-	pfam_Thiolase_N,pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000075239		0.381	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT1	HGNC	protein_coding	OTTHUMT00000389474.1		0.00	66	0	-	NM_000019		108005930	+1	tier1		no_errors	ENST00000265838	ensembl	human	known	74_37	frame_shift_ins	23.26	33	10	INS	1.000:1.000	CT
ACTN2	88	genome.wustl.edu	37	1	236908039	236908039	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:236908039C>T	ENST00000366578.4	+	12	1535	c.1369C>T	c.(1369-1371)Cgc>Tgc	p.R457C	ACTN2_ENST00000542672.1_Missense_Mutation_p.R457C|ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000546208.1_5'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	457					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.R457C(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GCACCAGGACCGCGTGGAGCA	0.642																																																	1	Substitution - Missense(1)	large_intestine(1)											61.0	53.0	56.0					1																	236908039		2203	4300	6503	SO:0001583	missense	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1369C>T	1.37:g.236908039C>T	ENSP00000355537:p.Arg457Cys		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R457C	ENST00000366578.4	37	c.1369	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124656	0.77436	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.55588	0.51;0.51	5.17	4.23	0.50019	.	0.045259	0.85682	N	0.000000	T	0.80259	0.4590	H	0.95850	3.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.86099	0.1555	10	0.87932	D	0	.	13.2905	0.60269	0.346:0.654:0.0:0.0	.	242;457;227;457	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	C	457;457;226	ENSP00000443495:R457C;ENSP00000355537:R457C	ENSP00000355537:R457C	R	+	1	0	ACTN2	234974662	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.463000	0.35277	1.247000	0.43917	0.563000	0.77884	CGC	ACTN2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000077522		0.642	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1		0.00	23	0	C	NM_001103		236908039	+1			no_errors	ENST00000366578	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
ACTR5	79913	genome.wustl.edu	37	20	37380838	37380838	+	Missense_Mutation	SNP	C	C	T	rs373165367		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:37380838C>T	ENST00000243903.4	+	3	707	c.670C>T	c.(670-672)Cgt>Tgt	p.R224C		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	224					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				TTACCTCCAGCGTCTCCTCCA	0.502																																																	0								C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	72.0	64.0	67.0		670	5.6	1.0	20		67	0,8600		0,0,4300	no	missense	ACTR5	NM_024855.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	224/608	37380838	1,13005	2203	4300	6503	SO:0001583	missense	0			AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.670C>T	20.37:g.37380838C>T	ENSP00000243903:p.Arg224Cys		Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related	p.R224C	ENST00000243903.4	37	c.670	CCDS13308.1	20	.	.	.	.	.	.	.	.	.	.	C	25.5	4.639729	0.87760	2.27E-4	0.0	ENSG00000101442	ENST00000243903	D	0.94758	-3.51	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.97439	0.9162	M	0.81614	2.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97601	1.0123	10	0.87932	D	0	-15.4561	20.0118	0.97458	0.0:1.0:0.0:0.0	.	224	Q9H9F9	ARP5_HUMAN	C	224	ENSP00000243903:R224C	ENSP00000243903:R224C	R	+	1	0	ACTR5	36814252	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.201000	0.65163	2.812000	0.96745	0.561000	0.74099	CGT	ACTR5	-	pfam_Actin-related,smart_Actin-related	ENSG00000101442		0.502	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR5	HGNC	protein_coding	OTTHUMT00000079205.2		0.00	46	0	C	NM_024855		37380838	+1			no_errors	ENST00000243903	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
ADAM20	8748	genome.wustl.edu	37	14	70989758	70989759	+	Frame_Shift_Ins	INS	-	-	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:70989758_70989759insA	ENST00000256389.3	-	2	2110_2111	c.1866_1867insT	c.(1864-1869)attcccfs	p.P623fs	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	573	Cys-rich.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		ATCAGATTGGGAATTACTCCCA	0.446																																																	0																																										SO:0001589	frameshift_variant	0			AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.1867dupT	14.37:g.70989760_70989760dupA	ENSP00000256389:p.Pro623fs		Q6GTZ1|Q9UKJ9	Frame_Shift_Ins	INS	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.P622fs	ENST00000256389.3	37	c.1867_1866	CCDS32111.1	14																																																																																			ADAM20	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich	ENSG00000134007		0.446	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM20	HGNC	protein_coding	OTTHUMT00000395004.2		0.00	22	0	-			70989759	-1	tier1		no_errors	ENST00000256389	ensembl	human	known	74_37	frame_shift_ins	38.24	21	13	INS	0.182:0.156	A
ADAM23	8745	genome.wustl.edu	37	2	207452097	207452097	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:207452097C>T	ENST00000264377.3	+	19	2114	c.1786C>T	c.(1786-1788)Cag>Tag	p.Q596*	ADAM23_ENST00000374415.3_Nonsense_Mutation_p.Q596*|ADAM23_ENST00000374416.1_Nonsense_Mutation_p.Q596*	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	596	Cys-rich.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CAATCAAAATCAGGTATGCTG	0.299																																					Melanoma(194;1127 2130 19620 24042 27855)												0													66.0	69.0	68.0					2																	207452097		2203	4297	6500	SO:0001587	stop_gained	0			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1786C>T	2.37:g.207452097C>T	ENSP00000264377:p.Gln596*		A2RU59	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.Q596*	ENST00000264377.3	37	c.1786	CCDS2369.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.550554	0.97658	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	.	.	.	5.36	5.36	0.76844	.	0.000000	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	19.4485	0.94857	0.0:1.0:0.0:0.0	.	.	.	.	X	596;596;490;596	.	ENSP00000264377:Q596X	Q	+	1	0	ADAM23	207160342	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.746000	0.74866	2.672000	0.90937	0.591000	0.81541	CAG	ADAM23	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich	ENSG00000114948		0.299	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM23	HGNC	protein_coding	OTTHUMT00000256431.2	-	0.00	221	0	C	NM_003812		207452097	+1	tier1	-	no_errors	ENST00000264377	ensembl	human	known	74_37	nonsense	6.75	152	11	SNP	1.000	T
ADPRHL1	113622	genome.wustl.edu	37	13	114079399	114079399	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr13:114079399G>T	ENST00000375418.3	-	5	828	c.742C>A	c.(742-744)Ccc>Acc	p.P248T	ADPRHL1_ENST00000356501.4_Missense_Mutation_p.P166T	NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	248					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			TAATTGTCGGGGAAGATGGCT	0.428																																																	0													245.0	226.0	232.0					13																	114079399		2203	4299	6502	SO:0001583	missense	0			AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.742C>A	13.37:g.114079399G>T	ENSP00000364567:p.Pro248Thr		Q5JUG2|Q96GD1	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	p.P248T	ENST00000375418.3	37	c.742	CCDS9535.1	13	.	.	.	.	.	.	.	.	.	.	g	15.78	2.933468	0.52866	.	.	ENSG00000153531	ENST00000356501;ENST00000375418;ENST00000413169	T	0.58652	0.32	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.80969	0.4726	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82802	-0.0277	10	0.41790	T	0.15	-15.1932	18.8087	0.92048	0.0:0.0:1.0:0.0	.	248	Q8NDY3	ARHL1_HUMAN	T	166;248;166	ENSP00000364567:P248T	ENSP00000348894:P166T	P	-	1	0	ADPRHL1	113127400	1.000000	0.71417	0.769000	0.31535	0.022000	0.10575	8.734000	0.91543	2.449000	0.82847	0.550000	0.68814	CCC	ADPRHL1	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	ENSG00000153531		0.428	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRHL1	HGNC	protein_coding	OTTHUMT00000045915.2	-	0.00	64	0	G	NM_138430		114079399	-1	tier1	-	no_errors	ENST00000375418	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105416927	105416927	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:105416927G>T	ENST00000333244.5	-	7	4980	c.4861C>A	c.(4861-4863)Ctg>Atg	p.L1621M	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1621						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ATGCTGGACAGAGACATCTTC	0.617																																																	0													93.0	112.0	106.0					14																	105416927		1833	4034	5867	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4861C>A	14.37:g.105416927G>T	ENSP00000353114:p.Leu1621Met		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L1621M	ENST00000333244.5	37	c.4861	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	12.72	2.021710	0.35701	.	.	ENSG00000185567	ENST00000333244	T	0.03004	4.08	3.97	1.91	0.25777	.	.	.	.	.	T	0.14442	0.0349	M	0.83953	2.67	0.09310	N	1	D	0.71674	0.998	D	0.70935	0.971	T	0.08827	-1.0703	9	0.32370	T	0.25	.	6.5378	0.22363	0.0963:0.0:0.7284:0.1753	.	1621	Q8IVF2	AHNK2_HUMAN	M	1621	ENSP00000353114:L1621M	ENSP00000353114:L1621M	L	-	1	2	AHNAK2	104487972	0.027000	0.19231	0.098000	0.21074	0.149000	0.21700	0.478000	0.22212	0.625000	0.30304	0.485000	0.47835	CTG	AHNAK2	-	NULL	ENSG00000185567		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	76	0	G	NM_138420		105416927	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	7.04	66	5	SNP	0.129	T
AMDHD1	144193	genome.wustl.edu	37	12	96350673	96350673	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:96350673G>C	ENST00000266736.2	+	4	626	c.520G>C	c.(520-522)Gag>Cag	p.E174Q		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	174					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCGCGTGATTGAGCGCGCCCG	0.617																																																	0													98.0	101.0	100.0					12																	96350673		2203	4300	6503	SO:0001583	missense	0			AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.520G>C	12.37:g.96350673G>C	ENSP00000266736:p.Glu174Gln		A8K463|Q68CI8	Missense_Mutation	SNP	pfam_Amidohydro_1,pfam_Amidohydro_3,superfamily_Metal-dep_hydrolase_composite,tigrfam_HutI	p.E174Q	ENST00000266736.2	37	c.520	CCDS9057.1	12	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584591	0.46110	.	.	ENSG00000139344	ENST00000266736	T	0.40476	1.03	5.57	3.71	0.42584	Metal-dependent hydrolase, composite domain (1);	0.328646	0.37955	N	0.001879	T	0.32406	0.0828	L	0.31294	0.92	0.42157	D	0.99158	B	0.15473	0.013	B	0.20384	0.029	T	0.07927	-1.0747	10	0.46703	T	0.11	0.2129	12.7059	0.57060	0.0:0.1262:0.7422:0.1315	.	174	Q96NU7	HUTI_HUMAN	Q	174	ENSP00000266736:E174Q	ENSP00000266736:E174Q	E	+	1	0	AMDHD1	94874804	1.000000	0.71417	0.788000	0.31933	0.818000	0.46254	6.369000	0.73109	0.695000	0.31675	0.491000	0.48974	GAG	AMDHD1	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_HutI	ENSG00000139344		0.617	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMDHD1	HGNC	protein_coding	OTTHUMT00000408640.1	-	0.00	53	0	G	NM_152435		96350673	+1	tier1	-	no_errors	ENST00000266736	ensembl	human	known	74_37	missense	13.11	53	8	SNP	0.990	C
ANAPC5	51433	genome.wustl.edu	37	12	121775156	121775156	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:121775156G>T	ENST00000261819.3	-	6	818	c.697C>A	c.(697-699)Cca>Aca	p.P233T	ANAPC5_ENST00000541887.1_Missense_Mutation_p.P233T|ANAPC5_ENST00000536366.1_Missense_Mutation_p.P112T|ANAPC5_ENST00000544314.1_5'Flank|ANAPC5_ENST00000344395.4_Missense_Mutation_p.P134T|ANAPC5_ENST00000441917.2_Missense_Mutation_p.P134T	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	233					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)	p.P233T(1)		breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AAGGAAGCTGGAGTGAGGGCC	0.358																																																	1	Substitution - Missense(1)	lung(1)											90.0	91.0	91.0					12																	121775156		2203	4300	6503	SO:0001583	missense	0			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.697C>A	12.37:g.121775156G>T	ENSP00000261819:p.Pro233Thr		E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	SNP	smart_TPR_repeat	p.P233T	ENST00000261819.3	37	c.697	CCDS9220.1	12	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779265	0.90195	.	.	ENSG00000089053	ENST00000441917;ENST00000541887;ENST00000261819;ENST00000344395;ENST00000536366;ENST00000544442	T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.80042	0.4551	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.80754	-0.1241	10	0.87932	D	0	.	20.0627	0.97684	0.0:0.0:1.0:0.0	.	134;233	E9PFB2;Q9UJX4	.;APC5_HUMAN	T	134;233;233;134;112;134	ENSP00000415061:P134T;ENSP00000439875:P233T;ENSP00000261819:P233T;ENSP00000343787:P134T;ENSP00000445310:P112T;ENSP00000440800:P134T	ENSP00000261819:P233T	P	-	1	0	ANAPC5	120259539	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.078000	0.94023	2.816000	0.96949	0.563000	0.77884	CCA	ANAPC5	-	NULL	ENSG00000089053		0.358	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC5	HGNC	protein_coding	OTTHUMT00000402582.1		0.00	44	0	G			121775156	-1			no_errors	ENST00000261819	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
ANK2	287	genome.wustl.edu	37	4	114161714	114161714	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:114161714G>C	ENST00000357077.4	+	8	820	c.767G>C	c.(766-768)gGa>gCa	p.G256A	ANK2_ENST00000394537.3_Missense_Mutation_p.G256A|ANK2_ENST00000506722.1_Missense_Mutation_p.G235A|ANK2_ENST00000264366.6_Missense_Mutation_p.G256A	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	256					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTAAACCGGGGAGCTGCTGTG	0.398																																																	0													123.0	116.0	118.0					4																	114161714		2203	4300	6503	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.767G>C	4.37:g.114161714G>C	ENSP00000349588:p.Gly256Ala		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.G256A	ENST00000357077.4	37	c.767	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140347	0.77775	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.76448	-1.02;-0.18;-0.18;-0.18;-0.18;1.57;1.57	5.5	5.5	0.81552	Ankyrin repeat-containing domain (3);	0.000000	0.49305	D	0.000143	D	0.90758	0.7099	M	0.91354	3.2	0.80722	D	1	D;P;D;P;D	0.89917	1.0;0.568;0.989;0.94;0.999	D;B;P;P;D	0.91635	0.999;0.118;0.872;0.794;0.995	D	0.90703	0.4622	10	0.42905	T	0.14	.	19.3646	0.94456	0.0:0.0:1.0:0.0	.	256;256;256;235;235	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	A	235;235;235;271;256;256;256;235	ENSP00000423799:G235A;ENSP00000421011:G235A;ENSP00000421067:G235A;ENSP00000424722:G271A;ENSP00000378044:G256A;ENSP00000349588:G256A;ENSP00000264366:G256A	ENSP00000264366:G256A	G	+	2	0	ANK2	114381163	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	9.813000	0.99286	2.740000	0.93945	0.650000	0.86243	GGA	ANK2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145362		0.398	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2		0.00	59	0	G	NM_001148		114161714	+1			no_errors	ENST00000357077	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	C
ANK2	287	genome.wustl.edu	37	4	114278214	114278214	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:114278214C>A	ENST00000357077.4	+	38	8493	c.8440C>A	c.(8440-8442)Ctc>Atc	p.L2814I	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.L2781I	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2814					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATCATTAGCTCTCCAAGGCAC	0.463																																																	0													93.0	91.0	91.0					4																	114278214		2203	4300	6503	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8440C>A	4.37:g.114278214C>A	ENSP00000349588:p.Leu2814Ile		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.L2814I	ENST00000357077.4	37	c.8440	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	C	7.615	0.675613	0.14841	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.67171	-0.24;-0.25	5.76	1.99	0.26369	.	0.864573	0.09859	N	0.746434	T	0.51753	0.1693	L	0.51422	1.61	0.09310	N	0.999999	B;P	0.34757	0.337;0.467	B;B	0.25884	0.046;0.064	T	0.38373	-0.9664	9	.	.	.	.	3.8437	0.08925	0.1352:0.5948:0.1303:0.1396	.	2781;2814	Q01484;Q01484-4	ANK2_HUMAN;.	I	2814;2781	ENSP00000349588:L2814I;ENSP00000264366:L2781I	.	L	+	1	0	ANK2	114497663	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.393000	0.07305	0.354000	0.24105	0.655000	0.94253	CTC	ANK2	-	NULL	ENSG00000145362		0.463	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2		0.00	36	0	C	NM_001148		114278214	+1			no_errors	ENST00000357077	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.001	A
ANO3	63982	genome.wustl.edu	37	11	26655812	26655812	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:26655812G>T	ENST00000256737.3	+	19	2787	c.1935G>T	c.(1933-1935)caG>caT	p.Q645H	ANO3_ENST00000537978.1_Missense_Mutation_p.Q629H|ANO3_ENST00000531568.1_Missense_Mutation_p.Q499H|ANO3_ENST00000525139.1_Missense_Mutation_p.Q629H	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	645					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TCCTCTTCCAGTTTGTCAATT	0.398																																																	0													121.0	106.0	111.0					11																	26655812		2203	4299	6502	SO:0001583	missense	0			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.1935G>T	11.37:g.26655812G>T	ENSP00000256737:p.Gln645His		B7Z3F5	Missense_Mutation	SNP	pfam_Anoctamin	p.Q645H	ENST00000256737.3	37	c.1935	CCDS31447.1	11	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813454	0.70912	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000538001;ENST00000531568	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.92	3.09	0.35607	.	0.000000	0.85682	D	0.000000	T	0.81351	0.4804	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80801	-0.1220	10	0.87932	D	0	.	8.8149	0.34989	0.3394:0.0:0.6606:0.0	.	547;645	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	H	629;629;645;547;499	ENSP00000440737:Q629H;ENSP00000432576:Q629H;ENSP00000256737:Q645H;ENSP00000432394:Q499H	ENSP00000256737:Q645H	Q	+	3	2	ANO3	26612388	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.681000	0.37618	0.432000	0.26286	0.650000	0.86243	CAG	ANO3	-	pfam_Anoctamin	ENSG00000134343		0.398	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO3	HGNC	protein_coding	OTTHUMT00000387806.1	-	0.00	35	0	G	NM_031418		26655812	+1	tier1	-	no_errors	ENST00000256737	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
AOAH	313	genome.wustl.edu	37	7	36561702	36561702	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:36561702C>A	ENST00000258749.5	-	20	1941	c.1542G>T	c.(1540-1542)aaG>aaT	p.K514N	AOAH_ENST00000538464.1_Missense_Mutation_p.K236N|AOAH_ENST00000535891.1_Missense_Mutation_p.K482N|AOAH_ENST00000431169.1_Missense_Mutation_p.K514N	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	514					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						GTCCGCCTCTCTTCTGCCACT	0.547																																																	0													88.0	72.0	78.0					7																	36561702		2203	4300	6503	SO:0001583	missense	0			BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.1542G>T	7.37:g.36561702C>A	ENSP00000258749:p.Lys514Asn		A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	pfam_Lipase_GDSL,pfam_SapB_2,superfamily_Saposin-like,smart_SaposinB,pfscan_SaposinB	p.K514N	ENST00000258749.5	37	c.1542	CCDS5448.1	7	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671725	0.29693	.	.	ENSG00000136250	ENST00000538464;ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	4.92	-1.2	0.09554	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);	0.360354	0.26424	N	0.024452	T	0.16171	0.0389	.	.	.	0.26827	N	0.968662	P;B;P	0.51147	0.942;0.357;0.491	P;B;B	0.50270	0.636;0.076;0.171	T	0.09530	-1.0670	9	0.45353	T	0.12	.	8.5751	0.33595	0.0:0.4298:0.0:0.5702	.	482;514;514	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	N	236;482;514;514;514	ENSP00000439283:K236N;ENSP00000441101:K482N;ENSP00000258749:K514N;ENSP00000405683:K514N	ENSP00000258749:K514N	K	-	3	2	AOAH	36528227	0.000000	0.05858	0.720000	0.30636	0.987000	0.75469	-0.149000	0.10204	-0.471000	0.06891	0.462000	0.41574	AAG	AOAH	-	pfam_Lipase_GDSL	ENSG00000136250		0.547	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AOAH	HGNC	protein_coding	OTTHUMT00000219829.2	-	0.00	64	0	C	NM_001637		36561702	-1	tier1	-	no_errors	ENST00000258749	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.839	A
APOBEC3G	60489	genome.wustl.edu	37	22	39479862	39479862	+	Silent	SNP	C	C	T	rs368345672		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr22:39479862C>T	ENST00000407997.3	+	5	1065	c.708C>T	c.(706-708)aaC>aaT	p.N236N	APOBEC3G_ENST00000452957.2_Silent_p.N236N|APOBEC3G_ENST00000461827.1_3'UTR	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	236	Necessary for homooligomerization.				base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					TCCTGCTGAACCAGCGCAGGG	0.572																																																	0													89.0	74.0	79.0					22																	39479862		2203	4300	6503	SO:0001819	synonymous_variant	0			AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.708C>T	22.37:g.39479862C>T			B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Silent	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.N236	ENST00000407997.3	37	c.708	CCDS13984.1	22																																																																																			APOBEC3G	-	pfam_APOBEC_N	ENSG00000239713		0.572	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3G	HGNC	protein_coding	OTTHUMT00000321219.1		0.00	55	0	C	NM_021822		39479862	+1			no_errors	ENST00000407997	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.000	T
ARHGAP24	83478	genome.wustl.edu	37	4	86916532	86916532	+	Silent	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:86916532C>A	ENST00000395184.1	+	9	2191	c.1725C>A	c.(1723-1725)acC>acA	p.T575T	ARHGAP24_ENST00000264343.4_Silent_p.T482T|ARHGAP24_ENST00000395183.2_Silent_p.T480T	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	575					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GCTCTTCTACCACCACCTGCC	0.542																																																	0													92.0	87.0	88.0					4																	86916532		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.1725C>A	4.37:g.86916532C>A			Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.T575	ENST00000395184.1	37	c.1725	CCDS34025.1	4																																																																																			ARHGAP24	-	NULL	ENSG00000138639		0.542	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP24	HGNC	protein_coding	OTTHUMT00000252815.2	-	0.00	80	0	C	NM_031305		86916532	+1	tier1	-	no_errors	ENST00000395184	ensembl	human	known	74_37	silent	6.35	59	4	SNP	1.000	A
ARHGEF26	26084	genome.wustl.edu	37	3	153935706	153935706	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:153935706A>T	ENST00000356448.4	+	10	2178	c.1894A>T	c.(1894-1896)Atg>Ttg	p.M632L	ARHGEF26_ENST00000465093.1_Missense_Mutation_p.M632L|ARHGEF26_ENST00000465817.1_Intron	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	632					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						AAGGACTGAGATGATGTACAC	0.423																																					GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)												0													110.0	105.0	106.0					3																	153935706		1860	4104	5964	SO:0001583	missense	0			BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1894A>T	3.37:g.153935706A>T	ENSP00000348828:p.Met632Leu		B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.M632L	ENST00000356448.4	37	c.1894	CCDS46938.1	3	.	.	.	.	.	.	.	.	.	.	A	18.98	3.738658	0.69304	.	.	ENSG00000114790	ENST00000356448;ENST00000465093	T;T	0.28069	1.63;1.63	5.05	5.05	0.67936	Dbl homology (DH) domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.33702	0.0872	L	0.36672	1.1	0.80722	D	1	P;D	0.53745	0.799;0.962	B;P	0.49012	0.227;0.598	T	0.05971	-1.0853	10	0.45353	T	0.12	-39.1808	15.1025	0.72292	1.0:0.0:0.0:0.0	.	632;632	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	L	632	ENSP00000348828:M632L;ENSP00000423418:M632L	ENSP00000348828:M632L	M	+	1	0	ARHGEF26	155418396	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.584000	0.74057	2.026000	0.59711	0.533000	0.62120	ATG	ARHGEF26	-	superfamily_DH-domain	ENSG00000114790		0.423	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF26	HGNC	protein_coding	OTTHUMT00000353287.3	-	0.00	89	0	A	NM_015595		153935706	+1	tier1	-	no_errors	ENST00000356448	ensembl	human	known	74_37	missense	6.86	94	7	SNP	1.000	T
ARL13A	392509	genome.wustl.edu	37	X	100241808	100241808	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chrX:100241808A>G	ENST00000450049.2	+	5	517	c.404A>G	c.(403-405)aAg>aGg	p.K135R		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	135					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|ovary(1)	2						CAAGACAAGAAGAAAGCCCTC	0.398																																																	0													87.0	74.0	78.0					X																	100241808		1893	4090	5983	SO:0001583	missense	0				CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.404A>G	X.37:g.100241808A>G	ENSP00000398637:p.Lys135Arg		B2RTT6|B4DX50	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR	p.K135R	ENST00000450049.2	37	c.404	CCDS55463.1	X	.	.	.	.	.	.	.	.	.	.	A	10.39	1.336778	0.24253	.	.	ENSG00000174225	ENST00000450049;ENST00000372953	D	0.82081	-1.57	4.38	1.69	0.24217	.	0.292116	0.37261	N	0.002177	T	0.73118	0.3546	L	0.39020	1.185	0.19775	N	0.999956	P;B	0.35383	0.498;0.302	B;B	0.40329	0.326;0.229	T	0.62680	-0.6803	10	0.44086	T	0.13	.	3.8526	0.08962	0.5567:0.2235:0.0:0.2198	.	135;135	B2RTT6;Q5H913	.;AR13A_HUMAN	R	135;9	ENSP00000398637:K135R	ENSP00000362044:K9R	K	+	2	0	ARL13A	100128464	0.134000	0.22483	0.656000	0.29637	0.584000	0.36387	0.039000	0.13884	0.595000	0.29777	0.417000	0.27973	AAG	ARL13A	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR	ENSG00000174225		0.398	ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ARL13A	HGNC	protein_coding	OTTHUMT00000057504.2	-	0.00	21	0	A	XM_373358		100241808	+1	tier1	-	no_errors	ENST00000450457	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.458	G
ATM	472	genome.wustl.edu	37	11	108121696	108121696	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:108121696G>T	ENST00000452508.2	+	11	1693	c.1504G>T	c.(1504-1506)Gct>Tct	p.A502S	ATM_ENST00000278616.4_Missense_Mutation_p.A502S			Q13315	ATM_HUMAN	ATM serine/threonine kinase	502					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GCAAATACAAGCTGAAAACTT	0.383			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													132.0	144.0	140.0					11																	108121696		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1504G>T	11.37:g.108121696G>T	ENSP00000388058:p.Ala502Ser		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.A502S	ENST00000452508.2	37	c.1504	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	10.18	1.280239	0.23392	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.54675	0.56;0.56;0.56	6.04	3.05	0.35203	Armadillo-type fold (1);	0.474699	0.23005	N	0.053034	T	0.36026	0.0952	L	0.38531	1.155	0.21355	N	0.999714	B	0.09022	0.002	B	0.06405	0.002	T	0.20207	-1.0282	10	0.09338	T	0.73	.	8.902	0.35501	0.3384:0.0:0.6616:0.0	.	502	Q13315	ATM_HUMAN	S	502	ENSP00000435747:A502S;ENSP00000278616:A502S;ENSP00000388058:A502S	ENSP00000278616:A502S	A	+	1	0	ATM	107626906	0.290000	0.24343	1.000000	0.80357	0.997000	0.91878	0.682000	0.25335	0.788000	0.33755	0.561000	0.74099	GCT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.383	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	60	0	G	NM_000051		108121696	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.841	T
ATP10B	23120	genome.wustl.edu	37	5	159992805	159992805	+	Silent	SNP	C	C	T	rs267600524		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:159992805C>T	ENST00000327245.5	-	26	4887	c.4041G>A	c.(4039-4041)caG>caA	p.Q1347Q		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1347					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCTCCAACTCTGGATTTCCA	0.502																																																	0													120.0	123.0	122.0					5																	159992805		1836	4094	5930	SO:0001819	synonymous_variant	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.4041G>A	5.37:g.159992805C>T			Q9H725	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.Q1347	ENST00000327245.5	37	c.4041	CCDS43394.1	5																																																																																			ATP10B	-	NULL	ENSG00000118322		0.502	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1		0.00	43	0	C	NM_025153		159992805	-1			no_errors	ENST00000327245	ensembl	human	known	74_37	silent	9.68	28	3	SNP	1.000	T
BANP	54971	genome.wustl.edu	37	16	88052199	88052199	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:88052199C>T	ENST00000393207.1	+	7	1018	c.797C>T	c.(796-798)gCt>gTt	p.A266V	BANP_ENST00000355022.4_Missense_Mutation_p.A235V|BANP_ENST00000393208.2_Missense_Mutation_p.A235V|BANP_ENST00000355163.5_Missense_Mutation_p.A241V|BANP_ENST00000479780.2_Missense_Mutation_p.A235V|BANP_ENST00000286122.7_Missense_Mutation_p.A266V|BANP_ENST00000538234.1_Missense_Mutation_p.A274V	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	266	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.|Interaction with CUX1 and HDAC1. {ECO:0000250}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GAGGTGCAGGCTGTGTCCAAC	0.647																																																	0													41.0	27.0	32.0					16																	88052199		2196	4299	6495	SO:0001583	missense	0			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.797C>T	16.37:g.88052199C>T	ENSP00000376902:p.Ala266Val		A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	pfam_BEN_domain	p.A266V	ENST00000393207.1	37	c.797	CCDS54054.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.570405	0.96540	.	.	ENSG00000172530	ENST00000286122;ENST00000355163;ENST00000289484;ENST00000479780;ENST00000393208;ENST00000540932;ENST00000355022;ENST00000538234;ENST00000393207	T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.11	5.11	0.69529	BEN domain (2);	0.000000	0.85682	D	0.000000	T	0.44350	0.1289	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;0.997;1.0;0.996;0.999	D;D;D;D;D;D	0.87578	0.996;0.998;0.983;0.996;0.971;0.997	T	0.24083	-1.0170	9	.	.	.	.	17.5078	0.87750	0.0:1.0:0.0:0.0	.	274;241;235;266;235;235	B4DE54;B4DNJ9;B2RCF7;Q8N9N5;Q8N9N5-2;Q8N9N5-4	.;.;.;BANP_HUMAN;.;.	V	266;241;231;235;235;235;235;274;266	ENSP00000286122:A266V;ENSP00000347290:A241V;ENSP00000432508:A235V;ENSP00000376903:A235V;ENSP00000347125:A235V;ENSP00000444352:A274V;ENSP00000376902:A266V	.	A	+	2	0	BANP	86609700	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.276000	0.78559	2.357000	0.79964	0.491000	0.48974	GCT	BANP	-	pfam_BEN_domain	ENSG00000172530		0.647	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	HGNC	protein_coding	OTTHUMT00000269166.1	-	0.00	81	0	C	NM_017869		88052199	+1	tier1	-	no_errors	ENST00000286122	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
BBS7	55212	genome.wustl.edu	37	4	122789143	122789143	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:122789143G>A	ENST00000264499.4	-	2	278	c.95C>T	c.(94-96)aCa>aTa	p.T32I	BBS7_ENST00000506636.1_Missense_Mutation_p.T32I|RP11-63B13.1_ENST00000567769.1_lincRNA	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	32					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TACCTTTTGTGTAGCTCTGTG	0.373									Bardet-Biedl syndrome																																								0													156.0	147.0	150.0					4																	122789143		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.95C>T	4.37:g.122789143G>A	ENSP00000264499:p.Thr32Ile		Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_7_prot	p.T32I	ENST00000264499.4	37	c.95	CCDS3724.1	4	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550215	0.86127	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	D;D	0.91843	-2.92;-2.92	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.95765	0.8622	M	0.78916	2.43	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	D	0.95200	0.8316	10	0.48119	T	0.1	-15.0048	19.5257	0.95206	0.0:0.0:1.0:0.0	.	32	Q8IWZ6	BBS7_HUMAN	I	32	ENSP00000264499:T32I;ENSP00000423626:T32I	ENSP00000264499:T32I	T	-	2	0	BBS7	123008593	1.000000	0.71417	0.979000	0.43373	0.930000	0.56654	7.058000	0.76676	2.614000	0.88457	0.655000	0.94253	ACA	BBS7	-	pirsf_Bardet-Biedl_syndrome_7_prot	ENSG00000138686		0.373	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS7	HGNC	protein_coding	OTTHUMT00000256716.1	-	0.00	59	0	G			122789143	-1	tier1	-	no_errors	ENST00000264499	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
BHMT2	23743	genome.wustl.edu	37	5	78376682	78376682	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:78376682T>C	ENST00000255192.3	+	4	497	c.431T>C	c.(430-432)gTg>gCg	p.V144A	BHMT2_ENST00000521567.1_Intron|DMGDH_ENST00000520388.1_Intron	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	144	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	TGGAAAAATGTGGACTTCTTG	0.398																																																	0													78.0	80.0	79.0					5																	78376682		2203	4300	6503	SO:0001583	missense	0				CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.431T>C	5.37:g.78376682T>C	ENSP00000255192:p.Val144Ala		B7Z516|Q9NXX7	Missense_Mutation	SNP	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_Betaine-hCys_S-MeTrfase_BHMT,pfscan_S_MeTrfase	p.V144A	ENST00000255192.3	37	c.431	CCDS4045.1	5	.	.	.	.	.	.	.	.	.	.	T	19.17	3.774838	0.70107	.	.	ENSG00000132840	ENST00000255192	T	0.35236	1.32	6.16	6.16	0.99307	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.52948	0.1766	L	0.52011	1.625	0.80722	D	1	P	0.51240	0.943	D	0.66602	0.945	T	0.38222	-0.9671	10	0.22706	T	0.39	-27.8215	16.8061	0.85666	0.0:0.0:0.0:1.0	.	144	Q9H2M3	BHMT2_HUMAN	A	144	ENSP00000255192:V144A	ENSP00000255192:V144A	V	+	2	0	BHMT2	78412438	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	4.846000	0.62860	2.367000	0.80283	0.528000	0.53228	GTG	BHMT2	-	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_Betaine-hCys_S-MeTrfase_BHMT,pfscan_S_MeTrfase	ENSG00000132840		0.398	BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHMT2	HGNC	protein_coding	OTTHUMT00000226962.2	-	0.00	64	0	T	NM_017614		78376682	+1	tier1	-	no_errors	ENST00000255192	ensembl	human	known	74_37	missense	21.31	48	13	SNP	1.000	C
BTBD6	90135	genome.wustl.edu	37	14	105716550	105716550	+	Silent	SNP	C	C	T	rs371770383		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:105716550C>T	ENST00000392554.3	+	4	1296	c.999C>T	c.(997-999)ctC>ctT	p.L333L	BRF1_ENST00000327359.3_Intron|BRF1_ENST00000546474.1_Intron|BTBD6_ENST00000536364.1_Silent_p.L333L|BTBD6_ENST00000327471.3_Silent_p.L258L|BRF1_ENST00000440513.3_Intron|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000446501.2_5'Flank|BTBD6_ENST00000463376.2_Silent_p.L258L			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	333						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		GGAAGGGCCTCGCCCCGCAGA	0.622																																																	0								C	,,,,	1,4405		0,1,2202	36.0	43.0	41.0		,,,,999	-10.1	0.0	14		41	0,8594		0,0,4297	no	intron,intron,intron,intron,coding-synonymous	BRF1,BTBD6	NM_001242786.1,NM_001242787.1,NM_001242788.1,NM_001519.3,NM_033271.2	,,,,	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	,,,,	,,,,333/486	105716550	1,12999	2203	4297	6500	SO:0001819	synonymous_variant	0			AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.999C>T	14.37:g.105716550C>T			Q8IVQ7|Q9BR94	Silent	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.L333	ENST00000392554.3	37	c.999	CCDS10002.2	14																																																																																			BTBD6	-	NULL	ENSG00000184887		0.622	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD6	HGNC	protein_coding	OTTHUMT00000074556.4	-	0.00	26	0	C			105716550	+1	tier1	-	no_errors	ENST00000392554	ensembl	human	known	74_37	silent	40.74	16	11	SNP	0.016	T
BTN1A1	696	genome.wustl.edu	37	6	26509061	26509061	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:26509061C>T	ENST00000244513.6	+	7	1306	c.1240C>T	c.(1240-1242)Cca>Tca	p.P414S		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	414	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						GACCCCTCTCCCATTGGCAGG	0.502																																																	0													66.0	66.0	66.0					6																	26509061		2203	4300	6503	SO:0001583	missense	0			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.1240C>T	6.37:g.26509061C>T	ENSP00000244513:p.Pro414Ser		Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.P414S	ENST00000244513.6	37	c.1240	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	C	8.215	0.801243	0.16397	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.68331	-0.32	5.98	4.2	0.49525	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.353856	0.24755	N	0.035877	T	0.14657	0.0354	N	0.01464	-0.85	0.19300	N	0.999979	B	0.23990	0.095	B	0.28305	0.088	T	0.31613	-0.9937	10	0.06625	T	0.88	.	10.3267	0.43798	0.0:0.8416:0.0:0.1584	.	414	Q13410	BT1A1_HUMAN	S	414	ENSP00000244513:P414S	ENSP00000244513:P414S	P	+	1	0	BTN1A1	26617040	0.000000	0.05858	0.385000	0.26158	0.245000	0.25701	0.137000	0.15995	1.533000	0.49186	0.655000	0.94253	CCA	BTN1A1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000124557		0.502	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	HGNC	protein_coding	OTTHUMT00000043776.1		0.00	52	0	C	NM_001732		26509061	+1			no_errors	ENST00000244513	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.346	T
C1orf52	148423	genome.wustl.edu	37	1	85725158	85725158	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:85725158C>T	ENST00000471115.1	-	1	167	c.159G>A	c.(157-159)gaG>gaA	p.E53E	C1orf52_ENST00000344356.5_Silent_p.E53E|C1orf52_ENST00000294661.4_5'UTR	NM_198077.3	NP_932343.1	Q8N6N3	CA052_HUMAN	chromosome 1 open reading frame 52	53							poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)	10				all cancers(265;0.0105)|Epithelial(280;0.0293)		GGAGCCGCTTCTCCGCCTTGT	0.627											OREG0013580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													38.0	42.0	41.0					1																	85725158		2203	4300	6503	SO:0001819	synonymous_variant	0			BC029538	CCDS703.1	1p22.3	2008-02-05			ENSG00000162642	ENSG00000162642			24871	protein-coding gene	gene with protein product						11891061	Standard	NM_198077		Approved	gm117, FLJ44982	uc001dkv.3	Q8N6N3	OTTHUMG00000009966	ENST00000471115.1:c.159G>A	1.37:g.85725158C>T		1239	B3KX89|Q8TDK5|Q8TDK6	Silent	SNP	NULL	p.E53	ENST00000471115.1	37	c.159	CCDS703.1	1																																																																																			C1orf52	-	NULL	ENSG00000162642		0.627	C1orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf52	HGNC	protein_coding	OTTHUMT00000027616.2	-	0.00	139	0	C	NM_198077		85725158	-1	tier1	-	no_errors	ENST00000471115	ensembl	human	known	74_37	silent	14.01	135	22	SNP	1.000	T
C20orf202	400831	genome.wustl.edu	37	20	1187643	1187643	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:1187643G>C	ENST00000400633.1	+	2	329	c.266G>C	c.(265-267)aGa>aCa	p.R89T		NM_001009612.2	NP_001009612.1	A1L168	CT202_HUMAN	chromosome 20 open reading frame 202	89										endometrium(1)	1						TCCCCCATCAGAGCTCGAGCG	0.662																																																	0													24.0	26.0	26.0					20																	1187643		692	1591	2283	SO:0001583	missense	0				CCDS46567.1	20p13	2009-09-10			ENSG00000215595	ENSG00000215595			37254	protein-coding gene	gene with protein product							Standard	NM_001009612		Approved		uc002wer.4	A1L168	OTTHUMG00000129375	ENST00000400633.1:c.266G>C	20.37:g.1187643G>C	ENSP00000383474:p.Arg89Thr			Missense_Mutation	SNP	NULL	p.R89T	ENST00000400633.1	37	c.266	CCDS46567.1	20	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073451	0.36566	.	.	ENSG00000215595	ENST00000400633	.	.	.	3.76	3.76	0.43208	.	.	.	.	.	T	0.54759	0.1878	L	0.44542	1.39	0.09310	N	1	D	0.76494	0.999	D	0.80764	0.994	T	0.39722	-0.9600	8	0.87932	D	0	-7.4276	11.3962	0.49843	0.0:0.0:1.0:0.0	.	89	A1L168	CT202_HUMAN	T	89	.	ENSP00000383474:R89T	R	+	2	0	C20orf202	1135643	1.000000	0.71417	0.100000	0.21137	0.810000	0.45777	4.166000	0.58203	2.379000	0.81126	0.561000	0.74099	AGA	C20orf202	-	NULL	ENSG00000215595		0.662	C20orf202-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf202	HGNC	protein_coding	OTTHUMT00000251531.1	-	0.00	75	0	G	NM_001009612		1187643	+1	tier1	-	no_errors	ENST00000400633	ensembl	human	known	74_37	missense	12.24	43	6	SNP	0.133	C
C3	718	genome.wustl.edu	37	19	6710693	6710693	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:6710693G>A	ENST00000245907.6	-	13	1735	c.1643C>T	c.(1642-1644)gCc>gTc	p.A548V		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	548					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CACGGAGTCGGCCACCACCTC	0.657																																																	0													47.0	40.0	42.0					19																	6710693		2203	4300	6503	SO:0001583	missense	0			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1643C>T	19.37:g.6710693G>A	ENSP00000245907:p.Ala548Val		A7E236	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.A548V	ENST00000245907.6	37	c.1643	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185154	0.78677	.	.	ENSG00000125730	ENST00000245907	T	0.67865	-0.29	5.09	5.09	0.68999	Alpha-2-macroglobulin, N-terminal 2 (1);	0.112676	0.64402	N	0.000010	D	0.85410	0.5690	M	0.91612	3.225	0.38715	D	0.953316	D	0.76494	0.999	D	0.79108	0.992	D	0.89347	0.3658	10	0.56958	D	0.05	.	17.2723	0.87105	0.0:0.0:1.0:0.0	.	548	P01024	CO3_HUMAN	V	548	ENSP00000245907:A548V	ENSP00000245907:A548V	A	-	2	0	C3	6661693	1.000000	0.71417	0.966000	0.40874	0.013000	0.08279	8.960000	0.93117	2.380000	0.81148	0.655000	0.94253	GCC	C3	-	pfam_A2M_N_2	ENSG00000125730		0.657	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2		0.00	64	0	G	NM_000064		6710693	-1			no_errors	ENST00000245907	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
CFAP69	79846	genome.wustl.edu	37	7	89917577	89917577	+	Missense_Mutation	SNP	C	C	G	rs188534119	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:89917577C>G	ENST00000389297.4	+	15	1937	c.1686C>G	c.(1684-1686)atC>atG	p.I562M	C7orf63_ENST00000316089.8_Missense_Mutation_p.I562M|C7orf63_ENST00000497910.1_Missense_Mutation_p.I544M	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		562								p.I562I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						GAGTAGATATCGTTCTTCATG	0.338																																																	1	Substitution - coding silent(1)	large_intestine(1)											122.0	113.0	116.0					7																	89917577		1827	4082	5909	SO:0001583	missense	0																														ENST00000389297.4:c.1686C>G	7.37:g.89917577C>G	ENSP00000373948:p.Ile562Met		A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.I562M	ENST00000389297.4	37	c.1686	CCDS43613.2	7	.	.	.	.	.	.	.	.	.	.	A	7.128	0.579327	0.13686	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000457170;ENST00000449577	T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73	5.62	3.04	0.35103	Armadillo-type fold (1);	0.239076	0.48767	D	0.000178	T	0.47893	0.1470	M	0.64404	1.975	0.26423	N	0.976076	B;P;P	0.47545	0.219;0.897;0.897	B;P;P	0.47376	0.15;0.545;0.545	T	0.44498	-0.9324	10	0.72032	D	0.01	-9.2167	6.6767	0.23098	0.4912:0.2593:0.0:0.2494	.	544;562;562	A5D8W1-5;A5D8W1;A5D8W1-2	.;CG063_HUMAN;.	M	562;562;544;445;145	ENSP00000373948:I562M;ENSP00000321753:I562M;ENSP00000419549:I544M;ENSP00000392365:I445M;ENSP00000391571:I145M	ENSP00000321753:I562M	I	+	3	3	C7orf63	89755513	0.810000	0.29049	0.997000	0.53966	0.875000	0.50365	0.492000	0.22435	0.386000	0.24997	-0.335000	0.08231	ATC	C7orf63	-	superfamily_ARM-type_fold	ENSG00000105792		0.338	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4	-	0.00	117	0	C			89917577	+1	tier1	-	no_errors	ENST00000389297	ensembl	human	known	74_37	missense	36.69	106	62	SNP	0.997	G
CALD1	800	genome.wustl.edu	37	7	134613566	134613566	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:134613566G>T	ENST00000361675.2	+	4	362	c.133G>T	c.(133-135)Gcc>Tcc	p.A45S	CALD1_ENST00000422748.1_Missense_Mutation_p.A45S|CALD1_ENST00000543443.1_Missense_Mutation_p.A50S|CALD1_ENST00000361901.2_Missense_Mutation_p.A45S|CALD1_ENST00000424922.1_Missense_Mutation_p.A39S|CALD1_ENST00000393118.2_Missense_Mutation_p.A39S|CALD1_ENST00000361388.2_Missense_Mutation_p.A45S|CALD1_ENST00000495522.1_Missense_Mutation_p.A39S|CALD1_ENST00000417172.1_Missense_Mutation_p.A45S			Q05682	CALD1_HUMAN	caldesmon 1	45	Myosin and calmodulin-binding. {ECO:0000250}.|Poly-Arg.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						GCGCCGCCGAGCCCGACAGGA	0.577																																																	0													51.0	48.0	49.0					7																	134613566		2203	4300	6503	SO:0001583	missense	0			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.133G>T	7.37:g.134613566G>T	ENSP00000354826:p.Ala45Ser		A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.A45S	ENST00000361675.2	37	c.133	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	G	26.0	4.695714	0.88830	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000454108;ENST00000361675;ENST00000361901;ENST00000445569;ENST00000435928;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.55	5.55	0.83447	.	0.000000	0.45126	D	0.000387	T	0.69233	0.3088	M	0.77103	2.36	0.48511	D	0.999668	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.87578	0.996;0.998;0.996;0.996;0.996;0.996;0.998;0.998	T	0.65681	-0.6109	10	0.26408	T	0.33	-12.8911	17.6838	0.88251	0.0:0.0:1.0:0.0	.	50;45;39;39;45;45;45;45	F5H1Z9;A8K0X1;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;CALD1_HUMAN;.	S	45;45;45;45;45;45;45;59;45;39;39;39;50	ENSP00000398826:A45S;ENSP00000411476:A45S;ENSP00000355000:A45S;ENSP00000395710:A45S;ENSP00000401988:A45S;ENSP00000354826:A45S;ENSP00000354513:A45S;ENSP00000390926:A59S;ENSP00000416611:A45S;ENSP00000376826:A39S;ENSP00000393621:A39S;ENSP00000419673:A39S;ENSP00000445641:A50S	ENSP00000355000:A45S	A	+	1	0	CALD1	134264106	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	6.517000	0.73759	2.600000	0.87896	0.561000	0.74099	GCC	CALD1	-	pfam_Caldesmon_LSP	ENSG00000122786		0.577	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	-	0.00	48	0	G	NM_033138		134613566	+1	tier1	-	no_errors	ENST00000361388	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
CAMK1G	57172	genome.wustl.edu	37	1	209782332	209782332	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:209782332G>T	ENST00000009105.1	+	8	888	c.643G>T	c.(643-645)Gga>Tga	p.G215*	CAMK1G_ENST00000361322.2_Nonsense_Mutation_p.G215*|CAMK1G_ENST00000494990.1_3'UTR			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	215	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		CAGGCTCTGTGGATACCCCCC	0.507																																					Ovarian(163;530 1939 9680 28669 48710)												0													106.0	102.0	103.0					1																	209782332		2203	4300	6503	SO:0001587	stop_gained	0				CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.643G>T	1.37:g.209782332G>T	ENSP00000009105:p.Gly215*		Q86UH5|Q9Y3J7	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G215*	ENST00000009105.1	37	c.643	CCDS1486.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.222640	0.95139	.	.	ENSG00000008118	ENST00000009105;ENST00000361322	.	.	.	5.48	5.48	0.80851	.	0.000000	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.3515	0.94389	0.0:0.0:1.0:0.0	.	.	.	.	X	215	.	ENSP00000009105:G215X	G	+	1	0	CAMK1G	207848955	1.000000	0.71417	1.000000	0.80357	0.279000	0.26890	9.507000	0.97996	2.593000	0.87608	0.561000	0.74099	GGA	CAMK1G	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000008118		0.507	CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1G	HGNC	protein_coding	OTTHUMT00000088526.1		0.00	77	0	G	NM_020439		209782332	+1			no_errors	ENST00000009105	ensembl	human	known	74_37	nonsense	5.88	64	4	SNP	1.000	T
CAPRIN1	4076	genome.wustl.edu	37	11	34107731	34107731	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:34107731A>G	ENST00000341394.4	+	10	1276	c.1087A>G	c.(1087-1089)Atg>Gtg	p.M363V	CAPRIN1_ENST00000389645.3_Missense_Mutation_p.M363V|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.M363V|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.M282V|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.M363V	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	363	G3BP1-binding.				negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				ACAAGACCTTATGGCACAAAT	0.438																																																	0													64.0	60.0	62.0					11																	34107731		2202	4298	6500	SO:0001583	missense	0			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1087A>G	11.37:g.34107731A>G	ENSP00000340329:p.Met363Val		A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	pfam_Caprin-1_C	p.M363V	ENST00000341394.4	37	c.1087	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	A	16.21	3.059889	0.55325	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.32315	0.0825	M	0.72479	2.2	0.80722	D	1	P;P	0.39181	0.533;0.663	B;B	0.33196	0.076;0.159	T	0.13415	-1.0510	10	0.17832	T	0.49	-5.0913	16.6512	0.85203	1.0:0.0:0.0:0.0	.	363;363	Q14444;Q14444-2	CAPR1_HUMAN;.	V	363;363;363;363;282	ENSP00000340329:M363V;ENSP00000374296:M363V;ENSP00000434150:M363V;ENSP00000434204:M363V;ENSP00000431581:M282V	ENSP00000340329:M363V	M	+	1	0	CAPRIN1	34064307	1.000000	0.71417	0.998000	0.56505	0.771000	0.43674	8.962000	0.93254	2.333000	0.79357	0.482000	0.46254	ATG	CAPRIN1	-	NULL	ENSG00000135387		0.438	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2	-	0.00	39	0	A	NM_005898		34107731	+1	tier1	-	no_errors	ENST00000341394	ensembl	human	known	74_37	missense	33.33	14	7	SNP	1.000	G
CASP14	23581	genome.wustl.edu	37	19	15164553	15164553	+	Missense_Mutation	SNP	G	G	C	rs575021361		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:15164553G>C	ENST00000427043.3	+	4	495	c.187G>C	c.(187-189)Gaa>Caa	p.E63Q	CASP14_ENST00000221740.1_Missense_Mutation_p.E63Q|AC004699.1_ENST00000411269.1_RNA	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	63					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						GCAATTCCAGGAAGAGCTGGA	0.552																																																	0													53.0	51.0	52.0					19																	15164553		2203	4300	6503	SO:0001583	missense	0				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.187G>C	19.37:g.15164553G>C	ENSP00000393417:p.Glu63Gln		O95823|Q3SYC9	Missense_Mutation	SNP	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.E63Q	ENST00000427043.3	37	c.187	CCDS12323.1	19	.	.	.	.	.	.	.	.	.	.	g	18.34	3.603561	0.66445	.	.	ENSG00000105141	ENST00000427043;ENST00000221740	T;T	0.20332	2.08;2.08	4.91	3.85	0.44370	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.275757	0.31323	N	0.007841	T	0.27594	0.0678	L	0.38953	1.18	0.37924	D	0.931772	D	0.56746	0.977	P	0.59357	0.856	T	0.07290	-1.0780	10	0.17369	T	0.5	.	11.3032	0.49318	0.0:0.1844:0.8156:0.0	.	63	P31944	CASPE_HUMAN	Q	63	ENSP00000393417:E63Q;ENSP00000221740:E63Q	ENSP00000221740:E63Q	E	+	1	0	CASP14	15025553	1.000000	0.71417	0.958000	0.39756	0.909000	0.53808	3.154000	0.50693	1.038000	0.40049	0.306000	0.20318	GAA	CASP14	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_ICE_p20	ENSG00000105141		0.552	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP14	HGNC	protein_coding	OTTHUMT00000465663.1	-	0.00	63	0	G	NM_012114		15164553	+1	tier1	-	no_errors	ENST00000221740	ensembl	human	known	74_37	missense	32.35	46	22	SNP	0.993	C
CASP8AP2	9994	genome.wustl.edu	37	6	90573976	90573976	+	RNA	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:90573976C>G	ENST00000551025.1	+	0	3985									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CCTTAATCACCTGAGACCTAT	0.418																																					Colon(187;1656 2025 17045 31481 39901)												0													62.0	60.0	61.0					6																	90573976		1875	4120	5995			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90573976C>G				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.418	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		-	0.00	95	0	C	NM_001137667		90573976	+1	tier1	-	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	33.33	34	17	SNP	0.016	G
CASR	846	genome.wustl.edu	37	3	121980495	121980495	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:121980495C>T	ENST00000490131.1	+	4	985	c.613C>T	c.(613-615)Cgc>Tgc	p.R205C	CASR_ENST00000296154.5_Missense_Mutation_p.R205C|CASR_ENST00000498619.1_Missense_Mutation_p.R205C	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	205					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CGAGTATTTCCGCTGGAACTG	0.522																																																	0													122.0	129.0	126.0					3																	121980495		2203	4300	6503	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.613C>T	3.37:g.121980495C>T	ENSP00000418685:p.Arg205Cys		Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,superfamily_Growth_fac_rcpt_N_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.R205C	ENST00000490131.1	37	c.613	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610662	0.66558	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.86562	-2.14;-2.14;-2.14	6.08	5.18	0.71444	Extracellular ligand-binding receptor (1);	0.217757	0.52532	D	0.000076	D	0.88757	0.6523	L	0.39898	1.24	0.48762	D	0.999708	D;D	0.76494	0.998;0.999	P;P	0.57679	0.761;0.825	D	0.89235	0.3580	10	0.66056	D	0.02	.	15.9638	0.79950	0.135:0.865:0.0:0.0	.	205;205	E7ENE0;P41180	.;CASR_HUMAN	C	205	ENSP00000418685:R205C;ENSP00000420194:R205C;ENSP00000296154:R205C	ENSP00000296154:R205C	R	+	1	0	CASR	123463185	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.541000	0.45735	2.894000	0.99253	0.591000	0.81541	CGC	CASR	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000036828		0.522	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	-	0.00	29	0	C	NM_000388		121980495	+1	tier1	-	no_errors	ENST00000498619	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	T
CBX3P2	645158	genome.wustl.edu	37	18	2652677	2652678	+	RNA	DEL	AC	AC	-			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr18:2652677_2652678delAC	ENST00000579647.1	-	0	919_920				RNU6-340P_ENST00000364005.1_RNA	NR_033754.2				chromobox homolog 3 pseudogene 2																		CCTAGGTTTTACACACACACAC	0.342																																																	0																																												0					18p11.32	2011-09-05				ENSG00000266405			42874	pseudogene	pseudogene							Standard	NR_033754		Approved		uc021ugl.1				18.37:g.2652687_2652688delAC				RNA	DEL	-	NULL	ENST00000579647.1	37	NULL		18																																																																																			CBX3P2	-	-	ENSG00000266405		0.342	CBX3P2-002	KNOWN	basic	processed_transcript	CBX3P2	HGNC	pseudogene	OTTHUMT00000441602.1		0.00	11	0	AC			2652678	-1			no_errors	ENST00000579647	ensembl	human	known	74_37	rna	37.50	5	3	DEL	0.001:0.000	0
CCDC109B	55013	genome.wustl.edu	37	4	110605697	110605697	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:110605697G>A	ENST00000394650.4	+	6	844	c.711G>A	c.(709-711)tgG>tgA	p.W237*		NM_017918.4	NP_060388.2	Q9NWR8	MCUB_HUMAN	coiled-coil domain containing 109B	237					mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of membrane (GO:0031224)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium channel inhibitor activity (GO:0019855)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(1)	9				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)		CACTGGCCTGGCTCACGTGGT	0.488																																																	0													175.0	160.0	165.0					4																	110605697		2203	4300	6503	SO:0001587	stop_gained	0			BC002633	CCDS3683.2	4q25	2011-05-24			ENSG00000005059	ENSG00000005059			26076	protein-coding gene	gene with protein product						12477932	Standard	NM_017918		Approved	FLJ20647	uc011cfs.2	Q9NWR8	OTTHUMG00000161103	ENST00000394650.4:c.711G>A	4.37:g.110605697G>A	ENSP00000378145:p.Trp237*		A8K4Y3|Q6IAC1	Nonsense_Mutation	SNP	pfam_Coiled-coil-dom_prot_109_C	p.W237*	ENST00000394650.4	37	c.711	CCDS3683.2	4	.	.	.	.	.	.	.	.	.	.	G	39	7.310206	0.98203	.	.	ENSG00000005059	ENST00000394650	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-9.7134	19.5583	0.95363	0.0:0.0:1.0:0.0	.	.	.	.	X	237	.	ENSP00000378145:W237X	W	+	3	0	CCDC109B	110825146	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.868000	0.87116	2.602000	0.87976	0.591000	0.81541	TGG	CCDC109B	-	pfam_Coiled-coil-dom_prot_109_C	ENSG00000005059		0.488	CCDC109B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC109B	HGNC	protein_coding	OTTHUMT00000254865.1	-	0.00	51	0	G	NM_017918		110605697	+1	tier1	-	no_errors	ENST00000394650	ensembl	human	known	74_37	nonsense	10.00	36	4	SNP	1.000	A
CCL5	6352	genome.wustl.edu	37	17	34199418	34199418	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:34199418C>T	ENST00000293272.3	-	3	441	c.239G>A	c.(238-240)tGg>tAg	p.W80*	CCL5_ENST00000366113.3_Nonsense_Mutation_p.W80*|AC015849.2_ENST00000413928.1_RNA	NM_002985.2	NP_002976.2	P13501	CCL5_HUMAN	chemokine (C-C motif) ligand 5	80					activation of phospholipase D activity (GO:0031584)|calcium ion transport (GO:0006816)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular protein complex assembly (GO:0043623)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|eosinophil chemotaxis (GO:0048245)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage chemotaxis (GO:0048246)|MAPK cascade (GO:0000165)|monocyte chemotaxis (GO:0002548)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of T cell apoptotic process (GO:0070233)|negative regulation of viral genome replication (GO:0045071)|neutrophil activation (GO:0042119)|positive chemotaxis (GO:0050918)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of innate immune response (GO:0045089)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell apoptotic process (GO:0070234)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell migration (GO:2000406)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of translational initiation (GO:0045948)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|positive regulation of viral genome replication (GO:0045070)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein tetramerization (GO:0051262)|regulation of chronic inflammatory response (GO:0002676)|regulation of insulin secretion (GO:0050796)|regulation of neuron death (GO:1901214)|regulation of T cell activation (GO:0050863)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|CCR4 chemokine receptor binding (GO:0031729)|CCR5 chemokine receptor binding (GO:0031730)|chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|chemokine receptor antagonist activity (GO:0046817)|chemokine receptor binding (GO:0042379)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase activator activity (GO:0016004)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|receptor signaling protein tyrosine kinase activator activity (GO:0030298)			breast(1)|kidney(1)|lung(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0183)		CTCCCGAACCCATTTCTTCTC	0.498																																																	0													187.0	149.0	162.0					17																	34199418		2203	4300	6503	SO:0001587	stop_gained	0			AF043341	CCDS11300.1	17q11.2-q12	2014-04-17	2002-08-22	2002-08-23	ENSG00000161570	ENSG00000271503		"""Chemokine ligands"", ""Endogenous ligands"""	10632	protein-coding gene	gene with protein product	"""T-cell specific protein p288"", ""T-cell specific RANTES protein"", ""SIS-delta"", ""regulated upon activation, normally T-expressed, and presumably secreted"", ""beta-chemokine RANTES"", ""small inducible cytokine subfamily A (Cys-Cys), member 5"""	187011	"""small inducible cytokine A5 (RANTES)"""	D17S136E, SCYA5		1691736	Standard	NM_002985		Approved	RANTES, SISd, TCP228, MGC17164	uc002hkf.3	P13501	OTTHUMG00000188396	ENST00000293272.3:c.239G>A	17.37:g.34199418C>T	ENSP00000293272:p.Trp80*		O43646|Q0QVW8|Q4ZGJ1|Q9NYA2|Q9UBG2|Q9UC99	Nonsense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.W80*	ENST00000293272.3	37	c.239	CCDS11300.1	17	.	.	.	.	.	.	.	.	.	.	c	23.8	4.455683	0.84209	.	.	ENSG00000161570	ENST00000293272;ENST00000366113	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5424	0.68005	0.0:1.0:0.0:0.0	.	.	.	.	X	80	.	ENSP00000293272:W80X	W	-	2	0	CCL5	31223531	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	3.874000	0.56101	2.812000	0.96745	0.556000	0.70494	TGG	CCL5	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000161570		0.498	CCL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL5	HGNC	protein_coding	OTTHUMT00000256486.3	-	0.00	123	0	C	NM_002985		34199418	-1	tier1	-	no_errors	ENST00000293272	ensembl	human	known	74_37	nonsense	12.14	123	17	SNP	1.000	T
CCPG1	9236	genome.wustl.edu	37	15	55648429	55648429	+	3'UTR	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:55648429G>T	ENST00000310958.6	-	0	5840				DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000425574.3_Missense_Mutation_p.P422T|CCPG1_ENST00000442196.3_Missense_Mutation_p.P805T	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1						cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		CAGTATTGAGGATCAAAAGGT	0.313																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.*3268C>A	15.37:g.55648429G>T			A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	NULL	p.P422T	ENST00000310958.6	37	c.1264	CCDS42039.1	15	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394646	0.62066	.	.	ENSG00000256061	ENST00000442196;ENST00000425574	T;T	0.60424	2.59;0.19	5.36	5.36	0.76844	.	.	.	.	.	T	0.74099	0.3672	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75878	-0.3162	9	0.87932	D	0	.	18.4358	0.90645	0.0:0.0:1.0:0.0	.	805;422	A8K9T0;Q9ULG6-3	.;.	T	805;422	ENSP00000403400:P805T;ENSP00000415128:P422T	ENSP00000415128:P422T	P	-	1	0	DYX1C1	53435721	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	8.847000	0.92166	2.681000	0.91329	0.591000	0.81541	CCT	CCPG1	-	NULL	ENSG00000260916		0.313	CCPG1-001	KNOWN	basic|CCDS	protein_coding	CCPG1	HGNC	protein_coding	OTTHUMT00000419850.1	-	0.00	76	0	G	NM_004748		55648429	-1	tier1	-	no_errors	ENST00000425574	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
CD55	1604	genome.wustl.edu	37	1	207527382	207527382	+	Intron	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:207527382G>C	ENST00000367064.3	+	10	1339				CD55_ENST00000367062.4_Intron|CD55_ENST00000391921.4_Intron|CD55_ENST00000391920.4_Missense_Mutation_p.G371A|CD55_ENST00000314754.8_Intron|CD55_ENST00000367065.5_Intron|CD55_ENST00000465534.1_Intron|CD55_ENST00000367067.4_Intron	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)						CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	GAAGTGTCTGGGTCATCCCAC	0.393																																																	0																																										SO:0001627	intron_variant	0			BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.1082-5509G>C	1.37:g.207527382G>C			B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G371A	ENST00000367064.3	37	c.1112	CCDS31006.1	1	.	.	.	.	.	.	.	.	.	.	G	7.039	0.562127	0.13498	.	.	ENSG00000196352	ENST00000391920	T	0.44083	0.93	2.18	1.24	0.21308	.	.	.	.	.	T	0.24699	0.0599	.	.	.	0.09310	N	0.999999	P	0.48911	0.917	B	0.33620	0.167	T	0.17776	-1.0358	8	0.72032	D	0.01	.	5.021	0.14361	0.1782:0.0:0.8218:0.0	.	371	Q14UF4	.	A	371	ENSP00000375787:G371A	ENSP00000375787:G371A	G	+	2	0	CD55	205594005	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.274000	0.08537	0.510000	0.28216	0.447000	0.29281	GGG	CD55	-	NULL	ENSG00000196352		0.393	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD55	HGNC	protein_coding	OTTHUMT00000088208.2	-	0.00	67	0	G	NM_000574		207527382	+1	tier1	-	no_errors	ENST00000391920	ensembl	human	known	74_37	missense	25.86	43	15	SNP	0.000	C
CD93	22918	genome.wustl.edu	37	20	23066586	23066586	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:23066586G>A	ENST00000246006.4	-	1	391	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	82	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)	p.R82W(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCTGCCTCCCGCCTCAGGAGC	0.642																																																	1	Substitution - Missense(1)	pancreas(1)											40.0	30.0	34.0					20																	23066586		2203	4300	6503	SO:0001583	missense	0			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.244C>T	20.37:g.23066586G>A	ENSP00000246006:p.Arg82Trp		O00274	Missense_Mutation	SNP	pirsf_CD93/CD141,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_MFS_dom_general_subst_transpt,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_C-type_lectin	p.R82W	ENST00000246006.4	37	c.244	CCDS13149.1	20	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890921	0.33348	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	T	0.80653	-1.4	5.06	-8.18	0.01053	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.625640	0.03830	N	0.268985	T	0.72606	0.3481	L	0.58510	1.815	0.09310	N	1	P	0.51791	0.948	P	0.45138	0.471	T	0.69514	-0.5125	10	0.66056	D	0.02	-0.8011	1.0558	0.01590	0.3846:0.0955:0.2191:0.3009	.	82	Q9NPY3	C1QR1_HUMAN	W	82	ENSP00000246006:R82W	ENSP00000246006:R82W	R	-	1	2	CD93	23014586	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.234000	0.09028	-1.284000	0.02390	0.655000	0.94253	CGG	CD93	-	pirsf_CD93/CD141,pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000125810		0.642	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD93	HGNC	protein_coding	OTTHUMT00000078312.2	-	0.00	110	0	G	NM_012072		23066586	-1	tier1	-	no_errors	ENST00000246006	ensembl	human	known	74_37	missense	23.40	72	22	SNP	0.000	A
CHAMP1	283489	genome.wustl.edu	37	13	115089417	115089417	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr13:115089417G>T	ENST00000361283.1	+	3	409	c.100G>T	c.(100-102)Ggt>Tgt	p.G34C		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	34					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										AATCCATATGGGTACCATCCA	0.403																																																	0													122.0	115.0	117.0					13																	115089417		2203	4300	6503	SO:0001583	missense	0			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.100G>T	13.37:g.115089417G>T	ENSP00000354730:p.Gly34Cys		B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G34C	ENST00000361283.1	37	c.100	CCDS9545.1	13	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525223	0.85600	.	.	ENSG00000198824	ENST00000361283	T	0.01821	4.62	5.83	5.83	0.93111	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000019	T	0.06781	0.0173	L	0.34521	1.04	0.51233	D	0.999917	D	0.89917	1.0	D	0.97110	1.0	T	0.54009	-0.8357	9	.	.	.	-8.4897	20.1184	0.97949	0.0:0.0:1.0:0.0	.	34	Q96JM3	ZN828_HUMAN	C	34	ENSP00000354730:G34C	.	G	+	1	0	ZNF828	114107519	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.139000	0.71728	2.769000	0.95229	0.655000	0.94253	GGT	CHAMP1	-	smart_Znf_C2H2-like	ENSG00000198824		0.403	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	HGNC	protein_coding	OTTHUMT00000045977.2	-	0.00	55	0	G	NM_032436		115089417	+1	tier1	-	no_errors	ENST00000361283	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
CHEK1	1111	genome.wustl.edu	37	11	125525377	125525377	+	3'UTR	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:125525377G>A	ENST00000534070.1	+	0	1848				CHEK1_ENST00000544373.1_3'UTR|CHEK1_ENST00000438015.1_3'UTR|CHEK1_ENST00000524737.1_Intron|CHEK1_ENST00000278916.3_3'UTR|CHEK1_ENST00000428830.2_Intron|CHEK1_ENST00000532449.1_3'UTR	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1						cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		TTGTTTGTTCGGCATACAAAT	0.328								Other conserved DNA damage response genes																																									0																																										SO:0001624	3_prime_UTR_variant	0			AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.*162G>A	11.37:g.125525377G>A			A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	RNA	SNP	-	NULL	ENST00000534070.1	37	NULL	CCDS8459.1	11																																																																																			CHEK1	-	-	ENSG00000149554		0.328	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CHEK1	HGNC	protein_coding	OTTHUMT00000386714.1	-	0.00	34	0	G	NM_001274		125525377	+1	tier1	-	no_errors	ENST00000532449	ensembl	human	known	74_37	rna	12.50	28	4	SNP	0.001	A
CHMP5	51510	genome.wustl.edu	37	9	33278078	33278079	+	Intron	INS	-	-	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:33278078_33278079insT	ENST00000223500.8	+	7	633				CHMP5_ENST00000419016.2_Intron|CHMP5_ENST00000487080.1_3'UTR	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5						endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			TCTTGGTTACATTTTTTTTAAA	0.401																																																	0																																										SO:0001627	intron_variant	0			AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765	ENST00000223500.8:c.497-32->T	9.37:g.33278086_33278086dupT			B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	RNA	INS	-	NULL	ENST00000223500.8	37	NULL	CCDS6537.1	9																																																																																			CHMP5	-	-	ENSG00000086065		0.401	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP5	HGNC	protein_coding	OTTHUMT00000052040.3		0.00	38	0	-	NM_016410		33278079	+1	tier1		no_errors	ENST00000487080	ensembl	human	known	74_37	rna	6.06	31	2	INS	0.000:0.008	T
CIZ1	25792	genome.wustl.edu	37	9	130941328	130941328	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:130941328C>T	ENST00000393608.1	-	8	1360	c.1158G>A	c.(1156-1158)caG>caA	p.Q386Q	CIZ1_ENST00000476727.2_Intron|CIZ1_ENST00000541172.1_Silent_p.Q285Q|CIZ1_ENST00000277465.4_Silent_p.Q386Q|CIZ1_ENST00000538431.1_Silent_p.Q386Q|CIZ1_ENST00000372954.1_Intron|CIZ1_ENST00000372938.5_Silent_p.Q386Q|CIZ1_ENST00000372948.3_Intron|CIZ1_ENST00000357558.5_Silent_p.Q386Q|CIZ1_ENST00000325721.8_Silent_p.Q357Q	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	386	Gln-rich.				maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						gccttgggccctgtgaatgtg	0.632																																																	0													54.0	45.0	48.0					9																	130941328		2203	4300	6503	SO:0001819	synonymous_variant	0			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.1158G>A	9.37:g.130941328C>T			A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,pfscan_Znf_C2H2_matrin	p.Q386	ENST00000393608.1	37	c.1158	CCDS6894.1	9																																																																																			CIZ1	-	NULL	ENSG00000148337		0.632	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1	-	0.00	72	0	C	NM_012127		130941328	-1	tier1	-	no_errors	ENST00000538431	ensembl	human	known	74_37	silent	16.00	42	8	SNP	0.855	T
CLINT1	9685	genome.wustl.edu	37	5	157218893	157218893	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:157218893C>T	ENST00000411809.2	-	10	1402	c.1198G>A	c.(1198-1200)Gcg>Acg	p.A400T	CLINT1_ENST00000530742.1_Missense_Mutation_p.A382T|CLINT1_ENST00000523908.1_Missense_Mutation_p.A400T|CLINT1_ENST00000523094.1_Missense_Mutation_p.A382T|CLINT1_ENST00000296951.5_Missense_Mutation_p.A382T	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	400					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGTTCTACCGCTGGCTGTGAG	0.542																																					Colon(22;427 587 2170 6147 14291)												0													77.0	82.0	80.0					5																	157218893		2078	4230	6308	SO:0001583	missense	0			AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.1198G>A	5.37:g.157218893C>T	ENSP00000388340:p.Ala400Thr		B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.A382T	ENST00000411809.2	37	c.1144	CCDS47330.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.73|13.73	2.325432|2.325432	0.41197|0.41197	.|.	.|.	ENSG00000113282|ENSG00000113282	ENST00000523094;ENST00000530742;ENST00000411809;ENST00000296951;ENST00000523908|ENST00000521615	T;T;T;T;T|.	0.48522|.	0.84;0.84;0.82;0.84;0.81|.	5.69|5.69	2.94|2.94	0.34122|0.34122	.|.	0.271207|.	0.36303|.	N|.	0.002675|.	T|T	0.45637|0.45637	0.1352|0.1352	L|L	0.36672|0.36672	1.1|1.1	0.39556|0.39556	D|D	0.969054|0.969054	B;B|.	0.15930|.	0.015;0.013|.	B;B|.	0.14578|.	0.011;0.005|.	T|T	0.26467|0.26467	-1.0102|-1.0102	10|5	0.24483|.	T|.	0.36|.	-30.7073|-30.7073	8.0574|8.0574	0.30612|0.30612	0.1226:0.6957:0.1179:0.0637|0.1226:0.6957:0.1179:0.0637	.|.	400;400|.	B7Z6F8;Q14677|.	.;EPN4_HUMAN|.	T|N	382;382;400;382;400|91	ENSP00000429345:A382T;ENSP00000433419:A382T;ENSP00000388340:A400T;ENSP00000296951:A382T;ENSP00000429824:A400T|.	ENSP00000296951:A382T|.	A|S	-|-	1|2	0|0	CLINT1|CLINT1	157151471|157151471	0.009000|0.009000	0.17119|0.17119	0.357000|0.357000	0.25798|0.25798	0.390000|0.390000	0.30446|0.30446	-0.209000|-0.209000	0.09358|0.09358	0.425000|0.425000	0.26087|0.26087	-0.158000|-0.158000	0.13435|0.13435	GCG|AGC	CLINT1	-	NULL	ENSG00000113282		0.542	CLINT1-001	KNOWN	basic|CCDS	protein_coding	CLINT1	HGNC	protein_coding	OTTHUMT00000374001.1		0.00	83	0	C	NM_014666		157218893	-1			no_errors	ENST00000296951	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.990	T
CLSTN2	64084	genome.wustl.edu	37	3	140265422	140265422	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:140265422C>T	ENST00000458420.3	+	10	1763	c.1573C>T	c.(1573-1575)Cgc>Tgc	p.R525C		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	525					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						TCTCACCATCCGCCCTGGCAA	0.498										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0													60.0	57.0	58.0					3																	140265422		2203	4300	6503	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1573C>T	3.37:g.140265422C>T	ENSP00000402460:p.Arg525Cys		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R525C	ENST00000458420.3	37	c.1573	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523699	0.85600	.	.	ENSG00000158258	ENST00000458420	T	0.02216	4.39	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);	0.000000	0.85682	D	0.000000	T	0.12390	0.0301	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00542	-1.1680	9	.	.	.	-13.5529	16.2435	0.82429	0.0:1.0:0.0:0.0	.	525	Q9H4D0	CSTN2_HUMAN	C	525	ENSP00000402460:R525C	.	R	+	1	0	CLSTN2	141748112	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.487000	0.81328	2.420000	0.82092	0.455000	0.32223	CGC	CLSTN2	-	superfamily_ConA-like_lec_gl_sf	ENSG00000158258		0.498	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	-	0.00	72	0	C	NM_022131		140265422	+1	tier1	-	no_errors	ENST00000458420	ensembl	human	known	74_37	missense	18.64	48	11	SNP	1.000	T
CMYA5	202333	genome.wustl.edu	37	5	79030185	79030185	+	Nonsense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:79030185C>G	ENST00000446378.2	+	2	5628	c.5597C>G	c.(5596-5598)tCa>tGa	p.S1866*		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1866					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTGGAACAATCAAAATCATTT	0.358																																																	0													79.0	77.0	78.0					5																	79030185		1815	4079	5894	SO:0001587	stop_gained	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.5597C>G	5.37:g.79030185C>G	ENSP00000394770:p.Ser1866*		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.S1866*	ENST00000446378.2	37	c.5597	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.403407	0.99161	.	.	ENSG00000164309	ENST00000446378	.	.	.	5.42	3.63	0.41609	.	0.376195	0.19635	N	0.109590	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	8.963	0.35858	0.0:0.8231:0.0:0.1769	.	.	.	.	X	1866	.	ENSP00000394770:S1866X	S	+	2	0	CMYA5	79065941	0.285000	0.24296	0.742000	0.31022	0.131000	0.20780	1.358000	0.34102	1.293000	0.44690	-0.143000	0.13931	TCA	CMYA5	-	NULL	ENSG00000164309		0.358	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	58	0	C	NM_153610		79030185	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	nonsense	9.62	47	5	SNP	0.567	G
CMYA5	202333	genome.wustl.edu	37	5	79031154	79031154	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:79031154C>G	ENST00000446378.2	+	2	6597	c.6566C>G	c.(6565-6567)tCg>tGg	p.S2189W		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2189					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTTTTTGGATCGAGCACTCCA	0.438																																																	0													73.0	72.0	73.0					5																	79031154		1875	4123	5998	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6566C>G	5.37:g.79031154C>G	ENSP00000394770:p.Ser2189Trp		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.S2189W	ENST00000446378.2	37	c.6566	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422740	0.62733	.	.	ENSG00000164309	ENST00000446378	T	0.22945	1.93	6.16	5.25	0.73442	.	0.166603	0.29028	N	0.013374	T	0.43277	0.1240	L	0.46157	1.445	0.40375	D	0.979385	D	0.89917	1.0	D	0.85130	0.997	T	0.23762	-1.0179	10	0.87932	D	0	.	12.7147	0.57109	0.0:0.8355:0.1645:0.0	.	2189	Q8N3K9	CMYA5_HUMAN	W	2189	ENSP00000394770:S2189W	ENSP00000394770:S2189W	S	+	2	0	CMYA5	79066910	0.992000	0.36948	1.000000	0.80357	0.952000	0.60782	1.551000	0.36233	2.937000	0.99478	0.650000	0.86243	TCG	CMYA5	-	NULL	ENSG00000164309		0.438	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	44	0	C	NM_153610		79031154	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	missense	18.64	48	11	SNP	0.999	G
CNOT8	9337	genome.wustl.edu	37	5	154244791	154244791	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:154244791G>T	ENST00000517876.1	+	4	633	c.157G>T	c.(157-159)Gaa>Taa	p.E53*	CNOT8_ENST00000403027.2_Nonsense_Mutation_p.E53*|CNOT8_ENST00000521583.1_5'UTR|CNOT8_ENST00000524105.1_5'UTR|CNOT8_ENST00000520671.1_5'UTR|CNOT8_ENST00000521402.1_3'UTR|CNOT8_ENST00000519404.1_Nonsense_Mutation_p.E53*|CNOT8_ENST00000523698.1_Intron|CNOT8_ENST00000285896.6_Nonsense_Mutation_p.E53*|CNOT8_ENST00000521450.1_Intron			Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8	53					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|negative regulation of cell proliferation (GO:0008285)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ACCAATTGGTGAATTTCGTAG	0.413																																					NSCLC(140;1804 1895 27149 29895 35312)												0													189.0	189.0	189.0					5																	154244791		2203	4300	6503	SO:0001587	stop_gained	0			AF053318	CCDS4329.1, CCDS75361.1	5q31-q33	2008-07-18			ENSG00000155508	ENSG00000155508			9207	protein-coding gene	gene with protein product	"""PGK promoter directed over production"""	603731		POP2		10036195, 10637334	Standard	XM_005268527		Approved	CAF1, hCAF1, CALIF	uc003lvw.3	Q9UFF9	OTTHUMG00000130192	ENST00000517876.1:c.157G>T	5.37:g.154244791G>T	ENSP00000430493:p.Glu53*		B0AZS3|B2RAR8|B7Z8R1|D3DQI8|O95709|Q7Z521|Q9H6Y1	Nonsense_Mutation	SNP	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.E53*	ENST00000517876.1	37	c.157	CCDS4329.1	5	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914337	0.92178	.	.	ENSG00000155508	ENST00000517876;ENST00000520472;ENST00000519211;ENST00000522458;ENST00000403027;ENST00000517568;ENST00000285896;ENST00000542339;ENST00000519430;ENST00000518028;ENST00000519404;ENST00000519394;ENST00000518775	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-16.0039	18.5463	0.91047	0.0:0.0:1.0:0.0	.	.	.	.	X	53;53;53;53;53;53;53;30;53;53;53;53;53	.	ENSP00000285896:E53X	E	+	1	0	CNOT8	154224984	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.394000	0.97261	2.366000	0.80165	0.557000	0.71058	GAA	CNOT8	-	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	ENSG00000155508		0.413	CNOT8-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CNOT8	HGNC	protein_coding	OTTHUMT00000377449.1	-	0.00	105	0	G	NM_004779		154244791	+1	tier1	-	no_errors	ENST00000285896	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	1.000	T
CNTN4	152330	genome.wustl.edu	37	3	3081620	3081620	+	Intron	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:3081620G>T	ENST00000397461.1	+	19	2547				CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000418658.1_Intron|CNTN4_ENST00000397459.2_Intron|CNTN4_ENST00000358480.3_Intron|CNTN4_ENST00000427331.1_Intron|CNTN4_ENST00000448906.2_Intron	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4						axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		AAGATGGGTGGAGAAGGATGT	0.383																																																	0																																										SO:0001627	intron_variant	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2164-101G>T	3.37:g.3081620G>T			B2RAX3|Q8IX14|Q8TC35	RNA	SNP	-	NULL	ENST00000397461.1	37	NULL	CCDS43041.1	3																																																																																			CNTN4-AS1	-	-	ENSG00000237990		0.383	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4-AS1	HGNC	protein_coding	OTTHUMT00000239236.2	-	0.00	20	0	G			3081620	-1	tier1	-	no_errors	ENST00000442749	ensembl	human	known	74_37	rna	44.44	10	8	SNP	0.009	T
CNTNAP2	26047	genome.wustl.edu	37	7	147183046	147183046	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:147183046G>A	ENST00000361727.3	+	11	2206	c.1690G>A	c.(1690-1692)Gag>Aag	p.E564K		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	564	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAATCACTGTGAGCATGGTGG	0.468										HNSCC(39;0.1)																																							0													189.0	170.0	177.0					7																	147183046		2203	4300	6503	SO:0001583	missense	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1690G>A	7.37:g.147183046G>A	ENSP00000354778:p.Glu564Lys		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E564K	ENST00000361727.3	37	c.1690	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.282336	0.95489	.	.	ENSG00000174469	ENST00000361727	D	0.91996	-2.95	5.88	5.88	0.94601	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000004	D	0.94424	0.8206	L	0.41961	1.31	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.93494	0.6838	10	0.41790	T	0.15	.	18.8161	0.92077	0.0:0.0:1.0:0.0	.	564	Q9UHC6	CNTP2_HUMAN	K	564	ENSP00000354778:E564K	ENSP00000354778:E564K	E	+	1	0	CNTNAP2	146813979	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.728000	0.98792	2.779000	0.95612	0.650000	0.86243	GAG	CNTNAP2	-	pfam_EG-like_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000174469		0.468	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	-	0.00	74	0	G			147183046	+1	tier1	-	no_errors	ENST00000361727	ensembl	human	known	74_37	missense	10.45	60	7	SNP	1.000	A
COL4A1	1282	genome.wustl.edu	37	13	110866296	110866296	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr13:110866296G>T	ENST00000375820.4	-	3	332	c.211C>A	c.(211-213)Cca>Aca	p.P71T	COL4A1_ENST00000543140.1_Missense_Mutation_p.P71T	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	71					axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GGTCCCTGTGGCCCCTCAGGT	0.537																																																	0													214.0	188.0	197.0					13																	110866296		2203	4300	6503	SO:0001583	missense	0			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.211C>A	13.37:g.110866296G>T	ENSP00000364979:p.Pro71Thr		A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P71T	ENST00000375820.4	37	c.211	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739698	0.69304	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	D;D	0.93076	-3.16;-3.16	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.94069	0.8099	L	0.37630	1.12	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74348	0.983;0.979	D	0.91271	0.5044	10	0.11182	T	0.66	.	18.3571	0.90361	0.0:0.0:1.0:0.0	.	71;71	F5H5K0;P02462	.;CO4A1_HUMAN	T	71	ENSP00000364979:P71T;ENSP00000443348:P71T	ENSP00000364973:P71T	P	-	1	0	COL4A1	109664297	1.000000	0.71417	0.993000	0.49108	0.950000	0.60333	8.367000	0.90113	2.330000	0.79161	0.643000	0.83706	CCA	COL4A1	-	pfam_Collagen	ENSG00000187498		0.537	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	HGNC	protein_coding	OTTHUMT00000045759.3	-	0.00	69	0	G			110866296	-1	tier1	-	no_errors	ENST00000375820	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
COLGALT1	79709	genome.wustl.edu	37	19	17690382	17690382	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:17690382G>T	ENST00000252599.4	+	10	1478	c.1358G>T	c.(1357-1359)cGg>cTg	p.R453L		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	453					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										AACCTCATGCGGGATGTGGAG	0.597																																																	0													127.0	117.0	121.0					19																	17690382		2203	4300	6503	SO:0001583	missense	0			AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1358G>T	19.37:g.17690382G>T	ENSP00000252599:p.Arg453Leu		Q8NC64	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.R453L	ENST00000252599.4	37	c.1358	CCDS12363.1	19	.	.	.	.	.	.	.	.	.	.	G	7.372	0.627026	0.14257	.	.	ENSG00000130309	ENST00000379714;ENST00000252599	T	0.77489	-1.1	5.12	-4.61	0.03380	.	1.452430	0.03960	N	0.289833	T	0.59542	0.2201	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.13407	0.006;0.009	T	0.50215	-0.8854	10	0.41790	T	0.15	-6.5012	11.8307	0.52293	0.7672:0.0:0.2328:0.0	.	181;453	E9PC06;Q8NBJ5	.;GT251_HUMAN	L	181;453	ENSP00000252599:R453L	ENSP00000252599:R453L	R	+	2	0	GLT25D1	17551382	0.000000	0.05858	0.561000	0.28357	0.011000	0.07611	-0.186000	0.09670	-0.565000	0.06061	0.313000	0.20887	CGG	COLGALT1	-	pfam_Glyco_trans_25	ENSG00000130309		0.597	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT1	HGNC	protein_coding	OTTHUMT00000464216.1		0.00	50	0	G	NM_024656		17690382	+1			no_errors	ENST00000252599	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.004	T
CPEB3	22849	genome.wustl.edu	37	10	93999920	93999920	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:93999920delG	ENST00000265997.4	-	2	360	c.188delC	c.(187-189)ccgfs	p.P63fs	CPEB3_ENST00000412050.4_Frame_Shift_Del_p.P63fs	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	63	Pro-rich.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				GTTGGGGGCCGGGGGGGCAGC	0.692																																																	0									,	30,23,3843		2,0,26,1,21,1898	5.0	6.0	6.0		,	2.0	1.0	10		6	36,65,7467		4,0,28,6,53,3693	no	codingComplex,codingComplex	CPEB3	NM_014912.4,NM_001178137.1	,	6,0,54,7,74,5591	A1A1,A1A2,A1R,A2A2,A2R,RR		1.3346,1.3604,1.3433	,	,	93999920	66,88,11310	2112	4127	6239	SO:0001589	frameshift_variant	0			AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.188delC	10.37:g.93999920delG	ENSP00000265997:p.Pro63fs		Q5T389|Q9NQJ7|Q9Y2E9	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P63fs	ENST00000265997.4	37	c.188	CCDS31246.1	10																																																																																			CPEB3	-	NULL	ENSG00000107864		0.692	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPEB3	HGNC	protein_coding	OTTHUMT00000049387.2		0.00	35	0	G	NM_014912		93999920	-1	tier1		no_errors	ENST00000265997	ensembl	human	known	74_37	frame_shift_del	5.88	32	2	DEL	1.000	-
CPXM1	56265	genome.wustl.edu	37	20	2777869	2777869	+	Silent	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:2777869G>T	ENST00000380605.2	-	6	865	c.801C>A	c.(799-801)ctC>ctA	p.L267L		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	267	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TCTCTGCCCGGAGGCAAGGCG	0.662																																																	0													23.0	26.0	25.0					20																	2777869		2200	4297	6497	SO:0001819	synonymous_variant	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.801C>A	20.37:g.2777869G>T			Q6P4G8|Q6UW65|Q9NUB5	Silent	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.L267	ENST00000380605.2	37	c.801	CCDS13033.1	20																																																																																			CPXM1	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000088882		0.662	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	-	0.00	61	0	G	NM_019609		2777869	-1	tier1	-	no_errors	ENST00000380605	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	T
CRIM1	51232	genome.wustl.edu	37	2	36668613	36668613	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:36668613G>T	ENST00000280527.2	+	3	1085	c.718G>T	c.(718-720)Gag>Tag	p.E240*		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	240					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GAAGCCGGGAGAGTGCTGTGA	0.577																																																	0													81.0	83.0	82.0					2																	36668613		2203	4300	6503	SO:0001587	stop_gained	0			AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.718G>T	2.37:g.36668613G>T	ENSP00000280527:p.Glu240*		Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Nonsense_Mutation	SNP	pfam_VWF_C,pfam_Antistasin-like,superfamily_Hirudin/antistatin,smart_IGFBP-like,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	p.E240*	ENST00000280527.2	37	c.718	CCDS1783.1	2	.	.	.	.	.	.	.	.	.	.	G	41	8.617968	0.98888	.	.	ENSG00000150938	ENST00000280527;ENST00000426856	.	.	.	4.75	4.75	0.60458	.	0.177627	0.48286	D	0.000184	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-10.9729	16.944	0.86226	0.0:0.0:1.0:0.0	.	.	.	.	X	240;132	.	ENSP00000280527:E240X	E	+	1	0	CRIM1	36522117	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.629000	0.67798	2.468000	0.83385	0.555000	0.69702	GAG	CRIM1	-	NULL	ENSG00000150938		0.577	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIM1	HGNC	protein_coding	OTTHUMT00000216878.2	-	0.00	65	0	G	NM_016441		36668613	+1	tier1	-	no_errors	ENST00000280527	ensembl	human	known	74_37	nonsense	5.71	66	4	SNP	1.000	T
CRY2	1408	genome.wustl.edu	37	11	45869207	45869207	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:45869207C>T	ENST00000443527.2	+	1	251	c.229C>T	c.(229-231)Ctc>Ttc	p.L77F	CRY2_ENST00000417225.2_Intron|CRY2_ENST00000473199.1_3'UTR	NM_021117.3	NP_066940.2	Q49AN0	CRY2_HUMAN	cryptochrome circadian clock 2	56	Photolyase/cryptochrome alpha/beta.				blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|glucose homeostasis (GO:0042593)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of sodium-dependent phosphate transport (GO:2000118)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|FAD binding (GO:0071949)|phosphatase binding (GO:0019902)|single-stranded DNA binding (GO:0003697)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(2)	15						CGTTTACATTCTCGACCCGTG	0.697																																					Esophageal Squamous(106;91 1499 8126 12599 39610)												0													12.0	12.0	12.0					11																	45869207		2181	4272	6453	SO:0001583	missense	0			AB014558	CCDS7915.2, CCDS44576.1	11p11.2	2014-01-17	2014-01-17		ENSG00000121671	ENSG00000121671			2385	protein-coding gene	gene with protein product		603732	"""cryptochrome 2 (photolyase-like)"""			8909283	Standard	NM_021117		Approved		uc010rgn.2	Q49AN0	OTTHUMG00000153225	ENST00000443527.2:c.229C>T	11.37:g.45869207C>T	ENSP00000406751:p.Leu77Phe		B4DH32|B4DZD6|O75148|Q8IV71	Missense_Mutation	SNP	pfam_Photolyase_FAD-bd/Cryptochr_C,pfam_DNA_photolyase_N,superfamily_Photolyase_FAD-bd/Cryptochr_C,superfamily_DNA_photolyase_N	p.L77F	ENST00000443527.2	37	c.229	CCDS7915.2	11	.	.	.	.	.	.	.	.	.	.	C	27.2	4.806601	0.90623	.	.	ENSG00000121671	ENST00000443527	.	.	.	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000001	T	0.63757	0.2538	M	0.63208	1.945	0.50039	D	0.999848	P	0.36909	0.573	B	0.40565	0.333	T	0.59894	-0.7368	9	0.26408	T	0.33	-31.5246	16.9381	0.86208	0.0:1.0:0.0:0.0	.	77	B4DZD6	.	F	77	.	ENSP00000406751:L77F	L	+	1	0	CRY2	45825783	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.310000	0.59141	2.813000	0.96785	0.561000	0.74099	CTC	CRY2	-	pfam_DNA_photolyase_N,superfamily_DNA_photolyase_N	ENSG00000121671		0.697	CRY2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CRY2	HGNC	protein_coding	OTTHUMT00000330235.2	-	0.00	8	0	C	NM_021117		45869207	+1	tier1	-	no_errors	ENST00000443527	ensembl	human	known	74_37	missense	40.00	6	4	SNP	1.000	T
CSK	1445	genome.wustl.edu	37	15	75090969	75090969	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:75090969C>A	ENST00000220003.9	+	3	758	c.29C>A	c.(28-30)tCc>tAc	p.S10Y	CSK_ENST00000439220.2_Missense_Mutation_p.S10Y|CSK_ENST00000567571.1_Missense_Mutation_p.S10Y|CSK_ENST00000309470.9_Missense_Mutation_p.S10Y	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	10	Interaction with PTPN8. {ECO:0000250}.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						GCCTGGCCATCCGGTACAGAA	0.642																																																	0													45.0	42.0	43.0					15																	75090969		2197	4296	6493	SO:0001583	missense	0				CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.29C>A	15.37:g.75090969C>A	ENSP00000220003:p.Ser10Tyr		Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.S10Y	ENST00000220003.9	37	c.29	CCDS10269.1	15	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205850	0.79127	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	T;T;T	0.76316	-1.01;-1.01;-1.01	4.71	4.71	0.59529	Src homology-3 domain (2);	0.516023	0.21522	N	0.073191	T	0.71417	0.3337	L	0.49571	1.57	0.43338	D	0.99538	P	0.49635	0.926	B	0.36030	0.216	T	0.77819	-0.2446	10	0.59425	D	0.04	-18.0388	17.4445	0.87574	0.0:1.0:0.0:0.0	.	10	P41240	CSK_HUMAN	Y	10	ENSP00000220003:S10Y;ENSP00000414764:S10Y;ENSP00000438808:S10Y	ENSP00000220003:S10Y	S	+	2	0	CSK	72878022	0.600000	0.26899	0.999000	0.59377	0.972000	0.66771	5.515000	0.67049	2.458000	0.83093	0.561000	0.74099	TCC	CSK	-	superfamily_SH3_domain,pfscan_SH3_domain	ENSG00000103653		0.642	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSK	HGNC	protein_coding	OTTHUMT00000286398.2	-	0.00	95	0	C	NM_004383		75090969	+1	tier1	-	no_errors	ENST00000220003	ensembl	human	known	74_37	missense	13.43	58	9	SNP	0.985	A
CTNNBL1	56259	genome.wustl.edu	37	20	36396439	36396439	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:36396439G>T	ENST00000361383.6	+	7	860	c.743G>T	c.(742-744)aGg>aTg	p.R248M	CTNNBL1_ENST00000405275.2_Missense_Mutation_p.R221M|CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000373473.1_Missense_Mutation_p.R61M	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	248					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CTGTTGAAGAGGCTGAAGGTG	0.532																																					Ovarian(184;582 2038 3273 4106 42608)												0													105.0	104.0	104.0					20																	36396439		2203	4300	6503	SO:0001583	missense	0			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.743G>T	20.37:g.36396439G>T	ENSP00000355050:p.Arg248Met		B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	pfam_CTNNBL1_N,superfamily_ARM-type_fold	p.R221M	ENST00000361383.6	37	c.662	CCDS13298.1	20	.	.	.	.	.	.	.	.	.	.	G	31	5.071193	0.93950	.	.	ENSG00000132792	ENST00000361383;ENST00000405275;ENST00000373473	T;T;T	0.48836	0.81;0.81;0.8	5.8	5.8	0.92144	Armadillo-like helical (1);Armadillo-type fold (1);	0.045387	0.85682	D	0.000000	T	0.75925	0.3916	M	0.89658	3.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.987;0.989	T	0.80353	-0.1418	10	0.87932	D	0	-19.3632	19.0426	0.93006	0.0:0.0:1.0:0.0	.	248;61	Q8WYA6;Q8WYA6-2	CTBL1_HUMAN;.	M	248;221;61	ENSP00000355050:R248M;ENSP00000384355:R221M;ENSP00000362572:R61M	ENSP00000355050:R248M	R	+	2	0	CTNNBL1	35829853	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.803000	0.99136	2.748000	0.94277	0.655000	0.94253	AGG	CTNNBL1	-	superfamily_ARM-type_fold	ENSG00000132792		0.532	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CTNNBL1	HGNC	protein_coding	OTTHUMT00000079125.1	-	0.00	66	0	G	NM_030877		36396439	+1	tier1	-	no_errors	ENST00000405275	ensembl	human	known	74_37	missense	6.49	72	5	SNP	1.000	T
CYP2F1	1572	genome.wustl.edu	37	19	41628000	41628000	+	Missense_Mutation	SNP	C	C	T	rs561045811		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:41628000C>T	ENST00000331105.2	+	6	856	c.784C>T	c.(784-786)Cgg>Tgg	p.R262W		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	262					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						CAGATCTCCCCGGGACTTCAT	0.582													N|||	1	0.000199681	0.0	0.0	5008	,	,		13123	0.001		0.0	False		,,,				2504	0.0																0													45.0	44.0	44.0					19																	41628000		2192	4288	6480	SO:0001583	missense	0			J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.784C>T	19.37:g.41628000C>T	ENSP00000333534:p.Arg262Trp		A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_CYP2_fam,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.R262W	ENST00000331105.2	37	c.784	CCDS12572.1	19	.	.	.	.	.	.	.	.	.	.	N	13.00	2.107448	0.37145	.	.	ENSG00000197446	ENST00000331105	T	0.71461	-0.57	3.21	2.06	0.26882	.	0.184114	0.43579	U	0.000541	D	0.85699	0.5757	H	0.97540	4.025	0.30040	N	0.812726	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.77557	0.99;0.955;0.742	T	0.79339	-0.1844	10	0.87932	D	0	.	2.8258	0.05485	0.2786:0.556:0.0:0.1654	.	48;262;262	B4DL83;Q32MN5;P24903	.;.;CP2F1_HUMAN	W	262	ENSP00000333534:R262W	ENSP00000333534:R262W	R	+	1	2	CYP2F1	46319840	0.268000	0.24133	0.984000	0.44739	0.382000	0.30200	0.832000	0.27490	1.641000	0.50575	0.398000	0.26397	CGG	CYP2F1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197446		0.582	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2F1	HGNC	protein_coding	OTTHUMT00000394527.2		0.00	37	0	C			41628000	+1			no_errors	ENST00000331105	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.861	T
DCAF12L2	340578	genome.wustl.edu	37	X	125298882	125298882	+	Silent	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chrX:125298882C>A	ENST00000360028.2	-	1	1052	c.1026G>T	c.(1024-1026)cgG>cgT	p.R342R	DCAF12L2_ENST00000538699.1_Silent_p.R342R			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	342										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						AGCACAGGGGCCGGATGTTCT	0.612																																																	0													50.0	55.0	53.0					X																	125298882		2203	4300	6503	SO:0001819	synonymous_variant	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1026G>T	X.37:g.125298882C>A			B2RN42	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R342	ENST00000360028.2	37	c.1026	CCDS43991.1	X																																																																																			DCAF12L2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198354		0.612	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	-	0.00	34	0	C	NM_001013628		125298882	-1	tier1	-	no_errors	ENST00000360028	ensembl	human	known	74_37	silent	18.18	36	8	SNP	0.833	A
DCDC1	341019	genome.wustl.edu	37	11	30902833	30902833	+	Missense_Mutation	SNP	C	C	G	rs375380625	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:30902833C>G	ENST00000597505.1	-	35	5095	c.5096G>C	c.(5095-5097)cGt>cCt	p.R1699P				P59894	DCDC1_HUMAN	doublecortin domain containing 1	205					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CATTTTGAGACGAGAGGAGCA	0.493																																																	0													105.0	105.0	105.0					11																	30902833		2037	4197	6234	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.5096G>C	11.37:g.30902833C>G	ENSP00000472625:p.Arg1699Pro		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Doublecortin_dom,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.R1699P	ENST00000597505.1	37	c.5096		11																																																																																			DCDC1	-	smart_Doublecortin_dom	ENSG00000170959		0.493	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	66	0	C	NM_181807		30902833	-1	tier1	-	no_errors	ENST00000597505	ensembl	human	putative	74_37	missense	15.07	62	11	SNP	0.659	G
DCHS2	54798	genome.wustl.edu	37	4	155180876	155180876	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:155180876C>G	ENST00000357232.4	-	20	5244	c.5245G>C	c.(5245-5247)Gat>Cat	p.D1749H		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1749	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ACTTCAAAATCAAGAAACTTG	0.323																																																	0													83.0	78.0	79.0					4																	155180876		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5245G>C	4.37:g.155180876C>G	ENSP00000349768:p.Asp1749His		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D1749H	ENST00000357232.4	37	c.5245	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447433	0.84101	.	.	ENSG00000197410	ENST00000357232	T	0.65364	-0.15	5.52	5.52	0.82312	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000001	D	0.87176	0.6112	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91260	0.5036	10	0.87932	D	0	.	18.5738	0.91147	0.0:1.0:0.0:0.0	.	1749	Q6V1P9	PCD23_HUMAN	H	1749	ENSP00000349768:D1749H	ENSP00000349768:D1749H	D	-	1	0	DCHS2	155400326	1.000000	0.71417	0.995000	0.50966	0.986000	0.74619	5.919000	0.70005	2.760000	0.94817	0.655000	0.94253	GAT	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.323	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2		0.00	59	0	C	NM_001142552		155180876	-1			no_errors	ENST00000357232	ensembl	human	known	74_37	missense	8.20	56	5	SNP	1.000	G
DMRT1	1761	genome.wustl.edu	37	9	916804	916804	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:916804C>A	ENST00000382276.3	+	4	1013	c.864C>A	c.(862-864)taC>taA	p.Y288*	DMRT1_ENST00000569227.1_Nonsense_Mutation_p.Y130*	NM_021951.2	NP_068770.2	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor 1	288					cell morphogenesis (GO:0000902)|germ cell migration (GO:0008354)|intracellular signal transduction (GO:0035556)|male germ cell proliferation (GO:0002176)|male sex determination (GO:0030238)|male sex differentiation (GO:0046661)|negative regulation of meiosis (GO:0045835)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oocyte development (GO:0048599)|positive regulation of male gonad development (GO:2000020)|positive regulation of meiosis I (GO:0060903)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of nodal signaling pathway (GO:1900107)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(10)|ovary(1)	13		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		GCTCCCAGTACAGGATGCATT	0.488																																																	0													157.0	135.0	142.0					9																	916804		2203	4300	6503	SO:0001587	stop_gained	0			AF130728	CCDS6442.1	9p24.3	2014-01-21			ENSG00000137090	ENSG00000137090			2934	protein-coding gene	gene with protein product	"""DM domain expressed in testis 1"""	602424				9490411, 10332030	Standard	XM_006716732		Approved	DMT1, CT154	uc003zgv.3	Q9Y5R6	OTTHUMG00000019435	ENST00000382276.3:c.864C>A	9.37:g.916804C>A	ENSP00000371711:p.Tyr288*		B2R913|Q6T1H8|Q6T1H9|Q8IW77	Nonsense_Mutation	SNP	pfam_DM_DNA-bd,pfam_DMRT1-like,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.Y288*	ENST00000382276.3	37	c.864	CCDS6442.1	9	.	.	.	.	.	.	.	.	.	.	C	37	6.591971	0.97688	.	.	ENSG00000137090	ENST00000382276	.	.	.	5.44	3.57	0.40892	.	0.158249	0.42682	D	0.000678	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.8383	0.46700	0.0:0.8462:0.0:0.1538	.	.	.	.	X	288	.	ENSP00000371711:Y288X	Y	+	3	2	DMRT1	906804	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.770000	0.38532	1.433000	0.47394	0.655000	0.94253	TAC	DMRT1	-	NULL	ENSG00000137090		0.488	DMRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT1	HGNC	protein_coding	OTTHUMT00000051489.2		0.00	52	0	C	NM_021951		916804	+1			no_errors	ENST00000382276	ensembl	human	known	74_37	nonsense	7.89	35	3	SNP	1.000	A
DNAH14	127602	genome.wustl.edu	37	1	225147937	225147937	+	Intron	DEL	A	A	-			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:225147937delA	ENST00000445597.2	+	6	748				DNAH14_ENST00000366850.3_Frame_Shift_Del_p.R100fs|DNAH14_ENST00000366848.1_Frame_Shift_Del_p.R100fs|DNAH14_ENST00000498360.1_3'UTR|DNAH14_ENST00000400952.3_Frame_Shift_Del_p.R100fs|DNAH14_ENST00000439375.2_Frame_Shift_Del_p.R100fs|DNAH14_ENST00000366849.1_Frame_Shift_Del_p.R100fs|DNAH14_ENST00000430092.1_Frame_Shift_Del_p.R100fs			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.D103fs*10(2)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AGTCAAGGAGAAAAAAGGATC	0.383																																																	2	Insertion - Frameshift(2)	large_intestine(2)											100.0	95.0	96.0					1																	225147937		1863	4101	5964	SO:0001627	intron_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.749-4244A>-	1.37:g.225147937delA			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Frame_Shift_Del	DEL	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.K102fs	ENST00000445597.2	37	c.300		1																																																																																			DNAH14	-	NULL	ENSG00000185842		0.383	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3		0.00	33	0	A	XM_059166		225147937	+1	tier1		no_errors	ENST00000430092	ensembl	human	known	74_37	frame_shift_del	6.90	27	2	DEL	0.001	-
DNAJA3	9093	genome.wustl.edu	37	16	4500469	4500469	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:4500469C>T	ENST00000262375.6	+	10	1387	c.1310C>T	c.(1309-1311)aCg>aTg	p.T437M	DNAJA3_ENST00000355296.4_Missense_Mutation_p.T437M|DNAJA3_ENST00000431375.2_Missense_Mutation_p.T284M	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	437					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						GTGGAGGGGACGGTGAACGGC	0.617																																																	0													46.0	37.0	40.0					16																	4500469		2197	4298	6495	SO:0001583	missense	0			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.1310C>T	16.37:g.4500469C>T	ENSP00000262375:p.Thr437Met		B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_DnaJ_C,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_domain,pfscan_DnaJ_domain,pfscan_HSP_DnaJ_Cys-rich_dom,prints_DnaJ_domain	p.T437M	ENST00000262375.6	37	c.1310	CCDS10515.1	16	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130611	0.77549	.	.	ENSG00000103423	ENST00000262375;ENST00000355296;ENST00000431375	T;T;T	0.65364	-0.15;-0.13;0.86	5.63	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.76190	0.3953	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.99;0.995	T	0.78430	-0.2207	10	0.87932	D	0	-13.0245	15.0791	0.72099	0.1419:0.8581:0.0:0.0	.	284;437;437	E7ES32;Q96EY1-2;Q96EY1	.;.;DNJA3_HUMAN	M	437;437;284	ENSP00000262375:T437M;ENSP00000347445:T437M;ENSP00000393970:T284M	ENSP00000262375:T437M	T	+	2	0	DNAJA3	4440470	1.000000	0.71417	0.975000	0.42487	0.582000	0.36321	7.629000	0.83207	2.659000	0.90383	0.561000	0.74099	ACG	DNAJA3	-	NULL	ENSG00000103423		0.617	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNAJA3	HGNC	protein_coding	OTTHUMT00000251633.1		0.00	71	0	C			4500469	+1			no_errors	ENST00000262375	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.999	T
DNM3	26052	genome.wustl.edu	37	1	171958093	171958093	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:171958093C>A	ENST00000355305.5	+	4	551	c.394C>A	c.(394-396)Cta>Ata	p.L132I	DNM3_ENST00000367731.1_Missense_Mutation_p.L132I|DNM3_ENST00000520906.1_Missense_Mutation_p.L132I|DNM3_ENST00000358155.4_Missense_Mutation_p.L132I|DNM3_ENST00000367733.2_Missense_Mutation_p.L132I			Q9UQ16	DYN3_HUMAN	dynamin 3	132	Dynamin-type G.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						AGTGTTAAATCTAACCCTTAT	0.383																																																	0													41.0	39.0	40.0					1																	171958093		1891	4118	6009	SO:0001583	missense	0			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.394C>A	1.37:g.171958093C>A	ENSP00000347457:p.Leu132Ile		A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin_SF	p.L132I	ENST00000355305.5	37	c.394		1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440866	0.83993	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	D;D;D;D;D;D	0.97303	-4.33;-4.33;-4.33;-4.33;-4.33;-4.33	5.9	3.99	0.46301	.	0.069005	0.64402	D	0.000012	D	0.98093	0.9371	M	0.90145	3.09	0.58432	D	0.999996	D;D;D;D	0.76494	0.999;0.992;0.984;0.994	D;D;D;D	0.97110	1.0;0.997;0.995;0.997	D	0.97784	1.0234	10	0.49607	T	0.09	.	10.9072	0.47086	0.0:0.8427:0.0:0.1573	.	132;132;132;132	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	I	132;132;132;132;132;132;22	ENSP00000350876:L132I;ENSP00000356707:L132I;ENSP00000347457:L132I;ENSP00000356705:L132I;ENSP00000429701:L132I;ENSP00000429416:L22I	ENSP00000347457:L132I	L	+	1	2	DNM3	170224716	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.679000	0.46909	0.788000	0.33755	0.650000	0.86243	CTA	DNM3	-	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	ENSG00000197959		0.383	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	HGNC	protein_coding	OTTHUMT00000084531.1	-	0.00	52	0	C	NM_015569		171958093	+1	tier1	-	no_errors	ENST00000358155	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	A
DOCK10	55619	genome.wustl.edu	37	2	225751206	225751206	+	Silent	SNP	C	C	T	rs561976782		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:225751206C>T	ENST00000258390.7	-	5	526	c.459G>A	c.(457-459)gaG>gaA	p.E153E	DOCK10_ENST00000409592.3_Silent_p.E147E	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	153					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CATGGTCAATCTCAAAGGAAT	0.318																																																	0													104.0	99.0	100.0					2																	225751206		1854	4079	5933	SO:0001819	synonymous_variant	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.459G>A	2.37:g.225751206C>T			B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E153	ENST00000258390.7	37	c.459	CCDS46528.1	2																																																																																			DOCK10	-	pfam_DOCK_C/D_N	ENSG00000135905		0.318	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	-	0.00	48	0	C			225751206	-1	tier1	-	no_errors	ENST00000258390	ensembl	human	known	74_37	silent	26.92	19	7	SNP	1.000	T
DSEL	92126	genome.wustl.edu	37	18	65180960	65180960	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr18:65180960G>A	ENST00000310045.7	-	2	2389	c.916C>T	c.(916-918)Cgc>Tgc	p.R306C	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	296					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TTAAAATGGCGCTGGGCCAGA	0.398																																																	0													72.0	77.0	75.0					18																	65180960		2203	4300	6503	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.916C>T	18.37:g.65180960G>A	ENSP00000310565:p.Arg306Cys		Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.R306C	ENST00000310045.7	37	c.916	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474135	0.63737	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.27720	1.65	4.62	3.75	0.43078	.	0.000000	0.85682	U	0.000000	T	0.36248	0.0960	M	0.78049	2.395	0.80722	D	1	B	0.13594	0.008	B	0.04013	0.001	T	0.34625	-0.9821	10	0.87932	D	0	.	12.9458	0.58371	0.0796:0.0:0.9204:0.0	.	296	Q8IZU8	DSEL_HUMAN	C	306;296	ENSP00000310565:R306C	ENSP00000310565:R306C	R	-	1	0	DSEL	63331940	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.761000	0.85260	1.093000	0.41377	0.462000	0.41574	CGC	DSEL	-	superfamily_Chondroitin_lyas	ENSG00000171451		0.398	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	-	0.00	62	0	G	NM_032160		65180960	-1	tier1	-	no_errors	ENST00000310045	ensembl	human	known	74_37	missense	23.53	65	20	SNP	1.000	A
DST	667	genome.wustl.edu	37	6	56417401	56417401	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:56417401G>A	ENST00000361203.3	-	57	15563	c.15556C>T	c.(15556-15558)Cag>Tag	p.Q5186*	DST_ENST00000370788.2_Nonsense_Mutation_p.Q3100*|DST_ENST00000312431.6_3'UTR|DST_ENST00000446842.2_Nonsense_Mutation_p.Q4862*|DST_ENST00000421834.2_Nonsense_Mutation_p.Q3100*|DST_ENST00000370754.5_Nonsense_Mutation_p.Q5366*|DST_ENST00000244364.6_Nonsense_Mutation_p.Q2774*|DST_ENST00000370769.4_Nonsense_Mutation_p.Q5188*			Q03001	DYST_HUMAN	dystonin	5186					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCTGCGAACTGAGAAAACATT	0.403																																																	0													59.0	55.0	56.0					6																	56417401		1870	4105	5975	SO:0001587	stop_gained	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.15556C>T	6.37:g.56417401G>A	ENSP00000354508:p.Gln5186*		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q5366*	ENST00000361203.3	37	c.16096		6	.	.	.	.	.	.	.	.	.	.	G	55	25.073061	0.99963	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.	.	.	6.17	6.17	0.99709	.	0.124326	0.36703	N	0.002454	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	2774;5366;5188;3100;4862;3100;5186	.	ENSP00000244364:Q2774X	Q	-	1	0	DST	56525360	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.747000	0.55134	2.941000	0.99782	0.655000	0.94253	CAG	DST	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.403	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3		0.00	17	0	G	NM_001723		56417401	-1			no_errors	ENST00000370754	ensembl	human	known	74_37	nonsense	11.76	15	2	SNP	1.000	A
DUSP4	1846	genome.wustl.edu	37	8	29195866	29195866	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:29195866G>A	ENST00000240100.2	-	3	1121	c.732C>T	c.(730-732)tgC>tgT	p.C244C	DUSP4_ENST00000240101.2_Silent_p.C153C	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	244	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		CCACTGGGATGCACTTGTACT	0.557																																																	0													193.0	156.0	168.0					8																	29195866		2203	4300	6503	SO:0001819	synonymous_variant	0			U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.732C>T	8.37:g.29195866G>A			B2RBU5|D3DSU4|G5E930|Q13524	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.C244	ENST00000240100.2	37	c.732	CCDS6072.1	8																																																																																			DUSP4	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	ENSG00000120875		0.557	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP4	HGNC	protein_coding	OTTHUMT00000257249.1		0.00	65	0	G	NM_001394		29195866	-1			no_errors	ENST00000240100	ensembl	human	known	74_37	silent	5.88	48	3	SNP	1.000	A
EGFLAM	133584	genome.wustl.edu	37	5	38338853	38338853	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:38338853C>T	ENST00000354891.3	+	3	607	c.261C>T	c.(259-261)agC>agT	p.S87S	EGFLAM_ENST00000322350.5_Silent_p.S87S	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	87	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGTTGCACAGCGTGCCTCTCA	0.557																																					Colon(62;485 1295 3347 17454)												0													90.0	83.0	85.0					5																	38338853		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.261C>T	5.37:g.38338853C>T			A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.S87	ENST00000354891.3	37	c.261	CCDS56363.1	5																																																																																			EGFLAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000164318		0.557	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	-	0.00	59	0	C	NM_152403		38338853	+1	tier1	-	no_errors	ENST00000354891	ensembl	human	known	74_37	silent	29.17	34	14	SNP	0.004	T
EIF6	3692	genome.wustl.edu	37	20	33868521	33868521	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:33868521G>A	ENST00000374450.3	-	4	569	c.305C>T	c.(304-306)tCa>tTa	p.S102L	RP4-614O4.11_ENST00000444717.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|EIF6_ENST00000374436.3_Missense_Mutation_p.S102L|MMP24-AS1_ENST00000438751.1_RNA|MMP24-AS1_ENST00000433764.1_RNA|MMP24-AS1_ENST00000435366.1_RNA|MMP24-AS1_ENST00000424358.1_RNA|MMP24-AS1_ENST00000455178.1_RNA|EDEM2_ENST00000540582.1_5'Flank|MMP24-AS1_ENST00000454184.1_RNA|EIF6_ENST00000374443.3_Intron|EIF6_ENST00000462894.1_Intron|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000456790.1_RNA	NM_002212.3	NP_002203.1			eukaryotic translation initiation factor 6											central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GCCCAAGGCTGAGAGCCGCTC	0.592																																																	0													180.0	136.0	151.0					20																	33868521		2203	4300	6503	SO:0001583	missense	0			Y11435	CCDS13249.1, CCDS13250.1	20q11.2	2008-01-18	2007-07-27	2007-07-27	ENSG00000242372	ENSG00000242372			6159	protein-coding gene	gene with protein product		602912	"""integrin beta 4 binding protein"""	EIF3A, ITGB4BP		9374518, 9740680	Standard	NM_181468		Approved	p27BBP, b(2)gcn	uc002xbz.2	P56537	OTTHUMG00000032328	ENST00000374450.3:c.305C>T	20.37:g.33868521G>A	ENSP00000363574:p.Ser102Leu			Nonsense_Mutation	SNP	NULL	p.Q142*	ENST00000374450.3	37	c.424	CCDS13249.1	20	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397789	0.83120	.	.	ENSG00000242372	ENST00000374436;ENST00000374450;ENST00000456600	.	.	.	4.75	4.75	0.60458	.	0.058123	0.64402	D	0.000001	D	0.90487	0.7020	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94314	0.7548	9	0.87932	D	0	-12.7019	17.1516	0.86779	0.0:0.0:1.0:0.0	.	102	P56537	IF6_HUMAN	L	102	.	ENSP00000363559:S102L	S	-	2	0	EIF6	33331935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.451000	0.80668	2.387000	0.81309	0.555000	0.69702	TCA	EIF6	-	NULL	ENSG00000242372		0.592	EIF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF6	HGNC	protein_coding	OTTHUMT00000078848.3	-	0.00	65	0	G	NM_002212		33868521	-1	tier1	-	no_errors	ENST00000415116	ensembl	human	known	74_37	nonsense	13.33	52	8	SNP	1.000	A
EML1	2009	genome.wustl.edu	37	14	100406345	100406345	+	Missense_Mutation	SNP	G	G	T	rs369564518		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:100406345G>T	ENST00000262233.6	+	22	2483	c.2344G>T	c.(2344-2346)Ggg>Tgg	p.G782W	EML1_ENST00000327921.9_Missense_Mutation_p.G770W|EML1_ENST00000334192.4_Missense_Mutation_p.G801W	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	782	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				CATCTACGGCGGGCACAGCAG	0.542																																																	0													109.0	88.0	95.0					14																	100406345		2203	4300	6503	SO:0001583	missense	0			AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.2344G>T	14.37:g.100406345G>T	ENSP00000262233:p.Gly782Trp		Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G801W	ENST00000262233.6	37	c.2401	CCDS32155.1	14	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124082	0.77436	.	.	ENSG00000066629	ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138	T;T;T	0.70869	-0.52;-0.52;-0.52	4.71	4.71	0.59529	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.89986	0.6874	H	0.97682	4.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93923	0.7207	10	0.87932	D	0	-18.0684	17.6632	0.88198	0.0:0.0:1.0:0.0	.	770;782;801	F8W717;O00423;O00423-3	.;EMAL1_HUMAN;.	W	770;782;801;801	ENSP00000327384:G770W;ENSP00000262233:G782W;ENSP00000334314:G801W	ENSP00000262233:G782W	G	+	1	0	EML1	99476098	1.000000	0.71417	0.943000	0.38184	0.617000	0.37484	9.675000	0.98638	2.169000	0.68431	0.655000	0.94253	GGG	EML1	-	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000066629		0.542	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EML1	HGNC	protein_coding	OTTHUMT00000413943.1		0.00	32	0	G	NM_001008707		100406345	+1			no_errors	ENST00000334192	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
ENPEP	2028	genome.wustl.edu	37	4	111434689	111434689	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:111434689G>T	ENST00000265162.5	+	7	1769	c.1427G>T	c.(1426-1428)gGa>gTa	p.G476V	RP11-380D23.1_ENST00000503998.1_RNA	NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	476					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GTTTTTGATGGAATATCCTAT	0.353																																																	0													167.0	157.0	160.0					4																	111434689		2203	4300	6503	SO:0001583	missense	0			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1427G>T	4.37:g.111434689G>T	ENSP00000265162:p.Gly476Val		Q504U2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.G476V	ENST00000265162.5	37	c.1427	CCDS3691.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.72|14.72	2.619256|2.619256	0.46736|0.46736	.|.	.|.	ENSG00000138792|ENSG00000250511	ENST00000265162|ENST00000503998	T|.	0.02498|.	4.27|.	5.29|5.29	4.43|4.43	0.53597|0.53597	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);|.	0.159045|.	0.53938|.	D|.	0.000057|.	T|T	0.55481|0.55481	0.1923|0.1923	L|L	0.41573|0.41573	1.285|1.285	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.71674|.	0.998|.	D|.	0.64506|.	0.926|.	T|T	0.51756|0.51756	-0.8665|-0.8665	10|5	0.40728|.	T|.	0.16|.	.|.	11.1941|11.1941	0.48703|0.48703	0.0:0.1384:0.7178:0.1438|0.0:0.1384:0.7178:0.1438	.|.	476|.	Q07075|.	AMPE_HUMAN|.	V|T	476|93	ENSP00000265162:G476V|.	ENSP00000265162:G476V|.	G|P	+|-	2|1	0|0	ENPEP|RP11-380D23.1	111654138|111654138	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.946000|0.946000	0.59487|0.59487	3.621000|3.621000	0.54210|0.54210	1.337000|1.337000	0.45525|0.45525	0.650000|0.650000	0.86243|0.86243	GGA|CCA	ENPEP	-	pfam_Peptidase_M1_N	ENSG00000138792		0.353	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	HGNC	protein_coding	OTTHUMT00000255747.2	-	0.00	115	0	G			111434689	+1	tier1	-	no_errors	ENST00000265162	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.998	T
SLC9A3	6550	genome.wustl.edu	37	5	472808	472808	+	IGR	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:472808C>T	ENST00000264938.3	-	0	2584				CTD-2228K2.5_ENST00000342584.3_Silent_p.R81R|CTD-2228K2.5_ENST00000510604.1_Silent_p.R81R|CTD-2228K2.5_ENST00000510714.1_5'UTR|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.7_ENST00000607286.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3						ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			AGTTCAAAGACCTGGCGAGGG	0.662																																																	0																																										SO:0001628	intergenic_variant	0				CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315		5.37:g.472808C>T			B7ZKR2|E9PF67|Q3MIW3	Silent	SNP	NULL	p.R81	ENST00000264938.3	37	c.243	CCDS3855.1	5																																																																																			CTD-2228K2.5	-	NULL	ENSG00000188242		0.662	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000188242	Clone_based_vega_gene	protein_coding	OTTHUMT00000206677.2		0.00	77	0	C	NM_004174		472808	-1			no_errors	ENST00000342584	ensembl	human	putative	74_37	silent	5.97	63	4	SNP	0.027	T
LOC101927209	101927209	genome.wustl.edu	37	1	142714766	142714766	+	lincRNA	SNP	A	A	G	rs4848006	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:142714766A>G	ENST00000610091.1	-	0	892																											AAGTACAAGGAACAATTTTAC	0.259																																																	0																																												0																															1.37:g.142714766A>G				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.259	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	20	0	A			142714766	-1	tier1	rs4848006	no_errors	ENST00000610091	ensembl	human	known	74_37	rna	71.43	2	5	SNP	0.003	G
AC023469.1	0	genome.wustl.edu	37	2	151900298	151900298	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:151900298C>G	ENST00000409243.1	-	3	199	c.115G>C	c.(115-117)Gta>Cta	p.V39L																								catgtctctaccatgtcttga	0.448																																																	0																																										SO:0001583	missense	0																														ENST00000409243.1:c.115G>C	2.37:g.151900298C>G	ENSP00000386400:p.Val39Leu			Missense_Mutation	SNP	NULL	p.V39L	ENST00000409243.1	37	c.115		2	.	.	.	.	.	.	.	.	.	.	C	1.514	-0.548782	0.04024	.	.	ENSG00000222031	ENST00000409243	.	.	.	0.556	0.556	0.17253	.	.	.	.	.	T	0.55816	0.1944	.	.	.	.	.	.	.	.	.	.	.	.	T	0.66508	-0.5906	3	0.87932	D	0	.	.	.	.	.	.	.	.	L	39	.	ENSP00000386400:V39L	V	-	1	0	AC023469.1	151608544	0.003000	0.15002	0.038000	0.18304	0.037000	0.13140	-0.383000	0.07398	0.550000	0.28991	0.557000	0.71058	GTA	AC023469.1	-	NULL	ENSG00000222031		0.448	AC023469.1-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000222031	Clone_based_vega_gene	protein_coding	OTTHUMT00000332405.1	-	0.00	48	0	C			151900298	-1	tier1	-	no_errors	ENST00000409243	ensembl	human	putative	74_37	missense	20.69	46	12	SNP	0.048	G
GS1-124K5.2	0	genome.wustl.edu	37	7	65894965	65894965	+	RNA	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:65894965C>G	ENST00000442578.1	-	0	560																											ATGTACTTTTCAATCTGATCC	0.358																																																	0																																												0																															7.37:g.65894965C>G				RNA	SNP	-	NULL	ENST00000442578.1	37	NULL		7																																																																																			GS1-124K5.2	-	-	ENSG00000230189		0.358	GS1-124K5.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000230189	Clone_based_vega_gene	pseudogene	OTTHUMT00000344730.1	-	0.00	36	0	C			65894965	-1	tier1	-	no_errors	ENST00000442578	ensembl	human	known	74_37	rna	21.05	15	4	SNP	1.000	G
AC096579.13	0	genome.wustl.edu	37	2	89111019	89111019	+	RNA	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:89111019G>T	ENST00000452230.1	-	0	385				MIR4436A_ENST00000585278.1_RNA																							AGGAAGCTCTGTTAATCCTGT	0.413																																																	0																																												0																															2.37:g.89111019G>T				RNA	SNP	-	NULL	ENST00000452230.1	37	NULL		2																																																																																			AC096579.13	-	-	ENSG00000240040		0.413	AC096579.13-001	KNOWN	basic	processed_transcript	ENSG00000240040	Clone_based_vega_gene	processed_transcript	OTTHUMT00000323493.1	-	0.00	51	0	G			89111019	-1	tier1	-	no_errors	ENST00000452230	ensembl	human	known	74_37	rna	8.70	42	4	SNP	0.049	T
ALG10	84920	genome.wustl.edu	37	12	34176818	34176818	+	Intron	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:34176818G>A	ENST00000266483.2	+	2	490				RP11-847H18.2_ENST00000501954.2_RNA|ALG10_ENST00000538927.1_Intron	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				TGCTGGAGATGAGACTTGGGC	0.368																																																	0																																										SO:0001627	intron_variant	0			AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.172-79G>A	12.37:g.34176818G>A			Q6NS98|Q96DU0|Q96SM6	RNA	SNP	-	NULL	ENST00000266483.2	37	NULL	CCDS41769.1	12																																																																																			RP11-847H18.2	-	-	ENSG00000245482		0.368	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000245482	Clone_based_vega_gene	protein_coding	OTTHUMT00000403309.1	-	0.00	78	0	G	NM_032834		34176818	-1	tier1	-	no_errors	ENST00000501954	ensembl	human	known	74_37	rna	16.07	47	9	SNP	0.001	A
RP11-597D13.7	0	genome.wustl.edu	37	4	159199089	159199089	+	RNA	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:159199089G>C	ENST00000512016.1	+	0	2451																											AAGAACAAAAGAAAACCATAG	0.403																																																	0																																												0																															4.37:g.159199089G>C				RNA	SNP	-	NULL	ENST00000512016.1	37	NULL		4																																																																																			RP11-597D13.7	-	-	ENSG00000251429		0.403	RP11-597D13.7-002	KNOWN	basic	processed_transcript	ENSG00000251429	Clone_based_vega_gene	pseudogene	OTTHUMT00000365621.1	-	0.00	45	0	G			159199089	+1	tier1	-	no_errors	ENST00000512016	ensembl	human	known	74_37	rna	10.53	34	4	SNP	1.000	C
MMP25	64386	genome.wustl.edu	37	16	3105771	3105771	+	Intron	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:3105771G>T	ENST00000336577.4	+	5	898				RP11-473M20.7_ENST00000570949.1_RNA|RP11-473M20.7_ENST00000572427.1_RNA|RP11-473M20.7_ENST00000572930.1_RNA|RP11-473M20.7_ENST00000573878.1_RNA|RP11-473M20.7_ENST00000597579.1_RNA|RP11-473M20.7_ENST00000572222.1_RNA|RP11-473M20.7_ENST00000576250.1_RNA|RP11-473M20.7_ENST00000573130.1_RNA|RP11-473M20.7_ENST00000572574.1_RNA|RP11-473M20.7_ENST00000573953.1_RNA|MMP25_ENST00000570755.1_Intron	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25						negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	TCATCCGCATGGGGTAACTGG	0.567																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)												0																																										SO:0001627	intron_variant	0			AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.662-1263G>T	16.37:g.3105771G>T			Q96F04|Q96TE2	RNA	SNP	-	NULL	ENST00000336577.4	37	NULL	CCDS10492.1	16																																																																																			RP11-473M20.7	-	-	ENSG00000261971		0.567	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261971	Clone_based_vega_gene	protein_coding	OTTHUMT00000437116.1	-	0.00	46	0	G	NM_022468		3105771	-1	tier1	-	no_errors	ENST00000570949	ensembl	human	known	74_37	rna	6.25	60	4	SNP	0.001	T
BRD2	6046	genome.wustl.edu	37	6	32940401	32940402	+	5'UTR	DEL	AG	AG	-			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:32940401_32940402delAG	ENST00000374825.4	+	0	1427_1428				BRD2-IT1_ENST00000415875.2_RNA|XXbac-BPG181M17.6_ENST00000580587.1_RNA|BRD2_ENST00000443797.2_5'UTR|BRD2_ENST00000395287.1_5'Flank|BRD2_ENST00000374831.4_5'UTR|BRD2_ENST00000449085.2_5'Flank|BRD2_ENST00000395289.2_5'UTR	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2						chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CGTCTTTTGAAGAGTCAGTCCC	0.629																																																	0																																										SO:0001623	5_prime_UTR_variant	0			X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.-274AG>-	6.37:g.32940403_32940404delAG			A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	RNA	DEL	-	NULL	ENST00000374825.4	37	NULL	CCDS4762.1	6																																																																																			XXbac-BPG181M17.6	-	-	ENSG00000263756		0.629	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000263756	Clone_based_vega_gene	protein_coding	OTTHUMT00000076503.2		0.00	91	0	AG			32940402	-1	tier1		no_errors	ENST00000580587	ensembl	human	known	74_37	rna	29.41	72	30	DEL	0.867:0.918	-
ENTHD1	150350	genome.wustl.edu	37	22	40139936	40139936	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr22:40139936G>T	ENST00000325157.6	-	7	1822	c.1572C>A	c.(1570-1572)ttC>ttA	p.F524L		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	524										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					ACAGAGGGATGAACTGGTCTA	0.413																																																	0													63.0	60.0	61.0					22																	40139936		2203	4300	6503	SO:0001583	missense	0			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.1572C>A	22.37:g.40139936G>T	ENSP00000317431:p.Phe524Leu		B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.F524L	ENST00000325157.6	37	c.1572	CCDS13998.1	22	.	.	.	.	.	.	.	.	.	.	G	7.712	0.695265	0.15039	.	.	ENSG00000176177	ENST00000325157	T	0.33865	1.39	5.75	-1.64	0.08318	.	0.590354	0.16851	N	0.196942	T	0.21022	0.0506	L	0.43923	1.385	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.11542	-1.0583	10	0.31617	T	0.26	-4.7155	1.2754	0.02030	0.3416:0.1479:0.3738:0.1368	.	524	Q8IYW4	ENTD1_HUMAN	L	524	ENSP00000317431:F524L	ENSP00000317431:F524L	F	-	3	2	ENTHD1	38469882	0.001000	0.12720	0.000000	0.03702	0.156000	0.22039	0.113000	0.15499	0.079000	0.16929	0.650000	0.86243	TTC	ENTHD1	-	NULL	ENSG00000176177		0.413	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD1	HGNC	protein_coding	OTTHUMT00000321302.1	-	0.00	41	0	G	NM_152512		40139936	-1	tier1	-	no_errors	ENST00000325157	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.000	T
EPHA1-AS1	285965	genome.wustl.edu	37	7	143219965	143219965	+	RNA	SNP	C	C	T	rs566131000	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:143219965C>T	ENST00000429289.1	+	0	4441					NR_033897.1				EPHA1 antisense RNA 1																		AATTACGAATCTGATGACTAT	0.348													C|||	866	0.172923	0.2905	0.134	5008	,	,		16951	0.0764		0.2217	False		,,,				2504	0.091																0																																												0			AL833583		7q35	2012-10-12	2012-08-15		ENSG00000229153	ENSG00000229153		"""Long non-coding RNAs"""	27799	non-coding RNA	RNA, long non-coding			"""EPHA1 antisense RNA 1 (non-protein coding)"""				Standard	NR_033897		Approved		uc003wda.4		OTTHUMG00000155893		7.37:g.143219965C>T				RNA	SNP	-	NULL	ENST00000429289.1	37	NULL		7																																																																																			EPHA1-AS1	-	-	ENSG00000229153		0.348	EPHA1-AS1-001	KNOWN	basic	antisense	EPHA1-AS1	HGNC	antisense	OTTHUMT00000342151.1	-	0.00	9	0	C	NR_033897		143219965	+1	tier1	-	no_errors	ENST00000429289	ensembl	human	known	74_37	rna	77.78	2	7	SNP	0.001	T
EPHA6	285220	genome.wustl.edu	37	3	96962952	96962952	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:96962952G>T	ENST00000389672.5	+	5	1465	c.1427G>T	c.(1426-1428)tGt>tTt	p.C476F	EPHA6_ENST00000470610.2_Missense_Mutation_p.C476F	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	382	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TGTGAGGACTGTGGTGGAGGA	0.458																																																	0													96.0	102.0	100.0					3																	96962952		2036	4173	6209	SO:0001583	missense	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.1427G>T	3.37:g.96962952G>T	ENSP00000374323:p.Cys476Phe		D6RAL5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C476F	ENST00000389672.5	37	c.1427	CCDS46876.1	3	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475764	0.84640	.	.	ENSG00000080224	ENST00000470610;ENST00000389672	D;D	0.98937	-5.25;-5.25	5.68	5.68	0.88126	.	.	.	.	.	D	0.99414	0.9793	M	0.93978	3.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98732	1.0713	9	0.87932	D	0	.	19.7917	0.96461	0.0:0.0:1.0:0.0	.	476;476	B3KS12;E7EU71	.;.	F	476	ENSP00000420598:C476F;ENSP00000374323:C476F	ENSP00000374323:C476F	C	+	2	0	EPHA6	98445642	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.459000	0.97638	2.685000	0.91497	0.650000	0.86243	TGT	EPHA6	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000080224		0.458	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000353845.3		0.00	95	0	G	NM_001080448		96962952	+1			no_errors	ENST00000389672	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
EYA1	2138	genome.wustl.edu	37	8	72181986	72181986	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:72181986T>C	ENST00000340726.3	-	11	1678	c.1039A>G	c.(1039-1041)Aga>Gga	p.R347G	EYA1_ENST00000388742.4_Missense_Mutation_p.R347G|EYA1_ENST00000388741.2_Missense_Mutation_p.R313G|EYA1_ENST00000388740.3_Missense_Mutation_p.R314G|EYA1_ENST00000419131.1_Missense_Mutation_p.R342G|EYA1_ENST00000388743.2_Missense_Mutation_p.R346G|EYA1_ENST00000303824.7_Missense_Mutation_p.R341G	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	347					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			CTCCCATATCTGTTGGCGTAG	0.368																																																	0													144.0	133.0	137.0					8																	72181986		2203	4300	6503	SO:0001583	missense	0			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1039A>G	8.37:g.72181986T>C	ENSP00000342626:p.Arg347Gly		A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.R347G	ENST00000340726.3	37	c.1039	CCDS34906.1	8	.	.	.	.	.	.	.	.	.	.	T	20.8	4.054663	0.75960	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.86	5.86	0.93980	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.000000	0.85682	D	0.000000	D	0.87160	0.6108	L	0.37697	1.125	0.80722	D	1	D;P;P;D;P	0.76494	0.998;0.915;0.915;0.999;0.837	P;P;P;D;P	0.75020	0.881;0.497;0.497;0.985;0.457	D	0.88063	0.2795	10	0.59425	D	0.04	-24.2839	16.2479	0.82454	0.0:0.0:0.0:1.0	.	341;274;314;347;342	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	G	347;347;315;314;341;313;346;342	ENSP00000373394:R347G;ENSP00000342626:R347G;ENSP00000373392:R314G;ENSP00000303221:R341G;ENSP00000373393:R313G;ENSP00000373395:R346G;ENSP00000410176:R342G	ENSP00000303221:R341G	R	-	1	2	EYA1	72344540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.800000	0.55537	2.241000	0.73720	0.533000	0.62120	AGA	EYA1	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	ENSG00000104313		0.368	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EYA1	HGNC	protein_coding	OTTHUMT00000313788.2	-	0.00	75	0	T	NM_000503, NM_172060		72181986	-1	tier1	-	no_errors	ENST00000340726	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	C
FAM189B	10712	genome.wustl.edu	37	1	155217905	155217905	+	Missense_Mutation	SNP	C	C	T	rs201013021		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:155217905C>T	ENST00000361361.2	-	11	2278	c.1769G>A	c.(1768-1770)cGt>cAt	p.R590H	FAM189B_ENST00000368368.3_Missense_Mutation_p.R572H|FAM189B_ENST00000350210.2_Missense_Mutation_p.R494H|FAM189B_ENST00000472550.1_5'Flank	NM_006589.2	NP_006580.2	P81408	F189B_HUMAN	family with sequence similarity 189, member B	590						integral component of membrane (GO:0016021)	WW domain binding (GO:0050699)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23						CTGGAGGAAACGAGTGACCAG	0.607																																																	0													35.0	39.0	37.0					1																	155217905		2203	4300	6503	SO:0001583	missense	0			AF070550	CCDS1103.1, CCDS1104.1, CCDS58035.1	1q21	2009-07-09	2009-07-09	2009-07-09	ENSG00000160767	ENSG00000160767			1233	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 2"""	C1orf2		9331372	Standard	NM_006589		Approved	cote1	uc001fjm.3	P81408	OTTHUMG00000035844	ENST00000361361.2:c.1769G>A	1.37:g.155217905C>T	ENSP00000354958:p.Arg590His		B1AVS5|Q8IXL3|Q9BR66	Missense_Mutation	SNP	pfam_CD20-like	p.R590H	ENST00000361361.2	37	c.1769	CCDS1103.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116135	0.77323	.	.	ENSG00000160767	ENST00000350210;ENST00000368368;ENST00000361361;ENST00000323361;ENST00000491082	T;T;T;T	0.39056	1.26;1.71;1.72;1.1	4.41	4.41	0.53225	.	0.073132	0.56097	D	0.000040	T	0.31327	0.0793	N	0.08118	0	0.31730	N	0.637225	D;D;D;D	0.89917	1.0;0.998;0.999;0.998	D;P;D;P	0.85130	0.997;0.906;0.957;0.906	T	0.35992	-0.9766	10	0.72032	D	0.01	.	12.745	0.57276	0.0:1.0:0.0:0.0	.	355;572;494;590	B1AVS2;B1AVS5;P81408-2;P81408	.;.;.;F189B_HUMAN	H	494;572;590;273;312	ENSP00000307128:R494H;ENSP00000357352:R572H;ENSP00000354958:R590H;ENSP00000427011:R312H	ENSP00000323164:R273H	R	-	2	0	FAM189B	153484529	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.896000	0.48656	2.457000	0.83068	0.555000	0.69702	CGT	FAM189B	-	NULL	ENSG00000160767		0.607	FAM189B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189B	HGNC	protein_coding	OTTHUMT00000087224.1	-	0.00	75	0	C	NM_006589		155217905	-1	tier1	-	no_errors	ENST00000361361	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
FAM200A	221786	genome.wustl.edu	37	7	99145817	99145817	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:99145817C>G	ENST00000449309.1	-	2	593	c.214G>C	c.(214-216)Gca>Cca	p.A72P		NM_145111.3	NP_659802.1	Q8TCP9	F200A_HUMAN	family with sequence similarity 200, member A	72						integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(5)|large_intestine(2)|ovary(2)|skin(1)	11						ttctcttttgccactctatat	0.398																																																	0													95.0	90.0	91.0					7																	99145817		2191	4281	6472	SO:0001583	missense	0				CCDS5668.1	7q22.1	2010-02-22	2010-02-22	2010-02-22	ENSG00000221909	ENSG00000221909			25401	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 38"""	C7orf38		10607616	Standard	NM_145111		Approved	FLJ36794, DKFZp727G131	uc003ura.3	Q8TCP9	OTTHUMG00000156723	ENST00000449309.1:c.214G>C	7.37:g.99145817C>G	ENSP00000411372:p.Ala72Pro		A4D293|A8K3V9|B2RD92|C9J6A8|D6W5T2|Q8N9P3	Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.A72P	ENST00000449309.1	37	c.214	CCDS5668.1	7	.	.	.	.	.	.	.	.	.	.	C	16.31	3.086583	0.55861	.	.	ENSG00000221909	ENST00000449309;ENST00000408938	T;T	0.49139	0.79;0.79	2.58	2.58	0.30949	.	0.000000	0.37530	N	0.002056	T	0.54398	0.1856	L	0.39245	1.2	0.25055	N	0.991109	D	0.89917	1.0	D	0.75484	0.986	T	0.35126	-0.9801	10	0.72032	D	0.01	.	8.7957	0.34878	0.0:1.0:0.0:0.0	.	72	Q8TCP9	F200A_HUMAN	P	72	ENSP00000411372:A72P;ENSP00000386191:A72P	ENSP00000386191:A72P	A	-	1	0	FAM200A	98983753	0.916000	0.31088	0.998000	0.56505	0.860000	0.49131	2.056000	0.41355	1.741000	0.51731	0.655000	0.94253	GCA	FAM200A	-	NULL	ENSG00000221909		0.398	FAM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM200A	HGNC	protein_coding	OTTHUMT00000345467.1	-	0.00	46	0	C	NM_145111		99145817	-1	tier1	-	no_errors	ENST00000449309	ensembl	human	known	74_37	missense	17.78	37	8	SNP	1.000	G
FAM21A	387680	genome.wustl.edu	37	10	47946902	47946902	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:47946902G>C	ENST00000358474.5	+	28	3538	c.3538G>C	c.(3538-3540)Gat>Cat	p.D1180H		NM_018232.1	NP_060702.1	Q5SNT6	FA21B_HUMAN		1180					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						TGATAACATTGATATCTTTGC	0.323																																																	0													2.0	3.0	3.0					10																	47946902		815	2376	3191	SO:0001583	missense	0																														ENST00000358474.5:c.3538G>C	10.37:g.47946902G>C	ENSP00000351259:p.Asp1180His			Missense_Mutation	SNP	NULL	p.D1180H	ENST00000358474.5	37	c.3538	CCDS44379.1	10	.	.	.	.	.	.	.	.	.	.	g	16.78	3.216549	0.58452	.	.	ENSG00000152726	ENST00000358474;ENST00000543972;ENST00000355876	.	.	.	2.94	2.94	0.34122	.	0.000000	0.85682	D	0.000000	T	0.77519	0.4142	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.80643	-0.1291	9	0.87932	D	0	-20.1831	11.4324	0.50050	0.0:0.0:1.0:0.0	.	1180;235;1247	Q5SNT6;Q5SRD0;B7ZME8	FA21B_HUMAN;FA21D_HUMAN;.	H	1180;437;1150	.	ENSP00000348138:D1150H	D	+	1	0	FAM21B	47466908	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.128000	0.94424	1.493000	0.48517	0.377000	0.23210	GAT	FAM21B	-	NULL	ENSG00000152726		0.323	FAM21B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM21B	HGNC	protein_coding	OTTHUMT00000047871.2	-	0.00	44	0	G			47946902	+1	tier1	-	no_errors	ENST00000358474	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	C
FAM71C	196472	genome.wustl.edu	37	12	100042091	100042091	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:100042091G>C	ENST00000324341.1	+	1	561	c.139G>C	c.(139-141)Gag>Cag	p.E47Q	ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547776.2_Intron|ANKS1B_ENST00000547010.1_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	47										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		ACCCATGTTTGAGAGCGACTT	0.517																																																	0													141.0	128.0	132.0					12																	100042091		2203	4300	6503	SO:0001583	missense	0				CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.139G>C	12.37:g.100042091G>C	ENSP00000315247:p.Glu47Gln		B2R6Y6	Missense_Mutation	SNP	pfam_DUF3699	p.E47Q	ENST00000324341.1	37	c.139	CCDS9072.1	12	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622264	0.46840	.	.	ENSG00000180219	ENST00000324341	T	0.28895	1.59	3.89	3.0	0.34707	.	0.203319	0.34828	N	0.003646	T	0.48390	0.1497	M	0.72894	2.215	0.23282	N	0.997988	D	0.89917	1.0	D	0.77004	0.989	T	0.22347	-1.0219	9	.	.	.	-25.5464	7.263	0.26214	0.12:0.0:0.88:0.0	.	47	Q8NEG0	FA71C_HUMAN	Q	47	ENSP00000315247:E47Q	.	E	+	1	0	FAM71C	98566222	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	2.915000	0.48805	1.215000	0.43411	0.555000	0.69702	GAG	FAM71C	-	NULL	ENSG00000180219		0.517	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71C	HGNC	protein_coding	OTTHUMT00000408458.1	-	0.00	50	0	G	NM_153364		100042091	+1	tier1	-	no_errors	ENST00000324341	ensembl	human	known	74_37	missense	10.53	51	6	SNP	1.000	C
FAM87A	157693	genome.wustl.edu	37	8	327671	327671	+	lincRNA	SNP	G	G	C	rs368807142		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:327671G>C	ENST00000330148.2	-	0	2790					NR_103537.1		P0C7U9	FA87A_HUMAN	family with sequence similarity 87, member A							integral component of membrane (GO:0016021)											gtctacggctgcccctggaca	0.597																																																	0																																												0			BC037297		8p23.3	2013-02-15				ENSG00000182366		"""Long non-coding RNAs"""	27233	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_103537		Approved			P0C7U9			8.37:g.327671G>C				RNA	SNP	-	NULL	ENST00000330148.2	37	NULL		8																																																																																			FAM87A	-	-	ENSG00000182366		0.597	FAM87A-001	KNOWN	basic	lincRNA	FAM87A	HGNC	lincRNA	OTTHUMT00000384563.2		0.00	32	0	G			327671	-1			no_errors	ENST00000330148	ensembl	human	known	74_37	rna	16.67	25	5	SNP	0.003	C
FAM87A	157693	genome.wustl.edu	37	8	327684	327684	+	lincRNA	SNP	A	A	G	rs372301088		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:327684A>G	ENST00000330148.2	-	0	2777					NR_103537.1		P0C7U9	FA87A_HUMAN	family with sequence similarity 87, member A							integral component of membrane (GO:0016021)											cctggacacaactgcagagct	0.602																																																	0																																												0			BC037297		8p23.3	2013-02-15				ENSG00000182366		"""Long non-coding RNAs"""	27233	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_103537		Approved			P0C7U9			8.37:g.327684A>G				RNA	SNP	-	NULL	ENST00000330148.2	37	NULL		8																																																																																			FAM87A	-	-	ENSG00000182366		0.602	FAM87A-001	KNOWN	basic	lincRNA	FAM87A	HGNC	lincRNA	OTTHUMT00000384563.2		0.00	36	0	A			327684	-1			no_errors	ENST00000330148	ensembl	human	known	74_37	rna	13.16	33	5	SNP	0.000	G
FANCA	2175	genome.wustl.edu	37	16	89858425	89858425	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:89858425G>T	ENST00000389301.3	-	13	1165	c.1135C>A	c.(1135-1137)Ctg>Atg	p.L379M	FANCA_ENST00000568369.1_Missense_Mutation_p.L379M	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	379					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TGCGTTTCCAGAACTTCTTGC	0.498			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0													122.0	111.0	115.0					16																	89858425		2198	4300	6498	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1135C>A	16.37:g.89858425G>T	ENSP00000373952:p.Leu379Met		A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.L379M	ENST00000389301.3	37	c.1135	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050738	0.36181	.	.	ENSG00000187741	ENST00000389301	D	0.98777	-5.13	5.49	4.49	0.54785	.	0.323406	0.22308	N	0.061778	D	0.98710	0.9567	M	0.77103	2.36	0.80722	D	1	D;D	0.71674	0.998;0.993	D;P	0.64595	0.927;0.878	D	0.98917	1.0782	10	0.66056	D	0.02	-7.1779	9.0322	0.36264	0.1755:0.0:0.8245:0.0	.	379;379	B4DRI7;O15360	.;FANCA_HUMAN	M	379	ENSP00000373952:L379M	ENSP00000373952:L379M	L	-	1	2	FANCA	88385926	0.978000	0.34361	0.738000	0.30950	0.009000	0.06853	0.974000	0.29436	1.243000	0.43853	-0.365000	0.07479	CTG	FANCA	-	NULL	ENSG00000187741		0.498	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1	-	0.00	47	0	G			89858425	-1	tier1	-	no_errors	ENST00000389301	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
FANCI	55215	genome.wustl.edu	37	15	89859688	89859688	+	Nonstop_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:89859688T>C	ENST00000310775.7	+	38	4071	c.3985T>C	c.(3985-3987)Taa>Caa	p.*1329Q	POLG_ENST00000442287.2_3'UTR|POLG_ENST00000268124.5_3'UTR|FANCI_ENST00000300027.8_Nonstop_Mutation_p.*1269Q	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	0					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					AAGGAAAAAATAAATGAAATG	0.438								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													37.0	37.0	37.0					15																	89859688		2200	4299	6499	SO:0001578	stop_lost	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.3985T>C	15.37:g.89859688T>C	ENSP00000310842:p.*1329Glnext*6		A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Nonstop_Mutation	SNP	NULL	p.*1329Q	ENST00000310775.7	37	c.3985	CCDS45346.1	15	.	.	.	.	.	.	.	.	.	.	T	13.22	2.171185	0.38315	.	.	ENSG00000140525	ENST00000300027;ENST00000310775	.	.	.	3.95	-4.08	0.03963	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0205	0.42039	0.0:0.1083:0.1611:0.7305	.	.	.	.	Q	1269;1329	.	.	X	+	1	0	FANCI	87660692	0.804000	0.28969	0.960000	0.40013	0.989000	0.77384	-0.561000	0.05957	-0.451000	0.07097	-0.213000	0.12676	TAA	FANCI	-	NULL	ENSG00000140525		0.438	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	HGNC	protein_coding	OTTHUMT00000421140.1	-	0.00	55	0	T	NM_018193		89859688	+1	tier1	-	no_errors	ENST00000310775	ensembl	human	known	74_37	nonstop	17.78	37	8	SNP	0.984	C
FASLG	356	genome.wustl.edu	37	1	172634774	172634774	+	Nonsense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:172634774C>G	ENST00000367721.2	+	4	648	c.464C>G	c.(463-465)tCa>tGa	p.S155*	FASLG_ENST00000340030.3_3'UTR	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	155					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						AAGTCCAACTCAAGGTCCATG	0.448																																					Ovarian(28;486 876 30334 44033)												0													107.0	96.0	100.0					1																	172634774		2203	4300	6503	SO:0001587	stop_gained	0			U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.464C>G	1.37:g.172634774C>G	ENSP00000356694:p.Ser155*		Q9BZP9	Nonsense_Mutation	SNP	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom,prints_FASL,prints_TNF,prints_TNF_C	p.S155*	ENST00000367721.2	37	c.464	CCDS1304.1	1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828046	0.90955	.	.	ENSG00000117560	ENST00000367721	.	.	.	5.24	5.24	0.73138	.	0.587910	0.16366	N	0.217529	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-18.5591	11.4623	0.50217	0.1796:0.8204:0.0:0.0	.	.	.	.	X	155	.	ENSP00000356694:S155X	S	+	2	0	FASLG	170901397	0.949000	0.32298	1.000000	0.80357	0.643000	0.38383	2.464000	0.45067	2.455000	0.83008	0.650000	0.86243	TCA	FASLG	-	superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom,prints_FASL	ENSG00000117560		0.448	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASLG	HGNC	protein_coding	OTTHUMT00000084276.1	-	0.00	39	0	C			172634774	+1	tier1	-	no_errors	ENST00000367721	ensembl	human	known	74_37	nonsense	15.00	33	6	SNP	0.931	G
FBN3	84467	genome.wustl.edu	37	19	8161420	8161420	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:8161420C>T	ENST00000600128.1	-	44	5861	c.5447G>A	c.(5446-5448)tGt>tAt	p.C1816Y	FBN3_ENST00000601739.1_Missense_Mutation_p.C1816Y|FBN3_ENST00000270509.2_Missense_Mutation_p.C1816Y			Q75N90	FBN3_HUMAN	fibrillin 3	1816	EGF-like 28. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ACCATGGCTACAGACATTCGG	0.577																																																	0													124.0	87.0	100.0					19																	8161420		2203	4300	6503	SO:0001583	missense	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5447G>A	19.37:g.8161420C>T	ENSP00000470498:p.Cys1816Tyr		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.C1816Y	ENST00000600128.1	37	c.5447	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133600	0.77662	.	.	ENSG00000142449	ENST00000270509	D	0.99445	-5.91	3.63	3.63	0.41609	Epidermal growth factor-like (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.99704	0.9887	H	0.97732	4.065	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.97084	0.9786	10	0.87932	D	0	.	15.6411	0.77001	0.0:1.0:0.0:0.0	.	1816	Q75N90	FBN3_HUMAN	Y	1816	ENSP00000270509:C1816Y	ENSP00000270509:C1816Y	C	-	2	0	FBN3	8067420	1.000000	0.71417	0.943000	0.38184	0.932000	0.56968	5.337000	0.65941	1.695000	0.51148	0.655000	0.94253	TGT	FBN3	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN	ENSG00000142449		0.577	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	-	0.00	30	0	C	NM_032447		8161420	-1	tier1	-	no_errors	ENST00000270509	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
FBXL6	26233	genome.wustl.edu	37	8	145580145	145580145	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:145580145C>T	ENST00000331890.5	-	7	1104	c.1040G>A	c.(1039-1041)cGa>cAa	p.R347Q	SLC52A2_ENST00000402965.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|FBXL6_ENST00000455319.2_Missense_Mutation_p.R341Q|SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|FBXL6_ENST00000526524.1_5'UTR|TMEM249_ENST00000531225.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	347					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			AGCCACCCCTCGTCCCGGAGG	0.652																																																	0													33.0	39.0	37.0					8																	145580145		2202	4300	6502	SO:0001583	missense	0			AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1040G>A	8.37:g.145580145C>T	ENSP00000330098:p.Arg347Gln		Q53G43|Q9H5W9|Q9UKC7	Missense_Mutation	SNP	superfamily_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp	p.R347Q	ENST00000331890.5	37	c.1040	CCDS6422.1	8	.	.	.	.	.	.	.	.	.	.	C	3.857	-0.030654	0.07543	.	.	ENSG00000182325	ENST00000455319;ENST00000331890	T;T	0.16457	5.52;2.34	4.92	2.9	0.33743	.	0.247112	0.33610	N	0.004728	T	0.09862	0.0242	N	0.24115	0.695	0.09310	N	1	B;B	0.19935	0.024;0.04	B;B	0.10450	0.002;0.005	T	0.31586	-0.9938	10	0.25106	T	0.35	-7.1819	7.4129	0.27027	0.0:0.7749:0.0:0.2251	.	347;341	Q8N531;Q8N531-2	FBXL6_HUMAN;.	Q	341;347	ENSP00000403873:R341Q;ENSP00000330098:R347Q	ENSP00000330098:R347Q	R	-	2	0	FBXL6	145550953	0.000000	0.05858	0.002000	0.10522	0.019000	0.09904	0.985000	0.29578	0.352000	0.24053	0.563000	0.77884	CGA	FBXL6	-	NULL	ENSG00000182325		0.652	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL6	HGNC	protein_coding	OTTHUMT00000382413.1	-	0.00	64	0	C	NM_024555		145580145	-1	tier1	-	no_errors	ENST00000331890	ensembl	human	known	74_37	missense	11.27	63	8	SNP	0.003	T
FBXL7	23194	genome.wustl.edu	37	5	15928017	15928017	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:15928017G>T	ENST00000504595.1	+	3	627	c.146G>T	c.(145-147)cGc>cTc	p.R49L	FBXL7_ENST00000329673.7_Missense_Mutation_p.R37L|FBXL7_ENST00000510662.1_Missense_Mutation_p.R2L	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	49					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R49H(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CTGAGCATGCGCACACTGAGC	0.572																																																	1	Substitution - Missense(1)	prostate(1)											89.0	97.0	94.0					5																	15928017		2084	4217	6301	SO:0001583	missense	0			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.146G>T	5.37:g.15928017G>T	ENSP00000423630:p.Arg49Leu		B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.R49L	ENST00000504595.1	37	c.146	CCDS54833.1	5	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579733	0.86645	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.12039	2.87;2.72;2.88	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.26484	0.0647	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	D	0.71184	0.972	T	0.01508	-1.1337	10	0.38643	T	0.18	.	19.2506	0.93923	0.0:0.0:1.0:0.0	.	49	Q9UJT9	FBXL7_HUMAN	L	49;2;37	ENSP00000423630:R49L;ENSP00000425184:R2L;ENSP00000329632:R37L	ENSP00000329632:R37L	R	+	2	0	FBXL7	15981017	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.206000	0.95056	2.571000	0.86741	0.563000	0.77884	CGC	FBXL7	-	NULL	ENSG00000183580		0.572	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL7	HGNC	protein_coding	OTTHUMT00000366117.1		0.00	60	0	G	NM_012304		15928017	+1			no_errors	ENST00000504595	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	T
FCGR2B	2213	genome.wustl.edu	37	1	161642865	161642865	+	Silent	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:161642865A>G	ENST00000358671.5	+	4	573	c.492A>G	c.(490-492)acA>acG	p.T164T	FCGR2B_ENST00000428605.2_Silent_p.T164T|FCGR2B_ENST00000236937.9_Silent_p.T164T|FCGR2B_ENST00000367962.4_Silent_p.T164T|FCGR2B_ENST00000403078.3_Silent_p.T164T|FCGR2B_ENST00000367960.5_Silent_p.T157T|RP11-25K21.1_ENST00000453111.1_RNA|FCGR2B_ENST00000367961.4_Silent_p.T157T	NM_001002275.2|NM_004001.4	NP_001002275.1|NP_003992.3	P31994	FCG2B_HUMAN	Fc fragment of IgG, low affinity IIb, receptor (CD32)	164	Ig-like C2-type 2.				immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)						all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Antithymocyte globulin(DB00098)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCAAGGTCACATTCTTCCAGA	0.527			T	?	ALL																																			Dom	yes		1	1q23	2213	"""Fc fragment of IgG, low affinity IIb, receptor for (CD32)"""		L	0													16.0	19.0	18.0					1																	161642865		2150	4258	6408	SO:0001819	synonymous_variant	0			BC031992	CCDS30924.1, CCDS30925.1, CCDS53414.1	1q23	2013-01-11	2005-02-02		ENSG00000072694	ENSG00000072694		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3618	protein-coding gene	gene with protein product		604590	"""Fc fragment of IgG, low affinity IIb, receptor for (CD32)"""	FCG2, FCGR2		2139735	Standard	NM_004001		Approved	CD32, CD32B	uc001gaz.2	P31994	OTTHUMG00000034470	ENST00000358671.5:c.492A>G	1.37:g.161642865A>G			A6H8N3|O95649|Q53X85|Q5VXA9|Q8NIA1	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T164	ENST00000358671.5	37	c.492	CCDS30924.1	1																																																																																			FCGR2B	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000072694		0.527	FCGR2B-002	KNOWN	basic|CCDS	protein_coding	FCGR2B	HGNC	protein_coding	OTTHUMT00000083337.4		0.00	119	0	A	NM_004001		161642865	+1			no_errors	ENST00000358671	ensembl	human	known	74_37	silent	6.12	92	6	SNP	0.685	G
FGF5	2250	genome.wustl.edu	37	4	81188301	81188301	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:81188301A>C	ENST00000312465.7	+	1	549	c.323A>C	c.(322-324)aAa>aCa	p.K108T	FGF5_ENST00000456523.3_Missense_Mutation_p.K108T	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	108					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						CCGGATGGCAAAGTCAATGGA	0.582																																																	0													43.0	46.0	45.0					4																	81188301		2202	4298	6500	SO:0001583	missense	0			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.323A>C	4.37:g.81188301A>C	ENSP00000311697:p.Lys108Thr		B2R554|O75846|Q3Y8M3|Q8NF90	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.K108T	ENST00000312465.7	37	c.323	CCDS34021.1	4	.	.	.	.	.	.	.	.	.	.	A	12.00	1.807925	0.31961	.	.	ENSG00000138675	ENST00000312465;ENST00000456523	D;D	0.82081	-1.57;-1.57	5.51	5.51	0.81932	.	0.283311	0.38548	N	0.001656	T	0.81019	0.4736	N	0.17312	0.475	0.42409	D	0.99259	D;B	0.71674	0.998;0.025	D;B	0.66351	0.943;0.021	T	0.78262	-0.2272	10	0.23302	T	0.38	.	10.4107	0.44291	0.9188:0.0:0.0811:0.0	.	108;108	P12034-2;P12034	.;FGF5_HUMAN	T	108	ENSP00000311697:K108T;ENSP00000398353:K108T	ENSP00000311697:K108T	K	+	2	0	FGF5	81407325	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.303000	0.59098	2.317000	0.78254	0.459000	0.35465	AAA	FGF5	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam	ENSG00000138675		0.582	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	HGNC	protein_coding	OTTHUMT00000252627.2	-	0.00	98	0	A			81188301	+1	tier1	-	no_errors	ENST00000312465	ensembl	human	known	74_37	missense	8.26	100	9	SNP	1.000	C
FIGNL1	63979	genome.wustl.edu	37	7	50513641	50513641	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:50513641G>C	ENST00000419119.1	-	2	2898	c.1345C>G	c.(1345-1347)Cta>Gta	p.L449V	FIGNL1_ENST00000433017.1_Missense_Mutation_p.L449V|FIGNL1_ENST00000356889.4_Missense_Mutation_p.L449V|FIGNL1_ENST00000395556.2_Missense_Mutation_p.L449V			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	449					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)	p.L449L(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				TTGCCAATTAGAGTTTTACCA	0.458																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											52.0	53.0	53.0					7																	50513641		2203	4300	6503	SO:0001583	missense	0			AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.1345C>G	7.37:g.50513641G>C	ENSP00000410811:p.Leu449Val		D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L449V	ENST00000419119.1	37	c.1345	CCDS5510.1	7	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675540	0.67928	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119	D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66	5.99	4.18	0.49190	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.64402	D	0.000001	D	0.97012	0.9024	M	0.87328	2.875	0.80722	D	1	D	0.59357	0.985	D	0.66351	0.943	D	0.97464	1.0036	10	0.87932	D	0	-9.5128	12.3571	0.55182	0.1376:0.0:0.8624:0.0	.	449	Q6PIW4	FIGL1_HUMAN	V	449	ENSP00000349356:L449V;ENSP00000378924:L449V;ENSP00000399997:L449V;ENSP00000410811:L449V	ENSP00000349356:L449V	L	-	1	2	FIGNL1	50481135	1.000000	0.71417	0.899000	0.35326	0.997000	0.91878	6.779000	0.75057	1.538000	0.49270	0.655000	0.94253	CTA	FIGNL1	-	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000132436		0.458	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FIGNL1	HGNC	protein_coding	OTTHUMT00000342579.1	-	0.00	71	0	G	NM_001042762		50513641	-1	tier1	-	no_errors	ENST00000356889	ensembl	human	known	74_37	missense	12.96	47	7	SNP	1.000	C
FITM2	128486	genome.wustl.edu	37	20	42935620	42935620	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:42935620C>T	ENST00000396825.3	-	2	454	c.434G>A	c.(433-435)gGc>gAc	p.G145D		NM_001080472.1	NP_001073941.1	Q8N6M3	FITM2_HUMAN	fat storage-inducing transmembrane protein 2	145					cellular triglyceride homeostasis (GO:0035356)|cytoskeleton organization (GO:0007010)|lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of cell morphogenesis (GO:0022604)|regulation of triglyceride biosynthetic process (GO:0010866)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)				endometrium(2)|lung(2)|skin(2)	6						ATGCCAAAAGCCCCCTTCCTG	0.562																																																	0													125.0	89.0	101.0					20																	42935620		2203	4300	6503	SO:0001583	missense	0			BC029662	CCDS33473.1	20q13.12	2009-04-29	2009-04-29	2009-04-29	ENSG00000197296	ENSG00000197296			16135	protein-coding gene	gene with protein product	"""fat inducing transcript 2"""	612029	"""chromosome 20 open reading frame 142"""	C20orf142		18160536	Standard	NM_001080472		Approved	dJ881L22.2, FIT2	uc002xlr.1	Q8N6M3	OTTHUMG00000032522	ENST00000396825.3:c.434G>A	20.37:g.42935620C>T	ENSP00000380037:p.Gly145Asp		A1L492|B9EGQ4|Q5TE59|Q9H3Y1	Missense_Mutation	SNP	pfam_FIT	p.G145D	ENST00000396825.3	37	c.434	CCDS33473.1	20	.	.	.	.	.	.	.	.	.	.	C	19.73	3.882765	0.72410	.	.	ENSG00000197296	ENST00000396825	.	.	.	5.84	5.84	0.93424	.	0.208574	0.49916	D	0.000139	D	0.84723	0.5535	M	0.87971	2.92	0.50632	D	0.999886	D	0.76494	0.999	D	0.71184	0.972	D	0.85308	0.1077	9	0.52906	T	0.07	.	20.1533	0.98095	0.0:1.0:0.0:0.0	.	145	Q8N6M3	FITM2_HUMAN	D	145	.	ENSP00000380037:G145D	G	-	2	0	FITM2	42369034	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.804000	0.55568	2.758000	0.94735	0.655000	0.94253	GGC	FITM2	-	pfam_FIT	ENSG00000197296		0.562	FITM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FITM2	HGNC	protein_coding	OTTHUMT00000079342.2	-	0.00	33	0	C	XM_371399		42935620	-1	tier1	-	no_errors	ENST00000396825	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152280935	152280935	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:152280935C>T	ENST00000368799.1	-	3	6462	c.6427G>A	c.(6427-6429)Ggg>Agg	p.G2143R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2143	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTTGGCCCCGGGTGTCCA	0.572									Ichthyosis																																								0													397.0	318.0	345.0					1																	152280935		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6427G>A	1.37:g.152280935C>T	ENSP00000357789:p.Gly2143Arg		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.G2143R	ENST00000368799.1	37	c.6427	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	5.472	0.272080	0.10349	.	.	ENSG00000143631	ENST00000368799	T	0.00745	5.75	3.12	-1.78	0.07957	.	.	.	.	.	T	0.00328	0.0010	M	0.69823	2.125	0.09310	N	1	B	0.21225	0.053	B	0.20767	0.031	T	0.40194	-0.9576	9	0.17369	T	0.5	.	3.5169	0.07728	0.0:0.3776:0.201:0.4214	.	2143	P20930	FILA_HUMAN	R	2143	ENSP00000357789:G2143R	ENSP00000357789:G2143R	G	-	1	0	FLG	150547559	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.733000	0.00380	-0.492000	0.06687	-0.350000	0.07774	GGG	FLG	-	NULL	ENSG00000143631		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	169	0	C	NM_002016		152280935	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	13.70	126	20	SNP	0.000	T
FLT3	2322	genome.wustl.edu	37	13	28602427	28602427	+	Splice_Site	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr13:28602427T>A	ENST00000241453.7	-	16	2024		c.e16-2		FLT3_ENST00000380982.4_Splice_Site|FLT3_ENST00000537084.1_Splice_Site	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3						B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.?(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTGCTTTTTCTGTCAAAGAAA	0.383			"""Mis, O"""		"""AML, ALL"""																																			Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	1	Unknown(1)	lung(1)											59.0	51.0	54.0					13																	28602427		2203	4300	6503	SO:0001630	splice_region_variant	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1943-2A>T	13.37:g.28602427T>A			A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Splice_Site	SNP	-	e16-2	ENST00000241453.7	37	c.1943-2	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936179	0.73442	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6684	0.77252	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FLT3	27500427	1.000000	0.71417	0.993000	0.49108	0.755000	0.42902	7.759000	0.85235	2.086000	0.62901	0.454000	0.30748	.	FLT3	-	-	ENSG00000122025		0.383	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2		0.00	48	0	T		Intron	28602427	-1			no_errors	ENST00000380982	ensembl	human	known	74_37	splice_site	5.41	35	2	SNP	1.000	A
FLT1	2321	genome.wustl.edu	37	13	28964125	28964125	+	Silent	SNP	G	G	T	rs377395740	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr13:28964125G>T	ENST00000282397.4	-	13	2028	c.1777C>A	c.(1777-1779)Cgg>Agg	p.R593R	FLT1_ENST00000541932.1_Silent_p.R593R	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	593	Ig-like C2-type 6.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.R593W(2)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTAACTGTCCGCAGTAAAATC	0.393																																																	2	Substitution - Missense(2)	lung(2)											235.0	205.0	215.0					13																	28964125		2203	4300	6503	SO:0001819	synonymous_variant	0			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1777C>A	13.37:g.28964125G>T			A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR1_rcpt	p.R593	ENST00000282397.4	37	c.1777	CCDS9330.1	13																																																																																			FLT1	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000102755		0.393	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1		0.00	56	0	G			28964125	-1			no_errors	ENST00000282397	ensembl	human	known	74_37	silent	6.25	45	3	SNP	1.000	T
FOXJ1	2302	genome.wustl.edu	37	17	74136021	74136021	+	Silent	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:74136021C>A	ENST00000322957.6	-	2	810	c.456G>T	c.(454-456)acG>acT	p.T152T	RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000585542.1_RNA|RNF157_ENST00000589912.1_5'Flank|RNF157-AS1_ENST00000586627.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	152					actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			AGAAGTTGTCCGTGATCCACT	0.632																																																	0													67.0	48.0	54.0					17																	74136021		2203	4300	6503	SO:0001819	synonymous_variant	0			X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.456G>T	17.37:g.74136021C>A			O00630	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.T152	ENST00000322957.6	37	c.456	CCDS32739.1	17																																																																																			FOXJ1	-	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	ENSG00000129654		0.632	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ1	HGNC	protein_coding	OTTHUMT00000449856.1	-	0.00	33	0	C	NM_001454		74136021	-1	tier1	-	no_errors	ENST00000322957	ensembl	human	known	74_37	silent	12.50	21	3	SNP	0.800	A
GAB3	139716	genome.wustl.edu	37	X	153944371	153944371	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chrX:153944371C>T	ENST00000369575.3	-	2	337	c.306G>A	c.(304-306)gaG>gaA	p.E102E	GAB3_ENST00000424127.2_Silent_p.E102E|GAB3_ENST00000496390.1_5'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	102	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCATTTCTTGCTCAGTTTTGG	0.517																																																	0													185.0	157.0	166.0					X																	153944371		2203	4300	6503	SO:0001819	synonymous_variant	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.306G>A	X.37:g.153944371C>T			A6NHF8|E9PB44	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E102	ENST00000369575.3	37	c.306	CCDS14760.1	X																																																																																			GAB3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000160219		0.517	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	-	0.00	42	0	C	NM_001081573		153944371	-1	tier1	-	no_errors	ENST00000424127	ensembl	human	known	74_37	silent	73.08	7	19	SNP	0.998	T
GALNT18	374378	genome.wustl.edu	37	11	11398890	11398890	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:11398890C>T	ENST00000227756.4	-	5	1227	c.816G>A	c.(814-816)cgG>cgA	p.R272R		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	272					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										TGATCCGCTTCCGGTTCTCCT	0.517																																																	0													73.0	66.0	68.0					11																	11398890		2201	4294	6495	SO:0001819	synonymous_variant	0			AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.816G>A	11.37:g.11398890C>T			O95903|Q8NDY9	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R272	ENST00000227756.4	37	c.816	CCDS7807.1	11																																																																																			GALNT18	-	pfam_Glyco_trans_2	ENSG00000110328		0.517	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT18	HGNC	protein_coding	OTTHUMT00000385848.1	-	0.00	55	0	C	NM_198516		11398890	-1	tier1	-	no_errors	ENST00000227756	ensembl	human	known	74_37	silent	12.00	44	6	SNP	1.000	T
GATM	2628	genome.wustl.edu	37	15	45654376	45654376	+	Silent	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:45654376C>A	ENST00000396659.3	-	9	1542	c.1203G>T	c.(1201-1203)ctG>ctT	p.L401L		NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	401					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	AGCCTCCTCCCAGGGAATTGG	0.498																																																	0													94.0	80.0	85.0					15																	45654376		2198	4298	6496	SO:0001819	synonymous_variant	0			S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.1203G>T	15.37:g.45654376C>A			B4DH99|B4DPI3|Q53EQ4	Silent	SNP	NULL	p.L401	ENST00000396659.3	37	c.1203	CCDS10122.1	15																																																																																			GATM	-	NULL	ENSG00000171766		0.498	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATM	HGNC	protein_coding	OTTHUMT00000254220.2		0.00	44	0	C	NM_001482		45654376	-1			no_errors	ENST00000396659	ensembl	human	known	74_37	silent	6.25	45	3	SNP	1.000	A
GDA	9615	genome.wustl.edu	37	9	74828843	74828843	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:74828843G>T	ENST00000358399.3	+	5	607	c.514G>T	c.(514-516)Gat>Tat	p.D172Y	GDA_ENST00000238018.4_Missense_Mutation_p.D172Y|GDA_ENST00000376986.1_Missense_Mutation_p.D130Y|GDA_ENST00000376989.3_Missense_Mutation_p.D147Y|GDA_ENST00000545168.1_Missense_Mutation_p.D98Y|GDA_ENST00000477618.1_3'UTR	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	172					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)	p.D172Y(2)		central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		AGTTTGCATGGATTTGAATGA	0.378																																																	2	Substitution - Missense(2)	endometrium(2)											138.0	133.0	134.0					9																	74828843		2203	4300	6503	SO:0001583	missense	0			AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.514G>T	9.37:g.74828843G>T	ENSP00000351170:p.Asp172Tyr		B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	pfam_Amidohydro_1,tigrfam_Guanine_deaminase	p.D172Y	ENST00000358399.3	37	c.514	CCDS6641.1	9	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658625	0.67586	.	.	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000376989;ENST00000376986;ENST00000358399	D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96	5.64	4.75	0.60458	Amidohydrolase 1 (1);	0.042895	0.85682	D	0.000000	D	0.97390	0.9146	H	0.97051	3.93	0.53688	D	0.999973	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.98459	1.0595	10	0.87932	D	0	-24.3511	14.5061	0.67752	0.0714:0.0:0.9286:0.0	.	130;172;172	Q5SZC6;Q9Y2T3-3;Q9Y2T3	.;.;GUAD_HUMAN	Y	98;172;147;130;172	ENSP00000437972:D98Y;ENSP00000238018:D172Y;ENSP00000366188:D147Y;ENSP00000366185:D130Y;ENSP00000351170:D172Y	ENSP00000238018:D172Y	D	+	1	0	GDA	74018663	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.423000	0.66458	1.400000	0.46741	-0.194000	0.12790	GAT	GDA	-	pfam_Amidohydro_1,tigrfam_Guanine_deaminase	ENSG00000119125		0.378	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDA	HGNC	protein_coding	OTTHUMT00000052633.1	-	0.00	103	0	G			74828843	+1	tier1	-	no_errors	ENST00000238018	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
GGA1	26088	genome.wustl.edu	37	22	38020994	38020994	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr22:38020994A>G	ENST00000343632.4	+	10	1237	c.851A>G	c.(850-852)aAt>aGt	p.N284S	GGA1_ENST00000381756.5_Missense_Mutation_p.N301S|GGA1_ENST00000406772.1_Missense_Mutation_p.N211S|GGA1_ENST00000325180.8_Intron|GGA1_ENST00000337437.4_Missense_Mutation_p.N251S	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	284	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					CTGCAGGCCAATGACAACCTC	0.637																																																	0													63.0	45.0	51.0					22																	38020994		2202	4299	6501	SO:0001583	missense	0			AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.851A>G	22.37:g.38020994A>G	ENSP00000341344:p.Asn284Ser		A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_ENTH_VHS,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.N284S	ENST00000343632.4	37	c.851	CCDS13951.1	22	.	.	.	.	.	.	.	.	.	.	A	16.25	3.070155	0.55539	.	.	ENSG00000100083	ENST00000343632;ENST00000381756;ENST00000337437;ENST00000406772	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.0	5.0	0.66597	GAT (2);	0.000000	0.85682	D	0.000000	T	0.71341	0.3328	L	0.45228	1.405	0.80722	D	1	D;P	0.89917	1.0;0.725	D;P	0.91635	0.999;0.68	T	0.68746	-0.5327	10	0.29301	T	0.29	-20.7756	14.6785	0.68998	1.0:0.0:0.0:0.0	.	301;284	Q6IC75;Q9UJY5	.;GGA1_HUMAN	S	284;301;251;211	ENSP00000341344:N284S;ENSP00000371175:N301S;ENSP00000338647:N251S;ENSP00000385287:N211S	ENSP00000338647:N251S	N	+	2	0	GGA1	36350940	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.213000	0.65230	1.882000	0.54519	0.397000	0.26171	AAT	GGA1	-	pfam_GAT,pfscan_GAT	ENSG00000100083		0.637	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA1	HGNC	protein_coding	OTTHUMT00000075873.3	-	0.00	77	0	A	NM_013365		38020994	+1	tier1	-	no_errors	ENST00000343632	ensembl	human	known	74_37	missense	24.56	41	14	SNP	1.000	G
GLB1	2720	genome.wustl.edu	37	3	33065806	33065806	+	Silent	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:33065806T>C	ENST00000399402.3	-	11	1121	c.990A>G	c.(988-990)gtA>gtG	p.V330V	GLB1_ENST00000307363.5_Silent_p.V360V|GLB1_ENST00000307377.8_Silent_p.V229V|GLB1_ENST00000497796.1_5'UTR|GLB1_ENST00000445488.2_Silent_p.V408V	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	360					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				GACCTTCTGGTACTTTTTCAA	0.308																																																	0													45.0	41.0	42.0					3																	33065806		1794	4058	5852	SO:0001819	synonymous_variant	0			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.990A>G	3.37:g.33065806T>C			B2R7H8|B7Z6B0|P16279	Silent	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.V408	ENST00000399402.3	37	c.1224	CCDS43062.1	3																																																																																			GLB1	-	superfamily_Glycoside_hydrolase_SF	ENSG00000170266		0.308	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	GLB1	HGNC	protein_coding	OTTHUMT00000341570.2	-	0.00	41	0	T	NM_000404		33065806	-1	tier1	-	no_errors	ENST00000445488	ensembl	human	known	74_37	silent	12.90	27	4	SNP	0.973	C
GLIS3	169792	genome.wustl.edu	37	9	4118563	4118563	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:4118563C>A	ENST00000324333.10	-	3	643	c.450G>T	c.(448-450)ttG>ttT	p.L150F	GLIS3_ENST00000381971.3_Missense_Mutation_p.L305F	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	150	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		ACAGCGGGGACAAGGACAGCG	0.597																																																	0													111.0	98.0	102.0					9																	4118563		2203	4300	6503	SO:0001583	missense	0			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.450G>T	9.37:g.4118563C>A	ENSP00000325494:p.Leu150Phe		B1AL19|Q1PHK5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L305F	ENST00000324333.10	37	c.915	CCDS6451.1	9	.	.	.	.	.	.	.	.	.	.	C	13.69	2.312253	0.40895	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	T;T	0.12465	2.72;2.68	5.59	3.66	0.41972	.	0.000000	0.39274	N	0.001404	T	0.30230	0.0758	M	0.70595	2.14	0.41676	D	0.989267	D;D	0.71674	0.998;0.997	D;D	0.69142	0.962;0.916	T	0.00834	-1.1547	10	0.46703	T	0.11	.	8.7132	0.34395	0.1147:0.7068:0.1116:0.0669	.	305;150	Q8NEA6-2;Q8NEA6	.;GLIS3_HUMAN	F	150;305	ENSP00000325494:L150F;ENSP00000371398:L305F	ENSP00000325494:L150F	L	-	3	2	GLIS3	4108563	0.947000	0.32204	1.000000	0.80357	0.180000	0.23129	0.293000	0.19029	2.633000	0.89246	0.655000	0.94253	TTG	GLIS3	-	NULL	ENSG00000107249		0.597	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000051559.1	-	0.00	72	0	C	NM_152629		4118563	-1	tier1	-	no_errors	ENST00000381971	ensembl	human	known	74_37	missense	27.91	31	12	SNP	1.000	A
GNL1	2794	genome.wustl.edu	37	6	30515132	30515132	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:30515132C>A	ENST00000376621.3	-	9	2245	c.1275G>T	c.(1273-1275)ttG>ttT	p.L425F		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	425					cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						GTCATACCTGCAACTGCCTAG	0.542																																																	0													217.0	211.0	213.0					6																	30515132		2203	4300	6503	SO:0001583	missense	0				CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.1275G>T	6.37:g.30515132C>A	ENSP00000365806:p.Leu425Phe		B0S838|Q96CT5	Missense_Mutation	SNP	pfam_GTP_binding_domain,superfamily_P-loop_NTPase	p.L425F	ENST00000376621.3	37	c.1275	CCDS4680.1	6	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052750	0.55218	.	.	ENSG00000204590	ENST00000376621;ENST00000426875;ENST00000429126	T	0.49139	0.79	5.19	3.26	0.37387	.	0.077759	0.52532	D	0.000080	T	0.26231	0.0640	L	0.41632	1.29	0.50171	D	0.999857	P;P;B	0.49090	0.727;0.919;0.134	P;P;B	0.51229	0.461;0.663;0.062	T	0.08597	-1.0714	10	0.10111	T	0.7	-16.2531	8.0279	0.30448	0.0:0.7526:0.0:0.2474	.	423;222;425	B4DYK6;B4DWZ0;P36915	.;.;GNL1_HUMAN	F	425;247;222	ENSP00000365806:L425F	ENSP00000365806:L425F	L	-	3	2	GNL1	30623111	0.999000	0.42202	1.000000	0.80357	0.979000	0.70002	0.441000	0.21611	1.419000	0.47118	0.561000	0.74099	TTG	GNL1	-	superfamily_P-loop_NTPase	ENSG00000204590		0.542	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL1	HGNC	protein_coding	OTTHUMT00000076241.2	-	0.00	61	0	C			30515132	-1	tier1	-	no_errors	ENST00000376621	ensembl	human	known	74_37	missense	10.20	44	5	SNP	1.000	A
GOLGA2	2801	genome.wustl.edu	37	9	131020104	131020104	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:131020104C>T	ENST00000421699.2	-	23	2507	c.2495G>A	c.(2494-2496)cGc>cAc	p.R832H	GOLGA2_ENST00000609374.1_Missense_Mutation_p.R820H|AL590708.1_ENST00000408370.1_RNA	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	832					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						CTGGATGCAGCGATGTTCCAG	0.557																																																	0													358.0	347.0	351.0					9																	131020104		2203	4300	6503	SO:0001583	missense	0			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2495G>A	9.37:g.131020104C>T	ENSP00000416097:p.Arg832His		Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	superfamily_CofA_tubulin-bd	p.R832H	ENST00000421699.2	37	c.2495	CCDS6896.2	9	.	.	.	.	.	.	.	.	.	.	c	19.08	3.758423	0.69763	.	.	ENSG00000167110	ENST00000421699;ENST00000342583	T	0.28255	1.62	4.56	4.56	0.56223	.	0.148879	0.64402	D	0.000007	T	0.52917	0.1764	M	0.77103	2.36	0.52501	D	0.999959	D;D	0.89917	0.999;1.0	P;D	0.64042	0.897;0.921	T	0.51236	-0.8731	10	0.18710	T	0.47	.	17.5217	0.87789	0.0:1.0:0.0:0.0	.	832;450	Q08379;Q08379-2	GOGA2_HUMAN;.	H	832;116	ENSP00000416097:R832H	ENSP00000342692:R116H	R	-	2	0	GOLGA2	130059925	1.000000	0.71417	0.823000	0.32752	0.185000	0.23345	5.620000	0.67736	2.350000	0.79820	0.650000	0.86243	CGC	GOLGA2	-	NULL	ENSG00000167110		0.557	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA2	HGNC	protein_coding	OTTHUMT00000054358.2		0.00	94	0	C	NM_004486		131020104	-1			no_errors	ENST00000421699	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
GPR75-ASB3	100302652	genome.wustl.edu	37	2	53941641	53941641	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:53941641G>A	ENST00000263634.3	-	7	994	c.860C>T	c.(859-861)gCa>gTa	p.A287V	ASB3_ENST00000406625.2_Missense_Mutation_p.A322V|GPR75-ASB3_ENST00000394717.2_Missense_Mutation_p.A214V|GPR75-ASB3_ENST00000482829.1_5'UTR|ASB3_ENST00000498475.2_5'UTR|GPR75-ASB3_ENST00000406687.1_Missense_Mutation_p.A214V|GPR75-ASB3_ENST00000352846.3_Missense_Mutation_p.A325V	NM_016115.4	NP_057199.1			GPR75-ASB3 readthrough																		CCCAAACACTGCTGAGTAAAC	0.458																																																	0													151.0	145.0	147.0					2																	53941641		2203	4300	6503	SO:0001583	missense	0				CCDS54361.1	2p16	2013-01-23			ENSG00000115239	ENSG00000115239			40043	other	readthrough							Standard	NM_001164165		Approved				OTTHUMG00000129279	ENST00000263634.3:c.860C>T	2.37:g.53941641G>A	ENSP00000263634:p.Ala287Val			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.A325V	ENST00000263634.3	37	c.974	CCDS1846.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.901922	0.97087	.	.	ENSG00000115239	ENST00000263634;ENST00000406625;ENST00000406687;ENST00000394717;ENST00000352846;ENST00000446049	D;D;D;D;D	0.87256	-1.53;-1.53;-2.23;-2.23;-1.53	6.02	6.02	0.97574	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.96144	0.8743	H	0.96460	3.825	0.42578	D	0.993205	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.96554	0.9410	9	0.87932	D	0	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	204;322;287	B4DZX6;Q2TAI4;Q9Y575	.;.;ASB3_HUMAN	V	287;322;214;214;325;204	ENSP00000263634:A287V;ENSP00000385085:A322V;ENSP00000384728:A214V;ENSP00000378206:A214V;ENSP00000313756:A325V	ENSP00000263634:A287V	A	-	2	0	ASB3	53795145	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.137000	0.94496	2.865000	0.98341	0.655000	0.94253	GCA	GPR75-ASB3	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000115239		0.458	GPR75-ASB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR75-ASB3	HGNC	protein_coding	OTTHUMT00000251402.3	-	0.00	112	0	G			53941641	-1	tier1	-	no_errors	ENST00000352846	ensembl	human	known	74_37	missense	5.31	107	6	SNP	1.000	A
GPR17	2840	genome.wustl.edu	37	2	128408503	128408503	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:128408503C>A	ENST00000272644.3	+	3	352	c.278C>A	c.(277-279)cCg>cAg	p.P93Q	LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000409254.1_5'Flank|LIMS2_ENST00000545738.2_Intron|GPR17_ENST00000544369.1_Missense_Mutation_p.P93Q|GPR17_ENST00000393018.3_Missense_Mutation_p.P93Q|GPR17_ENST00000486700.1_3'UTR|LIMS2_ENST00000409455.1_Intron|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000410038.1_5'Flank	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	93					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		TCCGGGACCCCGGCCAACGTG	0.582																																																	0													91.0	88.0	89.0					2																	128408503		2203	4300	6503	SO:0001583	missense	0				CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.278C>A	2.37:g.128408503C>A	ENSP00000272644:p.Pro93Gln		A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.P93Q	ENST00000272644.3	37	c.278	CCDS2148.1	2	.	.	.	.	.	.	.	.	.	.	c	20.6	4.014064	0.75161	.	.	ENSG00000144230	ENST00000544369;ENST00000272644;ENST00000423019;ENST00000393018	T;T;T;T	0.50548	1.27;1.27;0.74;1.27	5.47	5.47	0.80525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75443	0.3850	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77525	-0.2555	10	0.40728	T	0.16	.	19.3366	0.94322	0.0:1.0:0.0:0.0	.	93	Q13304	GPR17_HUMAN	Q	93	ENSP00000442982:P93Q;ENSP00000272644:P93Q;ENSP00000387970:P93Q;ENSP00000376741:P93Q	ENSP00000272644:P93Q	P	+	2	0	GPR17	128124973	1.000000	0.71417	0.956000	0.39512	0.854000	0.48673	7.791000	0.85805	2.573000	0.86826	0.655000	0.94253	CCG	GPR17	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000144230		0.582	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR17	HGNC	protein_coding	OTTHUMT00000254390.1		0.00	36	0	C			128408503	+1			no_errors	ENST00000272644	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.998	A
GPX8	493869	genome.wustl.edu	37	5	54460112	54460113	+	3'UTR	INS	-	-	T	rs552883936		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:54460112_54460113insT	ENST00000503787.1	+	0	771_772				CDC20B_ENST00000296733.1_Intron|GPX8_ENST00000506123.1_3'UTR|CDC20B_ENST00000331730.3_Intron|GPX8_ENST00000515370.1_3'UTR|CDC20B_ENST00000381375.2_Intron|GPX8_ENST00000296734.6_3'UTR|CDC20B_ENST00000322374.6_Intron|CDC20B_ENST00000334206.5_Intron	NM_001008397.2	NP_001008398.2	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8 (putative)						response to oxidative stress (GO:0006979)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	glutathione peroxidase activity (GO:0004602)|peroxidase activity (GO:0004601)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)	11					Glutathione(DB00143)	CATTTTAAACAttttttttttg	0.396																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC029424	CCDS34156.1	5q11.2	2008-09-29				ENSG00000164294			33100	protein-coding gene	gene with protein product							Standard	NM_001008397		Approved	UNQ847, EPLA847	uc003jpq.2	Q8TED1		ENST00000503787.1:c.*67->T	5.37:g.54460122_54460122dupT				RNA	INS	-	NULL	ENST00000503787.1	37	NULL	CCDS34156.1	5																																																																																			GPX8	-	-	ENSG00000164294		0.396	GPX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPX8	HGNC	protein_coding	OTTHUMT00000369717.1		0.00	27	0	-	NM_001008397		54460113	+1	tier1		no_errors	ENST00000506123	ensembl	human	known	74_37	rna	10.00	27	3	INS	0.000:0.000	T
GRM3	2913	genome.wustl.edu	37	7	86468286	86468286	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:86468286T>C	ENST00000361669.2	+	4	2555	c.1456T>C	c.(1456-1458)Tgg>Cgg	p.W486R	GRM3_ENST00000536043.1_Missense_Mutation_p.W358R|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000394720.2_Intron|GRM3_ENST00000546348.1_Missense_Mutation_p.W78R	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	486					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AGTTGGTCACTGGGCAGAAAC	0.473																																					GBM(52;969 1098 3139 52280)												0													83.0	76.0	78.0					7																	86468286		2203	4300	6503	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1456T>C	7.37:g.86468286T>C	ENSP00000355316:p.Trp486Arg		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B	p.W486R	ENST00000361669.2	37	c.1456	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	T	18.50	3.636990	0.67130	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.91464	-2.46;-2.85;-2.46	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.93766	0.8007	L	0.52573	1.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.94332	0.7563	10	0.87932	D	0	.	15.5295	0.75942	0.0:0.0:0.0:1.0	.	78;358;486	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	R	486;78;358	ENSP00000355316:W486R;ENSP00000444064:W78R;ENSP00000441407:W358R	ENSP00000355316:W486R	W	+	1	0	GRM3	86306222	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.040000	0.89188	2.254000	0.74563	0.533000	0.62120	TGG	GRM3	-	superfamily_Peripla_BP_I	ENSG00000198822		0.473	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	-	0.00	110	0	T			86468286	+1	tier1	-	no_errors	ENST00000361669	ensembl	human	known	74_37	missense	16.84	79	16	SNP	1.000	C
GUCA2B	2981	genome.wustl.edu	37	1	42620505	42620505	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:42620505C>T	ENST00000372581.1	+	2	275	c.245C>T	c.(244-246)tCg>tTg	p.S82L		NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)	82					body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTCTGCGCCTCGCAGGAGGCT	0.682																																																	0													51.0	50.0	51.0					1																	42620505		2203	4300	6503	SO:0001583	missense	0			BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.245C>T	1.37:g.42620505C>T	ENSP00000361662:p.Ser82Leu		Q52LV0	Missense_Mutation	SNP	pfam_Guanylin,superfamily_Guanylin,pirsf_Guanylin,prints_Guanylin	p.S82L	ENST00000372581.1	37	c.245	CCDS464.1	1	.	.	.	.	.	.	.	.	.	.	C	9.631	1.136430	0.21123	.	.	ENSG00000044012	ENST00000372581	T	0.46819	0.86	4.83	0.301	0.15781	.	0.713494	0.13579	N	0.377465	T	0.36826	0.0981	M	0.64997	1.995	0.09310	N	1	B	0.22683	0.073	B	0.21151	0.033	T	0.36553	-0.9743	10	0.48119	T	0.1	-14.4787	1.0976	0.01676	0.1621:0.3814:0.2461:0.2104	.	82	Q16661	GUC2B_HUMAN	L	82	ENSP00000361662:S82L	ENSP00000361662:S82L	S	+	2	0	GUCA2B	42393092	0.001000	0.12720	0.001000	0.08648	0.304000	0.27724	0.438000	0.21559	0.463000	0.27118	0.609000	0.83330	TCG	GUCA2B	-	pfam_Guanylin,superfamily_Guanylin,pirsf_Guanylin,prints_Guanylin	ENSG00000044012		0.682	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA2B	HGNC	protein_coding	OTTHUMT00000018307.1	-	0.00	13	0	C	NM_007102		42620505	+1	tier1	-	no_errors	ENST00000372581	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.000	T
GUCA2B	2981	genome.wustl.edu	37	1	42621215	42621215	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:42621215C>A	ENST00000372581.1	+	3	317	c.287C>A	c.(286-288)gCt>gAt	p.A96D		NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)	96					body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGGACCATCGCTAACGACGAC	0.617																																																	0													215.0	159.0	178.0					1																	42621215		2203	4300	6503	SO:0001583	missense	0			BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.287C>A	1.37:g.42621215C>A	ENSP00000361662:p.Ala96Asp		Q52LV0	Missense_Mutation	SNP	pfam_Guanylin,superfamily_Guanylin,pirsf_Guanylin,prints_Guanylin	p.A96D	ENST00000372581.1	37	c.287	CCDS464.1	1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.705936	0.30232	.	.	ENSG00000044012	ENST00000372581	T	0.51574	0.7	4.74	3.8	0.43715	.	0.472963	0.21739	N	0.069846	T	0.42921	0.1224	L	0.54323	1.7	0.20563	N	0.99989	B	0.24618	0.107	B	0.26202	0.067	T	0.40440	-0.9563	10	0.54805	T	0.06	-8.4098	10.1028	0.42515	0.2004:0.7995:0.0:0.0	.	96	Q16661	GUC2B_HUMAN	D	96	ENSP00000361662:A96D	ENSP00000361662:A96D	A	+	2	0	GUCA2B	42393802	0.157000	0.22836	0.015000	0.15790	0.011000	0.07611	2.186000	0.42593	0.940000	0.37473	0.563000	0.77884	GCT	GUCA2B	-	pfam_Guanylin,superfamily_Guanylin,pirsf_Guanylin	ENSG00000044012		0.617	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA2B	HGNC	protein_coding	OTTHUMT00000018307.1		0.00	21	0	C	NM_007102		42621215	+1			no_errors	ENST00000372581	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.238	A
HDAC5	10014	genome.wustl.edu	37	17	42160016	42160016	+	Silent	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:42160016T>A	ENST00000393622.2	-	20	2875	c.2544A>T	c.(2542-2544)gtA>gtT	p.V848V	HDAC5_ENST00000225983.6_Silent_p.V849V|HDAC5_ENST00000336057.5_Silent_p.V763V|HDAC5_ENST00000586802.1_Silent_p.V848V	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	848	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		CGGTGATGGCTACAGAGTTGA	0.592																																																	0													100.0	89.0	93.0					17																	42160016		2203	4300	6503	SO:0001819	synonymous_variant	0			AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.2544A>T	17.37:g.42160016T>A			C9JFV9|O60340|O60528|Q96DY4	Silent	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.V849	ENST00000393622.2	37	c.2547	CCDS45696.1	17																																																																																			HDAC5	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	ENSG00000108840		0.592	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	HGNC	protein_coding	OTTHUMT00000457686.1	-	0.00	55	0	T	NM_001015053		42160016	-1	tier1	-	no_errors	ENST00000225983	ensembl	human	known	74_37	silent	46.27	36	31	SNP	0.997	A
HIST1H1B	3009	genome.wustl.edu	37	6	27835282	27835282	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:27835282G>T	ENST00000331442.3	-	1	77	c.26C>A	c.(25-27)aCa>aAa	p.T9K		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	9					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						TGGGGTGGCTGTCTCGGCAGG	0.592																																																	0													19.0	23.0	22.0					6																	27835282		2108	4104	6212	SO:0001583	missense	0			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.26C>A	6.37:g.27835282G>T	ENSP00000330074:p.Thr9Lys		Q14529|Q3MJ42	Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.T9K	ENST00000331442.3	37	c.26	CCDS4635.1	6	.	.	.	.	.	.	.	.	.	.	G	15.69	2.909007	0.52439	.	.	ENSG00000184357	ENST00000331442	T	0.03889	3.77	5.58	5.58	0.84498	.	0.135015	0.33572	N	0.004775	T	0.01765	0.0056	N	0.08118	0	0.49483	D	0.999798	B	0.26400	0.148	B	0.22152	0.038	T	0.54596	-0.8270	10	0.72032	D	0.01	-35.6893	18.5435	0.91038	0.0:0.0:1.0:0.0	.	9	P16401	H15_HUMAN	K	9	ENSP00000330074:T9K	ENSP00000330074:T9K	T	-	2	0	HIST1H1B	27943261	0.885000	0.30320	0.821000	0.32701	0.030000	0.12068	2.686000	0.46968	2.793000	0.96121	0.655000	0.94253	ACA	HIST1H1B	-	NULL	ENSG00000184357		0.592	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1B	HGNC	protein_coding	OTTHUMT00000043371.1	-	0.00	76	0	G	NM_005322		27835282	-1	tier1	-	no_errors	ENST00000331442	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.893	T
HIST1H2AM	8336	genome.wustl.edu	37	6	27860562	27860562	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:27860562C>T	ENST00000359611.2	-	1	401	c.366G>A	c.(364-366)gaG>gaA	p.E122E	HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	122						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						TGTGGTGGCTCTCAGTCTTCT	0.493																																																	0													125.0	121.0	122.0					6																	27860562		2203	4300	6503	SO:0001819	synonymous_variant	0			X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.366G>A	6.37:g.27860562C>T			P02261|Q2M1R2|Q76PA6	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E122	ENST00000359611.2	37	c.366	CCDS4639.1	6																																																																																			HIST1H2AM	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000233224		0.493	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AM	HGNC	protein_coding	OTTHUMT00000040162.1	-	0.00	135	0	C	NM_003514		27860562	-1	tier1	-	no_errors	ENST00000359611	ensembl	human	known	74_37	silent	13.79	100	16	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186099708	186099708	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:186099708A>C	ENST00000271588.4	+	85	13338	c.13109A>C	c.(13108-13110)aAt>aCt	p.N4370T	HMCN1_ENST00000367492.2_Missense_Mutation_p.N4370T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4370	Ig-like C2-type 43.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCAATCCTGAATTGTGAGGTG	0.463																																																	0													108.0	104.0	106.0					1																	186099708		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13109A>C	1.37:g.186099708A>C	ENSP00000271588:p.Asn4370Thr		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.N4370T	ENST00000271588.4	37	c.13109	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.510111	0.85282	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66280	-0.2;-0.2	5.58	5.58	0.84498	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.083018	0.85682	D	0.000000	T	0.49047	0.1534	N	0.04724	-0.175	0.58432	D	0.999999	P	0.48834	0.916	P	0.49252	0.604	T	0.50268	-0.8848	10	0.19590	T	0.45	.	16.0439	0.80704	1.0:0.0:0.0:0.0	.	4370	Q96RW7	HMCN1_HUMAN	T	4370	ENSP00000271588:N4370T;ENSP00000356462:N4370T	ENSP00000271588:N4370T	N	+	2	0	HMCN1	184366331	1.000000	0.71417	0.792000	0.32020	0.997000	0.91878	9.277000	0.95755	2.250000	0.74265	0.482000	0.46254	AAT	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.463	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	78	0	A	NM_031935		186099708	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	10.17	53	6	SNP	1.000	C
HMCN1	83872	genome.wustl.edu	37	1	186113763	186113763	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:186113763C>T	ENST00000271588.4	+	91	14423	c.14194C>T	c.(14194-14196)Ccc>Tcc	p.P4732S	HMCN1_ENST00000367492.2_Missense_Mutation_p.P4732S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4732	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CGACCCTGTGCCCCAGTATGG	0.532																																																	0													132.0	123.0	126.0					1																	186113763		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14194C>T	1.37:g.186113763C>T	ENSP00000271588:p.Pro4732Ser		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.P4732S	ENST00000271588.4	37	c.14194	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946023	0.92593	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.61627	0.09;0.09	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.80934	0.4719	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82729	-0.0313	10	0.66056	D	0.02	.	20.1143	0.97922	0.0:1.0:0.0:0.0	.	4732	Q96RW7	HMCN1_HUMAN	S	4732	ENSP00000271588:P4732S;ENSP00000356462:P4732S	ENSP00000271588:P4732S	P	+	1	0	HMCN1	184380386	1.000000	0.71417	0.964000	0.40570	0.945000	0.59286	5.747000	0.68689	2.765000	0.95021	0.650000	0.86243	CCC	HMCN1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.532	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1		0.00	56	0	C	NM_031935		186113763	+1			no_errors	ENST00000271588	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
HNF1A	6927	genome.wustl.edu	37	12	121435420	121435420	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:121435420A>G	ENST00000257555.6	+	7	1679	c.1453A>G	c.(1453-1455)Acc>Gcc	p.T485A	HNF1A_ENST00000544413.1_Missense_Mutation_p.T485A|HNF1A_ENST00000541395.1_Missense_Mutation_p.T485A|HNF1A_ENST00000402929.1_3'UTR|HNF1A_ENST00000400024.2_Missense_Mutation_p.T485A|HNF1A_ENST00000538626.1_Missense_Mutation_p.T67A|RP11-216P16.2_ENST00000606238.1_RNA			P20823	HNF1A_HUMAN	HNF1 homeobox A	485					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAGCCATGTGACCCAGAGCCC	0.652									Hepatic Adenoma, Familial Clustering of																																								0													30.0	29.0	29.0					12																	121435420		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1453A>G	12.37:g.121435420A>G	ENSP00000257555:p.Thr485Ala		A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.T485A	ENST00000257555.6	37	c.1453	CCDS9209.1	12	.	.	.	.	.	.	.	.	.	.	A	0.038	-1.295988	0.01375	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000537424;ENST00000543027;ENST00000541395;ENST00000340577;ENST00000544413	D;D;D	0.96716	-4.1;-4.1;-4.1	4.49	2.64	0.31445	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.421727	0.21678	N	0.070776	T	0.80602	0.4654	N	0.00399	-1.545	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.74973	-0.3481	10	0.02654	T	1	-17.954	7.1317	0.25504	0.3222:0.0:0.6778:0.0	.	485;485;485	F5H0K0;P20823;E7EUQ4	.;HNF1A_HUMAN;.	A	485;377;485;306;485;485;485	ENSP00000257555:T485A;ENSP00000443112:T485A;ENSP00000438804:T485A	ENSP00000257555:T485A	T	+	1	0	HNF1A	119919803	1.000000	0.71417	0.979000	0.43373	0.453000	0.32348	1.807000	0.38902	0.504000	0.28082	-0.242000	0.12053	ACC	HNF1A	-	pfam_HNF1b_C	ENSG00000135100		0.652	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320957.5	-	0.00	26	0	A	NM_000545		121435420	+1	tier1	-	no_errors	ENST00000257555	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	G
HNRNPR	10236	genome.wustl.edu	37	1	23670802	23670802	+	5'UTR	DEL	T	T	-	rs35952129	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:23670802delT	ENST00000374612.1	-	0	13				HNRNPR_ENST00000426846.2_5'Flank|HNRNPR_ENST00000302271.6_5'Flank|HNRNPR_ENST00000374616.3_5'UTR|HNRNPR_ENST00000478691.1_5'UTR|HNRNPR_ENST00000606561.1_5'Flank|HNRNPR_ENST00000427764.2_5'Flank	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		CTCCCCCCCCTGATGGACTGA	0.692														603	0.120407	0.0764	0.1196	5008	,	,		10228	0.0258		0.2286	False		,,,				2504	0.1667																0																																										SO:0001623	5_prime_UTR_variant	0			AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.-111A>-	1.37:g.23670802delT			Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	RNA	DEL	-	NULL	ENST00000374612.1	37	NULL	CCDS232.1	1																																																																																			HNRNPR	-	-	ENSG00000125944		0.692	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	HGNC	protein_coding	OTTHUMT00000008889.1		0.00	60	0	T	NM_005826		23670802	-1	tier1		no_errors	ENST00000490652	ensembl	human	known	74_37	rna	21.33	59	16	DEL	0.979	-
HOXA5	3202	genome.wustl.edu	37	7	27183145	27183145	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:27183145T>C	ENST00000222726.3	-	1	142	c.82A>G	c.(82-84)Agt>Ggt	p.S28G	HOXA5_ENST00000520854.1_5'Flank|HOXA-AS3_ENST00000521197.1_RNA|HOXA6_ENST00000521478.1_5'Flank|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	28					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						CTCACGGAACTATGATCTCCA	0.507																																					Colon(119;75 2200 7557 42868)												0													72.0	76.0	74.0					7																	27183145		2203	4300	6503	SO:0001583	missense	0				CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.82A>G	7.37:g.27183145T>C	ENSP00000222726:p.Ser28Gly		A4D179|O43367|Q96CY6	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.S28G	ENST00000222726.3	37	c.82	CCDS5406.1	7	.	.	.	.	.	.	.	.	.	.	T	10.86	1.470000	0.26423	.	.	ENSG00000106004	ENST00000222726	D	0.91740	-2.9	5.56	5.56	0.83823	.	0.092293	0.64402	D	0.000001	D	0.87497	0.6192	L	0.39514	1.22	0.36478	D	0.867651	B	0.02656	0.0	B	0.04013	0.001	D	0.84699	0.0727	10	0.12103	T	0.63	.	15.3799	0.74648	0.0:0.0:0.0:1.0	.	28	P20719	HXA5_HUMAN	G	28	ENSP00000222726:S28G	ENSP00000222726:S28G	S	-	1	0	HOXA5	27149670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.789000	0.62446	2.102000	0.63906	0.482000	0.46254	AGT	HOXA5	-	NULL	ENSG00000106004		0.507	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA5	HGNC	protein_coding	OTTHUMT00000358705.1		0.00	76	0	T			27183145	-1			no_errors	ENST00000222726	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	C
HRNR	388697	genome.wustl.edu	37	1	152191248	152191248	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:152191248G>T	ENST00000368801.2	-	3	2932	c.2857C>A	c.(2857-2859)Cac>Aac	p.H953N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	953					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGAGGAGTGACCTGAGCCA	0.547																																																	0													268.0	263.0	265.0					1																	152191248		2203	4297	6500	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2857C>A	1.37:g.152191248G>T	ENSP00000357791:p.His953Asn		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.H953N	ENST00000368801.2	37	c.2857	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	G	5.405	0.260000	0.10239	.	.	ENSG00000197915	ENST00000368801	T	0.01613	4.73	3.62	0.135	0.14775	.	.	.	.	.	T	0.00468	0.0015	L	0.34521	1.04	0.09310	N	1	B	0.27625	0.183	B	0.21708	0.036	T	0.42015	-0.9476	9	0.18276	T	0.48	.	5.8623	0.18754	0.1151:0.3699:0.515:0.0	.	953	Q86YZ3	HORN_HUMAN	N	953	ENSP00000357791:H953N	ENSP00000357791:H953N	H	-	1	0	HRNR	150457872	0.007000	0.16637	0.000000	0.03702	0.007000	0.05969	0.526000	0.22971	0.176000	0.19873	0.456000	0.33151	CAC	HRNR	-	NULL	ENSG00000197915		0.547	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	147	0	G	XM_373868		152191248	-1	tier1	-	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	24.59	92	30	SNP	0.000	T
HTT	3064	genome.wustl.edu	37	4	3136265	3136265	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:3136265C>T	ENST00000355072.5	+	19	2776	c.2631C>T	c.(2629-2631)ttC>ttT	p.F877F		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	877					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGATTGACTTCAGGTAAGTGA	0.443																																																	0													133.0	122.0	126.0					4																	3136265		1989	4165	6154	SO:0001819	synonymous_variant	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.2631C>T	4.37:g.3136265C>T			Q9UQB7	Silent	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.F877	ENST00000355072.5	37	c.2631	CCDS43206.1	4																																																																																			HTT	-	superfamily_ARM-type_fold	ENSG00000197386		0.443	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	-	0.00	52	0	C	NM_002111		3136265	+1	tier1	-	no_errors	ENST00000355072	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.916	T
ITPKA	3706	genome.wustl.edu	37	15	41793750	41793750	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:41793750G>A	ENST00000260386.5	+	2	632	c.579G>A	c.(577-579)ggG>ggA	p.G193G		NM_002220.2	NP_002211.1	P23677	IP3KA_HUMAN	inositol-trisphosphate 3-kinase A	193					actin cytoskeleton organization (GO:0030036)|dendritic spine maintenance (GO:0097062)|inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|positive regulation of dendritic spine morphogenesis (GO:0061003)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendritic spine (GO:0043197)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			kidney(1)|lung(3)|skin(1)	5		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;7.63e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		AGCTGGCAGGGCACACTGGTG	0.647																																																	0													17.0	15.0	16.0					15																	41793750		2200	4298	6498	SO:0001819	synonymous_variant	0			X54938	CCDS10076.1	15q15.1	2011-04-28	2011-04-28		ENSG00000137825	ENSG00000137825	2.7.1.127		6178	protein-coding gene	gene with protein product		147521	"""inositol 1,4,5-trisphosphate 3-kinase A"""			1330886, 2175886	Standard	NM_002220		Approved	IP3KA, IP3-3KA	uc001znz.3	P23677	OTTHUMG00000130343	ENST00000260386.5:c.579G>A	15.37:g.41793750G>A			Q8TAN3	Silent	SNP	pfam_IPK	p.G193	ENST00000260386.5	37	c.579	CCDS10076.1	15																																																																																			ITPKA	-	NULL	ENSG00000137825		0.647	ITPKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKA	HGNC	protein_coding	OTTHUMT00000252695.3	-	0.00	45	0	G	NM_002220		41793750	+1	tier1	-	no_errors	ENST00000260386	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.957	A
ITSN1	6453	genome.wustl.edu	37	21	35208798	35208798	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr21:35208798G>A	ENST00000381318.3	+	29	3811	c.3523G>A	c.(3523-3525)Gcc>Acc	p.A1175T	ITSN1_ENST00000399352.1_Missense_Mutation_p.A1170T|ITSN1_ENST00000381291.4_Missense_Mutation_p.A1175T|ITSN1_ENST00000381285.4_Missense_Mutation_p.A1175T|ITSN1_ENST00000399353.1_Missense_Mutation_p.A1133T|ITSN1_ENST00000399349.1_Missense_Mutation_p.A1099T|ITSN1_ENST00000437442.2_Missense_Mutation_p.A1170T|ITSN1_ENST00000399367.3_Missense_Mutation_p.A1170T|ITSN1_ENST00000399355.2_Missense_Mutation_p.A1104T|ITSN1_ENST00000399326.3_3'UTR|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000379960.5_3'UTR	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1175	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CGATGAGCTGGCCTTCAACAA	0.562																																																	0													88.0	75.0	79.0					21																	35208798		2203	4300	6503	SO:0001583	missense	0			AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.3523G>A	21.37:g.35208798G>A	ENSP00000370719:p.Ala1175Thr		A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_dom,superfamily_DH-domain,superfamily_C2_dom,superfamily_SH3_domain,superfamily_P-loop_NTPase,smart_EPS15_homology,smart_EF_hand_dom,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.A1175T	ENST00000381318.3	37	c.3523	CCDS33545.1	21	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324724	0.81580	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000437442	T;T;T;T;T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69	4.46	4.46	0.54185	Src homology-3 domain (5);	0.059795	0.64402	D	0.000003	T	0.26448	0.0646	N	0.02379	-0.575	0.80722	D	1	B;D;B;D;B;D;P;B;P	0.64830	0.088;0.994;0.048;0.989;0.126;0.98;0.79;0.123;0.743	B;D;B;P;B;P;B;B;P	0.73380	0.407;0.98;0.184;0.833;0.344;0.833;0.389;0.267;0.661	T	0.51505	-0.8697	10	0.40728	T	0.16	.	17.1476	0.86770	0.0:0.0:1.0:0.0	.	1067;1138;1062;1170;1104;1170;1175;1099;1133	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;ITSN1_HUMAN;.;.	T	1133;1175;1175;1175;1104;1170;1170;1104;1099;1170	ENSP00000382290:A1133T;ENSP00000370719:A1175T;ENSP00000370691:A1175T;ENSP00000370685:A1175T;ENSP00000382301:A1170T;ENSP00000382289:A1170T;ENSP00000382292:A1104T;ENSP00000382286:A1099T;ENSP00000387377:A1170T	ENSP00000370685:A1175T	A	+	1	0	ITSN1	34130668	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.327000	0.72910	2.018000	0.59344	0.637000	0.83480	GCC	ITSN1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	ENSG00000205726		0.562	ITSN1-001	KNOWN	basic|CCDS	protein_coding	ITSN1	HGNC	protein_coding	OTTHUMT00000140070.4		0.00	45	0	G	NM_003024		35208798	+1			no_errors	ENST00000381285	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	A
KANSL3	55683	genome.wustl.edu	37	2	97271233	97271233	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:97271233T>A	ENST00000431828.1	-	15	1833	c.1757A>T	c.(1756-1758)gAa>gTa	p.E586V	KANSL3_ENST00000487070.1_5'UTR|KANSL3_ENST00000440133.1_Missense_Mutation_p.E406V|KANSL3_ENST00000441706.2_Missense_Mutation_p.E499V|KANSL3_ENST00000599854.1_Missense_Mutation_p.E499V			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	612					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CTCTGGTGGTTCTGATGAAAT	0.498																																																	0													101.0	100.0	101.0					2																	97271233		1978	4164	6142	SO:0001583	missense	0			BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.1757A>T	2.37:g.97271233T>A	ENSP00000396749:p.Glu586Val		A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Missense_Mutation	SNP	NULL	p.E586V	ENST00000431828.1	37	c.1757	CCDS46361.1	2	.	.	.	.	.	.	.	.	.	.	T	16.30	3.085815	0.55861	.	.	ENSG00000114982	ENST00000354204;ENST00000447759;ENST00000431828;ENST00000441706;ENST00000440133;ENST00000444759	T;T	0.50548	0.74;0.77	5.89	5.89	0.94794	.	0.114991	0.64402	D	0.000016	T	0.35008	0.0917	N	0.19112	0.55	0.80722	D	1	B;P;B;P	0.45176	0.18;0.693;0.275;0.852	B;B;B;B	0.40636	0.075;0.335;0.101;0.335	T	0.15122	-1.0448	10	0.35671	T	0.21	.	14.2679	0.66133	0.0:0.0:0.0:1.0	.	380;586;499;474	B4E1W4;Q9P2N6-3;Q9P2N6-5;Q9P2N6-6	.;.;.;.	V	499;474;586;499;406;380	ENSP00000396749:E586V;ENSP00000406207:E406V	ENSP00000346144:E499V	E	-	2	0	KIAA1310	96634960	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.449000	0.66619	2.254000	0.74563	0.533000	0.62120	GAA	KANSL3	-	NULL	ENSG00000114982		0.498	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	KANSL3	HGNC	protein_coding	OTTHUMT00000339040.2	-	0.00	60	0	T	NM_017991		97271233	-1	tier1	-	no_errors	ENST00000431828	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	A
KBTBD7	84078	genome.wustl.edu	37	13	41766370	41766370	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr13:41766370C>T	ENST00000379483.3	-	1	2332	c.2024G>A	c.(2023-2025)cGa>cAa	p.R675Q		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	675										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		CTGTGCATTTCGCTGAGGTGC	0.398																																																	0													111.0	108.0	109.0					13																	41766370		2203	4300	6503	SO:0001583	missense	0			AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.2024G>A	13.37:g.41766370C>T	ENSP00000368797:p.Arg675Gln		B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R675Q	ENST00000379483.3	37	c.2024	CCDS9377.1	13	.	.	.	.	.	.	.	.	.	.	C	7.794	0.712130	0.15306	.	.	ENSG00000120696	ENST00000379483;ENST00000501885	T	0.74421	-0.84	5.06	5.06	0.68205	.	0.270963	0.19619	N	0.109957	T	0.61035	0.2315	N	0.14661	0.345	0.41827	D	0.990051	B	0.24651	0.108	B	0.22386	0.039	T	0.61763	-0.6996	10	0.62326	D	0.03	.	15.9447	0.79784	0.0:1.0:0.0:0.0	.	675	Q8WVZ9	KBTB7_HUMAN	Q	675;577	ENSP00000368797:R675Q	ENSP00000368797:R675Q	R	-	2	0	KBTBD7	40664370	1.000000	0.71417	1.000000	0.80357	0.299000	0.27559	1.482000	0.35486	2.613000	0.88420	0.557000	0.71058	CGA	KBTBD7	-	NULL	ENSG00000120696		0.398	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD7	HGNC	protein_coding	OTTHUMT00000044660.1	-	0.00	66	0	C	NM_032138		41766370	-1	tier1	-	no_errors	ENST00000379483	ensembl	human	known	74_37	missense	11.11	39	5	SNP	0.981	T
KCNK10	54207	genome.wustl.edu	37	14	88729764	88729764	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:88729764C>T	ENST00000340700.5	-	2	620	c.169G>A	c.(169-171)Ggc>Agc	p.G57S	KCNK10_ENST00000319231.5_Missense_Mutation_p.G62S|KCNK10_ENST00000312350.5_Missense_Mutation_p.G62S	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	57					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TGGGAGGTGCCTTCCATCCTG	0.612																																																	0													102.0	94.0	97.0					14																	88729764		2203	4300	6503	SO:0001583	missense	0			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.169G>A	14.37:g.88729764C>T	ENSP00000343104:p.Gly57Ser		B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.G62S	ENST00000340700.5	37	c.184	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	C	7.689	0.690591	0.15039	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231;ENST00000556282	D;D;D;T	0.90133	-2.62;-2.62;-2.61;1.04	5.87	4.77	0.60923	.	0.252400	0.44688	D	0.000438	T	0.77811	0.4186	N	0.05078	-0.115	0.29238	N	0.872837	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.08055	0.002;0.003;0.002	T	0.65265	-0.6210	10	0.21014	T	0.42	.	10.3622	0.44001	0.0:0.8273:0.0:0.1727	.	57;62;62	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	S	57;62;62;45	ENSP00000343104:G57S;ENSP00000310568:G62S;ENSP00000312811:G62S;ENSP00000452587:G45S	ENSP00000310568:G62S	G	-	1	0	KCNK10	87799517	0.909000	0.30893	1.000000	0.80357	0.995000	0.86356	1.045000	0.30341	2.941000	0.99782	0.655000	0.94253	GGC	KCNK10	-	NULL	ENSG00000100433		0.612	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	HGNC	protein_coding	OTTHUMT00000410167.1		0.00	70	0	C	NM_021161		88729764	-1			no_errors	ENST00000312350	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.990	T
KIAA1551	55196	genome.wustl.edu	37	12	32145344	32145344	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:32145344T>A	ENST00000312561.4	+	6	5533	c.5119T>A	c.(5119-5121)Ttc>Atc	p.F1707I	KIAA1551_ENST00000535596.1_3'UTR	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1707																	GAAGAGAAGCTTCAGTGCAGA	0.323																																																	0													126.0	142.0	137.0					12																	32145344		2203	4300	6503	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.5119T>A	12.37:g.32145344T>A	ENSP00000310338:p.Phe1707Ile		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.F1707I	ENST00000312561.4	37	c.5119	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	T	0.098	-1.156448	0.01686	.	.	ENSG00000174718	ENST00000312561	T	0.11063	2.81	5.57	-5.88	0.02290	.	1.329900	0.04883	N	0.447942	T	0.08891	0.0220	L	0.60455	1.87	0.09310	N	1	B	0.17268	0.021	B	0.22152	0.038	T	0.38542	-0.9656	10	0.25106	T	0.35	.	0.2892	0.00256	0.3373:0.1521:0.2387:0.2719	.	1707	Q9HCM1	CL035_HUMAN	I	1707	ENSP00000310338:F1707I	ENSP00000310338:F1707I	F	+	1	0	C12orf35	32036611	0.062000	0.20869	0.045000	0.18777	0.063000	0.16089	-0.257000	0.08745	-1.285000	0.02387	-0.250000	0.11733	TTC	KIAA1551	-	NULL	ENSG00000174718		0.323	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2		0.00	59	0	T	NM_018169		32145344	+1			no_errors	ENST00000312561	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.004	A
KIF26B	55083	genome.wustl.edu	37	1	245772708	245772708	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:245772708G>A	ENST00000407071.2	+	8	2232	c.1792G>A	c.(1792-1794)Gtg>Atg	p.V598M	KIF26B_ENST00000366518.4_Missense_Mutation_p.V217M	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	598	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GGTTTCCGCCGTGGAAGTGTG	0.622																																																	0													22.0	26.0	24.0					1																	245772708		1926	4126	6052	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1792G>A	1.37:g.245772708G>A	ENSP00000385545:p.Val598Met		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V598M	ENST00000407071.2	37	c.1792	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352756	0.61293	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.76060	-0.99;-0.99	5.22	5.22	0.72569	Kinesin, motor domain (4);	.	.	.	.	T	0.81842	0.4908	L	0.37750	1.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	T	0.83134	-0.0112	9	0.62326	D	0.03	.	19.1397	0.93443	0.0:0.0:1.0:0.0	.	217;598	B7WPD9;Q2KJY2	.;KI26B_HUMAN	M	598;217;214	ENSP00000385545:V598M;ENSP00000355475:V217M	ENSP00000355475:V217M	V	+	1	0	KIF26B	243839331	1.000000	0.71417	0.998000	0.56505	0.543000	0.35085	7.969000	0.87988	2.590000	0.87494	0.650000	0.86243	GTG	KIF26B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000162849		0.622	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	-	0.00	82	0	G	XM_371354		245772708	+1	tier1	-	no_errors	ENST00000407071	ensembl	human	known	74_37	missense	7.79	71	6	SNP	1.000	A
KIF27	55582	genome.wustl.edu	37	9	86504111	86504111	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:86504111G>A	ENST00000297814.2	-	7	2010	c.1867C>T	c.(1867-1869)Cga>Tga	p.R623*	KIF27_ENST00000376347.1_Nonsense_Mutation_p.R14*|KIF27_ENST00000334204.2_Nonsense_Mutation_p.R623*|KIF27_ENST00000413982.1_Nonsense_Mutation_p.R623*	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	623					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						ATCTGACTTCGTGTTCGAAAT	0.428																																																	0													159.0	157.0	158.0					9																	86504111		2203	4300	6503	SO:0001587	stop_gained	0			AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.1867C>T	9.37:g.86504111G>A	ENSP00000297814:p.Arg623*		B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R623*	ENST00000297814.2	37	c.1867	CCDS6665.1	9	.	.	.	.	.	.	.	.	.	.	G	41	9.049464	0.99048	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204;ENST00000376347	.	.	.	4.85	4.85	0.62838	.	0.000000	0.44097	U	0.000492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.3352	0.90285	0.0:0.0:1.0:0.0	.	.	.	.	X	623;623;623;14	.	ENSP00000297814:R623X	R	-	1	2	KIF27	85693931	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.685000	0.68204	2.407000	0.81776	0.557000	0.71058	CGA	KIF27	-	NULL	ENSG00000165115		0.428	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF27	HGNC	protein_coding	OTTHUMT00000052861.1	-	0.00	102	0	G	NM_017576		86504111	-1	tier1	-	no_errors	ENST00000297814	ensembl	human	known	74_37	nonsense	31.63	67	31	SNP	1.000	A
KRT18P55	284085	genome.wustl.edu	37	17	26603096	26603096	+	RNA	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:26603096T>A	ENST00000577198.1	-	0	1865				AC061975.8_ENST00000385109.1_RNA	NR_028334.1				keratin 18 pseudogene 55																		TTGGCATCACTGGTCTCAGAC	0.463																																																	0																																												0					17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26603096T>A				RNA	SNP	-	NULL	ENST00000577198.1	37	NULL		17																																																																																			KRT18P55	-	-	ENSG00000265480		0.463	KRT18P55-002	KNOWN	basic	processed_transcript	KRT18P55	HGNC	pseudogene	OTTHUMT00000446194.1	-	0.00	32	0	T	NR_028334		26603096	-1	tier1	-	no_errors	ENST00000577198	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.017	A
KRTAP10-11	386678	genome.wustl.edu	37	21	46066427	46066427	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr21:46066427C>A	ENST00000334670.8	+	1	97	c.52C>A	c.(52-54)Cag>Aag	p.Q18K	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	18						keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						CGACTCCTGGCAGGTGGACGA	0.682																																																	0													57.0	62.0	60.0					21																	46066427		2199	4290	6489	SO:0001583	missense	0			AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.52C>A	21.37:g.46066427C>A	ENSP00000334197:p.Gln18Lys		A2RRF9	Missense_Mutation	SNP	NULL	p.Q18K	ENST00000334670.8	37	c.52	CCDS42962.1	21	.	.	.	.	.	.	.	.	.	.	c	8.709	0.911493	0.17833	.	.	ENSG00000243489	ENST00000334670	T	0.12672	2.66	3.71	1.61	0.23674	.	.	.	.	.	T	0.17874	0.0429	M	0.84082	2.675	0.19775	N	0.999959	B	0.30914	0.3	B	0.23275	0.045	T	0.11372	-1.0590	9	0.56958	D	0.05	.	9.0371	0.36293	0.0:0.5542:0.4458:0.0	.	18	P60412	KR10B_HUMAN	K	18	ENSP00000334197:Q18K	ENSP00000334197:Q18K	Q	+	1	0	KRTAP10-11	44890855	0.990000	0.36364	0.997000	0.53966	0.092000	0.18411	0.147000	0.16202	0.511000	0.28236	0.462000	0.41574	CAG	KRTAP10-11	-	NULL	ENSG00000243489		0.682	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-11	HGNC	protein_coding	OTTHUMT00000128029.1		0.00	76	0	C	NM_198692		46066427	+1			no_errors	ENST00000334670	ensembl	human	known	74_37	missense	5.80	64	4	SNP	0.936	A
LAMA1	284217	genome.wustl.edu	37	18	7040152	7040152	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr18:7040152G>A	ENST00000389658.3	-	10	1438	c.1345C>T	c.(1345-1347)Ccg>Tcg	p.P449S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	449	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.P449S(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACACAGGTCGGGTAATCCTTA	0.527																																																	1	Substitution - Missense(1)	skin(1)											133.0	120.0	124.0					18																	7040152		2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1345C>T	18.37:g.7040152G>A	ENSP00000374309:p.Pro449Ser			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.P449S	ENST00000389658.3	37	c.1345	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	25.0	4.593144	0.86953	.	.	ENSG00000101680	ENST00000389658	T	0.61742	0.08	5.32	5.32	0.75619	EGF-like, laminin (4);	0.118515	0.56097	D	0.000021	T	0.72486	0.3466	L	0.58810	1.83	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	T	0.67518	-0.5650	10	0.30854	T	0.27	.	19.1901	0.93663	0.0:0.0:1.0:0.0	.	449	P25391	LAMA1_HUMAN	S	449	ENSP00000374309:P449S	ENSP00000374309:P449S	P	-	1	0	LAMA1	7030152	1.000000	0.71417	0.998000	0.56505	0.652000	0.38707	9.347000	0.97059	2.775000	0.95449	0.655000	0.94253	CCG	LAMA1	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000101680		0.527	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1		0.00	60	0	G	NM_005559		7040152	-1			no_errors	ENST00000389658	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	A
LAMA2	3908	genome.wustl.edu	37	6	129649505	129649505	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:129649505G>A	ENST00000421865.2	+	29	4308	c.4259G>A	c.(4258-4260)tGt>tAt	p.C1420Y		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1420	Laminin EGF-like 15. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGTGTTCCATGTCAATGTAAT	0.532																																																	0													147.0	121.0	130.0					6																	129649505		2203	4300	6503	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4259G>A	6.37:g.129649505G>A	ENSP00000400365:p.Cys1420Tyr		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.C1420Y	ENST00000421865.2	37	c.4259	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850574	0.71719	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	D	0.94330	-3.4	5.15	5.15	0.70609	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.98473	0.9491	H	0.99487	4.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99878	1.1107	10	0.87932	D	0	.	18.626	0.91338	0.0:0.0:1.0:0.0	.	1420;1420	A6NF00;P24043	.;LAMA2_HUMAN	Y	1420	ENSP00000400365:C1420Y	ENSP00000346769:C1420Y	C	+	2	0	LAMA2	129691198	1.000000	0.71417	0.999000	0.59377	0.769000	0.43574	8.160000	0.89653	2.393000	0.81446	0.467000	0.42956	TGT	LAMA2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000196569		0.532	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	-	0.00	72	0	G			129649505	+1	tier1	-	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	9.43	48	5	SNP	1.000	A
LAMB1	3912	genome.wustl.edu	37	7	107570034	107570034	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:107570034G>T	ENST00000222399.6	-	30	4798	c.4568C>A	c.(4567-4569)gCa>gAa	p.A1523E	LAMB1_ENST00000393561.1_Missense_Mutation_p.A1547E|LAMB1_ENST00000474380.1_5'UTR	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1523	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						ATTAGCAACTGCTTCAATGCT	0.403																																																	0													124.0	106.0	112.0					7																	107570034		2203	4300	6503	SO:0001583	missense	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4568C>A	7.37:g.107570034G>T	ENSP00000222399:p.Ala1523Glu		Q14D91	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,superfamily_P-loop_NTPase,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.A1523E	ENST00000222399.6	37	c.4568	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227442	0.39399	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.29917	1.55;1.55	5.52	5.52	0.82312	.	.	.	.	.	T	0.27933	0.0688	L	0.41961	1.31	0.80722	D	1	B;B	0.24768	0.025;0.111	B;B	0.28139	0.022;0.086	T	0.10291	-1.0636	9	0.02654	T	1	.	19.6435	0.95767	0.0:0.0:1.0:0.0	.	1523;1547	P07942;G3XAI2	LAMB1_HUMAN;.	E	1547;1523	ENSP00000377191:A1547E;ENSP00000222399:A1523E	ENSP00000222399:A1523E	A	-	2	0	LAMB1	107357270	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.538000	0.53597	2.866000	0.98385	0.650000	0.86243	GCA	LAMB1	-	NULL	ENSG00000091136		0.403	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1		0.00	48	0	G	NM_002291		107570034	-1			no_errors	ENST00000222399	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.996	T
LEPR	3953	genome.wustl.edu	37	1	66058442	66058442	+	Silent	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:66058442T>C	ENST00000349533.6	+	6	782	c.597T>C	c.(595-597)ccT>ccC	p.P199P	LEPR_ENST00000406510.3_Intron|LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371060.3_Silent_p.P199P|LEPR_ENST00000371058.1_Silent_p.P199P|LEPR_ENST00000371059.3_Silent_p.P199P|LEPR_ENST00000344610.8_Silent_p.P199P	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		GTCTTGTGCCTGTGCCAACAG	0.428																																																	0													149.0	134.0	139.0					1																	66058442		2203	4300	6503	SO:0001819	synonymous_variant	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.597T>C	1.37:g.66058442T>C			Q6FHL5	Silent	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P199	ENST00000349533.6	37	c.597	CCDS631.1	1																																																																																			LEPR	-	NULL	ENSG00000116678		0.428	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	-	0.00	31	0	T	NM_002303		66058442	+1	tier1	-	no_errors	ENST00000349533	ensembl	human	known	74_37	silent	14.29	18	3	SNP	0.985	C
LHB	3972	genome.wustl.edu	37	19	49519433	49519433	+	Silent	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:49519433G>C	ENST00000221421.2	-	3	317	c.318C>G	c.(316-318)ctC>ctG	p.L106L	CTB-60B18.10_ENST00000600007.1_lincRNA	NM_000894.2	NP_000885.1	P01229	LSHB_HUMAN	luteinizing hormone beta polypeptide	106					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|male gonad development (GO:0008584)|peptide hormone processing (GO:0016486)|progesterone biosynthetic process (GO:0006701)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		AGCGACAGCTGAGAGCCACAG	0.657																																																	0													62.0	66.0	65.0					19																	49519433		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12748.1	19q13.3	2013-02-26				ENSG00000104826		"""Endogenous ligands"""	6584	protein-coding gene	gene with protein product	"""lutropin, beta chain"", ""interstitial cell stimulating hormone, beta chain"", ""luteinizing hormone beta subunit"""	152780				1191677	Standard	NM_000894		Approved	LSH-B, CGB4, hLHB	uc002plt.3	P01229		ENST00000221421.2:c.318C>G	19.37:g.49519433G>C			Q9UDI0	Silent	SNP	pfam_Cys_knot,smart_Gonadotropin_bsu	p.L106	ENST00000221421.2	37	c.318	CCDS12748.1	19																																																																																			LHB	-	pfam_Cys_knot,smart_Gonadotropin_bsu	ENSG00000104826		0.657	LHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHB	HGNC	protein_coding	OTTHUMT00000466246.1	-	0.00	117	0	G	NM_000894		49519433	-1	tier1	-	no_errors	ENST00000221421	ensembl	human	known	74_37	silent	7.69	96	8	SNP	0.998	C
LINC00238	440184	genome.wustl.edu	37	14	66954918	66954918	+	lincRNA	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:66954918G>A	ENST00000556874.1	-	0	643				LINC00238_ENST00000389594.3_RNA																							GAAGGGGTGTGAGGAATCCTC	0.468																																																	0																																												0																															14.37:g.66954918G>A				RNA	SNP	-	NULL	ENST00000556874.1	37	NULL		14																																																																																			LINC00238	-	-	ENSG00000196553		0.468	RP11-72M17.1-001	KNOWN	basic	lincRNA	LINC00238	HGNC	lincRNA	OTTHUMT00000412209.1	-	0.00	51	0	G			66954918	+1	tier1	-	no_errors	ENST00000359454	ensembl	human	known	74_37	rna	23.68	29	9	SNP	0.997	A
CADM3	57863	genome.wustl.edu	37	1	159166613	159166613	+	Intron	DEL	T	T	-	rs533935187		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:159166613delT	ENST00000368125.4	+	7	939				CADM3_ENST00000368124.4_Intron|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CTCCCAGTTATTTTTTTTTTT	0.527											OREG0013913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.783-68T>-	1.37:g.159166613delT		1799	Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	DEL	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			CTA-134P22.2	-	-	ENSG00000225670		0.527	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1		0.00	13	0	T	NM_021189		159166613	-1	tier1		no_errors	ENST00000415675	ensembl	human	known	74_37	rna	22.22	14	4	DEL	0.000	-
C21orf140	101928147	genome.wustl.edu	37	21	35772939	35772939	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr21:35772939G>A	ENST00000410005.1	-	1	431	c.432C>T	c.(430-432)ttC>ttT	p.F144F	SMIM11_ENST00000399299.1_Intron|SMIM11_ENST00000481710.1_Intron	NM_001282537.1	NP_001269466.1																					TAGGGATATAGAACTGGCCCT	0.507																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000410005.1:c.432C>T	21.37:g.35772939G>A				Silent	SNP	NULL	p.F144	ENST00000410005.1	37	c.432		21																																																																																			AP000322.54	-	NULL	ENSG00000222018		0.507	AP000322.54-001	PUTATIVE	basic|appris_principal	protein_coding	LOC101928147	Clone_based_vega_gene	protein_coding	OTTHUMT00000334702.1	-	0.00	59	0	G			35772939	-1	tier1	-	no_errors	ENST00000410005	ensembl	human	putative	74_37	silent	8.47	54	5	SNP	0.000	A
PLEKHB2	55041	genome.wustl.edu	37	2	132054509	132054509	+	Intron	SNP	A	A	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:132054509A>T	ENST00000404460.1	+	7	477				AC131180.4_ENST00000560285.1_RNA|PLEKHB2_ENST00000303908.3_Intron			Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2							endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		ATGGTGGTGCAGCAGGAGAGC	0.498																																																	0																																										SO:0001627	intron_variant	0				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000404460.1:c.424-56084A>T	2.37:g.132054509A>T			B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	RNA	SNP	-	NULL	ENST00000404460.1	37	NULL		2																																																																																			AC131180.4	-	-	ENSG00000231431		0.498	PLEKHB2-002	KNOWN	basic	protein_coding	LOC440910	Clone_based_vega_gene	protein_coding	OTTHUMT00000318943.2	-	0.00	67	0	A	NM_017958		132054509	+1	tier1	-	no_errors	ENST00000560285	ensembl	human	known	74_37	rna	5.41	70	4	SNP	1.000	T
LRRC37A5P	652972	genome.wustl.edu	37	9	114365331	114365331	+	RNA	DEL	T	T	-			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:114365331delT	ENST00000374304.1	-	0	1103							Q49AS3	L37A5_HUMAN	leucine rich repeat containing 37, member A5, pseudogene																		cggggagtccttcaggacagc	0.458																																																	0																																												0			BC031236		9q31.3	2012-10-16	2012-03-07	2012-03-07	ENSG00000204173	ENSG00000204173			23369	pseudogene	pseudogene			"""chromosome 9 open reading frame 29"""	C9orf29			Standard	NR_034087		Approved		uc022bly.1	Q49AS3	OTTHUMG00000020494		9.37:g.114365331delT			Q5JVP0	RNA	DEL	-	NULL	ENST00000374304.1	37	NULL		9																																																																																			LRRC37A5P	-	-	ENSG00000204173		0.458	LRRC37A5P-002	KNOWN	basic	processed_transcript	LRRC37A5P	HGNC	pseudogene	OTTHUMT00000053655.2		0.00	38	0	T	NR_034087		114365331	-1	tier1		no_errors	ENST00000536054	ensembl	human	known	74_37	rna	5.56	34	2	DEL	0.354	-
LRRC37A6P	387646	genome.wustl.edu	37	10	27537518	27537518	+	lincRNA	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:27537518C>T	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							GCATTCCATGCCAGGCCTGAA	0.353																																																	0																																												0																															10.37:g.27537518C>T				RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			LRRC37A6P	-	-	ENSG00000230445		0.353	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	HGNC	lincRNA	OTTHUMT00000436904.1	-	0.00	297	0	C			27537518	-1	tier1	-	no_errors	ENST00000284414	ensembl	human	known	74_37	rna	15.49	239	44	SNP	0.835	T
LRRC7	57554	genome.wustl.edu	37	1	70225961	70225961	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:70225961C>A	ENST00000035383.5	+	1	104	c.74C>A	c.(73-75)tCa>tAa	p.S25*	LRRC7_ENST00000370958.1_Nonsense_Mutation_p.S63*|LRRC7_ENST00000310961.5_Nonsense_Mutation_p.S30*|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	25						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GAAATCATCTCAGTTTTAGAT	0.463																																																	0													69.0	69.0	69.0					1																	70225961		2203	4300	6503	SO:0001587	stop_gained	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.74C>A	1.37:g.70225961C>A	ENSP00000035383:p.Ser25*		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.S25*	ENST00000035383.5	37	c.74	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	C	41	8.775022	0.98950	.	.	ENSG00000033122	ENST00000310961;ENST00000370958;ENST00000035383;ENST00000335298	.	.	.	5.84	5.84	0.93424	.	0.142627	0.49305	D	0.000151	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	18.7077	0.91644	0.0:1.0:0.0:0.0	.	.	.	.	X	30;63;25;25	.	ENSP00000035383:S25X	S	+	2	0	LRRC7	69998549	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.818000	0.86416	2.768000	0.95171	0.650000	0.86243	TCA	LRRC7	-	NULL	ENSG00000033122		0.463	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	50	0	C	NM_020794		70225961	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	nonsense	24.44	34	11	SNP	1.000	A
LRRC9	341883	genome.wustl.edu	37	14	60483421	60483421	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:60483421G>C	ENST00000445360.1	+	24	3434	c.3230G>C	c.(3229-3231)aGa>aCa	p.R1077T	RP11-16B13.1_ENST00000555432.1_RNA|RP11-16B13.1_ENST00000554123.1_RNA			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	1077																	TTTGGTGGTAGACTTACTTCT	0.343																																																	0																																										SO:0001583	missense	0			AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.3230G>C	14.37:g.60483421G>C	ENSP00000454748:p.Arg1077Thr			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R1077T	ENST00000445360.1	37	c.3230		14																																																																																			LRRC9	-	NULL	ENSG00000131951		0.343	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC9	HGNC	protein_coding	OTTHUMT00000072281.3	-	0.00	93	0	G			60483421	+1	tier1	-	no_errors	ENST00000254271	ensembl	human	known	74_37	missense	14.12	73	12	SNP	1.000	C
LRRN1	57633	genome.wustl.edu	37	3	3886578	3886578	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:3886578G>A	ENST00000319331.3	+	2	1014	c.253G>A	c.(253-255)Gca>Aca	p.A85T	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	85						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		CAATAACATCGCAAAGACTGT	0.448																																																	0													85.0	80.0	82.0					3																	3886578		2203	4300	6503	SO:0001583	missense	0			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.253G>A	3.37:g.3886578G>A	ENSP00000314901:p.Ala85Thr		Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A85T	ENST00000319331.3	37	c.253	CCDS33685.1	3	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550970	0.65311	.	.	ENSG00000175928	ENST00000319331	T	0.21932	1.98	5.76	5.76	0.90799	.	0.165141	0.52532	D	0.000069	T	0.11110	0.0271	N	0.05078	-0.115	0.50039	D	0.999848	P	0.36144	0.539	B	0.22753	0.041	T	0.16070	-1.0415	10	0.35671	T	0.21	.	19.9759	0.97304	0.0:0.0:1.0:0.0	.	85	Q6UXK5	LRRN1_HUMAN	T	85	ENSP00000314901:A85T	ENSP00000314901:A85T	A	+	1	0	LRRN1	3861578	1.000000	0.71417	0.594000	0.28785	0.934000	0.57294	5.571000	0.67404	2.713000	0.92767	0.655000	0.94253	GCA	LRRN1	-	NULL	ENSG00000175928		0.448	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN1	HGNC	protein_coding	OTTHUMT00000337704.2	-	0.00	44	0	G	NM_020873		3886578	+1	tier1	-	no_errors	ENST00000319331	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.999	A
LRTM1	57408	genome.wustl.edu	37	3	54958911	54958911	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:54958911C>T	ENST00000273286.5	-	2	501	c.339G>A	c.(337-339)ctG>ctA	p.L113L	CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000288197.5_Intron|LRTM1_ENST00000493075.1_Silent_p.L37L|CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000490478.1_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	113						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		GTCTGCTTTCCAGGGAAAGGA	0.478																																																	0													65.0	65.0	65.0					3																	54958911		2203	4300	6503	SO:0001819	synonymous_variant	0			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.339G>A	3.37:g.54958911C>T			Q8IUU2	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L113	ENST00000273286.5	37	c.339	CCDS2876.1	3																																																																																			LRTM1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000144771		0.478	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM1	HGNC	protein_coding	OTTHUMT00000351399.1	-	0.00	43	0	C	NM_020678		54958911	-1	tier1	-	no_errors	ENST00000273286	ensembl	human	known	74_37	silent	31.03	20	9	SNP	1.000	T
MAP1A	4130	genome.wustl.edu	37	15	43819502	43819502	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:43819502C>A	ENST00000300231.5	+	4	6281	c.5831C>A	c.(5830-5832)aCg>aAg	p.T1944K	MAP1A_ENST00000399453.1_Missense_Mutation_p.T1944K|MAP1A_ENST00000382031.1_Missense_Mutation_p.T2182K			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1944					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CATGCCACCACGGAGCCTGAG	0.532																																																	0													68.0	81.0	76.0					15																	43819502		2192	4278	6470	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.5831C>A	15.37:g.43819502C>A	ENSP00000300231:p.Thr1944Lys		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.T1944K	ENST00000300231.5	37	c.5831	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.659948	0.00772	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01192	5.2;5.2;5.2	4.88	1.53	0.23141	.	0.923415	0.08894	N	0.878315	T	0.00468	0.0015	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47100	-0.9143	10	0.05833	T	0.94	-0.9345	0.5863	0.00720	0.1839:0.1743:0.2837:0.3581	.	1944	P78559	MAP1A_HUMAN	K	2182;1944;1944	ENSP00000371462:T2182K;ENSP00000382380:T1944K;ENSP00000300231:T1944K	ENSP00000300231:T1944K	T	+	2	0	MAP1A	41606794	0.005000	0.15991	0.023000	0.16930	0.003000	0.03518	0.141000	0.16076	0.149000	0.19098	-1.517000	0.00937	ACG	MAP1A	-	NULL	ENSG00000166963		0.532	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	-	0.00	58	0	C	NM_002373		43819502	+1	tier1	-	no_errors	ENST00000399453	ensembl	human	known	74_37	missense	14.63	34	6	SNP	0.024	A
MAP4	4134	genome.wustl.edu	37	3	47958058	47958058	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:47958058T>C	ENST00000360240.6	-	7	1777	c.1259A>G	c.(1258-1260)cAg>cGg	p.Q420R	MAP4_ENST00000426837.2_Missense_Mutation_p.Q437R|MAP4_ENST00000395734.3_Missense_Mutation_p.Q420R|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	420	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	GTCATTAGCCTGTGCCACCTC	0.478																																																	0													137.0	124.0	129.0					3																	47958058		2203	4300	6503	SO:0001583	missense	0				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1259A>G	3.37:g.47958058T>C	ENSP00000353375:p.Gln420Arg		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	pfam_MAP_tubulin-bd_rpt	p.Q420R	ENST00000360240.6	37	c.1259	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	T	7.061	0.566373	0.13560	.	.	ENSG00000047849	ENST00000395734;ENST00000426837;ENST00000360240	T;T;T	0.06687	3.29;3.27;3.29	4.73	2.16	0.27623	.	.	.	.	.	T	0.04770	0.0129	N	0.14661	0.345	0.09310	N	1	P;P;P	0.35982	0.531;0.472;0.531	B;B;B	0.33960	0.124;0.173;0.124	T	0.39583	-0.9607	9	0.38643	T	0.18	0.16	6.9341	0.24457	0.6038:0.0:0.0:0.3962	.	397;420;420	C9JFC3;P27816-6;P27816	.;.;MAP4_HUMAN	R	420;437;420	ENSP00000379083:Q420R;ENSP00000407602:Q437R;ENSP00000353375:Q420R	ENSP00000353375:Q420R	Q	-	2	0	MAP4	47933062	0.105000	0.21958	0.006000	0.13384	0.003000	0.03518	1.783000	0.38664	0.923000	0.37045	-0.527000	0.04329	CAG	MAP4	-	NULL	ENSG00000047849		0.478	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1		0.00	36	0	T	NM_002375		47958058	-1			no_errors	ENST00000360240	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.005	C
MCC	4163	genome.wustl.edu	37	5	112824048	112824049	+	In_Frame_Ins	INS	-	-	GCC	rs35336557|rs531679771|rs370593160	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:112824048_112824049insGCC	ENST00000408903.3	-	1	478_479	c.63_64insGGC	c.(61-66)ggcagc>ggcGGCagc	p.21_22insG		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ctgctgccgctgccgccgccgc	0.738														1663	0.332069	0.0227	0.3487	5008	,	,		8489	0.5208		0.3668	False		,,,				2504	0.5082																0																																										SO:0001652	inframe_insertion	0				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.61_63dupGGC	5.37:g.112824055_112824057dupGCC	ENSP00000386227:p.Gly22_Gly23dup		D3DT05|Q6ZR04	In_Frame_Ins	INS	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm,smart_EF_hand_dom,pfscan_EF_hand_dom	p.21in_frame_insG	ENST00000408903.3	37	c.64_63	CCDS43351.1	5																																																																																			MCC	-	NULL	ENSG00000171444		0.738	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	MCC	HGNC	protein_coding	OTTHUMT00000370839.1		0.00	11	0	-	NM_001085377		112824049	-1	tier1		no_errors	ENST00000408903	ensembl	human	putative	74_37	in_frame_ins	30.77	9	4	INS	0.854:0.894	GCC
MDN1	23195	genome.wustl.edu	37	6	90438848	90438848	+	Silent	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:90438848T>A	ENST00000369393.3	-	36	5266	c.5151A>T	c.(5149-5151)ctA>ctT	p.L1717L	MDN1_ENST00000428876.1_Silent_p.L1717L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1717					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TATTCCTGTGTAGGACAGGTC	0.413																																																	0													45.0	38.0	40.0					6																	90438848		2203	4300	6503	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.5151A>T	6.37:g.90438848T>A			O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.L1717	ENST00000369393.3	37	c.5151	CCDS5024.1	6																																																																																			MDN1	-	superfamily_P-loop_NTPase,pirsf_Midasin	ENSG00000112159		0.413	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2		0.00	34	0	T			90438848	-1			no_errors	ENST00000369393	ensembl	human	known	74_37	silent	16.67	20	4	SNP	0.000	A
MED24	9862	genome.wustl.edu	37	17	38189392	38189392	+	Missense_Mutation	SNP	C	C	T	rs201198702		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:38189392C>T	ENST00000394128.2	-	8	820	c.739G>A	c.(739-741)Gtg>Atg	p.V247M	MED24_ENST00000394127.2_Missense_Mutation_p.V234M|MED24_ENST00000394126.1_Missense_Mutation_p.V272M|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000356271.3_Missense_Mutation_p.V234M|MED24_ENST00000501516.3_Missense_Mutation_p.V266M	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	247					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					AGCAGGATCACGGCGTGGACA	0.627																																																	0								C	MET/VAL,MET/VAL	0,4406		0,0,2203	63.0	54.0	57.0		739,700	0.7	0.1	17		57	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MED24	NM_014815.3,NM_001079518.1	21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	247/990,234/977	38189392	1,13005	2203	4300	6503	SO:0001583	missense	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.739G>A	17.37:g.38189392C>T	ENSP00000377686:p.Val247Met		A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	pfam_Mediator_Med24_N	p.V247M	ENST00000394128.2	37	c.739	CCDS11359.1	17	.	.	.	.	.	.	.	.	.	.	C	3.639	-0.073927	0.07184	0.0	1.16E-4	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000543759;ENST00000535508;ENST00000431269;ENST00000428757	T;T;T	0.46819	0.86;0.86;0.86	5.48	0.698	0.18087	Mediator complex, subunit Med24, N-terminal (1);	0.265170	0.37761	N	0.001960	T	0.47432	0.1445	L	0.43152	1.355	0.28570	N	0.91067	P;P;P;P;P;P;B;B;P	0.50617	0.937;0.566;0.825;0.784;0.791;0.511;0.289;0.337;0.511	P;B;P;P;B;B;B;B;B	0.50537	0.643;0.333;0.456;0.518;0.224;0.224;0.164;0.128;0.224	T	0.51172	-0.8739	10	0.56958	D	0.05	-4.0111	13.3003	0.60321	0.1083:0.4133:0.4784:0.0	.	221;234;197;176;197;157;234;247;189	B9TX63;B9TX65;B4DV99;B4DDR8;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;.;.;.;MED24_HUMAN;.	M	247;247;247;197;234;189;221;221;157;266	ENSP00000377686:V247M;ENSP00000443344:V197M;ENSP00000377685:V234M	ENSP00000348610:V247M	V	-	1	0	MED24	35442918	0.960000	0.32886	0.089000	0.20774	0.039000	0.13416	2.154000	0.42291	-0.081000	0.12662	-0.867000	0.03001	GTG	MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.627	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2		0.00	43	0	C	NM_014815		38189392	-1			no_errors	ENST00000394128	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.418	T
MEI4	101928601	genome.wustl.edu	37	6	78471284	78471284	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:78471284A>G	ENST00000602452.2	+	2	684	c.670A>G	c.(670-672)Aac>Gac	p.N224D		NM_001282136.1	NP_001269065.1	A8MW99	MEI4L_HUMAN	meiosis-specific 4 homolog (S. cerevisiae)	224					DNA recombination (GO:0006310)|meiotic DNA double-strand break formation (GO:0042138)|oogenesis (GO:0048477)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	lateral element (GO:0000800)											CAGTGACTATAACTTATCTAG	0.353																																																	0																																										SO:0001583	missense	0				CCDS64463.1	6q14.1	2014-08-13			ENSG00000269964	ENSG00000269964			43638	protein-coding gene	gene with protein product						20551173	Standard	XM_005248773		Approved			A8MW99	OTTHUMG00000153472	ENST00000602452.2:c.670A>G	6.37:g.78471284A>G	ENSP00000473370:p.Asn224Asp		R4GMV8	Missense_Mutation	SNP	NULL	p.N224D	ENST00000602452.2	37	c.670		6																																																																																			MEI4	-	NULL	ENSG00000269964		0.353	MEI4-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	MEI4	HGNC	protein_coding	OTTHUMT00000331298.2	-	0.00	52	0	A			78471284	+1	tier1	-	no_errors	ENST00000602452	ensembl	human	novel	74_37	missense	9.52	38	4	SNP	0.694	G
MEP1B	4225	genome.wustl.edu	37	18	29797884	29797884	+	Missense_Mutation	SNP	C	C	G	rs184031989		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr18:29797884C>G	ENST00000269202.6	+	14	2094	c.2047C>G	c.(2047-2049)Cgt>Ggt	p.R683G	MEP1B_ENST00000581447.1_Missense_Mutation_p.R683G	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	683					digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GAAGAAATATCGTGAAAGGAT	0.408																																																	0													143.0	144.0	143.0					18																	29797884		1990	4170	6160	SO:0001583	missense	0			X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.2047C>G	18.37:g.29797884C>G	ENSP00000269202:p.Arg683Gly		B7ZM35|B9EGL6|Q670J1	Missense_Mutation	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MAM_dom,pfam_MATH,superfamily_TRAF-like,superfamily_ConA-like_lec_gl_sf,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.R683G	ENST00000269202.6	37	c.2047	CCDS45846.1	18	.	.	.	.	.	.	.	.	.	.	C	13.03	2.115822	0.37339	.	.	ENSG00000141434	ENST00000269202	T	0.21543	2.0	5.41	-0.0116	0.13991	.	0.885837	0.10206	N	0.702641	T	0.22781	0.0550	M	0.79258	2.445	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.29792	-1.0000	10	0.41790	T	0.15	-0.4476	5.6071	0.17385	0.4949:0.3418:0.0901:0.0731	.	683	Q16820	MEP1B_HUMAN	G	683	ENSP00000269202:R683G	ENSP00000269202:R683G	R	+	1	0	MEP1B	28051882	0.000000	0.05858	0.014000	0.15608	0.346000	0.29079	-0.018000	0.12568	0.226000	0.20979	0.467000	0.42956	CGT	MEP1B	-	NULL	ENSG00000141434		0.408	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MEP1B	HGNC	protein_coding	OTTHUMT00000447755.1	-	0.00	76	0	C	NM_005925		29797884	+1	tier1	-	no_errors	ENST00000269202	ensembl	human	known	74_37	missense	8.47	54	5	SNP	0.101	G
MGAT5	4249	genome.wustl.edu	37	2	135076308	135076308	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:135076308G>T	ENST00000409645.1	+	5	823	c.571G>T	c.(571-573)Gag>Tag	p.E191*	MGAT5_ENST00000281923.2_Nonsense_Mutation_p.E191*			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	191					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		TTACCTCAGTGAGGTGAGTAG	0.453																																																	0													133.0	128.0	130.0					2																	135076308		2203	4300	6503	SO:0001587	stop_gained	0			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.571G>T	2.37:g.135076308G>T	ENSP00000386377:p.Glu191*		D3DP70	Nonsense_Mutation	SNP	NULL	p.E191*	ENST00000409645.1	37	c.571	CCDS2171.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.345176	0.98224	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.54	5.54	0.83059	.	0.049932	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-29.0599	17.6539	0.88172	0.0:0.0:1.0:0.0	.	.	.	.	X	191	.	ENSP00000281923:E191X	E	+	1	0	MGAT5	134792778	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.444000	0.97578	2.609000	0.88269	0.655000	0.94253	GAG	MGAT5	-	NULL	ENSG00000152127		0.453	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT5	HGNC	protein_coding	OTTHUMT00000254584.3		0.00	36	0	G	NM_002410		135076308	+1			no_errors	ENST00000281923	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	1.000	T
MICAL2	9645	genome.wustl.edu	37	11	12257748	12257748	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:12257748G>A	ENST00000256194.4	+	16	2308	c.2020G>A	c.(2020-2022)Gac>Aac	p.D674N	MICAL2_ENST00000379612.3_Missense_Mutation_p.D674N|MICAL2_ENST00000537344.1_Missense_Mutation_p.D674N|MICAL2_ENST00000527546.1_Missense_Mutation_p.D674N|MICAL2_ENST00000342902.5_Missense_Mutation_p.D674N	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	674					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		CGGAGAGAATGACATGAACAA	0.547											OREG0020771	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													163.0	129.0	141.0					11																	12257748		2201	4294	6495	SO:0001583	missense	0			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.2020G>A	11.37:g.12257748G>A	ENSP00000256194:p.Asp674Asn	678	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,pfam_FAD_bind_dom,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.D674N	ENST00000256194.4	37	c.2020	CCDS7809.1	11	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724146	0.48728	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.61742	0.1;0.08;0.1;0.08;0.21	5.39	5.39	0.77823	.	0.210811	0.38897	N	0.001531	T	0.59252	0.2180	L	0.55481	1.735	0.42035	D	0.991045	B;P;P;B;P;P	0.47762	0.26;0.9;0.698;0.243;0.839;0.57	B;P;B;B;B;B	0.44990	0.054;0.466;0.108;0.09;0.218;0.119	T	0.62196	-0.6905	10	0.48119	T	0.1	.	16.9969	0.86370	0.0:0.0:1.0:0.0	.	207;674;674;674;674;674	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	N	674;207;674;674;674;674	ENSP00000441689:D674N;ENSP00000256194:D674N;ENSP00000433965:D674N;ENSP00000344894:D674N;ENSP00000368932:D674N	ENSP00000256194:D674N	D	+	1	0	MICAL2	12214324	0.999000	0.42202	0.996000	0.52242	0.748000	0.42578	2.915000	0.48805	2.676000	0.91093	0.655000	0.94253	GAC	MICAL2	-	NULL	ENSG00000133816		0.547	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL2	HGNC	protein_coding	OTTHUMT00000385993.1	-	0.00	113	0	G	NM_014632		12257748	+1	tier1	-	no_errors	ENST00000256194	ensembl	human	known	74_37	missense	12.05	73	10	SNP	0.999	A
TWISTNB	221830	genome.wustl.edu	37	7	19745033	19745033	+	Intron	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:19745033T>C	ENST00000222567.5	-	2	325				MIR3146_ENST00000580367.1_RNA	NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor						transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						CTTCAAGTTATACTAGGATAG	0.358																																																	0																																										SO:0001627	intron_variant	0			AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.255-490A>G	7.37:g.19745033T>C			A0PJ45|B7Z724	RNA	SNP	-	NULL	ENST00000222567.5	37	NULL	CCDS34606.1	7																																																																																			MIR3146	-	-	ENSG00000265932		0.358	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3146	HGNC	protein_coding	OTTHUMT00000326463.1	-	0.00	29	0	T			19745033	-1	tier1	-	no_errors	ENST00000580367	ensembl	human	known	74_37	rna	15.79	32	6	SNP	0.000	C
MISP	126353	genome.wustl.edu	37	19	757214	757214	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:757214G>A	ENST00000215582.6	+	2	371	c.268G>A	c.(268-270)Gag>Aag	p.E90K		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	90					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CAGGGAGGATGAGGGTTGGCA	0.672																																																	0													60.0	55.0	57.0					19																	757214		2203	4300	6503	SO:0001583	missense	0			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.268G>A	19.37:g.757214G>A	ENSP00000215582:p.Glu90Lys			Missense_Mutation	SNP	NULL	p.E90K	ENST00000215582.6	37	c.268	CCDS12042.1	19	.	.	.	.	.	.	.	.	.	.	G	14.08	2.430145	0.43122	.	.	ENSG00000099812	ENST00000215582	T	0.68765	-0.35	1.73	-1.21	0.09524	.	.	.	.	.	T	0.44644	0.1303	L	0.40543	1.245	0.09310	N	1	P	0.41041	0.736	B	0.28784	0.094	T	0.35025	-0.9805	9	0.56958	D	0.05	.	2.9249	0.05781	0.1738:0.0:0.5591:0.267	.	90	Q8IVT2	CS021_HUMAN	K	90	ENSP00000215582:E90K	ENSP00000215582:E90K	E	+	1	0	C19orf21	708214	0.002000	0.14202	0.005000	0.12908	0.010000	0.07245	-0.080000	0.11339	-0.276000	0.09206	-0.521000	0.04368	GAG	MISP	-	NULL	ENSG00000099812		0.672	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MISP	HGNC	protein_coding	OTTHUMT00000457600.2	-	0.00	97	0	G	NM_173481		757214	+1	tier1	-	no_errors	ENST00000215582	ensembl	human	known	74_37	missense	9.02	111	11	SNP	0.000	A
MIR520F	574464	genome.wustl.edu	37	19	54188332	54188332	+	RNA	SNP	G	G	A	rs372763623		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:54188332G>A	ENST00000384824.1	+	0	87				MIR515-2_ENST00000384883.1_RNA|MIR519C_ENST00000385053.1_RNA	NR_030186.1				microRNA 520f																		CTTTTGGAGCGTTACTGTTTG	0.423																																																	0								G		0,3136		0,0,1568	82.0	74.0	77.0			-0.4	0.0	19		77	1,7125		0,1,3562	no	intergenic				0,1,5130	AA,AG,GG		0.014,0.0,0.0097			54188332	1,10261	1568	3563	5131			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207555	ENSG00000207555		"""ncRNAs / Micro RNAs"""	32096	non-coding RNA	RNA, micro				MIRN520F			Standard	NR_030186		Approved	hsa-mir-520f	uc021uzp.1				19.37:g.54188332G>A				RNA	SNP	-	NULL	ENST00000384824.1	37	NULL		19																																																																																			MIR515-2	-	-	ENSG00000207615		0.423	MIR520F-201	KNOWN	basic	miRNA	MIR515-2	HGNC	miRNA		-	0.00	77	0	G	NR_030186		54188332	+1	tier1	-	no_errors	ENST00000384883	ensembl	human	known	74_37	rna	18.06	59	13	SNP	0.005	A
MLLT3	4300	genome.wustl.edu	37	9	20414346	20414346	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:20414346G>A	ENST00000380338.4	-	5	784	c.498C>T	c.(496-498)agC>agT	p.S166S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S163S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	166	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S166S(4)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.527			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	4	Substitution - coding silent(4)	urinary_tract(2)|lung(1)|prostate(1)											8.0	15.0	13.0					9																	20414346		1434	3114	4548	SO:0001819	synonymous_variant	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.498C>T	9.37:g.20414346G>A			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	pfam_YEATS,pfscan_YEATS	p.S166	ENST00000380338.4	37	c.498	CCDS6494.1	9																																																																																			MLLT3	-	NULL	ENSG00000171843		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1	-	0.00	65	0	G	NM_004529		20414346	-1	tier1	-	no_errors	ENST00000380338	ensembl	human	known	74_37	silent	10.00	45	5	SNP	0.975	A
MMP24	10893	genome.wustl.edu	37	20	33862200	33862200	+	Silent	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:33862200C>A	ENST00000246186.6	+	9	1811	c.1726C>A	c.(1726-1728)Cgg>Agg	p.R576R	RP4-614O4.11_ENST00000444717.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|MMP24-AS1_ENST00000438751.1_RNA|MMP24-AS1_ENST00000433764.1_RNA|MMP24-AS1_ENST00000435366.1_RNA|MMP24-AS1_ENST00000424358.1_RNA|MMP24-AS1_ENST00000455178.1_RNA|MMP24-AS1_ENST00000453892.1_RNA|EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000454184.1_RNA|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000456790.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)	576					cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	GGAGGTGGAGCGGCGGAAGGA	0.632																																																	0													85.0	101.0	96.0					20																	33862200		2127	4219	6346	SO:0001819	synonymous_variant	0			AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.1726C>A	20.37:g.33862200C>A			B7ZBG8|Q9H440	Silent	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.R576	ENST00000246186.6	37	c.1726	CCDS46593.1	20																																																																																			MMP24	-	pfam_Pept_M10A_metallopeptidase_C	ENSG00000125966		0.632	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP24	HGNC	protein_coding	OTTHUMT00000078851.4	-	0.00	56	0	C	NM_006690		33862200	+1	tier1	-	no_errors	ENST00000246186	ensembl	human	known	74_37	silent	23.08	40	12	SNP	0.046	A
DPM1	8813	genome.wustl.edu	37	20	49576280	49576280	+	5'Flank	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:49576280G>T	ENST00000371588.5	-	0	0				DPM1_ENST00000371582.4_5'Flank|DPM1_ENST00000466152.1_5'Flank|DPM1_ENST00000371583.5_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.G301W	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						TGCAGCTTGCGGGGAACGGCC	0.592																																																	0													59.0	62.0	61.0					20																	49576280		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49576280G>T	Exception_encountered		O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_MoeZ_MoeB,pfam_Rhodanese-like_dom,superfamily_Molybdenum_cofac_synth_MoeB,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.G301W	ENST00000371588.5	37	c.901	CCDS13434.1	20	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153989	0.57259	.	.	ENSG00000124217	ENST00000244051	T	0.36157	1.27	4.74	3.78	0.43462	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);MoeZ/MoeB (1);	0.057534	0.64402	D	0.000001	T	0.74344	0.3704	H	0.98559	4.265	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.85458	0.1165	9	.	.	.	-23.4709	14.9576	0.71127	0.0:0.1436:0.8564:0.0	.	301	O95396	MOCS3_HUMAN	W	301	ENSP00000244051:G301W	.	G	+	1	0	MOCS3	49009687	1.000000	0.71417	0.350000	0.25708	0.603000	0.37013	9.123000	0.94387	1.195000	0.43115	0.561000	0.74099	GGG	MOCS3	-	pfam_MoeZ_MoeB,superfamily_Molybdenum_cofac_synth_MoeB	ENSG00000124217		0.592	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOCS3	HGNC	protein_coding	OTTHUMT00000079716.1	-	0.00	42	0	G	NM_003859		49576280	+1	tier1	-	no_errors	ENST00000244051	ensembl	human	known	74_37	missense	24.00	19	6	SNP	0.999	T
MOV10	4343	genome.wustl.edu	37	1	113235484	113235484	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:113235484A>G	ENST00000413052.2	+	7	1463	c.1073A>G	c.(1072-1074)tAt>tGt	p.Y358C	RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000369645.1_Missense_Mutation_p.Y358C|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_Missense_Mutation_p.Y302C|MOV10_ENST00000357443.2_Missense_Mutation_p.Y358C	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	358					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		ATCCGGCACTATGACCTGGAG	0.612																																																	0													50.0	42.0	44.0					1																	113235484		2203	4300	6503	SO:0001583	missense	0			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.1073A>G	1.37:g.113235484A>G	ENSP00000399797:p.Tyr358Cys		Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.Y358C	ENST00000413052.2	37	c.1073	CCDS853.1	1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.861024	0.91433	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000285733;ENST00000369644;ENST00000357443;ENST00000369648	D;D;D;D	0.96300	-3.97;-3.97;-3.94;-3.97	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.97788	0.9274	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98552	1.0637	10	0.66056	D	0.02	-11.1753	16.2708	0.82618	1.0:0.0:0.0:0.0	.	302;358;358	Q5JR04;Q9H8T8;Q9HCE1	.;.;MOV10_HUMAN	C	358;358;358;302;358;296	ENSP00000399797:Y358C;ENSP00000358659:Y358C;ENSP00000358658:Y302C;ENSP00000350028:Y358C	ENSP00000285733:Y358C	Y	+	2	0	MOV10	113037007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.526000	0.90588	2.324000	0.78689	0.533000	0.62120	TAT	MOV10	-	NULL	ENSG00000155363		0.612	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	HGNC	protein_coding	OTTHUMT00000032906.1	-	0.00	33	0	A	NM_020963		113235484	+1	tier1	-	no_errors	ENST00000357443	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	G
MPEG1	219972	genome.wustl.edu	37	11	58980158	58980158	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:58980158G>A	ENST00000361050.3	-	1	266	c.181C>T	c.(181-183)Cga>Tga	p.R61*	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	61	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)		p.R61*(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				TCCATAACTCGTCCCATGTCC	0.478																																																	1	Substitution - Nonsense(1)	large_intestine(1)											170.0	169.0	169.0					11																	58980158		2017	4174	6191	SO:0001587	stop_gained	0			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.181C>T	11.37:g.58980158G>A	ENSP00000354335:p.Arg61*		Q2M1T6|Q8TEF8	Nonsense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.R61*	ENST00000361050.3	37	c.181	CCDS41650.1	11	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994369	0.93167	.	.	ENSG00000197629	ENST00000361050;ENST00000545098	.	.	.	5.41	3.33	0.38152	.	0.064428	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1937	10.4012	0.44231	0.0:0.0:0.5005:0.4995	.	.	.	.	X	61	.	ENSP00000354335:R61X	R	-	1	2	MPEG1	58736734	0.994000	0.37717	1.000000	0.80357	0.940000	0.58332	2.854000	0.48325	1.262000	0.44165	0.644000	0.83932	CGA	MPEG1	-	NULL	ENSG00000197629		0.478	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPEG1	HGNC	protein_coding	OTTHUMT00000370027.1		0.00	74	0	G	NM_001039396		58980158	-1			no_errors	ENST00000361050	ensembl	human	known	74_37	nonsense	5.00	57	3	SNP	0.998	A
MUC16	94025	genome.wustl.edu	37	19	9064268	9064268	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:9064268C>T	ENST00000397910.4	-	3	23381	c.23178G>A	c.(23176-23178)gcG>gcA	p.A7726A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7728	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGTGGTTGTCGCCGGGCCAG	0.522																																																	0													127.0	119.0	122.0					19																	9064268		1997	4169	6166	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23178G>A	19.37:g.9064268C>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.A7726	ENST00000397910.4	37	c.23178	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	30	0	C	NM_024690		9064268	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	13.64	38	6	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9084035	9084035	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:9084035C>A	ENST00000397910.4	-	1	7983	c.7780G>T	c.(7780-7782)Gag>Tag	p.E2594*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2594	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AAAAGGCTCTCAGGAGTAGCT	0.468																																																	0													146.0	142.0	143.0					19																	9084035		1946	4141	6087	SO:0001587	stop_gained	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7780G>T	19.37:g.9084035C>A	ENSP00000381008:p.Glu2594*		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.E2594*	ENST00000397910.4	37	c.7780	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	48	14.416247	0.99794	.	.	ENSG00000181143	ENST00000397910	.	.	.	0.225	0.225	0.15325	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	2594	.	ENSP00000381008:E2594X	E	-	1	0	MUC16	8945035	0.009000	0.17119	0.114000	0.21550	0.117000	0.20001	0.305000	0.19254	0.300000	0.22699	0.305000	0.20034	GAG	MUC16	-	NULL	ENSG00000181143		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	71	0	C	NM_024690		9084035	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	nonsense	5.33	71	4	SNP	0.151	A
MYH10	4628	genome.wustl.edu	37	17	8445446	8445446	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:8445446G>T	ENST00000269243.4	-	13	1692	c.1554C>A	c.(1552-1554)tgC>tgA	p.C518*	MYH10_ENST00000396239.1_Nonsense_Mutation_p.C518*|MYH10_ENST00000379980.4_Nonsense_Mutation_p.C534*|MYH10_ENST00000360416.3_Nonsense_Mutation_p.C528*	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	518	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TTAGGTCGATGCATGGCTGCA	0.473																																																	0													145.0	126.0	133.0					17																	8445446		2203	4300	6503	SO:0001587	stop_gained	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.1554C>A	17.37:g.8445446G>T	ENSP00000269243:p.Cys518*		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.C518*	ENST00000269243.4	37	c.1554	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442513	0.83993	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1274	0.59363	0.077:0.0:0.923:0.0	.	.	.	.	X	518;528;518;534	.	ENSP00000269243:C518X	C	-	3	2	MYH10	8386171	1.000000	0.71417	1.000000	0.80357	0.217000	0.24651	5.321000	0.65846	2.735000	0.93741	0.563000	0.77884	TGC	MYH10	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000133026		0.473	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	-	0.00	73	0	G			8445446	-1	tier1	-	no_errors	ENST00000396239	ensembl	human	known	74_37	nonsense	7.02	52	4	SNP	1.000	T
MYH13	8735	genome.wustl.edu	37	17	10209808	10209808	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:10209808C>T	ENST00000418404.3	-	36	5597	c.5434G>A	c.(5434-5436)Ggg>Agg	p.G1812R	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.G1812R			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1812					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TGCTTCTTCCCGCCCTTCAGC	0.552																																																	0													164.0	173.0	170.0					17																	10209808		2203	4300	6503	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5434G>A	17.37:g.10209808C>T	ENSP00000404570:p.Gly1812Arg		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G1812R	ENST00000418404.3	37	c.5434	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378631	0.82682	.	.	ENSG00000006788	ENST00000252172	T	0.81247	-1.47	4.12	4.12	0.48240	Myosin tail (1);	.	.	.	.	D	0.93367	0.7885	H	0.98199	4.17	0.49687	D	0.999815	D	0.69078	0.997	D	0.71414	0.973	D	0.96057	0.9036	9	0.87932	D	0	.	16.9211	0.86164	0.0:1.0:0.0:0.0	.	1812	Q9UKX3	MYH13_HUMAN	R	1812	ENSP00000252172:G1812R	ENSP00000252172:G1812R	G	-	1	0	MYH13	10150533	1.000000	0.71417	0.991000	0.47740	0.787000	0.44495	5.897000	0.69831	2.290000	0.77057	0.491000	0.48974	GGG	MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.552	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	-	0.00	88	0	C	NM_003802		10209808	-1	tier1	-	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
MYH14	79784	genome.wustl.edu	37	19	50764849	50764849	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:50764849A>T	ENST00000596571.1	+	18	2419	c.2419A>T	c.(2419-2421)Atc>Ttc	p.I807F	MYH14_ENST00000262269.8_Missense_Mutation_p.I848F|MYH14_ENST00000425460.1_Missense_Mutation_p.I815F|MYH14_ENST00000601313.1_Missense_Mutation_p.I848F|MYH14_ENST00000598205.1_Missense_Mutation_p.I815F|MYH14_ENST00000376970.2_Missense_Mutation_p.I840F|MYH14_ENST00000440075.2_Missense_Mutation_p.I848F			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	807	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CACCGACATCATCGTCTCCTT	0.662																																																	0													33.0	38.0	36.0					19																	50764849		2129	4249	6378	SO:0001583	missense	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.2419A>T	19.37:g.50764849A>T	ENSP00000472819:p.Ile807Phe		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I848F	ENST00000596571.1	37	c.2542	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	A	27.5	4.839701	0.91117	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67	4.48	4.48	0.54585	.	.	.	.	.	T	0.77068	0.4076	M	0.84219	2.685	0.80722	D	1	P;D;D	0.63046	0.892;0.985;0.992	B;B;P	0.49252	0.429;0.4;0.604	T	0.81844	-0.0746	9	0.87932	D	0	.	12.0425	0.53460	1.0:0.0:0.0:0.0	.	848;807;815	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	F	807;848;840;815;807;848	ENSP00000406273:I848F;ENSP00000366169:I840F;ENSP00000407879:I815F;ENSP00000262269:I848F	ENSP00000262269:I848F	I	+	1	0	MYH14	55456661	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.830000	0.92063	2.028000	0.59812	0.454000	0.30748	ATC	MYH14	-	superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000105357		0.662	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2		0.00	53	0	A	NM_024729		50764849	+1			no_errors	ENST00000262269	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
MYH6	4624	genome.wustl.edu	37	14	23855576	23855576	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:23855576C>T	ENST00000356287.3	-	32	4936	c.4907G>A	c.(4906-4908)cGc>cAc	p.R1636H	MIR208A_ENST00000362287.1_RNA|MYH6_ENST00000405093.3_Missense_Mutation_p.R1636H			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1636					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GGCAGCCATGCGGTTGGCGTG	0.612																																																	0													90.0	84.0	86.0					14																	23855576		2203	4300	6503	SO:0001583	missense	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.4907G>A	14.37:g.23855576C>T	ENSP00000348634:p.Arg1636His		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1636H	ENST00000356287.3	37	c.4907	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	c	25.8	4.676857	0.88445	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.81908	-1.55;-1.55	4.5	4.5	0.54988	Myosin tail (1);	.	.	.	.	D	0.85195	0.5641	M	0.80746	2.51	0.46927	D	0.999254	P	0.35411	0.5	B	0.37198	0.243	D	0.87874	0.2673	9	0.87932	D	0	.	17.5797	0.87963	0.0:1.0:0.0:0.0	.	1636	P13533	MYH6_HUMAN	H	1636	ENSP00000386041:R1636H;ENSP00000348634:R1636H	ENSP00000348634:R1636H	R	-	2	0	MYH6	22925416	0.853000	0.29707	0.035000	0.18076	0.660000	0.38997	7.682000	0.84083	2.203000	0.70933	0.561000	0.74099	CGC	MYH6	-	pfam_Myosin_tail	ENSG00000197616		0.612	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3		0.00	50	0	C			23855576	-1			no_errors	ENST00000356287	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.884	T
MYO10	4651	genome.wustl.edu	37	5	16670647	16670647	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:16670647C>T	ENST00000513610.1	-	39	6325	c.5871G>A	c.(5869-5871)ctG>ctA	p.L1957L	MYO10_ENST00000427430.2_Silent_p.L1314L|MYO10_ENST00000515803.1_Silent_p.L1296L|MYO10_ENST00000274203.9_Silent_p.L1314L|MYO10_ENST00000505695.1_Silent_p.L1296L	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1957	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CCACATCAAACAGCGTCGAGC	0.537																																																	0													46.0	48.0	47.0					5																	16670647		2115	4237	6352	SO:0001819	synonymous_variant	0			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.5871G>A	5.37:g.16670647C>T			A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_P-loop_NTPase,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.L1957	ENST00000513610.1	37	c.5871	CCDS54834.1	5																																																																																			MYO10	-	pfam_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000145555		0.537	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	HGNC	protein_coding	OTTHUMT00000366167.1	-	0.00	55	0	C	NM_012334		16670647	-1	tier1	-	no_errors	ENST00000513610	ensembl	human	known	74_37	silent	10.00	45	5	SNP	0.994	T
MYO16	23026	genome.wustl.edu	37	13	109562480	109562480	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr13:109562480A>C	ENST00000357550.2	+	15	1882	c.1841A>C	c.(1840-1842)aAt>aCt	p.N614T	MYO16_ENST00000457511.2_Missense_Mutation_p.N126T|MYO16_ENST00000251041.5_Missense_Mutation_p.N614T|MYO16_ENST00000356711.2_Missense_Mutation_p.N614T	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CTTCATCTTAATAATTTATGT	0.348																																																	0													141.0	150.0	147.0					13																	109562480		2203	4300	6503	SO:0001583	missense	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1841A>C	13.37:g.109562480A>C	ENSP00000350160:p.Asn614Thr			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.N614T	ENST00000357550.2	37	c.1841	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	A	4.667	0.124049	0.08931	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857;ENST00000457511	D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16	5.2	-1.87	0.07737	Myosin head, motor domain (2);	0.527932	0.15436	U	0.262429	T	0.74642	0.3743	N	0.04746	-0.17	0.09310	N	1	P;B;P	0.45044	0.575;0.348;0.849	B;B;P	0.47299	0.167;0.108;0.543	T	0.69347	-0.5169	9	.	.	.	.	10.7878	0.46415	0.489:0.0:0.511:0.0	.	126;614;614	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	T	614;614;614;614;402;126	ENSP00000349145:N614T;ENSP00000350160:N614T;ENSP00000251041:N614T;ENSP00000401633:N126T	.	N	+	2	0	MYO16	108360481	0.000000	0.05858	0.000000	0.03702	0.387000	0.30353	-0.569000	0.05902	-0.570000	0.06022	0.482000	0.46254	AAT	MYO16	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000041515		0.348	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1		0.00	61	0	A	NM_015011		109562480	+1			no_errors	ENST00000356711	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.003	C
MYOD1	4654	genome.wustl.edu	37	11	17741339	17741339	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:17741339C>T	ENST00000250003.3	+	1	225	c.10C>T	c.(10-12)Ctg>Ttg	p.L4L		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	4					cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)	p.L4M(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						TATGGAGCTACTGTCGCCACC	0.662																																																	1	Substitution - Missense(1)	lung(1)											47.0	50.0	49.0					11																	17741339		2199	4293	6492	SO:0001819	synonymous_variant	0			AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.10C>T	11.37:g.17741339C>T			O75321	Silent	SNP	pfam_Basic,pfam_Myf5,pfam_bHLH_dom,superfamily_bHLH_dom,smart_Basic,smart_bHLH_dom,pfscan_bHLH_dom	p.L4	ENST00000250003.3	37	c.10	CCDS7826.1	11																																																																																			MYOD1	-	smart_Basic	ENSG00000129152		0.662	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOD1	HGNC	protein_coding	OTTHUMT00000389387.1		0.00	54	0	C	NM_002478		17741339	+1			no_errors	ENST00000250003	ensembl	human	known	74_37	silent	6.25	30	2	SNP	1.000	T
MYOM2	9172	genome.wustl.edu	37	8	2048834	2048834	+	Missense_Mutation	SNP	G	G	A	rs144235879		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:2048834G>A	ENST00000262113.4	+	20	2750	c.2609G>A	c.(2608-2610)cGt>cAt	p.R870H	MYOM2_ENST00000523438.1_Missense_Mutation_p.R295H	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	870	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ACAGCCAACCGTTATTTAAAG	0.527																																																	0								G	HIS/ARG	0,4406		0,0,2203	60.0	65.0	63.0		2609	5.6	0.2	8	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYOM2	NM_003970.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	870/1466	2048834	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2609G>A	8.37:g.2048834G>A	ENSP00000262113:p.Arg870His		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R870H	ENST00000262113.4	37	c.2609	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	G	10.34	1.324318	0.24080	0.0	1.16E-4	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.54279	0.58;0.58	5.55	5.55	0.83447	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.55273	0.1910	M	0.62016	1.91	0.58432	D	0.999993	B	0.22146	0.065	B	0.27500	0.08	T	0.50432	-0.8829	10	0.32370	T	0.25	.	19.488	0.95037	0.0:0.0:1.0:0.0	.	870	P54296	MYOM2_HUMAN	H	870;295	ENSP00000262113:R870H;ENSP00000428396:R295H	ENSP00000262113:R870H	R	+	2	0	MYOM2	2036241	1.000000	0.71417	0.155000	0.22561	0.018000	0.09664	5.112000	0.64634	2.618000	0.88619	0.643000	0.83706	CGT	MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000036448		0.527	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1		0.00	49	0	G	NM_003970		2048834	+1			no_errors	ENST00000262113	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.997	A
MYT1	4661	genome.wustl.edu	37	20	62843471	62843471	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:62843471C>T	ENST00000328439.1	+	9	1861	c.1497C>T	c.(1495-1497)agC>agT	p.S499S	MYT1_ENST00000536311.1_Silent_p.S499S|MYT1_ENST00000360149.4_Silent_p.S201S	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Interaction with CDC2-CCNB1.|Interaction with PIN1.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					ACGTGAACAGCAACCGCAACA	0.662																																					GBM(59;481 1041 20555 21139 33705)												0													128.0	119.0	122.0					20																	62843471		2203	4300	6503	SO:0001819	synonymous_variant	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1497C>T	20.37:g.62843471C>T			B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Silent	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.S499	ENST00000328439.1	37	c.1497	CCDS13558.1	20																																																																																			MYT1	-	pfam_Znf_C2HC	ENSG00000196132		0.662	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1	-	0.00	72	0	C	NM_004535		62843471	+1	tier1	-	no_errors	ENST00000536311	ensembl	human	known	74_37	silent	5.88	63	4	SNP	1.000	T
MZB1	51237	genome.wustl.edu	37	5	138725440	138725440	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:138725440C>G	ENST00000302125.8	-	1	163	c.106G>C	c.(106-108)Gat>Cat	p.D36H	MZB1_ENST00000457570.2_Missense_Mutation_p.D36H|MZB1_ENST00000412103.2_5'UTR	NM_016459.3	NP_057543.2	Q8WU39	MZB1_HUMAN	marginal zone B and B1 cell-specific protein	36					apoptotic process (GO:0006915)|integrin activation (GO:0033622)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin biosynthetic process (GO:0002642)|regulation of B cell proliferation (GO:0030888)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)											ATCTCCTCATCATCCAGTTGT	0.647																																																	0													73.0	80.0	77.0					5																	138725440		2188	4282	6470	SO:0001583	missense	0			AF151024	CCDS47273.1	5q31.2	2012-09-27	2012-09-19		ENSG00000170476	ENSG00000170476			30125	protein-coding gene	gene with protein product	"""plasma cell-induced ER protein 1"", ""proapoptotic caspase adaptor protein"", ""mesenteric oestrogen-dependent adipose gene- 7"""	609447				22573353, 12573802, 11350957, 21093319, 21688198	Standard	NM_016459		Approved	PACAP, MGC29506, HSPC190, pERp1, MEDA-7	uc003lei.3	Q8WU39	OTTHUMG00000163390	ENST00000302125.8:c.106G>C	5.37:g.138725440C>G	ENSP00000303920:p.Asp36His		D2IYS0|Q7Z6N2|Q96RL5|Q9P0T3	Missense_Mutation	SNP	NULL	p.D36H	ENST00000302125.8	37	c.106	CCDS47273.1	5	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239490	0.58995	.	.	ENSG00000170476	ENST00000302125;ENST00000457570	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	T	0.41026	0.1141	N	0.24115	0.695	0.30387	N	0.781342	D	0.56521	0.976	P	0.51582	0.674	T	0.40664	-0.9551	8	0.87932	D	0	.	13.3918	0.60829	0.0:1.0:0.0:0.0	.	36	Q8WU39	PERP1_HUMAN	H	36	.	ENSP00000303920:D36H	D	-	1	0	RP11-1280I22.1	138753339	0.809000	0.29036	0.860000	0.33809	0.914000	0.54420	2.786000	0.47790	2.633000	0.89246	0.650000	0.86243	GAT	MZB1	-	NULL	ENSG00000170476		0.647	MZB1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MZB1	HGNC	protein_coding	OTTHUMT00000373055.1		0.00	62	0	C	NM_016459		138725440	-1			no_errors	ENST00000503481	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.860	G
NAA50	80218	genome.wustl.edu	37	3	113440608	113440608	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:113440608C>T	ENST00000240922.3	-	5	833	c.509G>A	c.(508-510)tGa>tAa	p.*170*	NAA50_ENST00000497525.1_Silent_p.*96*|NAA50_ENST00000477813.1_Silent_p.*130*|NAA50_ENST00000467022.1_5'Flank|NAA50_ENST00000493454.1_Silent_p.*96*|NAA50_ENST00000497255.1_Silent_p.*59*|NAA50_ENST00000493900.1_Silent_p.*169*	NM_025146.2	NP_079422.1	Q9GZZ1	NAA50_HUMAN	N(alpha)-acetyltransferase 50, NatE catalytic subunit	0					histone H4 acetylation (GO:0043967)|mitotic sister chromatid cohesion, centromeric (GO:0071962)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	H4 histone acetyltransferase activity (GO:0010485)|peptide alpha-N-acetyltransferase activity (GO:0004596)|peptidyl-lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0052858)			large_intestine(2)|lung(2)|skin(1)	5						GTAATTTGTTCAGTTGTCTGT	0.418																																																	0													127.0	121.0	123.0					3																	113440608		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023256	CCDS2975.1	3q13.31	2010-05-07	2010-01-14	2010-01-14	ENSG00000121579	ENSG00000121579	2.3.1.-	"""N(alpha)-acetyltransferase subunits"""	29533	protein-coding gene	gene with protein product		610834	"""Mak3 homolog (S. cerevisiae)"", ""N-acetyltransferase 13"", ""N-acetyltransferase 13 (GCN5-related)"""	MAK3, NAT13		16507339, 17502424, 19660095	Standard	NM_025146		Approved	FLJ13194, NAT5, San	uc003ean.2	Q9GZZ1	OTTHUMG00000159294	ENST00000240922.3:c.509G>A	3.37:g.113440608C>T			D3DN74|Q68DQ1	Silent	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.*170	ENST00000240922.3	37	c.509	CCDS2975.1	3																																																																																			NAA50	-	NULL	ENSG00000121579		0.418	NAA50-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA50	HGNC	protein_coding	OTTHUMT00000354446.2	-	0.00	98	0	C	NM_025146		113440608	-1	tier1	-	no_errors	ENST00000240922	ensembl	human	known	74_37	silent	13.48	77	12	SNP	1.000	T
NAALADL1	10004	genome.wustl.edu	37	11	64825853	64825853	+	Silent	SNP	G	G	A	rs372762648		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:64825853G>A	ENST00000358658.3	-	1	168	c.141C>T	c.(139-141)acC>acT	p.T47T	NAALADL1_ENST00000356632.3_Silent_p.T47T|NAALADL1_ENST00000339885.2_Silent_p.T47T|NAALADL1_ENST00000355721.3_Silent_p.T47T|NAALADL1_ENST00000355369.2_Silent_p.T47T|NAALADL1_ENST00000340252.4_Silent_p.T47T	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						GCCCCATGACGGTCTCCAGGA	0.632																																																	0								G		1,4401	2.1+/-5.4	0,1,2200	50.0	47.0	48.0		141	-8.7	0.0	11		48	0,8594		0,0,4297	no	coding-synonymous	NAALADL1	NM_005468.2		0,1,6497	AA,AG,GG		0.0,0.0227,0.0077		47/741	64825853	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	0			AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.141C>T	11.37:g.64825853G>A			C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.T47	ENST00000358658.3	37	c.141	CCDS31604.1	11																																																																																			NAALADL1	-	NULL	ENSG00000168060		0.632	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL1	HGNC	protein_coding	OTTHUMT00000385162.1	-	0.00	121	0	G	NM_005468		64825853	-1	tier1	-	no_errors	ENST00000358658	ensembl	human	known	74_37	silent	7.89	105	9	SNP	0.000	A
NAALAD2	10003	genome.wustl.edu	37	11	89882218	89882218	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:89882218G>C	ENST00000534061.1	+	4	656	c.426G>C	c.(424-426)gaG>gaC	p.E142D	NAALAD2_ENST00000375944.3_Missense_Mutation_p.E142D|NAALAD2_ENST00000321955.4_Missense_Mutation_p.E142D|NAALAD2_ENST00000525171.1_Missense_Mutation_p.E142D	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	142					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				ATGGCTATGAGAATGTTACAA	0.318																																																	0													91.0	94.0	93.0					11																	89882218		2201	4292	6493	SO:0001583	missense	0			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.426G>C	11.37:g.89882218G>C	ENSP00000432481:p.Glu142Asp		B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.E142D	ENST00000534061.1	37	c.426	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	G	14.51	2.555604	0.45487	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171;ENST00000375944;ENST00000526637	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.37	3.27	0.37495	.	0.150695	0.45361	D	0.000380	T	0.37865	0.1019	M	0.83118	2.625	0.51482	D	0.999923	B;B;B;B;B	0.31193	0.025;0.0;0.004;0.312;0.011	B;B;B;B;B	0.23275	0.012;0.002;0.004;0.045;0.005	T	0.33497	-0.9866	9	.	.	.	-17.3762	4.0939	0.09982	0.491:0.0:0.509:0.0	.	142;142;142;142;142	Q4KKV4;E9PJV2;Q9Y3Q0;E9PKX5;Q8IUX3	.;.;NALD2_HUMAN;.;.	D	142;142;142;142;88	ENSP00000432481:E142D;ENSP00000320083:E142D;ENSP00000435249:E142D;ENSP00000365111:E142D;ENSP00000435670:E88D	.	E	+	3	2	NAALAD2	89521866	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	2.500000	0.45381	1.279000	0.44446	0.552000	0.68991	GAG	NAALAD2	-	NULL	ENSG00000077616		0.318	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	-	0.00	224	0	G	NM_005467		89882218	+1	tier1	-	no_errors	ENST00000534061	ensembl	human	known	74_37	missense	7.43	162	13	SNP	1.000	C
NADK	65220	genome.wustl.edu	37	1	1687745	1687745	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:1687745G>C	ENST00000341426.5	-	6	758	c.537C>G	c.(535-537)atC>atG	p.I179M	NADK_ENST00000342348.5_Missense_Mutation_p.I147M|NADK_ENST00000344463.4_Missense_Mutation_p.I324M|NADK_ENST00000378625.1_Missense_Mutation_p.I324M|NADK_ENST00000492768.1_5'Flank|NADK_ENST00000341991.3_Missense_Mutation_p.I179M	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase	179					ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		CCCCCAGGCAGATGATGAAGT	0.527																																																	0													114.0	115.0	115.0					1																	1687745		2203	4300	6503	SO:0001583	missense	0			BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.537C>G	1.37:g.1687745G>C	ENSP00000341679:p.Ile179Met		A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	Missense_Mutation	SNP	pfam_PolyP/ATP_NADK_prd,superfamily_ATP-NAD_kinase_PpnK-typ	p.I324M	ENST00000341426.5	37	c.972	CCDS30565.1	1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599532	0.66332	.	.	ENSG00000008130	ENST00000341426;ENST00000341991;ENST00000378625;ENST00000344463;ENST00000342348;ENST00000400922	T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57	5.49	-3.44	0.04796	ATP-NAD kinase, PpnK-type, alpha/beta (1);ATP-NAD kinase, PpnK-type (1);	0.000000	0.85682	D	0.000000	T	0.71151	0.3306	M	0.92219	3.285	0.49299	D	0.999778	D;D;D;D	0.76494	0.998;0.997;0.999;0.999	D;D;D;D	0.80764	0.981;0.99;0.992;0.994	T	0.69624	-0.5095	10	0.87932	D	0	-31.351	7.6833	0.28526	0.195:0.0:0.1778:0.6273	.	147;324;324;179	F5GXR5;Q9H2P2;Q5QPS4;O95544	.;.;.;NADK_HUMAN	M	179;179;324;324;147;147	ENSP00000341679:I179M;ENSP00000344340:I179M;ENSP00000367890:I324M;ENSP00000340925:I324M;ENSP00000339727:I147M;ENSP00000383713:I147M	ENSP00000341679:I179M	I	-	3	3	NADK	1677605	0.987000	0.35691	0.911000	0.35937	0.983000	0.72400	0.123000	0.15708	-1.085000	0.03088	0.462000	0.41574	ATC	NADK	-	pfam_PolyP/ATP_NADK_prd,superfamily_ATP-NAD_kinase_PpnK-typ	ENSG00000008130		0.527	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	NADK	HGNC	protein_coding	OTTHUMT00000002769.1	-	0.00	68	0	G	NM_023018		1687745	-1	tier1	-	no_errors	ENST00000344463	ensembl	human	known	74_37	missense	11.90	37	5	SNP	0.978	C
NADSYN1	55191	genome.wustl.edu	37	11	71208614	71208614	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:71208614G>A	ENST00000319023.2	+	19	2038	c.1850G>A	c.(1849-1851)tGc>tAc	p.C617Y	NADSYN1_ENST00000530055.1_Missense_Mutation_p.C246Y|NADSYN1_ENST00000539574.1_Missense_Mutation_p.C357Y	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	617	Ligase. {ECO:0000250}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	AGCATGTTCTGCAAACTCCTC	0.532																																					Ovarian(79;763 1781 6490 50276)												0													126.0	119.0	121.0					11																	71208614		2200	4294	6494	SO:0001583	missense	0			AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.1850G>A	11.37:g.71208614G>A	ENSP00000326424:p.Cys617Tyr		B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Missense_Mutation	SNP	pfam_C-N_Hydrolase,pfam_NAD/GMP_synthase,superfamily_C-N_Hydrolase,pirsf_Gln-dep_NAD_synthase,pfscan_C-N_Hydrolase,tigrfam_NAD_synthase	p.C617Y	ENST00000319023.2	37	c.1850	CCDS8201.1	11	.	.	.	.	.	.	.	.	.	.	.	21.3	4.130255	0.77549	.	.	ENSG00000172890	ENST00000319023;ENST00000539574;ENST00000530055	T;T;T	0.29655	2.57;1.98;1.56	4.81	4.81	0.61882	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.47911	0.1471	M	0.67569	2.06	0.80722	D	1	B;D	0.71674	0.146;0.998	B;D	0.75484	0.195;0.986	T	0.47947	-0.9077	10	0.02654	T	1	-31.5822	15.3854	0.74695	0.0:0.0:1.0:0.0	.	357;617	B3KUU4;Q6IA69	.;NADE_HUMAN	Y	617;357;246	ENSP00000326424:C617Y;ENSP00000443718:C357Y;ENSP00000431820:C246Y	ENSP00000326424:C617Y	C	+	2	0	NADSYN1	70886262	1.000000	0.71417	0.998000	0.56505	0.927000	0.56198	8.204000	0.89741	2.234000	0.73211	0.591000	0.81541	TGC	NADSYN1	-	pirsf_Gln-dep_NAD_synthase,tigrfam_NAD_synthase	ENSG00000172890		0.532	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NADSYN1	HGNC	protein_coding	OTTHUMT00000394356.1	-	0.00	78	0	G	NM_018161		71208614	+1	tier1	-	no_errors	ENST00000319023	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
NANS	54187	genome.wustl.edu	37	9	100823111	100823111	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:100823111C>G	ENST00000210444.5	+	2	250	c.180C>G	c.(178-180)ttC>ttG	p.F60L		NM_018946.3	NP_061819.2	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid synthase	60					lipopolysaccharide biosynthetic process (GO:0009103)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	N-acetylneuraminate synthase activity (GO:0050462)|N-acylneuraminate cytidylyltransferase activity (GO:0008781)|N-acylneuraminate-9-phosphate synthase activity (GO:0047444)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	11		Acute lymphoblastic leukemia(62;0.0559)				AGCTAGAATTCAAGTTTAATC	0.473																																																	0													163.0	166.0	165.0					9																	100823111		2203	4300	6503	SO:0001583	missense	0			AF161387	CCDS6733.1	9p24.1-p23	2008-07-31	2008-07-31		ENSG00000095380	ENSG00000095380			19237	protein-coding gene	gene with protein product	"""sialic acid synthase"""	605202				10749855	Standard	NM_018946		Approved	SAS	uc004ayc.3	Q9NR45	OTTHUMG00000020341	ENST00000210444.5:c.180C>G	9.37:g.100823111C>G	ENSP00000210444:p.Phe60Leu		B2RE98|Q8WUV9|Q9BWS6|Q9NVD4	Missense_Mutation	SNP	pfam_Neu5Ac_N,pfam_SAF,superfamily_AFP_Neu5c_C,smart_SAF,pfscan_AFP_Neu5c_C,prints_Antifreeze_III	p.F60L	ENST00000210444.5	37	c.180	CCDS6733.1	9	.	.	.	.	.	.	.	.	.	.	C	11.07	1.529921	0.27387	.	.	ENSG00000095380	ENST00000210444	T	0.40225	1.04	5.73	2.75	0.32379	Aldolase-type TIM barrel (1);N-acetylneuraminic acid synthase, N-terminal (1);	0.337819	0.37393	N	0.002119	T	0.12008	0.0292	N	0.00496	-1.435	0.33652	D	0.608606	B	0.13594	0.008	B	0.23275	0.045	T	0.17258	-1.0375	10	0.11794	T	0.64	-9.4905	8.9517	0.35792	0.0:0.7443:0.0:0.2557	.	60	Q9NR45	SIAS_HUMAN	L	60	ENSP00000210444:F60L	ENSP00000210444:F60L	F	+	3	2	NANS	99862932	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.763000	0.38461	0.817000	0.34445	0.655000	0.94253	TTC	NANS	-	pfam_Neu5Ac_N	ENSG00000095380		0.473	NANS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NANS	HGNC	protein_coding	OTTHUMT00000053359.1		0.00	46	0	C	NM_018946		100823111	+1			no_errors	ENST00000210444	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	G
NAV2	89797	genome.wustl.edu	37	11	19955208	19955208	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:19955208G>T	ENST00000396087.3	+	8	1586	c.1487G>T	c.(1486-1488)cGg>cTg	p.R496L	NAV2_ENST00000360655.4_Missense_Mutation_p.R409L|NAV2_ENST00000349880.4_Missense_Mutation_p.R473L|NAV2_ENST00000396085.1_Missense_Mutation_p.R473L|NAV2_ENST00000527559.2_Missense_Mutation_p.R425L|NAV2_ENST00000540292.1_Missense_Mutation_p.R427L	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	496					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						ACTTTTAGCCGGGCACTGACC	0.552																																																	0													60.0	71.0	67.0					11																	19955208		2199	4293	6492	SO:0001583	missense	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.1487G>T	11.37:g.19955208G>T	ENSP00000379396:p.Arg496Leu		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.R496L	ENST00000396087.3	37	c.1487	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	G	19.68	3.871965	0.72180	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292	T;T;T;T;T;T	0.30714	1.53;1.63;1.64;1.62;1.52;1.52	5.42	4.51	0.55191	.	0.000000	0.56097	D	0.000023	T	0.45975	0.1369	L	0.52573	1.65	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.79784	0.954;0.993	T	0.31668	-0.9935	9	.	.	.	.	10.3161	0.43738	0.1502:0.0:0.8498:0.0	.	473;409	Q8IVL1-3;Q8IVL1-4	.;.	L	409;473;473;496;425;427	ENSP00000353871:R409L;ENSP00000379394:R473L;ENSP00000309577:R473L;ENSP00000379396:R496L;ENSP00000435395:R425L;ENSP00000443489:R427L	.	R	+	2	0	NAV2	19911784	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.002000	0.88514	1.299000	0.44798	0.455000	0.32223	CGG	NAV2	-	NULL	ENSG00000166833		0.552	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1		0.00	44	0	G	NM_145117		19955208	+1			no_errors	ENST00000396087	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
NAV2	89797	genome.wustl.edu	37	11	20127143	20127143	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:20127143G>T	ENST00000396087.3	+	38	6987	c.6888G>T	c.(6886-6888)aaG>aaT	p.K2296N	NAV2_ENST00000533917.1_Missense_Mutation_p.K1301N|NAV2_ENST00000360655.4_Missense_Mutation_p.K2173N|NAV2_ENST00000311043.8_Missense_Mutation_p.K1301N|NAV2_ENST00000349880.4_Missense_Mutation_p.K2237N|NAV2_ENST00000396085.1_Missense_Mutation_p.K2240N|NAV2_ENST00000527559.2_Missense_Mutation_p.K2225N|NAV2_ENST00000540292.1_Missense_Mutation_p.K2227N	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	2296				K -> E (in Ref. 7; BAA91965). {ECO:0000305}.	glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						TGAGGAGGAAGCTCATGGAAA	0.522																																																	0													100.0	98.0	99.0					11																	20127143		2203	4300	6503	SO:0001583	missense	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.6888G>T	11.37:g.20127143G>T	ENSP00000379396:p.Lys2296Asn		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.K2296N	ENST00000396087.3	37	c.6888	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	g	19.83	3.899919	0.72754	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000311043	T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.25	3.36	0.38483	.	0.000000	0.64402	D	0.000004	T	0.63034	0.2477	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.996;1.0;0.997	T	0.64841	-0.6312	9	.	.	.	.	7.4843	0.27423	0.3183:0.0:0.6817:0.0	.	2240;1301;2237;2173	A7E2D6;Q8IVL1-5;Q8IVL1-3;Q8IVL1-4	.;.;.;.	N	2173;2240;2237;2296;2225;2227;1301;1301	ENSP00000353871:K2173N;ENSP00000379394:K2240N;ENSP00000309577:K2237N;ENSP00000379396:K2296N;ENSP00000435395:K2225N;ENSP00000443489:K2227N;ENSP00000437316:K1301N;ENSP00000312169:K1301N	.	K	+	3	2	NAV2	20083719	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.091000	0.50199	1.213000	0.43380	0.655000	0.94253	AAG	NAV2	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000166833		0.522	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1		0.00	87	0	G	NM_145117		20127143	+1			no_errors	ENST00000396087	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
NCAPD2	9918	genome.wustl.edu	37	12	6636988	6636988	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:6636988G>T	ENST00000315579.5	+	23	3752	c.2953G>T	c.(2953-2955)Ggg>Tgg	p.G985W	NCAPD2_ENST00000542492.1_3'UTR|NCAPD2_ENST00000545962.1_Missense_Mutation_p.G940W	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	985					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						GGGGCTGGTTGGGGCAACAGC	0.488																																																	0													138.0	142.0	141.0					12																	6636988		2203	4300	6503	SO:0001583	missense	0			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.2953G>T	12.37:g.6636988G>T	ENSP00000325017:p.Gly985Trp		D3DUR4|Q8N6U3	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	p.G985W	ENST00000315579.5	37	c.2953	CCDS8548.1	12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952956	0.73902	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	T;T;T	0.46063	2.01;0.88;1.74	5.95	5.95	0.96441	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71986	0.3405	M	0.87971	2.92	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.75328	-0.3356	10	0.87932	D	0	-32.0088	20.3931	0.98965	0.0:0.0:1.0:0.0	.	940;946;985	F5GZJ1;B3KY03;Q15021	.;.;CND1_HUMAN	W	985;857;940;857	ENSP00000325017:G985W;ENSP00000371895:G857W;ENSP00000444417:G940W	ENSP00000325017:G985W	G	+	1	0	NCAPD2	6507249	1.000000	0.71417	0.387000	0.26183	0.337000	0.28794	9.476000	0.97823	2.824000	0.97209	0.655000	0.94253	GGG	NCAPD2	-	superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	ENSG00000010292		0.488	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD2	HGNC	protein_coding	OTTHUMT00000399964.1	-	0.00	42	0	G	NM_014865		6636988	+1	tier1	-	no_errors	ENST00000315579	ensembl	human	known	74_37	missense	8.06	57	5	SNP	1.000	T
NDOR1	27158	genome.wustl.edu	37	9	140110463	140110463	+	Silent	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:140110463G>T	ENST00000344894.5	+	12	1631	c.1548G>T	c.(1546-1548)cgG>cgT	p.R516R	NDOR1_ENST00000371521.4_Silent_p.R516R|NDOR1_ENST00000458322.2_Silent_p.R509R|NDOR1_ENST00000427047.2_Silent_p.R482R	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CCTTCTCCCGGGAACAGGTGT	0.612																																																	0													72.0	79.0	77.0					9																	140110463		2203	4300	6503	SO:0001819	synonymous_variant	0			BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.1548G>T	9.37:g.140110463G>T				Silent	SNP	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.R516	ENST00000344894.5	37	c.1548	CCDS7036.1	9																																																																																			NDOR1	-	pfam_OxRdtase_FAD/NAD-bd	ENSG00000188566		0.612	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDOR1	HGNC	protein_coding	OTTHUMT00000254704.1	-	0.00	132	0	G	NM_014434		140110463	+1	tier1	-	no_errors	ENST00000371521	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
NDUFV3	4731	genome.wustl.edu	37	21	44317086	44317086	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr21:44317086C>A	ENST00000340344.4	+	2	164	c.98C>A	c.(97-99)tCt>tAt	p.S33Y	NDUFV3_ENST00000354250.2_Missense_Mutation_p.S33Y|NDUFV3_ENST00000460259.1_3'UTR	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa	33					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		TCTACGGTTTCTTTGTCTGCG	0.403																																																	0													85.0	84.0	84.0					21																	44317086		2203	4300	6503	SO:0001583	missense	0				CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.98C>A	21.37:g.44317086C>A	ENSP00000342895:p.Ser33Tyr		A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Missense_Mutation	SNP	NULL	p.S33Y	ENST00000340344.4	37	c.98	CCDS33573.1	21	.	.	.	.	.	.	.	.	.	.	C	9.807	1.182233	0.21787	.	.	ENSG00000160194	ENST00000354250;ENST00000340344;ENST00000398198	.	.	.	5.0	0.912	0.19349	.	0.988865	0.08239	N	0.976403	T	0.49525	0.1562	M	0.61703	1.905	0.09310	N	1	P;P	0.45634	0.688;0.863	B;P	0.50590	0.246;0.645	T	0.40813	-0.9543	9	0.62326	D	0.03	0.4712	7.603	0.28087	0.0:0.593:0.0:0.407	.	33;33	P56181;P56181-2	NDUV3_HUMAN;.	Y	33;33;16	.	ENSP00000342895:S33Y	S	+	2	0	NDUFV3	43190155	0.001000	0.12720	0.001000	0.08648	0.530000	0.34684	-0.229000	0.09098	0.195000	0.20347	0.655000	0.94253	TCT	NDUFV3	-	NULL	ENSG00000160194		0.403	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFV3	HGNC	protein_coding	OTTHUMT00000195448.2	-	0.00	86	0	C			44317086	+1	tier1	-	no_errors	ENST00000354250	ensembl	human	known	74_37	missense	7.69	60	5	SNP	0.000	A
NFASC	23114	genome.wustl.edu	37	1	204987007	204987007	+	3'UTR	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:204987007C>T	ENST00000401399.1	+	0	5262				NFASC_ENST00000367172.4_3'UTR|NFASC_ENST00000367169.4_3'UTR|NFASC_ENST00000367171.4_3'UTR|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000367170.4_3'UTR|NFASC_ENST00000339876.6_3'UTR|NFASC_ENST00000338586.6_3'UTR|NFASC_ENST00000338515.6_3'UTR|NFASC_ENST00000404076.1_3'UTR|NFASC_ENST00000539706.1_3'UTR|NFASC_ENST00000360049.4_3'UTR|NFASC_ENST00000404907.1_3'UTR			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ATGCCTTATGCAGCGCTGATC	0.567																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.*1340C>T	1.37:g.204987007C>T			B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	RNA	SNP	-	NULL	ENST00000401399.1	37	NULL	CCDS53460.1	1																																																																																			NFASC	-	-	ENSG00000163531		0.567	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	-	0.00	37	0	C	NM_001005388		204987007	+1	tier1	-	no_errors	ENST00000495396	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.995	T
NFE2L3	9603	genome.wustl.edu	37	7	26224313	26224313	+	Missense_Mutation	SNP	C	C	T	rs147199325		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:26224313C>T	ENST00000056233.3	+	4	1254	c.995C>T	c.(994-996)aCa>aTa	p.T332I		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	332					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						AGAGATCCAACAGCAAGGACT	0.408																																																	0													108.0	96.0	100.0					7																	26224313		2203	4300	6503	SO:0001583	missense	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.995C>T	7.37:g.26224313C>T	ENSP00000056233:p.Thr332Ile		Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	pfam_bZIP,pfam_bZIP_Maf,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.T332I	ENST00000056233.3	37	c.995	CCDS5396.1	7	.	.	.	.	.	.	.	.	.	.	c	0.830	-0.745584	0.03065	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.31247	1.5	4.63	-5.14	0.02875	.	1.593220	0.03300	N	0.188821	T	0.13927	0.0337	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20107	-1.0285	10	0.38643	T	0.18	1.2662	4.7543	0.13075	0.1048:0.4831:0.2352:0.177	.	332	Q9Y4A8	NF2L3_HUMAN	I	332;38	ENSP00000056233:T332I	ENSP00000056233:T332I	T	+	2	0	NFE2L3	26190838	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.396000	0.07278	-0.575000	0.05982	-1.912000	0.00520	ACA	NFE2L3	-	NULL	ENSG00000050344		0.408	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	-	0.00	45	0	C			26224313	+1	tier1	rs147199325	no_errors	ENST00000056233	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.000	T
NIN	51199	genome.wustl.edu	37	14	51192707	51192707	+	Missense_Mutation	SNP	C	C	A	rs534805269		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:51192707C>A	ENST00000382041.3	-	30	6346	c.6156G>T	c.(6154-6156)agG>agT	p.R2052S	RP11-248J18.3_ENST00000602615.1_RNA|NIN_ENST00000389868.3_3'UTR|NIN_ENST00000324330.9_3'UTR|NIN_ENST00000530997.2_Missense_Mutation_p.R2052S|NIN_ENST00000382043.4_Missense_Mutation_p.R1339S|NIN_ENST00000245441.5_Missense_Mutation_p.R2052S	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	2052					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CTTGAAGAAGCCTTTTCACTA	0.413			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													235.0	201.0	213.0					14																	51192707		2203	4300	6503	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.6156G>T	14.37:g.51192707C>A	ENSP00000371472:p.Arg2052Ser		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.R2052S	ENST00000382041.3	37	c.6156	CCDS32079.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.40|12.40	1.925853|1.925853	0.34002|0.34002	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000530997;ENST00000389869|ENST00000245441;ENST00000311149;ENST00000382043;ENST00000324292;ENST00000382041	.|T;T;T	.|0.29142	.|1.58;2.64;3.16	5.93|5.93	-2.72|-2.72	0.05968|0.05968	.|.	.|0.368313	.|0.29280	.|N	.|0.012612	T|T	0.20495|0.20495	0.0493|0.0493	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.15473	.|0.001;0.007;0.013;0.007	.|B;B;B;B	.|0.14578	.|0.004;0.011;0.003;0.011	T|T	0.23868|0.23868	-1.0176|-1.0176	5|10	.|0.10377	.|T	.|0.69	-16.181|-16.181	6.761|6.761	0.23540|0.23540	0.0:0.4646:0.1915:0.3439|0.0:0.4646:0.1915:0.3439	.|.	.|2058;2052;1339;2052	.|Q8N4C6-5;Q8N4C6;Q5BKU3;Q8N4C6-7	.|.;NIN_HUMAN;.;.	S|S	1543|2052;2035;1339;2058;2052	.|ENSP00000245441:R2052S;ENSP00000371474:R1339S;ENSP00000371472:R2052S	.|ENSP00000245441:R2052S	A|R	-|-	1|3	0|2	NIN|NIN	50262457|50262457	0.986000|0.986000	0.35501|0.35501	0.908000|0.908000	0.35775|0.35775	0.688000|0.688000	0.40055|0.40055	0.295000|0.295000	0.19065|0.19065	-0.572000|-0.572000	0.06006|0.06006	-3.186000|-3.186000	0.00055|0.00055	GCT|AGG	NIN	-	NULL	ENSG00000100503		0.413	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	-	0.00	97	0	C	NM_182946		51192707	-1	tier1	-	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	25.93	60	21	SNP	0.994	A
NLK	51701	genome.wustl.edu	37	17	26488245	26488245	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:26488245C>A	ENST00000407008.3	+	4	1422	c.704C>A	c.(703-705)cCa>cAa	p.P235Q		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	235	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Required for interaction with TAB2. {ECO:0000250}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		TCTCCTCAACCACTCAGCTCA	0.363																																																	0													119.0	113.0	115.0					17																	26488245		2203	4300	6503	SO:0001583	missense	0			AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.704C>A	17.37:g.26488245C>A	ENSP00000384625:p.Pro235Gln		B2RCX1|Q2PNI9|Q6P2A3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P235Q	ENST00000407008.3	37	c.704	CCDS11224.2	17	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035243	0.75617	.	.	ENSG00000087095	ENST00000407008	T	0.65549	-0.16	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55194	0.1905	N	0.17248	0.465	0.80722	D	1	B	0.30526	0.283	B	0.37267	0.245	T	0.53697	-0.8402	10	0.49607	T	0.09	-0.9486	19.8676	0.96824	0.0:1.0:0.0:0.0	.	235	Q9UBE8	NLK_HUMAN	Q	235	ENSP00000384625:P235Q	ENSP00000384625:P235Q	P	+	2	0	NLK	23512372	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CCA	NLK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000087095		0.363	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLK	HGNC	protein_coding	OTTHUMT00000255607.3		0.00	74	0	C	NM_016231		26488245	+1			no_errors	ENST00000407008	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	A
NLRP2	55655	genome.wustl.edu	37	19	55494605	55494605	+	Silent	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:55494605G>T	ENST00000543010.1	+	6	1682	c.1539G>T	c.(1537-1539)ctG>ctT	p.L513L	NLRP2_ENST00000427260.2_Silent_p.L490L|NLRP2_ENST00000263437.6_Silent_p.L510L|NLRP2_ENST00000538819.1_Silent_p.L489L|NLRP2_ENST00000391721.4_Silent_p.L489L|NLRP2_ENST00000448584.2_Silent_p.L513L|NLRP2_ENST00000339757.7_Silent_p.L491L|NLRP2_ENST00000537859.1_Silent_p.L491L	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	513	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TCACTGCCCTGTTCTACACCC	0.562																																																	0													65.0	61.0	63.0					19																	55494605		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1539G>T	19.37:g.55494605G>T			B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L513	ENST00000543010.1	37	c.1539	CCDS12913.1	19																																																																																			NLRP2	-	NULL	ENSG00000022556		0.562	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1		0.00	47	0	G	NM_017852		55494605	+1			no_errors	ENST00000448584	ensembl	human	known	74_37	silent	19.05	34	8	SNP	0.000	T
NOC3L	64318	genome.wustl.edu	37	10	96109877	96109877	+	Nonsense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:96109877G>C	ENST00000371361.3	-	9	1221	c.1121C>G	c.(1120-1122)tCa>tGa	p.S374*	NOC3L_ENST00000371350.1_Nonsense_Mutation_p.S374*|NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000543788.1_Nonsense_Mutation_p.S112*	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	374					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				CACCAATTTTGACATGTCATT	0.448																																																	0													178.0	162.0	168.0					10																	96109877		2203	4300	6503	SO:0001587	stop_gained	0			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1121C>G	10.37:g.96109877G>C	ENSP00000360412:p.Ser374*		Q9H5M6|Q9H9D8	Nonsense_Mutation	SNP	pfam_CCAAT-binding_factor,pfam_NOC3p,superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3	p.S374*	ENST00000371361.3	37	c.1121	CCDS7433.1	10	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383068	0.42207	.	.	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	.	.	.	5.83	5.83	0.93111	.	0.350989	0.29684	N	0.011467	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-11.8216	15.5825	0.76455	0.0:0.137:0.863:0.0	.	.	.	.	X	112;374;374	.	ENSP00000360401:S374X	S	-	2	0	NOC3L	96099867	1.000000	0.71417	0.997000	0.53966	0.053000	0.15095	3.574000	0.53863	2.775000	0.95449	0.650000	0.86243	TCA	NOC3L	-	superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3	ENSG00000173145		0.448	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOC3L	HGNC	protein_coding	OTTHUMT00000049466.1	-	0.00	56	0	G	NM_022451		96109877	-1	tier1	-	no_errors	ENST00000371350	ensembl	human	known	74_37	nonsense	11.11	56	7	SNP	1.000	C
NOS2	4843	genome.wustl.edu	37	17	26087701	26087701	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:26087701G>C	ENST00000313735.6	-	24	3191	c.2958C>G	c.(2956-2958)atC>atG	p.I986M		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	986					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GGAAGGGCGCGATGCCTGTGC	0.662											OREG0024268	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													25.0	22.0	23.0					17																	26087701		2157	4196	6353	SO:0001583	missense	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2958C>G	17.37:g.26087701G>C	ENSP00000327251:p.Ile986Met	784	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.I986M	ENST00000313735.6	37	c.2958	CCDS11223.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.03|13.03	2.116855|2.116855	0.37339|0.37339	.|.	.|.	ENSG00000007171|ENSG00000007171	ENST00000313735;ENST00000379105|ENST00000302153	T|.	0.78246|.	-1.16|.	4.63|4.63	-4.65|-4.65	0.03339|0.03339	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71745|0.71745	0.3376|0.3376	M|M	0.87682|0.87682	2.9|2.9	0.43824|0.43824	D|D	0.996396|0.996396	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.75747|0.75747	-0.3209|-0.3209	10|6	0.87932|0.87932	D|D	0|0	.|.	7.9008|7.9008	0.29734|0.29734	0.6809:0.0:0.1936:0.1255|0.6809:0.0:0.1936:0.1255	.|.	986|.	P35228|.	NOS2_HUMAN|.	M|W	986;947|706	ENSP00000327251:I986M|.	ENSP00000327251:I986M|ENSP00000305638:S706W	I|S	-|-	3|2	3|0	NOS2|NOS2	23111828|23111828	0.001000|0.001000	0.12720|0.12720	0.974000|0.974000	0.42286|0.42286	0.168000|0.168000	0.22595|0.22595	-1.351000|-1.351000	0.02622|0.02622	-0.517000|-0.517000	0.06461|0.06461	-0.463000|-0.463000	0.05309|0.05309	ATC|TCG	NOS2	-	pfam_OxRdtase_FAD/NAD-bd,pirsf_NOS_euk,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	ENSG00000007171		0.662	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	-	0.00	212	0	G	NM_000625		26087701	-1	tier1	-	no_errors	ENST00000313735	ensembl	human	known	74_37	missense	14.89	160	28	SNP	0.900	C
NPHS1	4868	genome.wustl.edu	37	19	36333075	36333075	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:36333075C>T	ENST00000378910.5	-	19	2613	c.2614G>A	c.(2614-2616)Gtt>Att	p.V872I	NPHS1_ENST00000353632.6_Missense_Mutation_p.V872I	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	872	Ig-like C2-type 8.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAAGTGAAAACGATGTTGGGG	0.617																																																	0			GRCh37	CD024189	NPHS1	D							24.0	22.0	23.0					19																	36333075		2202	4299	6501	SO:0001583	missense	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2614G>A	19.37:g.36333075C>T	ENSP00000368190:p.Val872Ile		A6NDH2|C3RX61	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V872I	ENST00000378910.5	37	c.2614	CCDS32996.1	19	.	.	.	.	.	.	.	.	.	.	C	15.18	2.757151	0.49468	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.67171	-0.25;-0.25	4.78	2.67	0.31697	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.386726	0.28538	N	0.014993	T	0.44138	0.1279	N	0.13003	0.285	0.18873	N	0.999988	P	0.50272	0.933	B	0.39339	0.297	T	0.33497	-0.9866	10	0.41790	T	0.15	-12.1659	8.9436	0.35745	0.0:0.8188:0.0:0.1812	.	872	O60500	NPHN_HUMAN	I	872	ENSP00000368190:V872I;ENSP00000343634:V872I	ENSP00000343634:V872I	V	-	1	0	NPHS1	41024915	0.205000	0.23458	0.557000	0.28306	0.961000	0.63080	0.492000	0.22435	0.657000	0.30906	0.558000	0.71614	GTT	NPHS1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000161270		0.617	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	-	0.00	54	0	C			36333075	-1	tier1	-	no_errors	ENST00000378910	ensembl	human	known	74_37	missense	27.50	29	11	SNP	0.856	T
NR6A1	2649	genome.wustl.edu	37	9	127302411	127302411	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:127302411G>A	ENST00000487099.2	-	5	654	c.497C>T	c.(496-498)gCc>gTc	p.A166V	NR6A1_ENST00000416460.2_Missense_Mutation_p.A162V|NR6A1_ENST00000373584.3_Missense_Mutation_p.A162V|NR6A1_ENST00000344523.4_Missense_Mutation_p.A166V	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	166					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						CCAGTGATTGGCCTCTTCCTC	0.517																																					Esophageal Squamous(192;272 2884 6208 20560)												0													264.0	214.0	231.0					9																	127302411		2203	4300	6503	SO:0001583	missense	0			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.497C>T	9.37:g.127302411G>A	ENSP00000420267:p.Ala166Val		O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.A166V	ENST00000487099.2	37	c.497	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837328	0.91117	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	D;D;D;D;D	0.94537	-3.15;-3.29;-3.3;-3.18;-3.45	5.99	5.99	0.97316	Nuclear hormone receptor, ligand-binding (2);	0.143611	0.64402	D	0.000006	D	0.95354	0.8492	L	0.47716	1.5	0.50171	D	0.999856	P;P;D	0.60575	0.956;0.781;0.988	B;B;P	0.57911	0.444;0.254;0.829	D	0.93660	0.6981	10	0.30854	T	0.27	.	19.4659	0.94939	0.0:0.0:1.0:0.0	.	162;166;162	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	V	166;162;162;166;124	ENSP00000420267:A166V;ENSP00000362686:A162V;ENSP00000413701:A162V;ENSP00000341135:A166V;ENSP00000420587:A124V	ENSP00000341135:A166V	A	-	2	0	NR6A1	126342232	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.364000	0.79526	2.840000	0.97914	0.655000	0.94253	GCC	NR6A1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000148200		0.517	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	HGNC	protein_coding	OTTHUMT00000054043.4	-	0.00	43	0	G			127302411	-1	tier1	-	no_errors	ENST00000487099	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
NRG1	3084	genome.wustl.edu	37	8	32621461	32621461	+	Silent	SNP	G	G	A	rs114216543		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:32621461G>A	ENST00000405005.3	+	12	1464	c.1464G>A	c.(1462-1464)gaG>gaA	p.E488E	RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000521670.1_3'UTR|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000356819.4_Silent_p.E493E|NRG1_ENST00000539990.1_Silent_p.E331E|NRG1_ENST00000338921.4_Silent_p.E496E|NRG1_ENST00000287845.5_Silent_p.E459E|NRG1_ENST00000287842.3_Silent_p.E485E|NRG1_ENST00000519301.1_Silent_p.E438E			Q02297	NRG1_HUMAN	neuregulin 1	488					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GGCTGCGGGAGAAGAAGTTTG	0.577																																																	0													143.0	108.0	120.0					8																	32621461		2203	4300	6503	SO:0001819	synonymous_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1464G>A	8.37:g.32621461G>A			A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.E496	ENST00000405005.3	37	c.1488	CCDS6085.1	8																																																																																			NRG1	-	pfam_Neuregulin_1_C	ENSG00000157168		0.577	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1		0.00	70	0	G			32621461	+1			no_errors	ENST00000338921	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.929	A
NRM	11270	genome.wustl.edu	37	6	30656474	30656474	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:30656474G>T	ENST00000259953.4	-	5	1104	c.753C>A	c.(751-753)caC>caA	p.H251Q	NRM_ENST00000376420.5_Missense_Mutation_p.H192Q|PPP1R18_ENST00000488324.1_5'Flank|NRM_ENST00000376421.5_Missense_Mutation_p.H251Q|NRM_ENST00000470733.1_5'UTR|PPP1R18_ENST00000399199.3_5'Flank|PPP1R18_ENST00000274853.3_5'Flank	NM_007243.2	NP_009174.1	Q8IXM6	NRM_HUMAN	nurim (nuclear envelope membrane protein)	251	Leu-rich.					integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)				large_intestine(1)|lung(2)	3						GAGAGAGCAGGTGGAGTTTTC	0.562																																																	0													54.0	61.0	59.0					6																	30656474		2203	4300	6503	SO:0001583	missense	0			AF143676	CCDS4686.1, CCDS59498.1	6p21.3	2010-02-17			ENSG00000137404	ENSG00000137404			8003	protein-coding gene	gene with protein product						10402458, 17517639	Standard	NM_007243		Approved	NRM29	uc031sng.1	Q8IXM6	OTTHUMG00000031223	ENST00000259953.4:c.753C>A	6.37:g.30656474G>T	ENSP00000259953:p.His251Gln		B0S7R0|B0S7R1|I3XIE2|I3XIE3|Q5JP57|Q5JP58|Q5JP59|Q5JP60|Q8WU45|Q9BSX3|Q9UN92	Missense_Mutation	SNP	pfam_NnrU	p.H251Q	ENST00000259953.4	37	c.753	CCDS4686.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.410|1.410	-0.575785|-0.575785	0.03882|0.03882	.|.	.|.	ENSG00000137404|ENSG00000137404	ENST00000259953;ENST00000376420;ENST00000376421|ENST00000444096	.|.	.|.	.|.	5.26|5.26	2.18|2.18	0.27775|0.27775	.|.	0.739829|.	0.13316|.	N|.	0.397116|.	T|T	0.06142|0.06142	0.0159|0.0159	N|N	0.02315|0.02315	-0.6|-0.6	0.22066|0.22066	N|N	0.999382|0.999382	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.40365|0.40365	-0.9567|-0.9567	9|5	0.06365|.	T|.	0.9|.	-9.0241|-9.0241	15.8986|15.8986	0.79356|0.79356	0.0:0.3948:0.6051:0.0|0.0:0.3948:0.6051:0.0	.|.	251|.	Q8IXM6|.	NRM_HUMAN|.	Q|T	251;192;251|251	.|.	ENSP00000259953:H251Q|.	H|P	-|-	3|1	2|0	NRM|NRM	30764453|30764453	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.855000|0.855000	0.48748|0.48748	0.706000|0.706000	0.25690|0.25690	0.566000|0.566000	0.29273|0.29273	0.655000|0.655000	0.94253|0.94253	CAC|CCT	NRM	-	NULL	ENSG00000137404		0.562	NRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRM	HGNC	protein_coding	OTTHUMT00000076466.2	-	0.00	62	0	G			30656474	-1	tier1	-	no_errors	ENST00000259953	ensembl	human	known	74_37	missense	23.53	39	12	SNP	0.935	T
OBSCN	84033	genome.wustl.edu	37	1	228525810	228525810	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:228525810T>C	ENST00000422127.1	+	67	17010	c.16966T>C	c.(16966-16968)Tgg>Cgg	p.W5656R	OBSCN_ENST00000570156.2_Missense_Mutation_p.W6613R|OBSCN_ENST00000366709.4_Missense_Mutation_p.W2775R|OBSCN_ENST00000284548.11_Missense_Mutation_p.W5656R|OBSCN_ENST00000366707.4_Missense_Mutation_p.W3290R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5656	SH3.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACGGCAGGGCTGGGTGTCACC	0.667																																																	0													18.0	20.0	20.0					1																	228525810		2013	4190	6203	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16966T>C	1.37:g.228525810T>C	ENSP00000409493:p.Trp5656Arg		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.W5656R	ENST00000422127.1	37	c.16966	CCDS58065.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.0|27.0	4.786677|4.786677	0.90367|0.90367	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000441106|ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	.|T;T;T;T	.|0.37584	.|1.19;1.19;1.19;1.19	4.15|4.15	4.15|4.15	0.48705|0.48705	.|Src homology-3 domain (2);Dbl homology (DH) domain (1);	.|0.086098	.|0.50627	.|D	.|0.000101	T|T	0.53850|0.53850	0.1822|0.1822	M|M	0.63843|0.63843	1.955|1.955	0.58432|0.58432	D|D	0.999993|0.999993	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.70935	.|0.936;0.971	T|T	0.52223|0.52223	-0.8604|-0.8604	5|10	.|0.34782	.|T	.|0.22	.|.	13.6308|13.6308	0.62193|0.62193	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|5656;5656	.|Q5VST9;Q5VST9-3	.|OBSCN_HUMAN;.	P|R	271|5656;5656;3290;2775	.|ENSP00000284548:W5656R;ENSP00000409493:W5656R;ENSP00000355668:W3290R;ENSP00000355670:W2775R	.|ENSP00000284548:W5656R	L|W	+|+	2|1	0|0	OBSCN|OBSCN	226592433|226592433	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	7.769000|7.769000	0.85360|0.85360	1.884000|1.884000	0.54569|0.54569	0.402000|0.402000	0.26972|0.26972	CTG|TGG	OBSCN	-	superfamily_DH-domain,superfamily_SH3_domain	ENSG00000154358		0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding			0.00	53	0	T	NM_052843		228525810	+1			no_errors	ENST00000422127	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	C
OPA1	4976	genome.wustl.edu	37	3	193372651	193372651	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:193372651G>T	ENST00000392438.3	+	20	2082	c.1848G>T	c.(1846-1848)tgG>tgT	p.W616C	OPA1_ENST00000361150.2_Splice_Site_p.W617C|OPA1_ENST00000361715.2_Splice_Site_p.W635C|OPA1_ENST00000361510.2_Splice_Site_p.W671C|OPA1_ENST00000361908.3_Splice_Site_p.W653C|OPA1_ENST00000361828.2_Splice_Site_p.W634C	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	616					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TTTATTTCAGGGAGGAAATCC	0.313																																																	0													47.0	46.0	46.0					3																	193372651		2203	4300	6503	SO:0001630	splice_region_variant	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.1848-1G>T	3.37:g.193372651G>T			D3DNW4	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.W671C	ENST00000392438.3	37	c.2013	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	G	23.0	4.360380	0.82353	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	D;D;D;D;D;D	0.97114	-3.87;-3.86;-3.79;-3.82;-3.9;-4.25	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.98365	0.9457	M	0.77486	2.375	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.997;0.999;0.999;0.999;0.999;0.997;0.999	D	0.98552	1.0637	9	.	.	.	.	18.7245	0.91710	0.0:0.0:1.0:0.0	.	580;616;598;617;634;653;635;671	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	C	653;616;671;635;634;617	ENSP00000354681:W653C;ENSP00000376233:W616C;ENSP00000355324:W671C;ENSP00000355311:W635C;ENSP00000354429:W634C;ENSP00000354781:W617C	.	W	+	3	0	OPA1	194855345	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.652000	0.90054	0.650000	0.86243	TGG	OPA1	-	NULL	ENSG00000198836		0.313	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	-	0.00	49	0	G	NM_130837	Missense_Mutation	193372651	+1	tier1	-	no_errors	ENST00000361510	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
OPN5	221391	genome.wustl.edu	37	6	47775894	47775894	+	Missense_Mutation	SNP	C	C	T	rs200503533		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:47775894C>T	ENST00000371211.2	+	5	789	c.761C>T	c.(760-762)gCg>gTg	p.A254V	OPN5_ENST00000244799.4_3'UTR|OPN5_ENST00000489301.2_Missense_Mutation_p.A254V|OPN5_ENST00000393699.2_Missense_Mutation_p.A254V	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5	254					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						CATCAGGTAGCGATGTTGATT	0.468																																					Melanoma(28;740 973 10870 42660 45347)												0													357.0	325.0	336.0					6																	47775894		2203	4300	6503	SO:0001583	missense	0			AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.761C>T	6.37:g.47775894C>T	ENSP00000360255:p.Ala254Val		A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Peropsin	p.A254V	ENST00000371211.2	37	c.761	CCDS4923.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.479687	0.96307	.	.	ENSG00000124818	ENST00000489301;ENST00000371211;ENST00000393699	T;T;T	0.34275	1.37;1.37;1.37	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.40423	0.1116	L	0.31752	0.955	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.03287	-1.1052	10	0.22706	T	0.39	.	20.2602	0.98440	0.0:1.0:0.0:0.0	.	254	Q6U736	OPN5_HUMAN	V	254	ENSP00000426991:A254V;ENSP00000360255:A254V;ENSP00000377302:A254V	ENSP00000360255:A254V	A	+	2	0	OPN5	47883853	1.000000	0.71417	0.994000	0.49952	0.975000	0.68041	7.445000	0.80570	2.861000	0.98227	0.655000	0.94253	GCG	OPN5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000124818		0.468	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPN5	HGNC	protein_coding	OTTHUMT00000359451.1		0.00	31	0	C	NM_181744		47775894	+1			no_errors	ENST00000371211	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	T
OR10H5	284433	genome.wustl.edu	37	19	15904867	15904867	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:15904867G>A	ENST00000308940.8	+	1	107	c.9G>A	c.(7-9)ggG>ggA	p.G3G		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						CCATGCAGGGGCTAAACCACA	0.572																																																	0													174.0	147.0	156.0					19																	15904867		2203	4300	6503	SO:0001819	synonymous_variant	0			AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.9G>A	19.37:g.15904867G>A			Q6IFJ0|Q96R60	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G3	ENST00000308940.8	37	c.9	CCDS32940.1	19																																																																																			OR10H5	-	NULL	ENSG00000172519		0.572	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H5	HGNC	protein_coding	OTTHUMT00000460363.1		0.00	61	0	G			15904867	+1			no_errors	ENST00000308940	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.000	A
OR10K1	391109	genome.wustl.edu	37	1	158435698	158435698	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:158435698C>A	ENST00000289451.2	+	1	427	c.347C>A	c.(346-348)gCa>gAa	p.A116E		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					TTCCTGCTGGCAGCCATGGGC	0.527																																																	0													168.0	166.0	167.0					1																	158435698		2203	4300	6503	SO:0001583	missense	0			AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.347C>A	1.37:g.158435698C>A	ENSP00000289451:p.Ala116Glu		Q6IFS2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A116E	ENST00000289451.2	37	c.347	CCDS30897.1	1	.	.	.	.	.	.	.	.	.	.	c	14.12	2.440177	0.43326	.	.	ENSG00000173285	ENST00000289451	T	0.00484	7.08	4.5	4.5	0.54988	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42821	D	0.000659	T	0.01092	0.0036	H	0.94771	3.58	0.24096	N	0.995898	D	0.89917	1.0	D	0.87578	0.998	T	0.27054	-1.0085	10	0.87932	D	0	.	11.8933	0.52641	0.1752:0.8248:0.0:0.0	.	116	Q8NGX5	O10K1_HUMAN	E	116	ENSP00000289451:A116E	ENSP00000289451:A116E	A	+	2	0	OR10K1	156702322	0.110000	0.22057	1.000000	0.80357	0.261000	0.26267	1.211000	0.32382	2.311000	0.77944	0.557000	0.71058	GCA	OR10K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000173285		0.527	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K1	HGNC	protein_coding	OTTHUMT00000046367.1	-	0.00	38	0	C			158435698	+1	tier1	-	no_errors	ENST00000289451	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.993	A
OR2G3	81469	genome.wustl.edu	37	1	247769531	247769531	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:247769531C>G	ENST00000320002.2	+	1	676	c.644C>G	c.(643-645)tCc>tGc	p.S215C	RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	215						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GCACTCATCTCCATCTCCTAT	0.478																																																	0													214.0	182.0	193.0					1																	247769531		2203	4300	6503	SO:0001583	missense	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.644C>G	1.37:g.247769531C>G	ENSP00000326301:p.Ser215Cys		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S215C	ENST00000320002.2	37	c.644	CCDS31093.1	1	.	.	.	.	.	.	.	.	.	.	C	3.769	-0.048099	0.07407	.	.	ENSG00000177476	ENST00000320002	T	0.00099	8.73	3.52	2.32	0.28847	GPCR, rhodopsin-like superfamily (1);	0.534907	0.13637	U	0.373278	T	0.00109	0.0003	N	0.11818	0.18	0.09310	N	1	B	0.24882	0.113	B	0.24269	0.052	T	0.17899	-1.0354	10	0.87932	D	0	.	7.0933	0.25295	0.0:0.1151:0.0:0.8849	.	215	Q8NGZ4	OR2G3_HUMAN	C	215	ENSP00000326301:S215C	ENSP00000326301:S215C	S	+	2	0	OR2G3	245836154	0.121000	0.22262	0.014000	0.15608	0.098000	0.18820	1.897000	0.39799	0.532000	0.28657	-0.764000	0.03450	TCC	OR2G3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000177476		0.478	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	-	0.00	38	0	C			247769531	+1	tier1	-	no_errors	ENST00000320002	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.016	G
OR2L8	391190	genome.wustl.edu	37	1	248112840	248112840	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:248112840G>A	ENST00000357191.3	+	1	681	c.681G>A	c.(679-681)atG>atA	p.M227I	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M227I(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TCTACCACATGAAATCTGCAG	0.448																																																	1	Substitution - Missense(1)	lung(1)											167.0	115.0	133.0					1																	248112840		2203	4300	6503	SO:0001583	missense	0			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.681G>A	1.37:g.248112840G>A	ENSP00000349719:p.Met227Ile		Q6IF03	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M227I	ENST00000357191.3	37	c.681	CCDS31101.1	1	.	.	.	.	.	.	.	.	.	.	.	1.719	-0.497188	0.04291	.	.	ENSG00000196936	ENST00000357191	T	0.00021	9.03	1.8	1.8	0.24995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37715	U	0.001974	T	0.00073	0.0002	N	0.20530	0.585	0.09310	N	1	B	0.22541	0.071	B	0.33690	0.168	T	0.17623	-1.0363	10	0.59425	D	0.04	.	4.185	0.10393	0.0:0.2546:0.4872:0.2582	.	227	Q8NGY9	OR2L8_HUMAN	I	227	ENSP00000349719:M227I	ENSP00000349719:M227I	M	+	3	0	OR2L8	246179463	0.000000	0.05858	0.018000	0.16275	0.096000	0.18686	-2.996000	0.00655	1.010000	0.39314	0.485000	0.47835	ATG	OR2L8	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196936		0.448	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	HGNC	protein_coding	OTTHUMT00000096853.2	-	0.00	117	0	G			248112840	+1	tier1	-	no_errors	ENST00000357191	ensembl	human	known	74_37	missense	9.38	86	9	SNP	0.004	A
OR2Z1	284383	genome.wustl.edu	37	19	8841727	8841727	+	Missense_Mutation	SNP	G	G	A	rs146942346	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:8841727G>A	ENST00000324060.2	+	1	412	c.337G>A	c.(337-339)Gtc>Atc	p.V113I		NM_001004699.1	NP_001004699.1	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGCTGAGGGCGTCCTGTTGGT	0.532																																																	0								G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	128.0	101.0	110.0		337	-3.8	0.9	19	dbSNP_134	110	3,8597	3.0+/-9.4	0,3,4297	yes	missense	OR2Z1	NM_001004699.1	29	0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308	benign	113/315	8841727	4,13002	2203	4300	6503	SO:0001583	missense	0			AC008753	CCDS32895.1	19p13.2	2013-09-20	2002-11-13		ENSG00000181733	ENSG00000181733		"""GPCR / Class A : Olfactory receptors"""	15391	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily Z, member 2"""	OR2Z2			Standard	NM_001004699		Approved		uc010xkg.2	Q8NG97	OTTHUMG00000182195	ENST00000324060.2:c.337G>A	19.37:g.8841727G>A	ENSP00000316284:p.Val113Ile		B9EH50|Q6IFK0|Q96R25	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V113I	ENST00000324060.2	37	c.337	CCDS32895.1	19	.	.	.	.	.	.	.	.	.	.	G	3.873	-0.027459	0.07589	2.27E-4	3.49E-4	ENSG00000181733	ENST00000324060	T	0.02974	4.09	4.33	-3.76	0.04359	GPCR, rhodopsin-like superfamily (1);	1.086380	0.07134	N	0.846007	T	0.02119	0.0066	N	0.21583	0.68	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.48019	-0.9071	10	0.45353	T	0.12	.	5.5655	0.17168	0.4632:0.3465:0.1902:0.0	.	113	Q8NG97	OR2Z1_HUMAN	I	113	ENSP00000316284:V113I	ENSP00000316284:V113I	V	+	1	0	OR2Z1	8702727	0.000000	0.05858	0.938000	0.37757	0.021000	0.10359	-1.234000	0.02931	-0.222000	0.09958	-0.270000	0.10280	GTC	OR2Z1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181733		0.532	OR2Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Z1	HGNC	protein_coding	OTTHUMT00000459954.1		0.00	24	0	G			8841727	+1			no_errors	ENST00000324060	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.005	A
OR5H14	403273	genome.wustl.edu	37	3	97869132	97869132	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:97869132C>A	ENST00000437310.1	+	1	963	c.903C>A	c.(901-903)ttC>ttA	p.F301L	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F301L(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TAGCTTCATTCACAAAAATGT	0.303																																																	1	Substitution - Missense(1)	lung(1)											32.0	32.0	32.0					3																	97869132		2200	4294	6494	SO:0001583	missense	0				CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.903C>A	3.37:g.97869132C>A	ENSP00000401706:p.Phe301Leu		B9EH15	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F301L	ENST00000437310.1	37	c.903	CCDS33798.1	3	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.976770	0.00452	.	.	ENSG00000236032	ENST00000437310	T	0.34072	1.38	2.49	0.4	0.16331	.	0.759301	0.10760	N	0.637227	T	0.09158	0.0226	N	0.01168	-0.975	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33292	-0.9874	10	0.02654	T	1	.	3.3188	0.07043	0.2922:0.2288:0.479:0.0	.	301	A6NHG9	O5H14_HUMAN	L	301	ENSP00000401706:F301L	ENSP00000401706:F301L	F	+	3	2	OR5H14	99351822	0.000000	0.05858	0.001000	0.08648	0.043000	0.13939	-1.282000	0.02799	-0.070000	0.12908	0.195000	0.17529	TTC	OR5H14	-	NULL	ENSG00000236032		0.303	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H14	HGNC	protein_coding	OTTHUMT00000359112.1	-	0.00	59	0	C			97869132	+1	tier1	-	no_errors	ENST00000437310	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.001	A
OR5H2	79310	genome.wustl.edu	37	3	98002652	98002652	+	Silent	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:98002652A>G	ENST00000355273.2	+	1	921	c.921A>G	c.(919-921)acA>acG	p.T307T	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						ATTCATTCACAAAAATGGTAA	0.284																																																	0													23.0	24.0	23.0					3																	98002652		2181	4277	6458	SO:0001819	synonymous_variant	0				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.921A>G	3.37:g.98002652A>G			Q6IF87	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T307	ENST00000355273.2	37	c.921	CCDS33801.1	3																																																																																			OR5H2	-	NULL	ENSG00000197938		0.284	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H2	HGNC	protein_coding	OTTHUMT00000359113.2	-	0.00	24	0	A			98002652	+1	tier1	-	no_errors	ENST00000355273	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.046	G
OR6C68	403284	genome.wustl.edu	37	12	55886973	55886973	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:55886973G>A	ENST00000548615.1	+	1	812	c.812G>A	c.(811-813)gGt>gAt	p.G271D	RP11-110A12.2_ENST00000554049.1_RNA|OR6C68_ENST00000379662.1_Missense_Mutation_p.G276D|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_001005519.2	NP_001005519.2	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C, member 68	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15						ATTAATAAAGGTGTGTCAGTG	0.358																																																	0													68.0	70.0	69.0					12																	55886973		2203	4300	6503	SO:0001583	missense	0				CCDS31826.1, CCDS31826.2	12q13.2	2013-09-23			ENSG00000205327	ENSG00000205327		"""GPCR / Class A : Olfactory receptors"""	31297	protein-coding gene	gene with protein product							Standard	NM_001005519		Approved		uc031qhq.1	A6NDL8	OTTHUMG00000169958	ENST00000548615.1:c.812G>A	12.37:g.55886973G>A	ENSP00000448811:p.Gly271Asp			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.G276D	ENST00000548615.1	37	c.827	CCDS31826.2	12	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074899	0.76415	.	.	ENSG00000205327	ENST00000379662;ENST00000548615	T;T	0.00099	8.73;8.73	5.24	-1.41	0.08941	GPCR, rhodopsin-like superfamily (1);	0.139564	0.32120	N	0.006556	T	0.00300	0.0009	M	0.76328	2.33	0.09310	N	1	D	0.63046	0.992	D	0.69479	0.964	T	0.51772	-0.8663	10	0.62326	D	0.03	.	2.8066	0.05429	0.1471:0.0985:0.3163:0.4381	.	271	A6NDL8	O6C68_HUMAN	D	276;271	ENSP00000368983:G276D;ENSP00000448811:G271D	ENSP00000368983:G276D	G	+	2	0	OR6C68	54173240	0.000000	0.05858	0.002000	0.10522	0.892000	0.51952	-0.578000	0.05841	0.002000	0.14630	0.596000	0.82720	GGT	OR6C68	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000205327		0.358	OR6C68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C68	HGNC	protein_coding	OTTHUMT00000406677.1	-	0.00	71	0	G			55886973	+1	tier1	-	no_errors	ENST00000379662	ensembl	human	known	74_37	missense	19.48	62	15	SNP	0.000	A
PADI3	51702	genome.wustl.edu	37	1	17597382	17597382	+	Silent	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:17597382G>T	ENST00000375460.3	+	8	880	c.840G>T	c.(838-840)tcG>tcT	p.S280S		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	280					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AGGATTTCTCGGCATCCCCTA	0.577																																																	0													74.0	67.0	69.0					1																	17597382		2203	4300	6503	SO:0001819	synonymous_variant	0			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.840G>T	1.37:g.17597382G>T			Q58EY7|Q70SX5	Silent	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.S280	ENST00000375460.3	37	c.840	CCDS179.1	1																																																																																			PADI3	-	pfam_PAD_C,superfamily_Prot_Arg_deaminase_cen_dom,pirsf_Protein-arginine_deiminase_sub	ENSG00000142619		0.577	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI3	HGNC	protein_coding	OTTHUMT00000006805.1		0.00	38	0	G			17597382	+1			no_errors	ENST00000375460	ensembl	human	known	74_37	silent	9.68	28	3	SNP	0.004	T
OR6N1	128372	genome.wustl.edu	37	1	158736112	158736112	+	Missense_Mutation	SNP	C	C	T	rs145448358		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:158736112C>T	ENST00000335094.2	-	1	380	c.361G>A	c.(361-363)Gat>Aat	p.D121N		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D121N(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					AAATACCTATCGTAGGCCATA	0.512																																																	2	Substitution - Missense(2)	endometrium(1)|skin(1)						C	ASN/ASP	0,4406		0,0,2203	51.0	54.0	53.0		361	5.1	1.0	1	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR6N1	NM_001005185.1	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	121/313	158736112	1,13005	2203	4300	6503	SO:0001583	missense	0			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.361G>A	1.37:g.158736112C>T	ENSP00000335535:p.Asp121Asn		Q5VUU8|Q96R35	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D121N	ENST00000335094.2	37	c.361	CCDS30905.1	1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927901	0.92389	0.0	1.16E-4	ENSG00000197403	ENST00000335094	T	0.18016	2.24	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000184	T	0.50973	0.1647	H	0.96080	3.765	0.51482	D	0.99992	D	0.89917	1.0	D	0.85130	0.997	T	0.67377	-0.5686	10	0.72032	D	0.01	-17.9464	17.4367	0.87554	0.0:1.0:0.0:0.0	.	121	Q8NGY5	OR6N1_HUMAN	N	121	ENSP00000335535:D121N	ENSP00000335535:D121N	D	-	1	0	OR6N1	157002736	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.459000	0.80802	2.623000	0.88846	0.655000	0.94253	GAT	OR6N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197403		0.512	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	HGNC	protein_coding	OTTHUMT00000059067.1	-	0.00	39	0	C	NM_001005185		158736112	-1	tier1	rs145448358	no_errors	ENST00000335094	ensembl	human	known	74_37	missense	26.76	52	19	SNP	1.000	T
PAQR5	54852	genome.wustl.edu	37	15	69677148	69677148	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:69677148C>T	ENST00000340965.3	+	5	980	c.312C>T	c.(310-312)ttC>ttT	p.F104F	PAQR5_ENST00000395407.2_Silent_p.F104F|PAQR5_ENST00000561153.1_Silent_p.F104F|PAQR5_ENST00000561027.1_3'UTR	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	104					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						CGCACACCTTCAGCTCTATGT	0.522																																																	0													217.0	157.0	177.0					15																	69677148		2200	4298	6498	SO:0001819	synonymous_variant	0				CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.312C>T	15.37:g.69677148C>T			Q8IXU2	Silent	SNP	pfam_HlyIII-related	p.F104	ENST00000340965.3	37	c.312	CCDS10232.1	15																																																																																			PAQR5	-	pfam_HlyIII-related	ENSG00000137819		0.522	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR5	HGNC	protein_coding	OTTHUMT00000416671.1	-	0.00	39	0	C	NM_017705		69677148	+1	tier1	-	no_errors	ENST00000340965	ensembl	human	known	74_37	silent	15.28	61	11	SNP	1.000	T
PARVA	55742	genome.wustl.edu	37	11	12525935	12525935	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:12525935C>T	ENST00000550549.1	+	6	665	c.616C>T	c.(616-618)Cga>Tga	p.R206*	PARVA_ENST00000539723.1_Nonsense_Mutation_p.R206*|PARVA_ENST00000334956.8_Nonsense_Mutation_p.R246*|PARVA_ENST00000538608.1_Nonsense_Mutation_p.R153*			Q9NVD7	PARVA_HUMAN	parvin, alpha	206					actin cytoskeleton reorganization (GO:0031532)|actin-mediated cell contraction (GO:0070252)|cell junction assembly (GO:0034329)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|heterotypic cell-cell adhesion (GO:0034113)|outflow tract septum morphogenesis (GO:0003148)|regulation of cell shape (GO:0008360)|smooth muscle cell chemotaxis (GO:0071670)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)	11				Epithelial(150;0.00624)		CGCACCAATTCGACTCCCAGA	0.468																																																	0													112.0	107.0	109.0					11																	12525935		2037	4174	6211	SO:0001587	stop_gained	0			AF237771	CCDS44541.1, CCDS44541.2	11p15.3	2014-06-13	2005-05-26		ENSG00000197702	ENSG00000197702		"""Parvins"""	14652	protein-coding gene	gene with protein product		608120	"""matrix-remodelling associated 2"""	MXRA2		11171322	Standard	NM_018222		Approved	FLJ12254, FLJ10793	uc001mki.4	Q9NVD7	OTTHUMG00000165778	ENST00000550549.1:c.616C>T	11.37:g.12525935C>T	ENSP00000447198:p.Arg206*		Q96C85|Q9HA48	Nonsense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.R246*	ENST00000550549.1	37	c.736		11	.	.	.	.	.	.	.	.	.	.	C	36	5.656180	0.96724	.	.	ENSG00000197702	ENST00000334956;ENST00000539723;ENST00000550549;ENST00000538608;ENST00000528916	.	.	.	5.03	4.12	0.48240	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.2433	8.7334	0.34514	0.1827:0.7372:0.0:0.0801	.	.	.	.	X	246;206;206;153;170	.	ENSP00000334008:R246X	R	+	1	2	PARVA	12482511	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.906000	0.39887	1.487000	0.48415	0.655000	0.94253	CGA	PARVA	-	superfamily_CH-domain	ENSG00000197702		0.468	PARVA-203	KNOWN	basic|appris_candidate_longest	protein_coding	PARVA	HGNC	protein_coding			0.00	90	0	C	NM_018222		12525935	+1			no_errors	ENST00000334956	ensembl	human	known	74_37	nonsense	5.33	71	4	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55826626	55826626	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:55826626T>A	ENST00000320301.6	-	18	2505	c.2111A>T	c.(2110-2112)aAc>aTc	p.N704I	PCDH15_ENST00000414778.1_Missense_Mutation_p.N709I|PCDH15_ENST00000373957.3_Missense_Mutation_p.N682I|PCDH15_ENST00000409834.1_Missense_Mutation_p.N315I|PCDH15_ENST00000437009.1_Missense_Mutation_p.N633I|PCDH15_ENST00000395433.1_Missense_Mutation_p.N682I|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.N711I|PCDH15_ENST00000395445.1_Missense_Mutation_p.N711I|PCDH15_ENST00000395430.1_Missense_Mutation_p.N704I|PCDH15_ENST00000395432.2_Missense_Mutation_p.N667I|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.N704I|PCDH15_ENST00000373955.1_Missense_Mutation_p.N704I|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.N704I	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	704	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CACCACTATGTTTACTGTGGC	0.378										HNSCC(58;0.16)																																							0													90.0	84.0	86.0					10																	55826626		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2111A>T	10.37:g.55826626T>A	ENSP00000322604:p.Asn704Ile		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N704I	ENST00000320301.6	37	c.2111	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	T	17.09	3.299604	0.60195	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T	0.57107	0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.42;0.64	5.7	5.7	0.88788	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.56217	0.1970	N	0.11892	0.195	0.41092	D	0.985604	D;D;P;P;D;D;D;D;P;P;P;D;D;D;P	0.76494	0.999;0.996;0.599;0.599;0.996;0.996;0.999;0.992;0.771;0.771;0.943;0.992;0.991;0.992;0.771	D;D;P;P;D;D;D;P;P;P;P;D;P;D;P	0.85130	0.997;0.954;0.574;0.472;0.943;0.979;0.997;0.889;0.574;0.574;0.83;0.925;0.823;0.949;0.574	T	0.64149	-0.6475	9	0.59425	D	0.04	.	14.9524	0.71086	0.0:0.0:0.0:1.0	.	682;704;704;709;633;667;704;704;711;711;704;709;704;682;704	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	I	711;709;704;704;315;711;667;704;682;682;704;704;709;633;704	ENSP00000363076:N711I;ENSP00000410304:N709I;ENSP00000378826:N704I;ENSP00000386693:N315I;ENSP00000378832:N711I;ENSP00000378820:N667I;ENSP00000354950:N704I;ENSP00000378821:N682I;ENSP00000363068:N682I;ENSP00000322604:N704I;ENSP00000378818:N704I;ENSP00000412628:N633I;ENSP00000363066:N704I	ENSP00000322604:N704I	N	-	2	0	PCDH15	55496632	0.998000	0.40836	0.701000	0.30321	0.955000	0.61496	3.573000	0.53856	2.183000	0.69458	0.533000	0.62120	AAC	PCDH15	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000150275		0.378	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	47	0	T	NM_033056		55826626	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.678	A
PCDH7	5099	genome.wustl.edu	37	4	30723525	30723525	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:30723525C>G	ENST00000361762.2	+	1	1489	c.481C>G	c.(481-483)Ctt>Gtt	p.L161V	PCDH7_ENST00000543491.1_Missense_Mutation_p.L161V	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	161	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GGTGGGCACACTTTACCTGCT	0.677																																																	0													17.0	13.0	14.0					4																	30723525		2198	4290	6488	SO:0001583	missense	0			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.481C>G	4.37:g.30723525C>G	ENSP00000355243:p.Leu161Val		O60246|O60247|Q4W5C4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L161V	ENST00000361762.2	37	c.481	CCDS33971.1	4	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428184	0.62844	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.37235	1.21;1.21	5.06	5.06	0.68205	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.41351	0.1155	N	0.05012	-0.13	0.44221	D	0.997059	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.995;0.998;0.989	T	0.55547	-0.8124	9	0.52906	T	0.07	.	18.4421	0.90670	0.0:1.0:0.0:0.0	.	161;161;161	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	V	161	ENSP00000355243:L161V;ENSP00000441802:L161V	ENSP00000330302:L161V	L	+	1	0	PCDH7	30332623	1.000000	0.71417	0.967000	0.41034	0.957000	0.61999	4.783000	0.62403	2.351000	0.79841	0.455000	0.32223	CTT	PCDH7	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000169851		0.677	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	HGNC	protein_coding	OTTHUMT00000360366.1	-	0.00	24	0	C	NM_032457, NM_002589		30723525	+1	tier1	-	no_errors	ENST00000543491	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.987	G
PCGF6	84108	genome.wustl.edu	37	10	105110755	105110756	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:105110755_105110756delCA	ENST00000369847.3	-	1	135_136	c.68_69delTG	c.(67-69)ttgfs	p.L23fs	PCGF6_ENST00000337211.4_Frame_Shift_Del_p.L23fs|PCGF6_ENST00000490296.1_5'UTR	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	23	Pro-rich.		L -> LPP. {ECO:0000269|PubMed:12167161, ECO:0000269|PubMed:15489334}.		negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		gcggaggcggCAAGGCTGCAGC	0.743																																																	0																																										SO:0001589	frameshift_variant	0			AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.68_69delTG	10.37:g.105110755_105110756delCA	ENSP00000358862:p.Leu23fs		A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Frame_Shift_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L23fs	ENST00000369847.3	37	c.69_68	CCDS31275.1	10																																																																																			PCGF6	-	NULL	ENSG00000156374		0.743	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF6	HGNC	protein_coding	OTTHUMT00000050132.1		0.00	25	0	CA	NM_032154		105110756	-1	tier1		no_errors	ENST00000369847	ensembl	human	known	74_37	frame_shift_del	25.00	12	4	DEL	0.953:0.836	-
PCM1	5108	genome.wustl.edu	37	8	17797549	17797549	+	Splice_Site	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:17797549A>G	ENST00000518537.1	+	7	1063		c.e7-1		PCM1_ENST00000519253.1_Intron|PCM1_ENST00000524226.1_Intron|PCM1_ENST00000325083.8_Intron			Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AAAATATTTCAGGCTAGAGAA	0.378			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																			Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	0													17.0	15.0	16.0					8																	17797549		876	1989	2865	SO:0001630	splice_region_variant	0				CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000518537.1:c.784-1A>G	8.37:g.17797549A>G			Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Splice_Site	SNP	-	e5-2	ENST00000518537.1	37	c.784-2		8	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039436	0.75617	.	.	ENSG00000078674	ENST00000325126;ENST00000517730;ENST00000518537	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.718	0.69284	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCM1	17841829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.919000	0.92770	2.135000	0.66039	0.473000	0.43528	.	PCM1	-	-	ENSG00000078674		0.378	PCM1-005	PUTATIVE	basic	protein_coding	PCM1	HGNC	protein_coding	OTTHUMT00000374797.1	-	0.00	57	0	A	NM_006197	Intron	17797549	+1	tier1	-	no_errors	ENST00000518537	ensembl	human	putative	74_37	splice_site	6.67	56	4	SNP	1.000	G
PCP4	5121	genome.wustl.edu	37	21	41300928	41300928	+	Silent	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr21:41300928A>G	ENST00000328619.5	+	3	266	c.81A>G	c.(79-81)caA>caG	p.Q27Q	PCP4_ENST00000468717.1_3'UTR	NM_006198.2	NP_006189.2	P48539	PCP4_HUMAN	Purkinje cell protein 4	27					central nervous system development (GO:0007417)	cytosol (GO:0005829)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)	4		Prostate(19;2.65e-06)|all_epithelial(19;0.138)				AGAAAGTTCAAGAAGAATTTG	0.453																																																	0													114.0	104.0	107.0					21																	41300928		2203	4300	6503	SO:0001819	synonymous_variant	0			X93349, U53709	CCDS33563.1	21q22.2	2006-12-01			ENSG00000183036	ENSG00000183036			8742	protein-coding gene	gene with protein product		601629				8931698, 8914602	Standard	NM_006198		Approved	PEP-19	uc002yyp.3	P48539	OTTHUMG00000086731	ENST00000328619.5:c.81A>G	21.37:g.41300928A>G			A6NDJ9|Q6ICS4|Q93059	Silent	SNP	NULL	p.Q27	ENST00000328619.5	37	c.81	CCDS33563.1	21																																																																																			PCP4	-	NULL	ENSG00000183036		0.453	PCP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCP4	HGNC	protein_coding	OTTHUMT00000195025.1	-	0.00	72	0	A	NM_006198		41300928	+1	tier1	-	no_errors	ENST00000328619	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.807	G
NTN4	59277	genome.wustl.edu	37	12	96066409	96066409	+	Intron	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:96066409C>T	ENST00000343702.4	-	8	1959				NTN4_ENST00000538383.1_Intron|PGAM1P5_ENST00000552554.1_RNA|NTN4_ENST00000344911.4_Intron|NTN4_ENST00000553059.1_Intron	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4						axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						CATGGTGAGGCCCAGGTGAAG	0.547																																																	0																																										SO:0001627	intron_variant	0			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1511-2487G>A	12.37:g.96066409C>T			B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	RNA	SNP	-	NULL	ENST00000343702.4	37	NULL	CCDS9054.1	12																																																																																			PGAM1P5	-	-	ENSG00000257150		0.547	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAM1P5	HGNC	protein_coding	OTTHUMT00000408372.1	-	0.00	66	0	C	NM_021229		96066409	+1	tier1	-	no_errors	ENST00000552554	ensembl	human	known	74_37	rna	7.84	46	4	SNP	1.000	T
PGLS	25796	genome.wustl.edu	37	19	17628148	17628148	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:17628148G>T	ENST00000252603.2	+	3	492	c.448G>T	c.(448-450)Ggc>Tgc	p.G150C	CTD-3131K8.3_ENST00000596192.1_RNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	150					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CCTGGGGGTGGGCCCCGATGG	0.622																																																	0													127.0	131.0	130.0					19																	17628148		2203	4300	6503	SO:0001583	missense	0			AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.448G>T	19.37:g.17628148G>T	ENSP00000252603:p.Gly150Cys			Missense_Mutation	SNP	tigrfam_6-phosphogluconolactonase_DevB	p.G150C	ENST00000252603.2	37	c.448	CCDS12361.1	19	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032005	0.75504	.	.	ENSG00000130313	ENST00000252603	D	0.92149	-2.98	5.02	5.02	0.67125	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.108646	0.64402	D	0.000007	D	0.97920	0.9316	H	0.99117	4.435	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99585	1.0974	10	0.87932	D	0	-47.5268	15.8711	0.79119	0.0:0.0:1.0:0.0	.	150	O95336	6PGL_HUMAN	C	150	ENSP00000252603:G150C	ENSP00000252603:G150C	G	+	1	0	PGLS	17489148	1.000000	0.71417	0.960000	0.40013	0.595000	0.36748	8.833000	0.92089	2.335000	0.79485	0.478000	0.44815	GGC	PGLS	-	tigrfam_6-phosphogluconolactonase_DevB	ENSG00000130313		0.622	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLS	HGNC	protein_coding	OTTHUMT00000464154.1	-	0.00	41	0	G			17628148	+1	tier1	-	no_errors	ENST00000252603	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PHF14	9678	genome.wustl.edu	37	7	11022380	11022380	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:11022380C>T	ENST00000403050.3	+	3	946	c.494C>T	c.(493-495)tCt>tTt	p.S165F	PHF14_ENST00000445996.2_Intron	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	165					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		ACATCCCCTTCTGTTCCCACT	0.488																																																	0													62.0	66.0	65.0					7																	11022380		2030	4192	6222	SO:0001583	missense	0			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.494C>T	7.37:g.11022380C>T	ENSP00000385795:p.Ser165Phe		A7MCZ3|B4DI82	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S165F	ENST00000403050.3	37	c.494	CCDS47542.1	7	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861468	0.32884	.	.	ENSG00000106443	ENST00000403050	T	0.64991	-0.13	5.11	5.11	0.69529	.	0.968208	0.08526	N	0.932683	T	0.45538	0.1347	N	0.08118	0	0.80722	D	1	P;P	0.44578	0.838;0.838	B;B	0.38562	0.276;0.276	T	0.47586	-0.9106	10	0.56958	D	0.05	.	13.8926	0.63750	0.0:1.0:0.0:0.0	.	165;165	A8MSQ1;O94880	.;PHF14_HUMAN	F	165	ENSP00000385795:S165F	ENSP00000385795:S165F	S	+	2	0	PHF14	10988905	0.145000	0.22656	0.998000	0.56505	0.699000	0.40488	2.199000	0.42715	2.641000	0.89580	0.585000	0.79938	TCT	PHF14	-	NULL	ENSG00000106443		0.488	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	HGNC	protein_coding	OTTHUMT00000318212.1	-	0.00	57	0	C	NM_014660		11022380	+1	tier1	-	no_errors	ENST00000403050	ensembl	human	known	74_37	missense	10.77	58	7	SNP	0.992	T
JADE1	79960	genome.wustl.edu	37	4	129792508	129792508	+	Splice_Site	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:129792508A>G	ENST00000226319.6	+	11	1901		c.e11-1		PHF17_ENST00000512960.1_Splice_Site|PHF17_ENST00000452328.2_Splice_Site	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TTATGTTTATAGGTGTGCCTT	0.413																																																	0													141.0	135.0	137.0					4																	129792508		2203	4300	6503	SO:0001630	splice_region_variant	0																														ENST00000226319.6:c.1622-1A>G	4.37:g.129792508A>G				Splice_Site	SNP	-	e10-2	ENST00000226319.6	37	c.1622-2	CCDS34062.1	4	.	.	.	.	.	.	.	.	.	.	A	13.71	2.319238	0.41096	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1588	0.54093	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHF17	130011958	1.000000	0.71417	0.883000	0.34634	0.664000	0.39144	5.443000	0.66581	1.849000	0.53698	0.459000	0.35465	.	PHF17	-	-	ENSG00000077684		0.413	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF17	HGNC	protein_coding	OTTHUMT00000364280.1		0.00	45	0	A		Intron	129792508	+1			no_errors	ENST00000226319	ensembl	human	known	74_37	splice_site	14.29	18	3	SNP	0.965	G
PI4KAP2	375133	genome.wustl.edu	37	22	21834224	21834224	+	RNA	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr22:21834224C>A	ENST00000450651.1	-	0	1172							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						CTCACCTCTGCATCGGGGTCC	0.597																																																	0													120.0	107.0	111.0					22																	21834224		692	1584	2276			0					22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21834224C>A			Q6ICJ0|Q6ZT68|Q8WUK7	RNA	SNP	-	NULL	ENST00000450651.1	37	NULL		22																																																																																			PI4KAP2	-	-	ENSG00000183506		0.597	PI4KAP2-005	KNOWN	basic	processed_transcript	PI4KAP2	HGNC	pseudogene	OTTHUMT00000334908.1	-	0.00	109	0	C			21834224	-1	tier1	-	no_errors	ENST00000450651	ensembl	human	known	74_37	rna	24.11	85	27	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110456047	110456047	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:110456047C>A	ENST00000378402.5	+	37	4811	c.4707C>A	c.(4705-4707)agC>agA	p.S1569R		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1569	IPT/TIG 8.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CATCTATAAGCAACATTACTC	0.368										HNSCC(38;0.096)																																							0													109.0	105.0	106.0					8																	110456047		1831	4076	5907	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.4707C>A	8.37:g.110456047C>A	ENSP00000367655:p.Ser1569Arg		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.S1569R	ENST00000378402.5	37	c.4707	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	C	8.050	0.765802	0.15983	.	.	ENSG00000205038	ENST00000378402	T	0.78246	-1.16	5.87	3.1	0.35709	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.538526	0.21234	N	0.077931	T	0.68467	0.3004	L	0.40543	1.245	0.22835	N	0.998676	B	0.12630	0.006	B	0.23716	0.048	T	0.58405	-0.7642	10	0.37606	T	0.19	.	10.3157	0.43736	0.0:0.7706:0.0:0.2294	.	1569	Q86WI1	PKHL1_HUMAN	R	1569	ENSP00000367655:S1569R	ENSP00000367655:S1569R	S	+	3	2	PKHD1L1	110525223	0.264000	0.24093	0.998000	0.56505	0.822000	0.46500	1.567000	0.36407	0.951000	0.37770	0.655000	0.94253	AGC	PKHD1L1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000205038		0.368	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	99	0	C	NM_177531		110456047	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	12.20	72	10	SNP	0.985	A
PKP3	11187	genome.wustl.edu	37	11	404040	404040	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:404040delC	ENST00000331563.2	+	11	2251	c.2175delC	c.(2173-2175)ctcfs	p.L725fs		NM_007183.2	NP_009114.1	Q9Y446	PKP3_HUMAN	plakophilin 3	725					desmosome assembly (GO:0002159)|establishment of protein localization to plasma membrane (GO:0090002)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|desmosome (GO:0030057)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)			breast(1)|central_nervous_system(1)|endometrium(3)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TAGCTGTGCTCAACAACCTGG	0.597																																																	0													67.0	74.0	71.0					11																	404040		2190	4287	6477	SO:0001589	frameshift_variant	0			Z98265	CCDS7695.1	11p15	2013-02-14			ENSG00000184363	ENSG00000184363		"""Armadillo repeat containing"""	9025	protein-coding gene	gene with protein product		605561				10374265	Standard	XM_005252760		Approved		uc001lpc.3	Q9Y446	OTTHUMG00000119068	ENST00000331563.2:c.2175delC	11.37:g.404040delC	ENSP00000331678:p.Leu725fs		F8J390|Q53EX8	Frame_Shift_Del	DEL	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.N726fs	ENST00000331563.2	37	c.2175	CCDS7695.1	11																																																																																			PKP3	-	superfamily_ARM-type_fold	ENSG00000184363		0.597	PKP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP3	HGNC	protein_coding	OTTHUMT00000239281.1		0.00	63	0	C	NM_007183		404040	+1	tier1		no_errors	ENST00000331563	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	1.000	-
PODN	127435	genome.wustl.edu	37	1	53544114	53544114	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:53544114T>A	ENST00000312553.5	+	8	1083	c.1076T>A	c.(1075-1077)cTg>cAg	p.L359Q	PODN_ENST00000395871.2_Missense_Mutation_p.L217Q|PODN_ENST00000371500.3_Missense_Mutation_p.L340Q|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	311					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCGCGCAGCCTGGTGCTGCTG	0.632																																																	0													62.0	65.0	64.0					1																	53544114		2203	4300	6503	SO:0001583	missense	0			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1076T>A	1.37:g.53544114T>A	ENSP00000308315:p.Leu359Gln		B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.L359Q	ENST00000312553.5	37	c.1076	CCDS573.1	1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373359	0.82573	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	D;T;D	0.82711	-1.64;-0.5;-1.64	4.98	4.98	0.66077	.	0.159430	0.43919	D	0.000503	D	0.94208	0.8141	H	0.97240	3.965	0.42193	D	0.991737	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.87578	0.998;0.987;0.994	D	0.96313	0.9230	10	0.87932	D	0	.	14.8213	0.70074	0.0:0.0:0.0:1.0	.	217;340;359	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	Q	340;217;359	ENSP00000360555:L340Q;ENSP00000379212:L217Q;ENSP00000308315:L359Q	ENSP00000308315:L359Q	L	+	2	0	PODN	53316702	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.843000	0.62838	2.081000	0.62600	0.454000	0.30748	CTG	PODN	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000174348		0.632	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	HGNC	protein_coding	OTTHUMT00000024735.1	-	0.00	61	0	T	NM_153703		53544114	+1	tier1	-	no_errors	ENST00000312553	ensembl	human	known	74_37	missense	10.29	61	7	SNP	1.000	A
PPM1A	5494	genome.wustl.edu	37	14	60712739	60712739	+	5'UTR	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:60712739G>A	ENST00000529574.1	+	0	265				PPM1A_ENST00000325642.3_Missense_Mutation_p.M58I|CTD-2184C24.2_ENST00000553269.1_RNA|CTD-2184C24.2_ENST00000532515.1_RNA|CTD-2184C24.2_ENST00000529171.1_RNA|CTD-2184C24.2_ENST00000553775.1_RNA			P35813	PPM1A_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1A						cell cycle arrest (GO:0007050)|dephosphorylation (GO:0016311)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|N-terminal protein myristoylation (GO:0006499)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|protein dephosphorylation (GO:0006470)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|voltage-gated calcium channel complex (GO:0005891)	calmodulin-dependent protein phosphatase activity (GO:0033192)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)|R-SMAD binding (GO:0070412)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(1)|large_intestine(8)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.046)		TGAAGAGGATGTGTGAGAGAA	0.418																																																	0													114.0	116.0	115.0					14																	60712739		1567	3580	5147	SO:0001623	5_prime_UTR_variant	0			S87759	CCDS9744.1, CCDS9745.1, CCDS45120.1	14q23.1	2013-01-24	2010-03-05		ENSG00000100614	ENSG00000100614	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9275	protein-coding gene	gene with protein product	"""phosphatase 2C alpha"", ""protein phosphatase 2C, alpha isoform"""	606108	"""protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform"""			1311954	Standard	NM_177952		Approved	MGC9201, PP2Calpha, PP2CA	uc001xew.4	P35813	OTTHUMG00000140333	ENST00000529574.1:c.-133G>A	14.37:g.60712739G>A			B5BU11|J3KNM0|O75551	Missense_Mutation	SNP	pfam_PP2C-like_dom,pfam_PP2C_C,superfamily_PP2C-like_dom,superfamily_PP2C_C,smart_PP2C-like_dom	p.M58I	ENST00000529574.1	37	c.174	CCDS9744.1	14	.	.	.	.	.	.	.	.	.	.	G	5.992	0.366896	0.11352	.	.	ENSG00000100614	ENST00000325642	T	0.28895	1.59	3.65	-7.31	0.01441	.	.	.	.	.	T	0.13500	0.0327	N	0.08118	0	0.37392	D	0.912489	.	.	.	.	.	.	T	0.27971	-1.0058	7	0.22109	T	0.4	.	9.3548	0.38159	0.7236:0.1183:0.1582:0.0	.	.	.	.	I	58	ENSP00000327255:M58I	ENSP00000327255:M58I	M	+	3	0	PPM1A	59782492	0.000000	0.05858	0.001000	0.08648	0.260000	0.26232	-2.820000	0.00749	-2.044000	0.00911	-0.657000	0.03884	ATG	PPM1A	-	NULL	ENSG00000100614		0.418	PPM1A-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPM1A	HGNC	protein_coding		-	0.00	50	0	G	NM_021003		60712739	+1	tier1	-	no_errors	ENST00000325642	ensembl	human	known	74_37	missense	14.29	48	8	SNP	0.001	A
PRDM16	63976	genome.wustl.edu	37	1	3342259	3342259	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:3342259G>A	ENST00000270722.5	+	13	3103	c.3054G>A	c.(3052-3054)ggG>ggA	p.G1018G	PRDM16_ENST00000442529.2_Silent_p.G1017G|PRDM16_ENST00000378398.3_Silent_p.G1018G|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Silent_p.G1018G|PRDM16_ENST00000511072.1_Silent_p.G1019G|PRDM16_ENST00000514189.1_Silent_p.G1018G|PRDM16_ENST00000441472.2_Silent_p.G1017G			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	1018	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GCTGCTTCGGGCAGCAGACCA	0.642			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0													76.0	88.0	84.0					1																	3342259		2130	4241	6371	SO:0001819	synonymous_variant	0			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.3054G>A	1.37:g.3342259G>A			A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.G1018	ENST00000270722.5	37	c.3054	CCDS41236.2	1																																																																																			PRDM16	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000142611		0.642	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	-	0.00	71	0	G	NM_022114		3342259	+1	tier1	-	no_errors	ENST00000270722	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.994	A
PRKCE	5581	genome.wustl.edu	37	2	46228632	46228632	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:46228632G>T	ENST00000306156.3	+	7	1240	c.913G>T	c.(913-915)Gac>Tac	p.D305Y	PRKCE_ENST00000394874.1_Missense_Mutation_p.D28Y	NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	305					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	AGTACTGGCCGACCTGGGCGT	0.527																																																	0													88.0	84.0	85.0					2																	46228632		1827	3783	5610	SO:0001583	missense	0				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.913G>T	2.37:g.46228632G>T	ENSP00000306124:p.Asp305Tyr		B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.D305Y	ENST00000306156.3	37	c.913	CCDS1824.1	2	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720373	0.89205	.	.	ENSG00000171132	ENST00000306156;ENST00000394874	T;T	0.69040	-0.37;0.38	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.65439	0.2691	N	0.19112	0.55	0.80722	D	1	P	0.51147	0.942	P	0.51055	0.657	T	0.68780	-0.5318	10	0.66056	D	0.02	.	19.8946	0.96949	0.0:0.0:1.0:0.0	.	305	Q02156	KPCE_HUMAN	Y	305;28	ENSP00000306124:D305Y;ENSP00000378341:D28Y	ENSP00000306124:D305Y	D	+	1	0	PRKCE	46082136	1.000000	0.71417	0.970000	0.41538	0.646000	0.38490	9.657000	0.98554	2.937000	0.99478	0.650000	0.86243	GAC	PRKCE	-	pirsf_Prot_kin_PKC_delta	ENSG00000171132		0.527	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	HGNC	protein_coding	OTTHUMT00000250751.2		0.00	67	0	G			46228632	+1			no_errors	ENST00000306156	ensembl	human	known	74_37	missense	5.68	83	5	SNP	1.000	T
PROP1	5626	genome.wustl.edu	37	5	177420005	177420005	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:177420005C>T	ENST00000308304.2	-	3	694	c.386G>A	c.(385-387)cGc>cAc	p.R129H		NM_006261.4	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	129					blood vessel development (GO:0001568)|canonical Wnt signaling pathway (GO:0060070)|cell migration (GO:0016477)|central nervous system development (GO:0007417)|dorsal/ventral pattern formation (GO:0009953)|hypophysis morphogenesis (GO:0048850)|hypothalamus cell differentiation (GO:0021979)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatotropin secreting cell differentiation (GO:0060126)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(9)|stomach(1)	13	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGCAGTGAGCGCTCTTGCTT	0.567																																																	0													148.0	135.0	139.0					5																	177420005		2203	4300	6503	SO:0001583	missense	0			AF076215	CCDS4430.1	5q35.3	2011-06-20	2007-07-12		ENSG00000175325	ENSG00000175325		"""Homeoboxes / PRD class"""	9455	protein-coding gene	gene with protein product		601538	"""prophet of Pit1, paired-like homeodomain transcription factor"""			9462743	Standard	NM_006261		Approved		uc003mif.1	O75360	OTTHUMG00000130887	ENST00000308304.2:c.386G>A	5.37:g.177420005C>T	ENSP00000311290:p.Arg129His			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.R129H	ENST00000308304.2	37	c.386	CCDS4430.1	5	.	.	.	.	.	.	.	.	.	.	.	16.63	3.177496	0.57692	.	.	ENSG00000175325	ENST00000308304	D	0.95885	-3.84	3.22	3.22	0.36961	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.38005	N	0.001842	D	0.94295	0.8167	L	0.32530	0.975	0.34067	D	0.657929	D	0.89917	1.0	D	0.63192	0.912	D	0.94555	0.7757	10	0.72032	D	0.01	-17.2775	6.4353	0.21819	0.0:0.8612:0.0:0.1388	.	129	O75360	PROP1_HUMAN	H	129	ENSP00000311290:R129H	ENSP00000311290:R129H	R	-	2	0	PROP1	177352611	0.990000	0.36364	0.987000	0.45799	0.548000	0.35241	3.960000	0.56752	1.830000	0.53286	0.467000	0.42956	CGC	PROP1	-	superfamily_Homeodomain-like,smart_Homeobox_dom	ENSG00000175325		0.567	PROP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROP1	HGNC	protein_coding	OTTHUMT00000253472.1	-	0.00	48	0	C	NM_006261		177420005	-1	tier1	-	no_errors	ENST00000308304	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.995	T
PRPF8	10594	genome.wustl.edu	37	17	1554764	1554764	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:1554764C>A	ENST00000572621.1	-	40	6859	c.6594G>T	c.(6592-6594)aaG>aaT	p.K2198N	PRPF8_ENST00000575116.1_5'Flank|PRPF8_ENST00000304992.6_Missense_Mutation_p.K2198N|RILP_ENST00000301336.6_5'Flank			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	2198	MPN.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CAGCCATGATCTTGGCATGGG	0.542																																																	0													125.0	111.0	115.0					17																	1554764		2203	4300	6503	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.6594G>T	17.37:g.1554764C>A	ENSP00000460348:p.Lys2198Asn		O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_PRO8NT,pfam_Prp8_U5-snRNA-bd,pfam_PROCT,pfam_RRM_spliceosomal_PrP8,pfam_JAB_MPN_dom,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB_MPN_dom	p.K2198N	ENST00000572621.1	37	c.6594	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	C	13.37	2.217171	0.39201	.	.	ENSG00000174231	ENST00000304992	T	0.55413	0.52	5.36	1.15	0.20763	.	0.000000	0.85682	D	0.000000	T	0.53948	0.1828	M	0.84846	2.72	0.80722	D	1	B	0.32188	0.359	B	0.34038	0.174	T	0.52895	-0.8514	10	0.54805	T	0.06	.	9.183	0.37154	0.0:0.5528:0.0:0.4472	.	2198	Q6P2Q9	PRP8_HUMAN	N	2198	ENSP00000304350:K2198N	ENSP00000304350:K2198N	K	-	3	2	PRPF8	1501514	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	1.261000	0.32980	0.005000	0.14708	-0.140000	0.14226	AAG	PRPF8	-	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	ENSG00000174231		0.542	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	-	0.00	60	0	C			1554764	-1	tier1	-	no_errors	ENST00000304992	ensembl	human	known	74_37	missense	18.97	47	11	SNP	1.000	A
PSMC1	5700	genome.wustl.edu	37	14	90725515	90725515	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:90725515G>C	ENST00000261303.8	+	2	118	c.15G>C	c.(13-15)caG>caC	p.Q5H	PSMC1_ENST00000543772.2_5'UTR	NM_002802.2	NP_002793.2	P62191	PRS4_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 1	5					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|upper_aerodigestive_tract(2)	6		all_cancers(154;0.142)		COAD - Colon adenocarcinoma(157;0.21)		GTCAAAGTCAGAGTGGTGGTC	0.403																																																	0													124.0	120.0	121.0					14																	90725515		2203	4300	6503	SO:0001583	missense	0			L02426	CCDS32139.1	14q32.11	2010-04-21			ENSG00000100764	ENSG00000100764		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9547	protein-coding gene	gene with protein product		602706				9473509	Standard	NM_002802		Approved	S4, p56	uc001xyf.3	P62191		ENST00000261303.8:c.15G>C	14.37:g.90725515G>C	ENSP00000261303:p.Gln5His		B4DR63|P49014|Q03527|Q6IAW0|Q6NW36|Q96AZ3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_DUF815,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.Q5H	ENST00000261303.8	37	c.15	CCDS32139.1	14	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332774	0.41297	.	.	ENSG00000100764	ENST00000261303	D	0.94758	-3.51	4.9	4.0	0.46444	.	0.514876	0.20757	N	0.086222	D	0.93161	0.7822	M	0.79123	2.44	0.80722	D	1	P	0.39520	0.676	B	0.36030	0.216	D	0.92555	0.6053	10	0.46703	T	0.11	-16.5678	13.0149	0.58751	0.0785:0.0:0.9215:0.0	.	5	P62191	PRS4_HUMAN	H	5	ENSP00000261303:Q5H	ENSP00000261303:Q5H	Q	+	3	2	PSMC1	89795268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.595000	0.46197	1.428000	0.47296	0.655000	0.94253	CAG	PSMC1	-	NULL	ENSG00000100764		0.403	PSMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC1	HGNC	protein_coding	OTTHUMT00000411253.1	-	0.00	60	0	G	NM_002802		90725515	+1	tier1	-	no_errors	ENST00000261303	ensembl	human	known	74_37	missense	7.14	65	5	SNP	1.000	C
PSME4	23198	genome.wustl.edu	37	2	54152802	54152802	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:54152802G>T	ENST00000404125.1	-	14	1738	c.1683C>A	c.(1681-1683)agC>agA	p.S561R	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	561					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GCTCCAATGTGCTACTTTCTA	0.363																																																	0													150.0	125.0	133.0					2																	54152802		2203	4300	6503	SO:0001583	missense	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.1683C>A	2.37:g.54152802G>T	ENSP00000384211:p.Ser561Arg		Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	pfam_DUF3437,superfamily_ARM-type_fold	p.S561R	ENST00000404125.1	37	c.1683	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698597	0.68386	.	.	ENSG00000068878	ENST00000404125	T	0.24908	1.83	5.84	3.07	0.35406	.	0.000000	0.85682	D	0.000000	T	0.42539	0.1207	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.19647	-1.0299	10	0.19590	T	0.45	.	9.5886	0.39532	0.268:0.0:0.732:0.0	.	561	Q14997	PSME4_HUMAN	R	561	ENSP00000384211:S561R	ENSP00000384211:S561R	S	-	3	2	PSME4	54006306	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.639000	0.46570	0.378000	0.24764	-0.145000	0.13849	AGC	PSME4	-	superfamily_ARM-type_fold	ENSG00000068878		0.363	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1	-	0.00	74	0	G	XM_040158		54152802	-1	tier1	-	no_errors	ENST00000404125	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
PTGFRN	5738	genome.wustl.edu	37	1	117487302	117487302	+	Splice_Site	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:117487302G>A	ENST00000393203.2	+	3	567	c.420G>A	c.(418-420)gtG>gtA	p.V140V		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	140					lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		TCTCCGCAGTGCTGGCCGACT	0.711																																																	0													6.0	7.0	6.0					1																	117487302		1810	3709	5519	SO:0001630	splice_region_variant	0			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.419-1G>A	1.37:g.117487302G>A			Q5VVU9|Q8N2K6	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.V140	ENST00000393203.2	37	c.420	CCDS890.1	1																																																																																			PTGFRN	-	smart_Ig_sub	ENSG00000134247		0.711	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1		0.00	82	0	G	NM_020440	Silent	117487302	+1			no_errors	ENST00000393203	ensembl	human	known	74_37	silent	5.80	65	4	SNP	1.000	A
PTH1R	5745	genome.wustl.edu	37	3	46939887	46939887	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:46939887G>A	ENST00000313049.5	+	6	766	c.563G>A	c.(562-564)gGc>gAc	p.G188D	PTH1R_ENST00000430002.2_Missense_Mutation_p.G188D|PTH1R_ENST00000449590.1_Missense_Mutation_p.G188D|PTH1R_ENST00000418619.1_Missense_Mutation_p.G188D|PTH1R_ENST00000490109.1_3'UTR			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	188					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	GACCGCCTGGGCATGATTTAC	0.652																																																	0													73.0	70.0	71.0					3																	46939887		2203	4300	6503	SO:0001583	missense	0				CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.563G>A	3.37:g.46939887G>A	ENSP00000321999:p.Gly188Asp		Q2M1U3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_parathyroid_rcpt	p.G188D	ENST00000313049.5	37	c.563	CCDS2747.1	3	.	.	.	.	.	.	.	.	.	.	G	11.93	1.787136	0.31593	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049;ENST00000313063	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	4.9	3.09	0.35607	GPCR, family 2-like (1);	.	.	.	.	T	0.19406	0.0466	N	0.04508	-0.205	0.33863	D	0.634017	B	0.12013	0.005	B	0.15052	0.012	T	0.17410	-1.0370	9	0.28530	T	0.3	.	7.56	0.27845	0.2717:0.0:0.7283:0.0	.	188	Q03431	PTH1R_HUMAN	D	188;188;188;188;188;323	ENSP00000402723:G188D;ENSP00000411424:G188D;ENSP00000400977:G188D;ENSP00000413774:G188D;ENSP00000321999:G188D	ENSP00000321999:G188D	G	+	2	0	PTH1R	46914891	0.975000	0.34042	1.000000	0.80357	0.995000	0.86356	4.039000	0.57325	1.056000	0.40484	0.462000	0.41574	GGC	PTH1R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_parathyroid_rcpt	ENSG00000160801		0.652	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH1R	HGNC	protein_coding	OTTHUMT00000257481.1	-	0.00	76	0	G	NM_000316		46939887	+1	tier1	-	no_errors	ENST00000313049	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.995	A
RADIL	55698	genome.wustl.edu	37	7	4874346	4874346	+	Silent	SNP	G	G	T	rs540883493		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:4874346G>T	ENST00000399583.3	-	4	1495	c.1308C>A	c.(1306-1308)ccC>ccA	p.P436P	RADIL_ENST00000538469.1_Silent_p.P196P|RADIL_ENST00000536091.1_Silent_p.P436P	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	436					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GGAGGAAGGCGGGGGTCAGCT	0.642																																																	0													20.0	26.0	24.0					7																	4874346		2124	4237	6361	SO:0001819	synonymous_variant	0			AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.1308C>A	7.37:g.4874346G>T			A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	pfam_Dil_domain,pfam_Ras-assoc,pfam_PDZ,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.P436	ENST00000399583.3	37	c.1308	CCDS43544.1	7																																																																																			RADIL	-	NULL	ENSG00000157927		0.642	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RADIL	HGNC	protein_coding	OTTHUMT00000323769.2		0.00	101	0	G	NM_018059		4874346	-1			no_errors	ENST00000399583	ensembl	human	known	74_37	silent	6.33	73	5	SNP	0.028	T
RALGAPB	57148	genome.wustl.edu	37	20	37146211	37146211	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:37146211C>T	ENST00000262879.6	+	8	1398	c.1114C>T	c.(1114-1116)Caa>Taa	p.Q372*	MIR548O2_ENST00000583129.1_RNA|RALGAPB_ENST00000397040.1_Nonsense_Mutation_p.Q372*|RALGAPB_ENST00000397038.1_Nonsense_Mutation_p.Q150*|RALGAPB_ENST00000537204.1_Nonsense_Mutation_p.Q372*|RALGAPB_ENST00000397042.3_Nonsense_Mutation_p.Q372*			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	372					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AAGTATGCCTCAAAGTGCTGC	0.438																																																	0													142.0	133.0	136.0					20																	37146211		2203	4300	6503	SO:0001587	stop_gained	0			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.1114C>T	20.37:g.37146211C>T	ENSP00000262879:p.Gln372*		A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Nonsense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.Q372*	ENST00000262879.6	37	c.1114	CCDS13305.1	20	.	.	.	.	.	.	.	.	.	.	C	45	11.366448	0.99551	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000304939;ENST00000397038;ENST00000537204;ENST00000397040;ENST00000438490	.	.	.	5.07	5.07	0.68467	.	0.053488	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	17.8087	0.88609	0.0:1.0:0.0:0.0	.	.	.	.	X	372;372;372;150;372;372;200	.	ENSP00000262879:Q372X	Q	+	1	0	RALGAPB	36579625	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.955000	0.76007	2.515000	0.84797	0.555000	0.69702	CAA	RALGAPB	-	NULL	ENSG00000170471		0.438	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	HGNC	protein_coding	OTTHUMT00000079191.1	-	0.00	82	0	C	NM_020336		37146211	+1	tier1	-	no_errors	ENST00000262879	ensembl	human	known	74_37	nonsense	6.78	55	4	SNP	1.000	T
RALGPS2	55103	genome.wustl.edu	37	1	178855196	178855196	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:178855196C>T	ENST00000367635.3	+	13	1471	c.1133C>T	c.(1132-1134)cCc>cTc	p.P378L	RALGPS2_ENST00000477383.1_3'UTR|RALGPS2_ENST00000367634.2_Missense_Mutation_p.P378L	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	378					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						GTCATGGAGCCCCATGCGCCA	0.403																																																	0													82.0	84.0	83.0					1																	178855196		2203	4300	6503	SO:0001583	missense	0			AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.1133C>T	1.37:g.178855196C>T	ENSP00000356607:p.Pro378Leu		B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Missense_Mutation	SNP	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.P378L	ENST00000367635.3	37	c.1133	CCDS1325.1	1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.612821	0.66672	.	.	ENSG00000116191	ENST00000367635;ENST00000367634;ENST00000324778;ENST00000535251	T;T;T	0.41758	0.99;0.99;0.99	5.55	5.55	0.83447	.	0.239871	0.41712	D	0.000823	T	0.38506	0.1043	L	0.47716	1.5	0.80722	D	1	B;B	0.23540	0.019;0.087	B;B	0.23716	0.028;0.048	T	0.22417	-1.0217	10	0.11182	T	0.66	.	19.1111	0.93317	0.0:1.0:0.0:0.0	.	378;378	B7Z7B1;Q86X27	.;RGPS2_HUMAN	L	378;378;343;27	ENSP00000356607:P378L;ENSP00000356606:P378L;ENSP00000313613:P343L	ENSP00000313613:P343L	P	+	2	0	RALGPS2	177121819	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.717000	0.68446	2.623000	0.88846	0.655000	0.94253	CCC	RALGPS2	-	NULL	ENSG00000116191		0.403	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS2	HGNC	protein_coding	OTTHUMT00000084926.2	-	0.00	62	0	C	NM_152663		178855196	+1	tier1	-	no_errors	ENST00000367635	ensembl	human	known	74_37	missense	28.12	46	18	SNP	1.000	T
RANGAP1	5905	genome.wustl.edu	37	22	41650402	41650402	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr22:41650402C>T	ENST00000455915.2	-	10	2639	c.1170G>A	c.(1168-1170)gaG>gaA	p.E390E	RANGAP1_ENST00000407260.4_Silent_p.E335E|RANGAP1_ENST00000405486.1_Silent_p.E390E|RANGAP1_ENST00000356244.3_Silent_p.E390E			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	390	Asp/Glu-rich (highly acidic).				mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)	p.E390E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						cctcctcctcctcttcttcct	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											233.0	159.0	184.0					22																	41650402		2203	4300	6503	SO:0001819	synonymous_variant	0			X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1170G>A	22.37:g.41650402C>T			Q96JJ2	Silent	SNP	pfam_Ran_GTPase_activating_1_C,superfamily_Ran_GTPase_activating_1_C,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E390	ENST00000455915.2	37	c.1170	CCDS14012.1	22																																																																																			RANGAP1	-	NULL	ENSG00000100401		0.562	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RANGAP1	HGNC	protein_coding	OTTHUMT00000320606.1		0.00	62	0	C	NM_002883		41650402	-1			no_errors	ENST00000356244	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.781	T
RASGRP1	10125	genome.wustl.edu	37	15	38800196	38800196	+	Missense_Mutation	SNP	C	C	G	rs372568458		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:38800196C>G	ENST00000310803.5	-	9	1150	c.973G>C	c.(973-975)Ggt>Cgt	p.G325R	RASGRP1_ENST00000558164.1_Missense_Mutation_p.G325R|RASGRP1_ENST00000561180.1_Missense_Mutation_p.G376R|RASGRP1_ENST00000450598.2_Missense_Mutation_p.G325R|RASGRP1_ENST00000539159.1_Missense_Mutation_p.G277R|RASGRP1_ENST00000559830.1_Missense_Mutation_p.G325R	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	325	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		GTCATCTCACCGAGAACCTAC	0.517																																																	0													38.0	36.0	37.0					15																	38800196		2044	4196	6240	SO:0001583	missense	0			AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.973G>C	15.37:g.38800196C>G	ENSP00000310244:p.Gly325Arg		Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.G325R	ENST00000310803.5	37	c.973	CCDS45222.1	15	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184315	0.57800	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.17	3.16	0.36331	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.102166	0.64402	D	0.000005	T	0.08492	0.0211	N	0.00841	-1.15	0.33632	D	0.606144	P;B;B;B	0.36354	0.549;0.019;0.203;0.018	B;B;B;B	0.37304	0.246;0.068;0.231;0.041	T	0.07790	-1.0754	10	0.23891	T	0.37	-7.2719	4.4399	0.11568	0.0:0.5867:0.0:0.4133	.	325;325;325;325	C9JM27;C9JCE5;O95267;O95267-2	.;.;GRP1_HUMAN;.	R	325;325;325;325;277;325;325	ENSP00000310244:G325R;ENSP00000388540:G325R;ENSP00000444762:G277R;ENSP00000413105:G325R	ENSP00000310244:G325R	G	-	1	0	RASGRP1	36587488	0.999000	0.42202	0.995000	0.50966	0.915000	0.54546	3.234000	0.51320	1.396000	0.46663	0.655000	0.94253	GGT	RASGRP1	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000172575		0.517	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRP1	HGNC	protein_coding	OTTHUMT00000418223.1		0.00	45	0	C	NM_005739		38800196	-1			no_errors	ENST00000310803	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	G
RBM42	79171	genome.wustl.edu	37	19	36123901	36123901	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:36123901C>T	ENST00000262633.4	+	5	611	c.506C>T	c.(505-507)gCa>gTa	p.A169V	RBM42_ENST00000589871.1_Intron|RBM42_ENST00000586618.1_Intron|RBM42_ENST00000589559.1_Intron|RBM42_ENST00000588161.1_Intron|RBM42_ENST00000360475.4_Intron|RBM42_ENST00000592202.1_Intron	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	169						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CTACAGAGAGCAGGTGAGGGG	0.637																																																	0													113.0	126.0	122.0					19																	36123901		2203	4300	6503	SO:0001583	missense	0			BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.506C>T	19.37:g.36123901C>T	ENSP00000262633:p.Ala169Val		O00320|Q8N5R7|Q9BU66	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A169V	ENST00000262633.4	37	c.506	CCDS12468.1	19	.	.	.	.	.	.	.	.	.	.	C	27.7	4.850654	0.91277	.	.	ENSG00000126254	ENST00000262633	T	0.06768	3.26	5.18	5.18	0.71444	.	0.057284	0.64402	D	0.000001	T	0.11239	0.0274	L	0.36672	1.1	0.80722	D	1	D	0.58268	0.982	P	0.46825	0.528	T	0.03910	-1.0993	10	0.38643	T	0.18	-8.1047	16.2378	0.82389	0.0:1.0:0.0:0.0	.	169	Q9BTD8	RBM42_HUMAN	V	169	ENSP00000262633:A169V	ENSP00000262633:A169V	A	+	2	0	RBM42	40815741	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.007000	0.70731	2.697000	0.92050	0.655000	0.94253	GCA	RBM42	-	NULL	ENSG00000126254		0.637	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM42	HGNC	protein_coding	OTTHUMT00000459057.2		0.00	74	0	C	NM_024321		36123901	+1			no_errors	ENST00000262633	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
RERE	473	genome.wustl.edu	37	1	8555218	8555218	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:8555218T>A	ENST00000337907.3	-	11	1643	c.1009A>T	c.(1009-1011)Atg>Ttg	p.M337L	RERE_ENST00000377464.1_Missense_Mutation_p.M69L|RERE_ENST00000400908.2_Missense_Mutation_p.M337L|RERE_ENST00000400907.2_Missense_Mutation_p.M337L	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	337	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		AATGCCGCCATGCTCCTTCAG	0.463																																																	0													149.0	152.0	151.0					1																	8555218		2203	4300	6503	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1009A>T	1.37:g.8555218T>A	ENSP00000338629:p.Met337Leu		O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.M337L	ENST00000337907.3	37	c.1009	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118201	0.77323	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000400907;ENST00000400908	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.83	5.83	0.93111	ELM2 domain (2);	.	.	.	.	T	0.49355	0.1552	L	0.49126	1.545	0.80722	D	1	P;P	0.49696	0.927;0.856	D;P	0.66602	0.945;0.881	T	0.44050	-0.9353	9	0.54805	T	0.06	-17.6569	15.0254	0.71667	0.0:0.0:0.0:1.0	.	69;337	B1AKN3;Q9P2R6	.;RERE_HUMAN	L	337;69;337;337	ENSP00000338629:M337L;ENSP00000366684:M69L;ENSP00000383699:M337L;ENSP00000383700:M337L	ENSP00000338629:M337L	M	-	1	0	RERE	8477805	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	7.731000	0.84895	2.227000	0.72691	0.459000	0.35465	ATG	RERE	-	pfam_ELM2_dom,pfscan_ELM2_dom	ENSG00000142599		0.463	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	-	0.00	40	0	T			8555218	-1	tier1	-	no_errors	ENST00000337907	ensembl	human	known	74_37	missense	17.07	34	7	SNP	1.000	A
REV1	51455	genome.wustl.edu	37	2	100019466	100019466	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:100019466C>G	ENST00000258428.3	-	20	3498	c.3270G>C	c.(3268-3270)ttG>ttC	p.L1090F	REV1_ENST00000465835.1_5'Flank|REV1_ENST00000393445.3_Missense_Mutation_p.L1089F|RP11-527J8.1_ENST00000608144.1_RNA	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1090					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCTTGTTATTCAAAGGACTCT	0.408								Direct reversal of damage																																									0													98.0	93.0	95.0					2																	100019466		2203	4300	6503	SO:0001583	missense	0			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3270G>C	2.37:g.100019466C>G	ENSP00000258428:p.Leu1090Phe		O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.L1090F	ENST00000258428.3	37	c.3270	CCDS2045.1	2	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659192	0.67586	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.29917	1.55;1.55	5.86	5.86	0.93980	.	0.207429	0.42420	D	0.000714	T	0.49236	0.1545	M	0.72118	2.19	0.46823	D	0.999211	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.983	T	0.40942	-0.9536	10	0.10636	T	0.68	.	11.4625	0.50219	0.0:0.861:0.0:0.139	.	1090;1089	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	F	1089;1090	ENSP00000377091:L1089F;ENSP00000258428:L1090F	ENSP00000258428:L1090F	L	-	3	2	REV1	99385898	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	1.477000	0.35431	2.773000	0.95371	0.655000	0.94253	TTG	REV1	-	pirsf_REV1	ENSG00000135945		0.408	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2	-	0.00	43	0	C	NM_016316		100019466	-1	tier1	-	no_errors	ENST00000258428	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	G
RFX4	5992	genome.wustl.edu	37	12	107103153	107103153	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:107103153G>T	ENST00000392842.1	+	9	1293	c.879G>T	c.(877-879)tgG>tgT	p.W293C	RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Missense_Mutation_p.W302C|RFX4_ENST00000229387.5_Missense_Mutation_p.W199C	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	293					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						TGGATGAGTGGCTAAAAGTGG	0.433																																																	0													99.0	87.0	91.0					12																	107103153		2203	4300	6503	SO:0001583	missense	0			AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.879G>T	12.37:g.107103153G>T	ENSP00000376585:p.Trp293Cys		A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.W302C	ENST00000392842.1	37	c.906	CCDS9106.1	12	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767125	0.90020	.	.	ENSG00000111783	ENST00000392842;ENST00000357881;ENST00000266774;ENST00000551640;ENST00000229387	T;T;D;T	0.87809	-0.41;-0.41;-2.3;0.5	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.94489	0.8226	M	0.84846	2.72	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.997	D;D;D;D	0.91635	0.999;0.993;0.993;0.977	D	0.94725	0.7904	10	0.87932	D	0	-8.6405	19.8155	0.96566	0.0:0.0:1.0:0.0	.	199;302;302;293	B2RDW4;Q33E94-2;Q33E94-4;Q33E94	.;.;.;RFX4_HUMAN	C	293;302;302;238;199	ENSP00000376585:W293C;ENSP00000350552:W302C;ENSP00000448694:W238C;ENSP00000229387:W199C	ENSP00000229387:W199C	W	+	3	0	RFX4	105627283	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.434000	0.97515	2.682000	0.91365	0.650000	0.86243	TGG	RFX4	-	NULL	ENSG00000111783		0.433	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX4	HGNC	protein_coding	OTTHUMT00000402707.1	-	0.00	84	0	G	NM_032491		107103153	+1	tier1	-	no_errors	ENST00000357881	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
RGS18	64407	genome.wustl.edu	37	1	192129548	192129548	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:192129548G>A	ENST00000367460.3	+	3	443	c.262G>A	c.(262-264)Gac>Aac	p.D88N	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	88	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGAATCATTTGACAAACTGCT	0.363																																																	0													130.0	116.0	120.0					1																	192129548		2203	4300	6503	SO:0001583	missense	0			AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.262G>A	1.37:g.192129548G>A	ENSP00000356430:p.Asp88Asn		B2RD23	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.D88N	ENST00000367460.3	37	c.262	CCDS1374.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169900	0.78452	.	.	ENSG00000150681	ENST00000367460	T	0.65916	-0.18	6.03	6.03	0.97812	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.085822	0.85682	D	0.000000	T	0.78407	0.4278	M	0.78344	2.41	0.58432	D	0.999999	B	0.32409	0.37	P	0.49597	0.616	T	0.77281	-0.2646	10	0.72032	D	0.01	.	19.1206	0.93362	0.0:0.0:1.0:0.0	.	88	Q9NS28	RGS18_HUMAN	N	88	ENSP00000356430:D88N	ENSP00000356430:D88N	D	+	1	0	RGS18	190396171	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.497000	0.60367	2.861000	0.98227	0.655000	0.94253	GAC	RGS18	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	ENSG00000150681		0.363	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS18	HGNC	protein_coding	OTTHUMT00000086382.1	-	0.00	139	0	G	NM_130782		192129548	+1	tier1	-	no_errors	ENST00000367460	ensembl	human	known	74_37	missense	12.17	101	14	SNP	1.000	A
RPH3A	22895	genome.wustl.edu	37	12	113266120	113266120	+	5'UTR	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:113266120T>A	ENST00000389385.4	+	0	494				RPH3A_ENST00000447659.2_5'UTR|RPH3A_ENST00000548866.1_5'UTR|RPH3A_ENST00000415485.3_5'UTR|RPH3A_ENST00000543106.2_5'UTR|RPH3A_ENST00000551052.1_5'UTR|RPH3A_ENST00000420983.2_5'Flank	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A						intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		ACTAGACATCTACTATGACTG	0.493																																																	0													180.0	154.0	163.0					12																	113266120		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.-4T>A	12.37:g.113266120T>A			B7Z3C3|Q96AE0	RNA	SNP	-	NULL	ENST00000389385.4	37	NULL	CCDS44979.1	12																																																																																			RPH3A	-	-	ENSG00000089169		0.493	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	-	0.00	76	0	T	NM_014954		113266120	+1	tier1	-	no_errors	ENST00000552679	ensembl	human	known	74_37	rna	6.25	60	4	SNP	0.002	A
RRS1	23212	genome.wustl.edu	37	8	67341947	67341947	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:67341947C>T	ENST00000320270.2	+	1	685	c.581C>T	c.(580-582)gCc>gTc	p.A194V	ADHFE1_ENST00000396623.3_5'Flank|RP11-346I3.4_ENST00000499642.1_lincRNA|ADHFE1_ENST00000379385.4_5'Flank|ADHFE1_ENST00000415254.1_5'Flank	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	194					hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CGTAACCTGGCCCGCGCGCAC	0.657																																																	0													20.0	24.0	22.0					8																	67341947		2186	4272	6458	SO:0001583	missense	0			BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.581C>T	8.37:g.67341947C>T	ENSP00000322396:p.Ala194Val		Q9BUX8	Missense_Mutation	SNP	pfam_Ribosom_reg	p.A194V	ENST00000320270.2	37	c.581	CCDS6189.1	8	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459726	0.84317	.	.	ENSG00000179041	ENST00000320270	D	0.86230	-2.09	5.78	4.91	0.64330	.	0.049298	0.85682	N	0.000000	D	0.91533	0.7326	M	0.71581	2.175	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	D	0.90387	0.4392	10	0.34782	T	0.22	-12.439	12.3839	0.55322	0.0:0.9189:0.0:0.0811	.	194	Q15050	RRS1_HUMAN	V	194	ENSP00000322396:A194V	ENSP00000322396:A194V	A	+	2	0	RRS1	67504501	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.086000	0.76885	1.453000	0.47775	0.650000	0.86243	GCC	RRS1	-	NULL	ENSG00000179041		0.657	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRS1	HGNC	protein_coding	OTTHUMT00000380126.1	-	0.00	59	0	C	NM_015169		67341947	+1	tier1	-	no_errors	ENST00000320270	ensembl	human	known	74_37	missense	11.36	39	5	SNP	1.000	T
RYR1	6261	genome.wustl.edu	37	19	39075637	39075637	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:39075637G>A	ENST00000359596.3	+	102	14701	c.14701G>A	c.(14701-14703)Gag>Aag	p.E4901K	RYR1_ENST00000360985.3_Missense_Mutation_p.E4896K|RYR1_ENST00000355481.4_Missense_Mutation_p.E4896K			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4901					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CATTGGGGACGAGATCGAGGA	0.552																																																	0													226.0	180.0	195.0					19																	39075637		2203	4300	6503	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14701G>A	19.37:g.39075637G>A	ENSP00000352608:p.Glu4901Lys		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E4901K	ENST00000359596.3	37	c.14701	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	19.72	3.879423	0.72294	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98684	-5.07;-5.07;-5.07	5.08	5.08	0.68730	Ion transport (1);	0.000000	0.64402	U	0.000002	D	0.99248	0.9738	M	0.88512	2.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	D	0.99289	1.0898	10	0.87932	D	0	.	18.3248	0.90250	0.0:0.0:1.0:0.0	.	4896;4901	P21817-2;P21817	.;RYR1_HUMAN	K	4901;4896;4896	ENSP00000352608:E4901K;ENSP00000347667:E4896K;ENSP00000354254:E4896K	ENSP00000347667:E4896K	E	+	1	0	RYR1	43767477	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	9.656000	0.98514	2.658000	0.90341	0.449000	0.29647	GAG	RYR1	-	pfam_Ion_trans_dom	ENSG00000196218		0.552	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	-	0.00	72	0	G			39075637	+1	tier1	-	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	9.09	90	9	SNP	1.000	A
SAP18	10284	genome.wustl.edu	37	13	21721403	21721403	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr13:21721403G>C	ENST00000607003.1	+	4	416	c.384G>C	c.(382-384)caG>caC	p.Q128H	SAP18_ENST00000382533.4_Missense_Mutation_p.Q147H			O00422	SAP18_HUMAN	Sin3A-associated protein, 18kDa	128	Involved in splicing regulation activity.				mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|lung(4)	6		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.79e-05)|Epithelial(112;0.000292)|OV - Ovarian serous cystadenocarcinoma(117;0.00276)|Lung(94;0.0941)		AGAAGTTCCAGATAGGAGATT	0.443																																																	0													125.0	126.0	125.0					13																	21721403		2203	4300	6503	SO:0001583	missense	0			U96915	CCDS9295.2	13q12.11	2008-02-05	2006-02-02		ENSG00000150459	ENSG00000150459			10530	protein-coding gene	gene with protein product		602949	"""sin3A-associated protein, 18kDa"""			9150135	Standard	NM_005870		Approved	SAP18p, 2HOR0202, MGC27131	uc001uns.3	O00422	OTTHUMG00000016535	ENST00000607003.1:c.384G>C	13.37:g.21721403G>C	ENSP00000475925:p.Gln128His		B2R494|Q2TTR4|Q6IAW9|Q8N606|Q9UF14	Missense_Mutation	SNP	pfam_SAP18,pirsf_Hist_deAcase_cplx_SAP18	p.Q128H	ENST00000607003.1	37	c.384		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.87|13.87	2.367490|2.367490	0.42003|0.42003	.|.	.|.	ENSG00000150459|ENSG00000150459	ENST00000450573|ENST00000382533	.|.	.|.	.|.	5.87|5.87	-5.53|-5.53	0.02552|0.02552	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67040|0.67040	0.2851|0.2851	M|M	0.73962|0.73962	2.25|2.25	0.54753|0.54753	D|D	0.999987|0.999987	.|B	.|0.21381	.|0.055	.|B	.|0.31390	.|0.129	T|T	0.57906|0.57906	-0.7730|-0.7730	5|9	.|0.48119	.|T	.|0.1	-19.0804|-19.0804	20.6322|20.6322	0.99526|0.99526	0.1655:0.0:0.8345:0.0|0.1655:0.0:0.8345:0.0	.|.	.|128	.|O00422	.|SAP18_HUMAN	H|H	142|147	.|.	.|ENSP00000371973:Q147H	D|Q	+|+	1|3	0|2	SAP18|SAP18	20619403|20619403	1.000000|1.000000	0.71417|0.71417	0.685000|0.685000	0.30070|0.30070	0.971000|0.971000	0.66376|0.66376	0.863000|0.863000	0.27913|0.27913	-0.955000|-0.955000	0.03636|0.03636	-0.345000|-0.345000	0.07892|0.07892	GAT|CAG	SAP18	-	pfam_SAP18,pirsf_Hist_deAcase_cplx_SAP18	ENSG00000150459		0.443	SAP18-009	PUTATIVE	basic|appris_candidate	protein_coding	SAP18	HGNC	protein_coding	OTTHUMT00000470725.1	-	0.00	59	0	G	NM_005870		21721403	+1	tier1	-	no_errors	ENST00000607003	ensembl	human	putative	74_37	missense	27.91	31	12	SNP	0.997	C
SCN1A	6323	genome.wustl.edu	37	2	166897845	166897845	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:166897845C>T	ENST00000303395.4	-	13	2310	c.2311G>A	c.(2311-2313)Gac>Aac	p.D771N	AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.D771N|SCN1A_ENST00000375405.3_Missense_Mutation_p.D760N|SCN1A_ENST00000409050.1_Missense_Mutation_p.D743N|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000599041.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	771					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGGCCAGGTCAACAAATGGG	0.383																																																	0													115.0	108.0	111.0					2																	166897845		2203	4300	6503	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2311G>A	2.37:g.166897845C>T	ENSP00000303540:p.Asp771Asn		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.D771N	ENST00000303395.4	37	c.2311	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.443281	0.96187	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97710	-4.5;-4.5;-4.5;-4.5	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000001	D	0.99202	0.9723	H	0.95780	3.72	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.929	D;D;P	0.87578	0.998;0.994;0.482	D	0.99056	1.0829	10	0.87932	D	0	.	19.8328	0.96642	0.0:1.0:0.0:0.0	.	760;743;771	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	N	771;771;760;743	ENSP00000407030:D771N;ENSP00000303540:D771N;ENSP00000364554:D760N;ENSP00000386312:D743N	ENSP00000303540:D771N	D	-	1	0	SCN1A	166606091	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.773000	0.85462	2.758000	0.94735	0.591000	0.81541	GAC	SCN1A	-	NULL	ENSG00000144285		0.383	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	-	0.00	80	0	C	NM_006920		166897845	-1	tier1	-	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	14.29	78	13	SNP	1.000	T
SCN7A	6332	genome.wustl.edu	37	2	167288952	167288952	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:167288952C>A	ENST00000409855.1	-	15	2594	c.2468G>T	c.(2467-2469)aGc>aTc	p.S823I		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	823					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AAGTGATTGGCTCTCATTTTC	0.388																																																	0													222.0	209.0	213.0					2																	167288952		1859	4103	5962	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2468G>T	2.37:g.167288952C>A	ENSP00000386796:p.Ser823Ile			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.S823I	ENST00000409855.1	37	c.2468	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	6.912	0.537810	0.13188	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.83992	-1.79;-1.79	5.27	-1.29	0.09288	Sodium ion transport-associated (1);	0.674353	0.14632	N	0.307757	T	0.81513	0.4838	M	0.72118	2.19	0.09310	N	1	D	0.55172	0.97	P	0.54815	0.761	T	0.68907	-0.5285	10	0.23891	T	0.37	.	1.222	0.01926	0.1442:0.3608:0.1407:0.3543	.	823	Q01118	SCN7A_HUMAN	I	823	ENSP00000386796:S823I;ENSP00000413699:S823I	ENSP00000259060:S823I	S	-	2	0	SCN7A	166997198	0.000000	0.05858	0.003000	0.11579	0.239000	0.25481	-0.148000	0.10219	-0.120000	0.11809	-1.065000	0.02276	AGC	SCN7A	-	pfam_Na_trans_assoc	ENSG00000136546		0.388	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	-	0.00	67	0	C			167288952	-1	tier1	-	no_errors	ENST00000409855	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.000	A
SEC11C	90701	genome.wustl.edu	37	18	56819910	56819910	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr18:56819910C>T	ENST00000587834.1	+	3	812	c.340C>T	c.(340-342)Cat>Tat	p.H114Y	SEC11C_ENST00000588875.1_Missense_Mutation_p.H114Y	NM_033280.2	NP_150596.1	Q9BY50	SC11C_HUMAN	SEC11 homolog C (S. cerevisiae)	114					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|liver(2)|lung(2)	9		Colorectal(73;0.175)				AATCAAAGTTCATGAAAAGTA	0.343																																																	0													65.0	68.0	67.0					18																	56819910		2203	4300	6503	SO:0001583	missense	0			AF212233	CCDS11970.1	18q21.32	2006-11-07	2006-11-07	2006-11-07	ENSG00000166562	ENSG00000166562			23400	protein-coding gene	gene with protein product			"""SEC11-like 3 (S. cerevisiae)"""	SEC11L3			Standard	NM_033280		Approved	SPC21, SPCS4C	uc002lht.3	Q9BY50	OTTHUMG00000132762	ENST00000587834.1:c.340C>T	18.37:g.56819910C>T	ENSP00000468633:p.His114Tyr		B2RAA3	Missense_Mutation	SNP	pfam_Peptidase_S24_S26,superfamily_Peptidase_S24_S26A/B/C,prints_Peptidase_S26B,tigrfam_Peptidase_S26B	p.H114Y	ENST00000587834.1	37	c.340	CCDS11970.1	18	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524619	0.85600	.	.	ENSG00000166562	ENST00000299714;ENST00000509791	.	.	.	5.48	5.48	0.80851	Peptidase S24/S26A/S26B/S26C (1);Peptidase S24/S26A/S26B/S26C, beta-ribbon domain (1);Peptidase S24/S26A/S26B (1);	0.000000	0.64402	D	0.000001	T	0.71846	0.3388	M	0.81341	2.54	0.80722	D	1	P	0.46912	0.886	P	0.46585	0.521	T	0.75139	-0.3423	9	0.48119	T	0.1	-13.5098	18.9821	0.92758	0.0:1.0:0.0:0.0	.	114	Q9BY50	SC11C_HUMAN	Y	114	.	ENSP00000299714:H114Y	H	+	1	0	SEC11C	54970890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.572000	0.86782	0.655000	0.94253	CAT	SEC11C	-	pfam_Peptidase_S24_S26,superfamily_Peptidase_S24_S26A/B/C,tigrfam_Peptidase_S26B	ENSG00000166562		0.343	SEC11C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC11C	HGNC	protein_coding	OTTHUMT00000256134.2	-	0.00	78	0	C	NM_033280		56819910	+1	tier1	-	no_errors	ENST00000587834	ensembl	human	known	74_37	missense	6.58	71	5	SNP	1.000	T
SF3B3	23450	genome.wustl.edu	37	16	70599428	70599428	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:70599428G>T	ENST00000302516.5	+	20	3037		c.e20+1			NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				TTTGCACAAGGTAGGAATCTG	0.458																																																	0													61.0	67.0	65.0					16																	70599428		2198	4300	6498	SO:0001630	splice_region_variant	0			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2826+1G>T	16.37:g.70599428G>T			Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Splice_Site	SNP	-	e19+1	ENST00000302516.5	37	c.2826+1	CCDS10894.1	16	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781572	0.90282	.	.	ENSG00000189091	ENST00000302516	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.422	0.99049	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SF3B3	69156929	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.835000	0.99442	2.832000	0.97577	0.655000	0.94253	.	SF3B3	-	-	ENSG00000189091		0.458	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B3	HGNC	protein_coding	OTTHUMT00000268972.1	-	0.00	76	0	G	NM_012426	Intron	70599428	+1	tier1	-	no_errors	ENST00000302516	ensembl	human	known	74_37	splice_site	5.80	65	4	SNP	1.000	T
SLC12A7	10723	genome.wustl.edu	37	5	1079589	1079589	+	Silent	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:1079589C>G	ENST00000264930.5	-	10	1363	c.1320G>C	c.(1318-1320)cgG>cgC	p.R440R		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	440					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GGTCCCCGGACCGGTTTGAAC	0.567																																																	0													130.0	120.0	124.0					5																	1079589		2202	4297	6499	SO:0001819	synonymous_variant	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1320G>C	5.37:g.1079589C>G			A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.R440	ENST00000264930.5	37	c.1320	CCDS34129.1	5																																																																																			SLC12A7	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000113504		0.567	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2	-	0.00	42	0	C	NM_006598		1079589	-1	tier1	-	no_errors	ENST00000264930	ensembl	human	known	74_37	silent	11.36	39	5	SNP	0.734	G
SLC13A1	6561	genome.wustl.edu	37	7	122774551	122774551	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:122774551C>G	ENST00000194130.2	-	8	884	c.845G>C	c.(844-846)gGa>gCa	p.G282A	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	282					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	AAACCATGATCCAAAGTTGAG	0.448																																																	0													183.0	146.0	158.0					7																	122774551		2203	4300	6503	SO:0001583	missense	0				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.845G>C	7.37:g.122774551C>G	ENSP00000194130:p.Gly282Ala		Q9H5Z0	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.G282A	ENST00000194130.2	37	c.845	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	C	11.30	1.599225	0.28534	.	.	ENSG00000081800	ENST00000194130	T	0.02421	4.3	5.72	5.72	0.89469	.	0.047313	0.85682	D	0.000000	T	0.07728	0.0194	L	0.35723	1.085	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.71414	0.973;0.973	T	0.30238	-0.9985	10	0.02654	T	1	-25.3213	17.7332	0.88384	0.0:1.0:0.0:0.0	.	282;282	A4D0X1;Q9BZW2	.;S13A1_HUMAN	A	282	ENSP00000194130:G282A	ENSP00000194130:G282A	G	-	2	0	SLC13A1	122561787	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.919000	0.70005	2.865000	0.98341	0.655000	0.94253	GGA	SLC13A1	-	pfam_Na/sul_symport	ENSG00000081800		0.448	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	HGNC	protein_coding	OTTHUMT00000347404.1	-	0.00	104	0	C	NM_022444		122774551	-1	tier1	-	no_errors	ENST00000194130	ensembl	human	known	74_37	missense	21.30	85	23	SNP	1.000	G
SLC16A9	220963	genome.wustl.edu	37	10	61413642	61413642	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:61413642A>G	ENST00000395348.3	-	5	1778	c.1142T>C	c.(1141-1143)aTc>aCc	p.I381T	SLC16A9_ENST00000395347.1_Missense_Mutation_p.I381T	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	381					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						TAGGCCCATGATGATTAAGGT	0.413																																																	0													142.0	133.0	136.0					10																	61413642		2203	4300	6503	SO:0001583	missense	0			AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.1142T>C	10.37:g.61413642A>G	ENSP00000378757:p.Ile381Thr		Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I381T	ENST00000395348.3	37	c.1142	CCDS7256.1	10	.	.	.	.	.	.	.	.	.	.	A	0.052	-1.247375	0.01481	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.59083	0.29;0.29	5.2	-1.35	0.09114	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.917328	0.09670	N	0.771281	T	0.31513	0.0799	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17228	-1.0376	10	0.21540	T	0.41	.	6.156	0.20338	0.4902:0.1385:0.3713:0.0	.	381	Q7RTY1	MOT9_HUMAN	T	381	ENSP00000378757:I381T;ENSP00000378756:I381T	ENSP00000378756:I381T	I	-	2	0	SLC16A9	61083648	0.008000	0.16893	0.259000	0.24435	0.972000	0.66771	0.436000	0.21526	-0.257000	0.09459	0.482000	0.46254	ATC	SLC16A9	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000165449		0.413	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC16A9	HGNC	protein_coding	OTTHUMT00000048174.2	-	0.00	80	0	A	NM_194298		61413642	-1	tier1	-	no_errors	ENST00000395347	ensembl	human	known	74_37	missense	12.50	42	6	SNP	0.008	G
SLC18A2	6571	genome.wustl.edu	37	10	119013947	119013947	+	Missense_Mutation	SNP	T	T	A	rs147489556	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:119013947T>A	ENST00000298472.5	+	6	782	c.639T>A	c.(637-639)gaT>gaA	p.D213E	SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	213					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	TCTACACAGATGATGAAGAGA	0.562																																																	0													97.0	86.0	90.0					10																	119013947		2203	4300	6503	SO:0001583	missense	0			L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.639T>A	10.37:g.119013947T>A	ENSP00000298472:p.Asp213Glu		B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.D213E	ENST00000298472.5	37	c.639	CCDS7599.1	10	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949603	0.73787	.	.	ENSG00000165646	ENST00000298472	T	0.80909	-1.43	5.79	2.19	0.27852	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.81465	0.4828	L	0.41415	1.275	0.53688	D	0.999977	D	0.76494	0.999	D	0.80764	0.994	T	0.74377	-0.3685	10	0.15066	T	0.55	-8.844	9.7239	0.40320	0.0:0.3357:0.0:0.6643	.	213	Q05940	VMAT2_HUMAN	E	213	ENSP00000298472:D213E	ENSP00000298472:D213E	D	+	3	2	SLC18A2	119003937	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	1.402000	0.34600	0.129000	0.18514	0.455000	0.32223	GAT	SLC18A2	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000165646		0.562	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A2	HGNC	protein_coding	OTTHUMT00000050563.1	-	0.00	29	0	T	NM_003054		119013947	+1	tier1	-	no_errors	ENST00000298472	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	A
SLC25A44	9673	genome.wustl.edu	37	1	156180163	156180163	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:156180163T>C	ENST00000359511.4	+	4	1058	c.886T>C	c.(886-888)Tat>Cat	p.Y296H	PMF1_ENST00000567140.1_5'Flank|PMF1_ENST00000368273.4_5'Flank|PMF1-BGLAP_ENST00000320139.5_5'Flank|PMF1_ENST00000368279.3_5'Flank|PMF1-BGLAP_ENST00000490491.1_5'Flank|PMF1_ENST00000565805.1_5'Flank|PMF1_ENST00000368277.3_5'Flank|PMF1-BGLAP_ENST00000368276.4_5'Flank|SLC25A44_ENST00000423538.2_Missense_Mutation_p.Y273H|SLC25A44_ENST00000469537.1_3'UTR	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	296					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					TGTGGTGGGCTATGAGAGCCT	0.567																																																	0													91.0	83.0	86.0					1																	156180163		2203	4300	6503	SO:0001583	missense	0			AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.886T>C	1.37:g.156180163T>C	ENSP00000352497:p.Tyr296His		O75034	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.Y296H	ENST00000359511.4	37	c.886	CCDS1133.1	1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041128	0.75732	.	.	ENSG00000160785	ENST00000359511;ENST00000423538;ENST00000412949	D;D	0.84873	-1.91;-1.91	4.71	3.59	0.41128	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.92678	0.7673	H	0.96720	3.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92677	0.6155	10	0.87932	D	0	-9.8379	8.3457	0.32272	0.0:0.0936:0.0:0.9064	.	273;273;296	E9PGQ0;B4DGC4;Q96H78	.;.;S2544_HUMAN	H	296;273;144	ENSP00000352497:Y296H;ENSP00000407560:Y273H	ENSP00000352497:Y296H	Y	+	1	0	SLC25A44	154446787	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.596000	0.82721	0.845000	0.35118	0.533000	0.62120	TAT	SLC25A44	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000160785		0.567	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	HGNC	protein_coding	OTTHUMT00000040856.1	-	0.00	80	0	T	NM_014655		156180163	+1	tier1	-	no_errors	ENST00000359511	ensembl	human	known	74_37	missense	6.98	80	6	SNP	1.000	C
SLCO1B3	28234	genome.wustl.edu	37	12	21051370	21051370	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:21051370G>T	ENST00000381545.3	+	14	1902	c.1683G>T	c.(1681-1683)aaG>aaT	p.K561N	LST3_ENST00000540229.1_Splice_Site_p.K561N|SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000261196.2_Splice_Site_p.K561N|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000553473.1_Splice_Site_p.K561N	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	561					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	CATATTTCAGGATTGTTCAAC	0.299																																																	0													82.0	81.0	81.0					12																	21051370		2203	4293	6496	SO:0001630	splice_region_variant	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1683-1G>T	12.37:g.21051370G>T			E7EMT8|Q5JAR4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.K561N	ENST00000381545.3	37	c.1683	CCDS8684.1	12	.	.	.	.	.	.	.	.	.	.	.	7.644	0.681535	0.14907	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	3.7	-1.35	0.09114	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.324885	0.34555	N	0.003879	T	0.34164	0.0888	M	0.61703	1.905	0.80722	D	1	B;B;B	0.23442	0.085;0.049;0.049	B;B;B	0.27262	0.076;0.078;0.078	T	0.07809	-1.0753	9	.	.	.	.	8.0189	0.30398	0.3394:0.0:0.6606:0.0	.	561;561;561	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	N	561;561;561;385;561	ENSP00000261196:K561N;ENSP00000370956:K561N;ENSP00000451758:K561N;ENSP00000443225:K385N;ENSP00000441269:K561N	.	K	+	3	2	SLCO1B3;RP11-545J16.1	20942637	0.999000	0.42202	0.985000	0.45067	0.326000	0.28443	1.004000	0.29822	-0.126000	0.11682	0.455000	0.32223	AAG	SLCO1B3	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.299	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	-	0.00	157	0	G	NM_019844	Missense_Mutation	21051370	+1	tier1	-	no_errors	ENST00000553473	ensembl	human	known	74_37	missense	8.85	103	10	SNP	0.975	T
SOCS4	122809	genome.wustl.edu	37	14	55494135	55494135	+	5'UTR	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:55494135C>T	ENST00000395472.2	+	0	188				WDHD1_ENST00000420358.2_5'Flank|WDHD1_ENST00000360586.3_5'Flank|SOCS4_ENST00000553735.1_3'UTR|WDHD1_ENST00000421192.1_5'Flank|SOCS4_ENST00000339298.2_5'Flank|SOCS4_ENST00000555846.1_5'UTR	NM_080867.2|NM_199421.1	NP_543143.1|NP_955453.1	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4						intracellular signal transduction (GO:0035556)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)					central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	14						AGACTGATGGCGATGGTGATG	0.622																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF424815	CCDS9722.1	14q22.1	2013-02-14	2004-02-25	2004-02-27	ENSG00000180008	ENSG00000180008		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19392	protein-coding gene	gene with protein product			"""suppressor of cytokine signaling 7"""	SOCS7		12076535, 10500304	Standard	NM_080867		Approved		uc001xbp.3	Q8WXH5	OTTHUMG00000140311	ENST00000395472.2:c.-145C>T	14.37:g.55494135C>T				RNA	SNP	-	NULL	ENST00000395472.2	37	NULL	CCDS9722.1	14																																																																																			SOCS4	-	-	ENSG00000180008		0.622	SOCS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS4	HGNC	protein_coding	OTTHUMT00000276910.1	-	0.00	60	0	C			55494135	+1	tier1	-	no_errors	ENST00000553735	ensembl	human	putative	74_37	rna	8.06	57	5	SNP	0.983	T
SOGA1	140710	genome.wustl.edu	37	20	35422656	35422656	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:35422656C>T	ENST00000357779.3	-	14	3441	c.3115G>A	c.(3115-3117)Gag>Aag	p.E1039K	SOGA1_ENST00000456801.2_Missense_Mutation_p.E880K|SOGA1_ENST00000279034.6_Intron|SOGA1_ENST00000237536.4_Missense_Mutation_p.E1277K			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	1039					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						AAGCCGGGCTCGATAATGATC	0.607																																																	0													51.0	56.0	55.0					20																	35422656		692	1591	2283	SO:0001583	missense	0			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.3115G>A	20.37:g.35422656C>T	ENSP00000350424:p.Glu1039Lys		A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	pfam_SOGA	p.E1277K	ENST00000357779.3	37	c.3829		20	.	.	.	.	.	.	.	.	.	.	C	23.7	4.444114	0.83993	.	.	ENSG00000149639	ENST00000237536;ENST00000456801;ENST00000357779	T;T;T	0.22336	1.96;1.99;1.98	5.3	5.3	0.74995	.	0.113192	0.64402	D	0.000012	T	0.42966	0.1226	M	0.68952	2.095	0.40758	D	0.982979	.	.	.	.	.	.	T	0.30765	-0.9967	8	0.72032	D	0.01	-42.3406	17.8764	0.88826	0.0:1.0:0.0:0.0	.	.	.	.	K	1277;880;1039	ENSP00000237536:E1277K;ENSP00000413886:E880K;ENSP00000350424:E1039K	ENSP00000237536:E1277K	E	-	1	0	KIAA0889	34856070	1.000000	0.71417	0.979000	0.43373	0.705000	0.40729	5.118000	0.64673	2.748000	0.94277	0.655000	0.94253	GAG	SOGA1	-	NULL	ENSG00000149639		0.607	SOGA1-201	KNOWN	basic	protein_coding	SOGA1	HGNC	protein_coding		-	0.00	50	0	C	NM_199181		35422656	-1	tier1	-	no_errors	ENST00000237536	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.994	T
SORBS1	10580	genome.wustl.edu	37	10	97170530	97170530	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:97170530G>T	ENST00000361941.3	-	8	841	c.815C>A	c.(814-816)tCc>tAc	p.S272Y	SORBS1_ENST00000306402.6_Missense_Mutation_p.S149Y|SORBS1_ENST00000353505.5_Missense_Mutation_p.S203Y|SORBS1_ENST00000371249.2_Missense_Mutation_p.S240Y|SORBS1_ENST00000371241.1_Missense_Mutation_p.S108Y|SORBS1_ENST00000393949.1_Missense_Mutation_p.S263Y|SORBS1_ENST00000371239.1_Missense_Mutation_p.S117Y|SORBS1_ENST00000354106.3_Missense_Mutation_p.S263Y|SORBS1_ENST00000607232.1_Missense_Mutation_p.S117Y|SORBS1_ENST00000371227.4_Missense_Mutation_p.S272Y|SORBS1_ENST00000277982.5_Missense_Mutation_p.S272Y|SORBS1_ENST00000371246.2_Missense_Mutation_p.S272Y|SORBS1_ENST00000347291.4_Missense_Mutation_p.S140Y|SORBS1_ENST00000371247.2_Missense_Mutation_p.S272Y|SORBS1_ENST00000474353.2_5'UTR|SORBS1_ENST00000371245.3_Missense_Mutation_p.S203Y	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TAGAGGACTGGAATCCTGAAA	0.353																																																	0													91.0	84.0	86.0					10																	97170530		2203	4300	6503	SO:0001583	missense	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.815C>A	10.37:g.97170530G>T	ENSP00000355136:p.Ser272Tyr			Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.S117Y	ENST00000361941.3	37	c.350	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397542	0.62177	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371249;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000371241;ENST00000354106;ENST00000371239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.47528	0.84;1.54;1.36;0.84;1.36;0.84;0.84;0.84;2.79;0.84;0.84;1.54;0.84;1.54	5.56	5.56	0.83823	.	0.000000	0.36101	N	0.002797	T	0.57975	0.2090	L	0.40543	1.245	0.28287	N	0.923717	D;P;P;D;P;B;P;B;P;D;B	0.69078	0.997;0.681;0.889;0.963;0.875;0.222;0.654;0.222;0.895;0.98;0.002	P;B;P;P;B;B;B;P;P;P;B	0.59643	0.795;0.133;0.648;0.648;0.309;0.404;0.431;0.473;0.547;0.861;0.009	T	0.56208	-0.8017	10	0.66056	D	0.02	-2.4904	17.7016	0.88296	0.0:0.0:1.0:0.0	.	470;117;272;240;149;108;117;203;272;272;140	B7Z9B7;B4DTX5;Q9BX66-11;Q9BX66-10;Q9BX66-9;Q9BX66-4;Q9BX66-8;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6	.;.;.;.;.;.;.;.;SRBS1_HUMAN;.;.	Y	203;149;240;272;272;272;263;203;140;272;272;108;263;117	ENSP00000360291:S203Y;ENSP00000302556:S149Y;ENSP00000360295:S240Y;ENSP00000360293:S272Y;ENSP00000360271:S272Y;ENSP00000360292:S272Y;ENSP00000377521:S263Y;ENSP00000343998:S203Y;ENSP00000277985:S140Y;ENSP00000355136:S272Y;ENSP00000277982:S272Y;ENSP00000360285:S108Y;ENSP00000277984:S263Y;ENSP00000360283:S117Y	ENSP00000277982:S272Y	S	-	2	0	SORBS1	97160520	0.999000	0.42202	1.000000	0.80357	0.784000	0.44337	4.324000	0.59228	2.617000	0.88574	0.563000	0.77884	TCC	SORBS1	-	NULL	ENSG00000095637		0.353	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	-	0.00	75	0	G			97170530	-1	tier1	-	no_errors	ENST00000607232	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
SOS1	6654	genome.wustl.edu	37	2	39283972	39283972	+	Silent	SNP	A	A	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:39283972A>T	ENST00000426016.1	-	5	467	c.381T>A	c.(379-381)tcT>tcA	p.S127S	SOS1_ENST00000428721.2_Silent_p.S70S|SOS1_ENST00000402219.2_Silent_p.S127S|SOS1_ENST00000395038.2_Silent_p.S127S			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	127					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				CTATGTAAACAGAAACCTGGT	0.308									Noonan syndrome																																								0													146.0	169.0	161.0					2																	39283972		2203	4297	6500	SO:0001819	synonymous_variant	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.381T>A	2.37:g.39283972A>T			A8K2G3|B4DXG2	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S127	ENST00000426016.1	37	c.381	CCDS1802.1	2																																																																																			SOS1	-	pfam_Histone_core_D,superfamily_Histone-fold	ENSG00000115904		0.308	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SOS1	HGNC	protein_coding	OTTHUMT00000219948.3	-	0.00	70	0	A	NM_005633		39283972	-1	tier1	-	no_errors	ENST00000402219	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	T
SP140L	93349	genome.wustl.edu	37	2	231267563	231267563	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:231267563G>T	ENST00000415673.2	+	19	1781	c.1695G>T	c.(1693-1695)aaG>aaT	p.K565N	SP140L_ENST00000396563.4_3'UTR|SP140L_ENST00000243810.6_3'UTR	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	565						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						AATTTGAGAAGGATTTCAAGG	0.393																																																	0													155.0	143.0	147.0					2																	231267563		1862	4104	5966	SO:0001583	missense	0			BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.1695G>T	2.37:g.231267563G>T	ENSP00000397911:p.Lys565Asn		Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.K565N	ENST00000415673.2	37	c.1695	CCDS46538.1	2	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897997	0.33535	.	.	ENSG00000185404	ENST00000415673	T	0.46451	0.87	2.79	1.9	0.25705	.	.	.	.	.	T	0.32971	0.0847	L	0.41492	1.28	0.58432	D	0.999999	P	0.36110	0.537	B	0.40165	0.321	T	0.09751	-1.0660	9	0.48119	T	0.1	.	5.5812	0.17250	0.1565:0.0:0.8435:0.0	.	565	Q9H930-4	.	N	565	ENSP00000397911:K565N	ENSP00000397911:K565N	K	+	3	2	SP140L	230975807	1.000000	0.71417	0.897000	0.35233	0.605000	0.37080	0.873000	0.28052	0.727000	0.32360	0.305000	0.20034	AAG	SP140L	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000185404		0.393	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SP140L	HGNC	protein_coding	OTTHUMT00000374538.1		0.00	126	0	G	NM_138402		231267563	+1			no_errors	ENST00000415673	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.932	T
SPANXC	64663	genome.wustl.edu	37	X	140335751	140335751	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chrX:140335751C>G	ENST00000358993.2	-	2	231	c.193G>C	c.(193-195)Gag>Cag	p.E65Q		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	65						cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					AGCAGTTCCTCTGGAGATGTT	0.468																																																	0													236.0	174.0	195.0					X																	140335751		2141	4142	6283	SO:0001583	missense	0			AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.193G>C	X.37:g.140335751C>G	ENSP00000351884:p.Glu65Gln		Q32WL9|Q5JX88	Missense_Mutation	SNP	pfam_SPANX_prot	p.E65Q	ENST00000358993.2	37	c.193	CCDS14673.1	X	.	.	.	.	.	.	.	.	.	.	c	0.505	-0.869351	0.02570	.	.	ENSG00000198573	ENST00000358993	T	0.06933	3.24	.	.	.	.	.	.	.	.	T	0.05090	0.0136	N	0.16478	0.41	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.39165	-0.9627	7	0.45353	T	0.12	.	.	.	.	.	65	Q9NY87	SPNXC_HUMAN	Q	65	ENSP00000351884:E65Q	ENSP00000351884:E65Q	E	-	1	0	SPANXC	140163417	0.021000	0.18746	0.020000	0.16555	0.020000	0.10135	0.064000	0.14437	0.328000	0.23435	0.330000	0.21533	GAG	SPANXC	-	pfam_SPANX_prot	ENSG00000198573		0.468	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXC	HGNC	protein_coding	OTTHUMT00000058590.1	-	0.00	247	0	C	NM_022661		140335751	-1	tier1	-	no_errors	ENST00000358993	ensembl	human	known	74_37	missense	10.27	297	34	SNP	0.020	G
SPATA32	124783	genome.wustl.edu	37	17	43332672	43332672	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:43332672C>T	ENST00000331780.4	-	4	972	c.877G>A	c.(877-879)Gca>Aca	p.A293T	MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|SPATA32_ENST00000543122.1_Missense_Mutation_p.A272T|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA	NM_152343.2	NP_689556.2	Q96LK8	SPT32_HUMAN	spermatogenesis associated 32	293					spermatogenesis (GO:0007283)	perinuclear region of cytoplasm (GO:0048471)											AGGGTCTCTGCGTGATTTTCT	0.532																																																	0													143.0	130.0	134.0					17																	43332672		2203	4300	6503	SO:0001583	missense	0			AK058143	CCDS32669.1	17q21.31	2013-10-11	2012-10-08	2012-10-08	ENSG00000184361	ENSG00000184361			26349	protein-coding gene	gene with protein product	"""acrosome expressed 2"""		"""chromosome 17 open reading frame 46"", ""testis expressed 34"""	C17orf46, TEX34		18621766	Standard	NM_152343		Approved	FLJ25414, AEP2, VAD1.2	uc002iis.1	Q96LK8	OTTHUMG00000180363	ENST00000331780.4:c.877G>A	17.37:g.43332672C>T	ENSP00000331532:p.Ala293Thr		Q7Z4U1|Q8N6V6	Missense_Mutation	SNP	NULL	p.A293T	ENST00000331780.4	37	c.877	CCDS32669.1	17	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.376218	0.01214	.	.	ENSG00000184361	ENST00000331780;ENST00000543122	T;T	0.40225	1.04;1.04	3.8	-7.59	0.01308	.	2.838640	0.01015	N	0.003893	T	0.22399	0.0540	L	0.29908	0.895	0.09310	N	1	B	0.25521	0.128	B	0.10450	0.005	T	0.24261	-1.0165	10	0.09338	T	0.73	-14.7677	2.068	0.03607	0.2109:0.1117:0.3498:0.3277	.	293	Q96LK8	CQ046_HUMAN	T	293;272	ENSP00000331532:A293T;ENSP00000442724:A272T	ENSP00000331532:A293T	A	-	1	0	C17orf46	40688455	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.577000	0.00112	-5.987000	0.00007	-1.059000	0.02297	GCA	SPATA32	-	NULL	ENSG00000184361		0.532	SPATA32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA32	HGNC	protein_coding	OTTHUMT00000450946.1		0.00	42	0	C	NM_152343		43332672	-1			no_errors	ENST00000331780	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.000	T
SPATA6	54558	genome.wustl.edu	37	1	48878823	48878823	+	Splice_Site	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:48878823T>C	ENST00000371847.3	-	4	403	c.239A>G	c.(238-240)tAt>tGt	p.Y80C	SPATA6_ENST00000371843.3_Splice_Site_p.Y80C|SPATA6_ENST00000463938.1_5'UTR|SPATA6_ENST00000396199.3_Intron	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	80					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TGCTGTATCATCTAAAAGTTT	0.254																																																	0													9.0	10.0	10.0					1																	48878823		2114	4188	6302	SO:0001630	splice_region_variant	0			AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.239-1A>G	1.37:g.48878823T>C			Q5T3N7|Q8WUE6	Missense_Mutation	SNP	NULL	p.Y80C	ENST00000371847.3	37	c.239	CCDS551.1	1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.362494	0.41902	.	.	ENSG00000132122	ENST00000371847;ENST00000371843	T;T	0.11821	2.74;2.74	4.33	4.33	0.51752	.	0.400656	0.23636	N	0.046072	T	0.12518	0.0304	L	0.34521	1.04	0.80722	D	1	B;B	0.28713	0.22;0.047	B;B	0.37451	0.25;0.015	T	0.11060	-1.0603	10	0.38643	T	0.18	.	7.45	0.27234	0.2081:0.0:0.0:0.7919	.	80;80	Q9NWH7-2;Q9NWH7	.;SPAT6_HUMAN	C	80	ENSP00000360913:Y80C;ENSP00000360909:Y80C	ENSP00000360909:Y80C	Y	-	2	0	SPATA6	48651410	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	0.967000	0.29344	1.965000	0.57142	0.397000	0.26171	TAT	SPATA6	-	NULL	ENSG00000132122		0.254	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA6	HGNC	protein_coding	OTTHUMT00000021347.1	-	0.00	125	0	T	NM_019073	Missense_Mutation	48878823	-1	tier1	-	no_errors	ENST00000371847	ensembl	human	known	74_37	missense	6.03	109	7	SNP	1.000	C
SSR1	6745	genome.wustl.edu	37	6	7299004	7299004	+	Missense_Mutation	SNP	C	C	A	rs149302696	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:7299004C>A	ENST00000244763.4	-	5	682	c.596G>T	c.(595-597)aGa>aTa	p.R199I	SSR1_ENST00000474597.1_Missense_Mutation_p.R199I|SSR1_ENST00000488834.1_5'Flank|SSR1_ENST00000479365.1_Missense_Mutation_p.R199I|SSR1_ENST00000489567.1_Missense_Mutation_p.R131I|SSR1_ENST00000534851.1_Missense_Mutation_p.R172I|SSR1_ENST00000462112.1_Missense_Mutation_p.R199I|RP11-69L16.4_ENST00000379928.4_RNA|SSR1_ENST00000397511.2_Missense_Mutation_p.R199I	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha	199					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.R199T(1)		NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					CCCATCCTCTCTTTCAATAAC	0.338																																																	1	Substitution - Missense(1)	NS(1)											201.0	180.0	187.0					6																	7299004		2203	4299	6502	SO:0001583	missense	0				CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.596G>T	6.37:g.7299004C>A	ENSP00000244763:p.Arg199Ile		A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	Missense_Mutation	SNP	pfam_TRAP_alpha	p.R199I	ENST00000244763.4	37	c.596	CCDS4499.1	6	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076617	0.55753	.	.	ENSG00000124783	ENST00000474597;ENST00000244763;ENST00000397511;ENST00000534851;ENST00000489567;ENST00000479365;ENST00000479485;ENST00000462112	T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.8	4.92	0.64577	.	0.147317	0.64402	D	0.000007	T	0.12944	0.0314	N	0.17082	0.46	0.58432	D	0.999999	B;B;B	0.23377	0.008;0.084;0.014	B;B;B	0.26416	0.02;0.069;0.02	T	0.08027	-1.0742	10	0.36615	T	0.2	.	6.2873	0.21041	0.0:0.7714:0.0:0.2286	.	199;131;199	C9J5W0;C9JBX5;P43307	.;.;SSRA_HUMAN	I	199;199;199;172;131;199;36;199	ENSP00000418617:R199I;ENSP00000244763:R199I;ENSP00000380647:R199I;ENSP00000443020:R172I;ENSP00000420730:R131I;ENSP00000417911:R199I;ENSP00000419953:R36I;ENSP00000417290:R199I	ENSP00000244763:R199I	R	-	2	0	SSR1	7244003	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.078000	0.41567	2.740000	0.93945	0.650000	0.86243	AGA	SSR1	-	pfam_TRAP_alpha	ENSG00000124783		0.338	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSR1	HGNC	protein_coding	OTTHUMT00000039775.2		0.00	50	0	C			7299004	-1			no_errors	ENST00000244763	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
STK31	56164	genome.wustl.edu	37	7	23768795	23768795	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:23768795C>G	ENST00000355870.3	+	6	529	c.410C>G	c.(409-411)tCt>tGt	p.S137C	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000354639.3_Missense_Mutation_p.S114C|STK31_ENST00000433467.2_Missense_Mutation_p.S137C|STK31_ENST00000428484.1_Missense_Mutation_p.S114C	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	137	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CTGCAGTTTTCTAGTGTTGCC	0.348																																																	0													92.0	96.0	95.0					7																	23768795		2203	4300	6503	SO:0001583	missense	0			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.410C>G	7.37:g.23768795C>G	ENSP00000348132:p.Ser137Cys		B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	pfam_Tudor,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tudor,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Tudor,pfscan_Prot_kinase_dom	p.S137C	ENST00000355870.3	37	c.410	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	c	22.3	4.268974	0.80469	.	.	ENSG00000196335	ENST00000355870;ENST00000422637;ENST00000456014;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73;2.73	5.79	5.79	0.91817	Tudor subgroup (1);Maternal tudor protein (1);	0.206931	0.41823	D	0.000807	T	0.24547	0.0595	N	0.25647	0.755	0.38742	D	0.953912	D;D	0.69078	0.997;0.997	P;P	0.60173	0.87;0.87	T	0.01608	-1.1313	10	0.87932	D	0	-4.3059	18.8116	0.92059	0.0:1.0:0.0:0.0	.	137;137	B4DZ06;Q9BXU1	.;STK31_HUMAN	C	137;93;114;137;114;114	ENSP00000348132:S137C;ENSP00000414087:S93C;ENSP00000389340:S114C;ENSP00000411852:S137C;ENSP00000346660:S114C;ENSP00000406146:S114C	ENSP00000346660:S114C	S	+	2	0	STK31	23735320	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.792000	0.69052	2.716000	0.92895	0.591000	0.81541	TCT	STK31	-	pfam_Tudor,pfscan_Tudor	ENSG00000196335		0.348	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	HGNC	protein_coding	OTTHUMT00000214036.2	-	0.00	124	0	C	NM_031414		23768795	+1	tier1	-	no_errors	ENST00000355870	ensembl	human	known	74_37	missense	5.50	103	6	SNP	1.000	G
GTF2A1L	11036	genome.wustl.edu	37	2	48848395	48848395	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:48848395G>A	ENST00000403751.3	+	3	250	c.213G>A	c.(211-213)ccG>ccA	p.P71P	GTF2A1L_ENST00000468326.1_3'UTR|STON1-GTF2A1L_ENST00000309827.2_Silent_p.P775P|STON1-GTF2A1L_ENST00000394754.1_Silent_p.P775P|GTF2A1L_ENST00000430487.2_Silent_p.P37P|STON1-GTF2A1L_ENST00000402114.2_Silent_p.P775P|STON1-GTF2A1L_ENST00000405008.1_Silent_p.P775P|STON1-GTF2A1L_ENST00000394751.3_Silent_p.P775P	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	71					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTCAGTTGCCGCACAGCTTGC	0.418																																																	0													82.0	82.0	82.0					2																	48848395		2203	4300	6503	SO:0001819	synonymous_variant	0			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.213G>A	2.37:g.48848395G>A			B4DY14|Q53FD9|Q5D050	Silent	SNP	pfam_TFIIA_asu/bsu,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pfscan_Clathrin_mu_C,pfscan_SHD	p.P775	ENST00000403751.3	37	c.2325	CCDS46281.1	2																																																																																			STON1-GTF2A1L	-	pfam_TFIIA_asu/bsu	ENSG00000068781		0.418	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000323852.4	-	0.00	41	0	G	NM_006872		48848395	+1	tier1	-	no_errors	ENST00000309827	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.985	A
STXBP5L	9515	genome.wustl.edu	37	3	120760584	120760584	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:120760584G>T	ENST00000273666.6	+	4	596	c.325G>T	c.(325-327)Gaa>Taa	p.E109*	STXBP5L_ENST00000497029.1_Nonsense_Mutation_p.E109*|STXBP5L_ENST00000472879.1_Nonsense_Mutation_p.E109*|STXBP5L_ENST00000492541.1_Nonsense_Mutation_p.E109*|STXBP5L_ENST00000471454.1_Nonsense_Mutation_p.E109*	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	109					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TTGCCAACATGAAAGTGGTGC	0.368																																																	0													144.0	131.0	135.0					3																	120760584		1841	4099	5940	SO:0001587	stop_gained	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.325G>T	3.37:g.120760584G>T	ENSP00000273666:p.Glu109*		Q4G1B4|Q6PIC3	Nonsense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.E109*	ENST00000273666.6	37	c.325	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303173	0.81136	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000495504;ENST00000471262	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-6.1294	17.7423	0.88410	0.0:0.0:1.0:0.0	.	.	.	.	X	109	.	ENSP00000273666:E109X	E	+	1	0	STXBP5L	122243274	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.287000	0.89918	2.423000	0.82170	0.557000	0.71058	GAA	STXBP5L	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000145087		0.368	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	-	0.00	57	0	G			120760584	+1	tier1	-	no_errors	ENST00000273666	ensembl	human	known	74_37	nonsense	6.15	61	4	SNP	1.000	T
SVEP1	79987	genome.wustl.edu	37	9	113170469	113170469	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:113170469C>T	ENST00000401783.2	-	38	7747	c.7411G>A	c.(7411-7413)Gaa>Aaa	p.E2471K	SVEP1_ENST00000297826.5_Missense_Mutation_p.E397K|SVEP1_ENST00000374469.1_Missense_Mutation_p.E2448K	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2471	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CCCACCAATTCAAAGCCTGGC	0.473																																																	0													61.0	60.0	60.0					9																	113170469		1918	4135	6053	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.7411G>A	9.37:g.113170469C>T	ENSP00000384917:p.Glu2471Lys		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Growth_fac_rcpt_N_dom,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.E2471K	ENST00000401783.2	37	c.7411	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704313	0.68615	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826;ENST00000374463	T;T;T	0.63913	-0.07;-0.07;-0.07	5.85	5.85	0.93711	Complement control module (2);Sushi/SCR/CCP (3);	0.093226	0.64402	D	0.000001	T	0.70911	0.3278	L	0.47716	1.5	0.80722	D	1	D	0.61080	0.989	P	0.62298	0.9	T	0.61903	-0.6967	10	0.10636	T	0.68	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	2471	Q4LDE5	SVEP1_HUMAN	K	2471;2448;397;143	ENSP00000384917:E2471K;ENSP00000363593:E2448K;ENSP00000297826:E397K	ENSP00000297826:E397K	E	-	1	0	SVEP1	112210290	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.812000	0.55628	2.767000	0.95098	0.655000	0.94253	GAA	SVEP1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000165124		0.473	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding			0.00	23	0	C			113170469	-1			no_errors	ENST00000401783	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
TAP1	6890	genome.wustl.edu	37	6	32818769	32818769	+	Silent	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:32818769G>T	ENST00000354258.4	-	4	1343	c.1182C>A	c.(1180-1182)acC>acA	p.T394T	PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000425148.2_Silent_p.T133T	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	394	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GCAGAGGCAGGGTGATCAGGG	0.532																																																	0													151.0	132.0	139.0					6																	32818769		1511	2708	4219	SO:0001819	synonymous_variant	0				CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.1182C>A	6.37:g.32818769G>T			Q16149|Q96CP4	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_ABC_B2,tigrfam_Ag_transporter2	p.T394	ENST00000354258.4	37	c.1182	CCDS4758.1	6																																																																																			TAP1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_Ag_transporter2	ENSG00000168394		0.532	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAP1	HGNC	protein_coding	OTTHUMT00000076087.2		0.00	72	0	G	NM_000593		32818769	-1			no_errors	ENST00000354258	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.026	T
TBC1D32	221322	genome.wustl.edu	37	6	121655463	121655463	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:121655463C>A	ENST00000398212.2	-	1	163	c.114G>T	c.(112-114)gaG>gaT	p.E38D	TBC1D32_ENST00000275159.6_Missense_Mutation_p.E38D	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	38					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										GTAAAAGAATCTCTTCGGCAC	0.488																																																	0													66.0	66.0	66.0					6																	121655463		1887	4107	5994	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.114G>T	6.37:g.121655463C>A	ENSP00000381270:p.Glu38Asp		Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	NULL	p.E38D	ENST00000398212.2	37	c.114	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	C	14.01	2.409300	0.42715	.	.	ENSG00000146350	ENST00000275159;ENST00000398212;ENST00000422369	T;T;T	0.24723	1.84;1.84;1.84	5.25	2.39	0.29439	.	0.063308	0.64402	N	0.000010	T	0.06325	0.0163	L	0.38175	1.15	0.36145	D	0.847085	P	0.36315	0.547	B	0.34093	0.175	T	0.26780	-1.0093	10	0.19590	T	0.45	-11.275	7.0946	0.25303	0.0:0.6572:0.1233:0.2195	.	38	Q96NH3	BROMI_HUMAN	D	38	ENSP00000275159:E38D;ENSP00000381270:E38D;ENSP00000397993:E38D	ENSP00000275159:E38D	E	-	3	2	C6orf170	121697162	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	1.089000	0.30890	0.316000	0.23135	0.313000	0.20887	GAG	TBC1D32	-	NULL	ENSG00000146350		0.488	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TBC1D32	HGNC	protein_coding	OTTHUMT00000380937.2	-	0.00	69	0	C	NM_152730		121655463	-1	tier1	-	no_errors	ENST00000464622	ensembl	human	known	74_37	missense	10.42	43	5	SNP	1.000	A
TGFBR2	7048	genome.wustl.edu	37	3	30691872	30691872	+	Frame_Shift_Del	DEL	A	A	-	rs79375991		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:30691872delA	ENST00000295754.5	+	3	756	c.374delA	c.(373-375)gaafs	p.E125fs	TGFBR2_ENST00000359013.4_Frame_Shift_Del_p.E150fs	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	125					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.?(1)|p.P129fs*3(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						ATTATGAAGGAAAAAAAAAAG	0.423																																																	2	Unknown(1)|Insertion - Frameshift(1)	large_intestine(1)|skin(1)											89.0	92.0	91.0					3																	30691872		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.374delA	3.37:g.30691872delA	ENSP00000295754:p.Glu125fs		B4DTV5|Q15580|Q6DKT6|Q99474	Frame_Shift_Del	DEL	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.K153fs	ENST00000295754.5	37	c.449	CCDS2648.1	3																																																																																			TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,prints_TGFB_receptor	ENSG00000163513		0.423	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2		0.00	49	0	A			30691872	+1	tier1		no_errors	ENST00000359013	ensembl	human	known	74_37	frame_shift_del	8.33	33	3	DEL	1.000	-
TLCD1	116238	genome.wustl.edu	37	17	27051820	27051820	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:27051820A>T	ENST00000292090.3	-	4	562	c.452T>A	c.(451-453)cTc>cAc	p.L151H	SNORD4A_ENST00000459174.1_RNA|SNORD4B_ENST00000459083.1_RNA|AC010761.14_ENST00000587898.1_RNA|AC010761.8_ENST00000582718.1_RNA|SNORD42A_ENST00000459584.1_RNA|TLCD1_ENST00000394933.3_Missense_Mutation_p.L104H	NM_138463.3	NP_612472.1	Q96CP7	TLCD1_HUMAN	TLC domain containing 1	151	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(2)|lung(2)	7	Lung NSC(42;0.00431)					GCGAATGGTGAGGAAGATGTT	0.498																																																	0													117.0	111.0	113.0					17																	27051820		2203	4300	6503	SO:0001583	missense	0			BC014072	CCDS11242.1, CCDS54102.1	17q11.2	2007-03-23			ENSG00000160606	ENSG00000160606			25177	protein-coding gene	gene with protein product						12151215	Standard	NM_138463		Approved		uc002hco.3	Q96CP7	OTTHUMG00000132683	ENST00000292090.3:c.452T>A	17.37:g.27051820A>T	ENSP00000292090:p.Leu151His		A8MYP9	Missense_Mutation	SNP	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.L151H	ENST00000292090.3	37	c.452	CCDS11242.1	17	.	.	.	.	.	.	.	.	.	.	A	25.9	4.683957	0.88639	.	.	ENSG00000160606	ENST00000292090;ENST00000394933	D;D	0.89875	-2.58;-2.58	5.91	5.91	0.95273	TRAM/LAG1/CLN8 homology domain (3);	0.000000	0.85682	D	0.000000	D	0.94118	0.8114	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94650	0.7838	10	0.87932	D	0	-0.4012	14.0835	0.64939	1.0:0.0:0.0:0.0	.	104;151	A8MYP9;Q96CP7	.;TLCD1_HUMAN	H	151;104	ENSP00000292090:L151H;ENSP00000378391:L104H	ENSP00000292090:L151H	L	-	2	0	TLCD1	24075947	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	8.042000	0.89430	2.263000	0.75096	0.379000	0.24179	CTC	TLCD1	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000160606		0.498	TLCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLCD1	HGNC	protein_coding	OTTHUMT00000255973.1	-	0.00	59	0	A	NM_138463		27051820	-1	tier1	-	no_errors	ENST00000292090	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	T
TMEM248	55069	genome.wustl.edu	37	7	66410195	66410195	+	Missense_Mutation	SNP	G	G	A	rs374932648		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:66410195G>A	ENST00000341567.4	+	3	647	c.392G>A	c.(391-393)cGc>cAc	p.R131H		NM_017994.4	NP_060464.1	Q9NWD8	TM248_HUMAN	transmembrane protein 248	131						integral component of membrane (GO:0016021)											GGGTATTCCCGCAACGTCACC	0.557																																																	0								G	HIS/ARG	0,4406		0,0,2203	103.0	101.0	101.0		392	5.8	1.0	7		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	C7orf42	NM_017994.4	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	131/315	66410195	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS5536.1	7q11.21	2012-05-30	2012-05-30	2012-05-30	ENSG00000106609	ENSG00000106609			25476	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 42"""	C7orf42		12477932	Standard	XM_005250482		Approved	FLJ10099, FLJ13090	uc003tvk.3	Q9NWD8	OTTHUMG00000129553	ENST00000341567.4:c.392G>A	7.37:g.66410195G>A	ENSP00000340668:p.Arg131His		Q53H07|Q96FR2	Missense_Mutation	SNP	NULL	p.R131H	ENST00000341567.4	37	c.392	CCDS5536.1	7	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069252	0.55539	0.0	1.16E-4	ENSG00000106609	ENST00000341567;ENST00000424964	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	N	0.20986	0.625	0.80722	D	1	B	0.23891	0.093	B	0.16722	0.016	T	0.40079	-0.9582	9	0.20519	T	0.43	-10.4256	19.0145	0.92888	0.0:0.0:1.0:0.0	.	131	Q9NWD8	CG042_HUMAN	H	131	.	ENSP00000340668:R131H	R	+	2	0	C7orf42	66047630	1.000000	0.71417	0.974000	0.42286	0.581000	0.36288	9.394000	0.97261	2.735000	0.93741	0.655000	0.94253	CGC	TMEM248	-	NULL	ENSG00000106609		0.557	TMEM248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM248	HGNC	protein_coding	OTTHUMT00000251745.2	-	0.00	47	0	G	NM_017994		66410195	+1	tier1	-	no_errors	ENST00000341567	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
TMEM30A	55754	genome.wustl.edu	37	6	75965914	75965914	+	Silent	SNP	G	G	A	rs557948243		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:75965914G>A	ENST00000230461.6	-	7	1319	c.990C>T	c.(988-990)atC>atT	p.I330I	TMEM30A_ENST00000370050.5_Silent_p.I211I|TMEM30A_ENST00000475111.2_Silent_p.I294I	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	330					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						ATCCAACAGCGATGTAAGCAA	0.363																																																	0													118.0	110.0	113.0					6																	75965914		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.990C>T	6.37:g.75965914G>A			A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Silent	SNP	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	p.I330	ENST00000230461.6	37	c.990	CCDS4983.1	6																																																																																			TMEM30A	-	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	ENSG00000112697		0.363	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM30A	HGNC	protein_coding	OTTHUMT00000041248.2		0.00	44	0	G	NM_018247		75965914	-1			no_errors	ENST00000230461	ensembl	human	known	74_37	silent	5.88	32	2	SNP	1.000	A
TNC	3371	genome.wustl.edu	37	9	117792627	117792627	+	Missense_Mutation	SNP	G	G	A	rs373428721		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:117792627G>A	ENST00000350763.4	-	24	6389	c.5978C>T	c.(5977-5979)aCg>aTg	p.T1993M	TNC_ENST00000537320.1_Missense_Mutation_p.T1356M|TNC_ENST00000423613.2_Missense_Mutation_p.T1720M|TNC_ENST00000535648.1_Missense_Mutation_p.T1538M|TNC_ENST00000341037.4_Missense_Mutation_p.T1811M|TNC_ENST00000542877.1_Missense_Mutation_p.T1630M|TNC_ENST00000340094.3_Missense_Mutation_p.T1629M|TNC_ENST00000345230.3_Missense_Mutation_p.T1356M|TNC_ENST00000346706.3_Missense_Mutation_p.T1447M	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1993	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GCCAGAGGTCGTGTCTCCATT	0.517																																																	0								G	MET/THR	0,4406		0,0,2203	142.0	119.0	127.0		5978	5.3	1.0	9		127	2,8598	2.2+/-6.3	0,2,4298	no	missense	TNC	NM_002160.3	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	1993/2202	117792627	2,13004	2203	4300	6503	SO:0001583	missense	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5978C>T	9.37:g.117792627G>A	ENSP00000265131:p.Thr1993Met		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.T1993M	ENST00000350763.4	37	c.5978	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332949	0.81801	0.0	2.33E-4	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.35	5.35	0.76521	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.209840	0.49305	D	0.000157	D	0.87111	0.6096	M	0.74467	2.265	0.26098	N	0.980861	D;D	0.89917	0.999;1.0	D;D	0.77557	0.96;0.99	T	0.80953	-0.1152	10	0.66056	D	0.02	.	14.6952	0.69115	0.0722:0.0:0.9278:0.0	.	1720;1993	E9PC84;P24821	.;TENA_HUMAN	M	1629;1538;1447;1356;1993;1811;1720;1356;1630	ENSP00000344400:T1629M;ENSP00000438152:T1538M;ENSP00000344555:T1447M;ENSP00000345861:T1356M;ENSP00000265131:T1993M;ENSP00000339553:T1811M;ENSP00000411406:T1720M;ENSP00000443478:T1356M;ENSP00000442242:T1630M	ENSP00000344400:T1629M	T	-	2	0	TNC	116832448	1.000000	0.71417	0.978000	0.43139	0.999000	0.98932	4.342000	0.59341	2.663000	0.90544	0.655000	0.94253	ACG	TNC	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000041982		0.517	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	-	0.00	42	0	G	NM_002160		117792627	-1	tier1	-	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.997	A
TNFRSF25	8718	genome.wustl.edu	37	1	6521693	6521693	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:6521693C>T	ENST00000356876.3	-	10	1142	c.1055G>A	c.(1054-1056)cGc>cAc	p.R352H	TNFRSF25_ENST00000351959.5_Missense_Mutation_p.R315H|TNFRSF25_ENST00000348333.3_Missense_Mutation_p.R307H|TNFRSF25_ENST00000351748.3_Missense_Mutation_p.R169H|TNFRSF25_ENST00000377782.3_Missense_Mutation_p.R361H|TNFRSF25_ENST00000461703.2_5'Flank	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	352	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		CCCCAGCGTGCGCACGAACTC	0.692																																																	0													19.0	20.0	19.0					1																	6521693		2202	4295	6497	SO:0001583	missense	0			U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.1055G>A	1.37:g.6521693C>T	ENSP00000349341:p.Arg352His		B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Missense_Mutation	SNP	pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,prints_TNFR_25,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg	p.R361H	ENST00000356876.3	37	c.1082	CCDS71.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.322526	0.95708	.	.	ENSG00000215788	ENST00000356876;ENST00000377782;ENST00000351959;ENST00000351748;ENST00000348333	D;D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3;-4.3	5.14	5.14	0.70334	Death (3);DEATH-like (2);	0.247460	0.21481	U	0.073834	D	0.98273	0.9428	M	0.73962	2.25	0.58432	D	0.99999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.992;0.992;0.994;0.996;0.994;0.998	D	0.99564	1.0969	10	0.87932	D	0	-16.6554	17.1833	0.86860	0.0:1.0:0.0:0.0	.	361;307;315;352;353;169	Q93038-11;Q93038-9;Q93038-10;Q93038;Q93038-2;Q93038-8	.;.;.;TNR25_HUMAN;.;.	H	352;361;315;169;307	ENSP00000349341:R352H;ENSP00000367013:R361H;ENSP00000337713:R315H;ENSP00000326762:R169H;ENSP00000314451:R307H	ENSP00000314451:R307H	R	-	2	0	TNFRSF25	6444280	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.752000	0.68728	2.381000	0.81170	0.650000	0.86243	CGC	TNFRSF25	-	pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain	ENSG00000215788		0.692	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF25	HGNC	protein_coding	OTTHUMT00000002259.1	-	0.00	23	0	C	NM_148965		6521693	-1	tier1	-	no_errors	ENST00000377782	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	T
TNFRSF8	943	genome.wustl.edu	37	1	12172066	12172066	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:12172066C>G	ENST00000263932.2	+	7	1010	c.788C>G	c.(787-789)tCt>tGt	p.S263C	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.S152C	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	263					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	GTGAGCTGTTCTCGAGGTAAG	0.577																																																	0													39.0	39.0	39.0					1																	12172066		2203	4300	6503	SO:0001583	missense	0			M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.788C>G	1.37:g.12172066C>G	ENSP00000263932:p.Ser263Cys		B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_8	p.S263C	ENST00000263932.2	37	c.788	CCDS144.1	1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880143	0.51801	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	D;D	0.91686	-2.89;-2.89	3.85	1.68	0.24146	TNFR/CD27/30/40/95 cysteine-rich region (3);	19.177300	0.00166	N	0.000000	D	0.93406	0.7897	L	0.50333	1.59	0.09310	N	1	D;D	0.76494	0.983;0.999	P;D	0.64506	0.533;0.926	T	0.78816	-0.2055	10	0.40728	T	0.16	-0.9544	2.5944	0.04850	0.0:0.448:0.313:0.239	.	152;263	D3YTD8;P28908	.;TNR8_HUMAN	C	263;152	ENSP00000263932:S263C;ENSP00000390650:S152C	ENSP00000263932:S263C	S	+	2	0	TNFRSF8	12094653	0.000000	0.05858	0.017000	0.16124	0.231000	0.25187	-1.654000	0.01984	0.408000	0.25621	0.563000	0.77884	TCT	TNFRSF8	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg	ENSG00000120949		0.577	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF8	HGNC	protein_coding	OTTHUMT00000005130.1		0.00	42	0	C			12172066	+1			no_errors	ENST00000263932	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.022	G
TOP1	7150	genome.wustl.edu	37	20	39709861	39709861	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:39709861G>T	ENST00000361337.2	+	7	738	c.488G>T	c.(487-489)aGa>aTa	p.R163I		NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	163	Lys-rich.				chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	GAGAAGAAAAGAAAACTAGAA	0.348			T	NUP98	AML*																																			Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	0													90.0	95.0	94.0					20																	39709861		2203	4300	6503	SO:0001583	missense	0				CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.488G>T	20.37:g.39709861G>T	ENSP00000354522:p.Arg163Ile		A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Missense_Mutation	SNP	pfam_TopoI_DNA-bd_euk,pfam_TopoI_cat_euk,superfamily_TopoI_DNA-bd_euk,superfamily_DNA_brk_join_enz,smart_TopoI_euk,prints_TopoI	p.R163I	ENST00000361337.2	37	c.488	CCDS13312.1	20	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916554	0.73098	.	.	ENSG00000198900	ENST00000361337	T	0.23754	1.89	5.61	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.20820	0.0501	L	0.43152	1.355	0.80722	D	1	P	0.39964	0.697	B	0.35413	0.202	T	0.02676	-1.1125	10	0.39692	T	0.17	-6.3397	11.7411	0.51794	0.0822:0.0:0.9178:0.0	.	163	P11387	TOP1_HUMAN	I	163	ENSP00000354522:R163I	ENSP00000354522:R163I	R	+	2	0	TOP1	39143275	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.272000	0.65559	1.503000	0.48686	0.655000	0.94253	AGA	TOP1	-	NULL	ENSG00000198900		0.348	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP1	HGNC	protein_coding	OTTHUMT00000080397.2	-	0.00	52	0	G			39709861	+1	tier1	-	no_errors	ENST00000361337	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7574000	7574000	+	Nonsense_Mutation	SNP	C	C	A	rs375573770		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr17:7574000C>A	ENST00000269305.4	-	10	1216	c.1027G>T	c.(1027-1029)Gag>Tag	p.E343*	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.E343*|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	343	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		E -> G (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E343*(8)|p.0?(8)|p.R342_N345delRELN(1)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCATTCAGCTCTCGGAACATC	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	19	Substitution - Nonsense(8)|Whole gene deletion(8)|Unknown(1)|Deletion - In frame(1)|Deletion - Frameshift(1)	bone(4)|lung(3)|large_intestine(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|biliary_tract(2)|oesophagus(2)|stomach(1)|breast(1)											63.0	49.0	54.0					17																	7574000		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1027G>T	17.37:g.7574000C>A	ENSP00000269305:p.Glu343*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E343*	ENST00000269305.4	37	c.1027	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.416742	0.96092	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	0.0488	0.14286	.	0.424710	0.26746	N	0.022702	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.3598	8.103	0.30868	0.0:0.4892:0.0:0.5108	.	.	.	.	X	343;343;332	.	ENSP00000269305:E343X	E	-	1	0	TP53	7514725	0.924000	0.31332	0.029000	0.17559	0.870000	0.49936	2.211000	0.42825	0.026000	0.15269	-0.291000	0.09656	GAG	TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	ENSG00000141510		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	29	0	C	NM_000546		7574000	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	47.37	20	18	SNP	0.042	A
TRABD2A	129293	genome.wustl.edu	37	2	85051238	85051238	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:85051238G>A	ENST00000409520.2	-	6	1215	c.1173C>T	c.(1171-1173)gcC>gcT	p.A391A	TRABD2A_ENST00000479944.1_5'UTR|TRABD2A_ENST00000335459.5_Silent_p.A342A	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	391					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										CTGAGGATACGGCTTCTGGTG	0.597																																																	0													49.0	59.0	56.0					2																	85051238		2188	4294	6482	SO:0001819	synonymous_variant	0			BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.1173C>T	2.37:g.85051238G>A			B4DKK8|I6UMB9	Silent	SNP	NULL	p.A391	ENST00000409520.2	37	c.1173		2																																																																																			TRABD2A	-	NULL	ENSG00000186854		0.597	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	TRABD2A	HGNC	protein_coding		-	0.00	70	0	G	NM_001080824		85051238	-1	tier1	-	no_errors	ENST00000409520	ensembl	human	known	74_37	silent	32.05	53	25	SNP	0.011	A
TRIM38	10475	genome.wustl.edu	37	6	25983831	25983831	+	Silent	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:25983831G>T	ENST00000357085.3	+	8	1790	c.1314G>T	c.(1312-1314)ccG>ccT	p.P438P	TRIM38_ENST00000349458.3_Silent_p.P438P|U91328.21_ENST00000608931.1_RNA	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	438	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.P438P(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						TTACTTTCCCGAAGGCTTCCT	0.478																																																	1	Substitution - coding silent(1)	lung(1)											72.0	71.0	71.0					6																	25983831		2203	4300	6503	SO:0001819	synonymous_variant	0			U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.1314G>T	6.37:g.25983831G>T			B2R862	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P438	ENST00000357085.3	37	c.1314	CCDS4568.1	6																																																																																			TRIM38	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000112343		0.478	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM38	HGNC	protein_coding	OTTHUMT00000040076.2		0.00	55	0	G			25983831	+1			no_errors	ENST00000349458	ensembl	human	known	74_37	silent	6.38	44	3	SNP	0.000	T
TRIM27	5987	genome.wustl.edu	37	6	28876863	28876863	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:28876863G>T	ENST00000377199.3	-	5	1129	c.773C>A	c.(772-774)gCt>gAt	p.A258D	TRIM27_ENST00000377194.3_Missense_Mutation_p.A258D|TRIM27_ENST00000498117.1_5'Flank	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	258					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GATTCTTTCAGCCCTAAATTT	0.423			T	RET	papillary thyroid																																			Dom	yes		6	6p22	5987	tripartite motif-containing 27		E	0													56.0	58.0	57.0					6																	28876863		2201	4300	6501	SO:0001583	missense	0			Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.773C>A	6.37:g.28876863G>T	ENSP00000366404:p.Ala258Asp		A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.A258D	ENST00000377199.3	37	c.773	CCDS4654.1	6	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570852	0.65765	.	.	ENSG00000204713	ENST00000377199;ENST00000377194	T;T	0.62364	0.56;0.03	4.29	4.29	0.51040	.	0.000000	0.52532	D	0.000079	T	0.65123	0.2661	L	0.49126	1.545	0.58432	D	0.999992	D;D;D	0.89917	1.0;1.0;0.994	D;D;P	0.77004	0.971;0.989;0.795	T	0.61907	-0.6966	10	0.36615	T	0.2	.	12.5492	0.56218	0.0:0.0:1.0:0.0	.	325;258;258	Q59EC6;P14373-2;P14373	.;.;TRI27_HUMAN	D	258	ENSP00000366404:A258D;ENSP00000366399:A258D	ENSP00000366399:A258D	A	-	2	0	TRIM27	28984842	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	2.029000	0.41098	2.675000	0.91044	0.655000	0.94253	GCT	TRIM27	-	NULL	ENSG00000204713		0.423	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM27	HGNC	protein_coding	OTTHUMT00000076442.2	-	0.00	41	0	G	NM_030950		28876863	-1	tier1	-	no_errors	ENST00000377199	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
TRIM10	10107	genome.wustl.edu	37	6	30126364	30126364	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr6:30126364C>T	ENST00000449742.2	-	3	643	c.568G>A	c.(568-570)Gca>Aca	p.A190T	TRIM10_ENST00000376704.3_Missense_Mutation_p.A190T	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	190					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.A190T(1)		ovary(1)	1						CTCAGGTGTGCGAACTCAGAA	0.512																																																	1	Substitution - Missense(1)	prostate(1)											262.0	283.0	276.0					6																	30126364		1511	2709	4220	SO:0001583	missense	0			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.568G>A	6.37:g.30126364C>T	ENSP00000397073:p.Ala190Thr		A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.A190T	ENST00000449742.2	37	c.568	CCDS34375.1	6	.	.	.	.	.	.	.	.	.	.	C	6.673	0.492709	0.12702	.	.	ENSG00000204613	ENST00000449742;ENST00000376704;ENST00000376706	T;T	0.04758	3.56;3.56	5.68	0.586	0.17434	.	0.376195	0.22913	N	0.054107	T	0.01835	0.0058	M	0.71581	2.175	0.18873	N	0.999986	B;B	0.28971	0.147;0.229	B;B	0.28709	0.035;0.093	T	0.40701	-0.9549	10	0.49607	T	0.09	.	2.9036	0.05713	0.2355:0.5001:0.121:0.1434	.	190;190	Q9UDY6;Q9UDY6-2	TRI10_HUMAN;.	T	190	ENSP00000397073:A190T;ENSP00000365894:A190T	ENSP00000365894:A190T	A	-	1	0	TRIM10	30234343	0.001000	0.12720	0.124000	0.21820	0.005000	0.04900	-0.436000	0.06922	0.072000	0.16694	-2.526000	0.00183	GCA	TRIM10	-	NULL	ENSG00000204613		0.512	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM10	HGNC	protein_coding	OTTHUMT00000076634.1	-	0.00	30	0	C			30126364	-1	tier1	-	no_errors	ENST00000449742	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.216	T
TRIM4	89122	genome.wustl.edu	37	7	99489970	99489970	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:99489970T>A	ENST00000355947.2	-	7	1448	c.1319A>T	c.(1318-1320)gAg>gTg	p.E440V	TRIM4_ENST00000349062.2_Missense_Mutation_p.E414V	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	440	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				GAGAGCTGGCTCTTGCTGGGT	0.557																																																	0													136.0	138.0	137.0					7																	99489970		2203	4300	6503	SO:0001583	missense	0			AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.1319A>T	7.37:g.99489970T>A	ENSP00000348216:p.Glu440Val		A4D298|Q75MK1|Q96F06|Q9C036	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E440V	ENST00000355947.2	37	c.1319	CCDS5679.1	7	.	.	.	.	.	.	.	.	.	.	T	7.765	0.706223	0.15239	.	.	ENSG00000146833	ENST00000355947;ENST00000349062;ENST00000542799	T;T	0.70045	-0.45;-0.45	2.64	1.49	0.22878	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.66147	0.2760	L	0.31294	0.92	0.18873	N	0.999982	D;D	0.76494	0.998;0.999	D;D	0.69824	0.943;0.966	T	0.53012	-0.8498	9	0.30078	T	0.28	.	5.9414	0.19196	0.0:0.1384:0.0:0.8616	.	414;440	Q9C037-2;Q9C037	.;TRIM4_HUMAN	V	440;414;270	ENSP00000348216:E440V;ENSP00000275736:E414V	ENSP00000275736:E414V	E	-	2	0	TRIM4	99327906	0.000000	0.05858	0.003000	0.11579	0.012000	0.07955	-0.198000	0.09505	0.452000	0.26830	0.533000	0.62120	GAG	TRIM4	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000146833		0.557	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM4	HGNC	protein_coding	OTTHUMT00000345050.1	-	0.00	44	0	T	NM_033017		99489970	-1	tier1	-	no_errors	ENST00000355947	ensembl	human	known	74_37	missense	28.57	20	8	SNP	0.022	A
TRIM64C	646754	genome.wustl.edu	37	11	49076920	49076920	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:49076920G>A	ENST00000530230.1	-	6	791	c.792C>T	c.(790-792)aaC>aaT	p.N264N		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	264						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TGAGCTCTGGGTTCACTGGCT	0.468																																																	0																																										SO:0001819	synonymous_variant	0				CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.792C>T	11.37:g.49076920G>A				Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.N264	ENST00000530230.1	37	c.792		11																																																																																			TRIM64C	-	NULL	ENSG00000214891		0.468	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	HGNC	protein_coding	OTTHUMT00000391366.1	-	0.00	251	0	G			49076920	-1	tier1	-	no_errors	ENST00000530230	ensembl	human	known	74_37	silent	18.99	209	49	SNP	0.000	A
TRIM64B	642446	genome.wustl.edu	37	11	89604018	89604018	+	Missense_Mutation	SNP	C	C	G	rs569855806	byFrequency	TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr11:89604018C>G	ENST00000329862.6	-	6	1120	c.1121G>C	c.(1120-1122)aGa>aCa	p.R374T		NM_001136486.1|NM_001164397.1	NP_001129958.1|NP_001157869.1	A6NI03	TR64B_HUMAN	tripartite motif containing 64B	374	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)	2						TAAAAAAAATCTTTCATCAGA	0.453																																																	0													34.0	34.0	34.0					11																	89604018		692	1591	2283	SO:0001583	missense	0				CCDS53693.1	11q14.3	2014-04-02	2011-01-25		ENSG00000189253	ENSG00000189253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37147	protein-coding gene	gene with protein product			"""tripartite motif-containing 64B"""				Standard	NM_001164397		Approved		uc021qoo.1	A6NI03	OTTHUMG00000167638	ENST00000329862.6:c.1121G>C	11.37:g.89604018C>G	ENSP00000332969:p.Arg374Thr			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R374T	ENST00000329862.6	37	c.1121	CCDS53693.1	11	.	.	.	.	.	.	.	.	.	.	.	0	-2.700232	0.00097	.	.	ENSG00000189253	ENST00000329862	T	0.68903	-0.36	2.09	-1.33	0.09172	.	.	.	.	.	T	0.30510	0.0767	N	0.02539	-0.55	0.09310	N	1	.	.	.	.	.	.	T	0.16217	-1.0410	6	.	.	.	.	2.7337	0.05234	0.3511:0.2565:0.3924:0.0	.	.	.	.	T	374	ENSP00000332969:R374T	.	R	-	2	0	TRIM64B	89243666	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.327000	0.07955	-0.156000	0.11079	-1.820000	0.00599	AGA	TRIM64B	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000189253		0.453	TRIM64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM64B	HGNC	protein_coding	OTTHUMT00000395440.1	-	0.00	169	0	C			89604018	-1	tier1	-	no_errors	ENST00000329862	ensembl	human	known	74_37	missense	10.71	125	15	SNP	0.002	G
TSC22D4	81628	genome.wustl.edu	37	7	100075404	100075404	+	Silent	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr7:100075404G>T	ENST00000300181.2	-	2	1012	c.258C>A	c.(256-258)cgC>cgA	p.R86R	TSC22D4_ENST00000496728.1_5'Flank|TSC22D4_ENST00000393991.1_Intron	NM_030935.3	NP_112197.1	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	86					negative regulation of transcription, DNA-templated (GO:0045892)|response to osmotic stress (GO:0006970)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGCGACCGCGGCGATAAGGCT	0.692																																																	0													13.0	14.0	14.0					7																	100075404		2141	4150	6291	SO:0001819	synonymous_variant	0			BC010406	CCDS5695.1	7p21-p15	2010-04-30			ENSG00000166925	ENSG00000166925			21696	protein-coding gene	gene with protein product		611914					Standard	NM_030935		Approved	THG-1, TILZ2	uc003uva.3	Q9Y3Q8	OTTHUMG00000150233	ENST00000300181.2:c.258C>A	7.37:g.100075404G>T			A4D2C3|A8MWR6|D6W5V9	Silent	SNP	pfam_TSC-22_Dip_Bun	p.R86	ENST00000300181.2	37	c.258	CCDS5695.1	7																																																																																			TSC22D4	-	NULL	ENSG00000166925		0.692	TSC22D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC22D4	HGNC	protein_coding	OTTHUMT00000316970.1		0.00	79	0	G	NM_030935		100075404	-1			no_errors	ENST00000300181	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.841	T
UBE4B	10277	genome.wustl.edu	37	1	10207055	10207055	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:10207055G>A	ENST00000253251.8	+	18	2950	c.2111G>A	c.(2110-2112)gGc>gAc	p.G704D	UBE4B_ENST00000343090.6_Missense_Mutation_p.G833D|UBE4B_ENST00000377157.3_Missense_Mutation_p.G588D					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GCTGATGCTGGCCTACTTGAC	0.547																																																	0													161.0	136.0	145.0					1																	10207055		2203	4300	6503	SO:0001583	missense	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2111G>A	1.37:g.10207055G>A	ENSP00000253251:p.Gly704Asp			Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.G833D	ENST00000253251.8	37	c.2498	CCDS110.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.485510	0.96323	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.42131	0.98;0.98;0.98	5.68	5.68	0.88126	Ubiquitin conjugation factor E4, core (1);	0.049384	0.85682	D	0.000000	T	0.66519	0.2797	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.994;0.993	T	0.62632	-0.6813	10	0.35671	T	0.21	-22.1202	19.8593	0.96777	0.0:0.0:1.0:0.0	.	704;833;704	A8K8S9;O95155;O95155-2	.;UBE4B_HUMAN;.	D	704;588;833	ENSP00000253251:G704D;ENSP00000366362:G588D;ENSP00000343001:G833D	ENSP00000253251:G704D	G	+	2	0	UBE4B	10129642	1.000000	0.71417	0.680000	0.29994	0.987000	0.75469	9.472000	0.97709	2.700000	0.92200	0.558000	0.71614	GGC	UBE4B	-	pfam_Ub_conjug_fac_E4_core	ENSG00000130939		0.547	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005017.1		0.00	48	0	G	NM_006048		10207055	+1			no_errors	ENST00000343090	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
UBN1	29855	genome.wustl.edu	37	16	4921228	4921228	+	Silent	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:4921228T>A	ENST00000396658.4	+	11	2335	c.1632T>A	c.(1630-1632)gcT>gcA	p.A544A	UBN1_ENST00000545171.1_Silent_p.A544A|UBN1_ENST00000590769.1_Silent_p.A544A|UBN1_ENST00000262376.6_Silent_p.A544A	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	544					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						AAGCCCAGGCTTGGGAGGACT	0.577																																																	0													144.0	132.0	136.0					16																	4921228		2197	4300	6497	SO:0001819	synonymous_variant	0			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1632T>A	16.37:g.4921228T>A			B7Z6D3|D3DUE8|Q13079|Q9P1P7	Silent	SNP	NULL	p.A544	ENST00000396658.4	37	c.1632	CCDS10525.1	16																																																																																			UBN1	-	NULL	ENSG00000118900		0.577	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBN1	HGNC	protein_coding	OTTHUMT00000251719.1	-	0.00	71	0	T	NM_016936		4921228	+1	tier1	-	no_errors	ENST00000262376	ensembl	human	known	74_37	silent	10.59	76	9	SNP	0.009	A
UBN1	29855	genome.wustl.edu	37	16	4924401	4924401	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:4924401G>C	ENST00000396658.4	+	14	2693	c.1990G>C	c.(1990-1992)Gac>Cac	p.D664H	UBN1_ENST00000545171.1_Missense_Mutation_p.D664H|UBN1_ENST00000590769.1_Missense_Mutation_p.D664H|UBN1_ENST00000262376.6_Missense_Mutation_p.D664H	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	664					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						ATTGGATGAAGACTTGATCCG	0.577																																																	0													106.0	104.0	104.0					16																	4924401		2197	4300	6497	SO:0001583	missense	0			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1990G>C	16.37:g.4924401G>C	ENSP00000379894:p.Asp664His		B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	NULL	p.D664H	ENST00000396658.4	37	c.1990	CCDS10525.1	16	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318830	0.60524	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.67865	0.34;-0.29;0.34	4.64	4.64	0.57946	.	0.074725	0.53938	D	0.000041	D	0.82393	0.5027	M	0.77103	2.36	0.36884	D	0.889569	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.87058	0.2151	10	0.87932	D	0	-14.7334	18.0643	0.89386	0.0:0.0:1.0:0.0	.	664;664	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	H	664	ENSP00000262376:D664H;ENSP00000442379:D664H;ENSP00000379894:D664H	ENSP00000262376:D664H	D	+	1	0	UBN1	4864402	1.000000	0.71417	0.914000	0.36105	0.658000	0.38924	6.888000	0.75622	2.575000	0.86900	0.561000	0.74099	GAC	UBN1	-	NULL	ENSG00000118900		0.577	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBN1	HGNC	protein_coding	OTTHUMT00000251719.1	-	0.00	81	0	G	NM_016936		4924401	+1	tier1	-	no_errors	ENST00000262376	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.994	C
UGCG	7357	genome.wustl.edu	37	9	114695254	114695254	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:114695254G>A	ENST00000374279.3	+	9	1612	c.1162G>A	c.(1162-1164)Gca>Aca	p.A388T	MIR4668_ENST00000582284.1_RNA	NM_003358.1	NP_003349.1	Q16739	CEGT_HUMAN	UDP-glucose ceramide glucosyltransferase	388					epidermis development (GO:0008544)|glucosylceramide biosynthetic process (GO:0006679)|glycosphingolipid biosynthetic process (GO:0006688)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ceramide glucosyltransferase activity (GO:0008120)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	12				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)	TGGGGGTACAGCAGAGGAAAT	0.353																																																	0													72.0	67.0	69.0					9																	114695254		2203	4300	6503	SO:0001583	missense	0			D50840	CCDS6782.1	9q31	2014-03-13			ENSG00000148154	ENSG00000148154	2.4.1.80	"""Glycosyltransferase family 2 domain containing"""	12524	protein-coding gene	gene with protein product	"""glucosylceramide synthase"", ""ceramide glucosyltransferase"""	602874				8643456, 9605861	Standard	NM_003358		Approved	GCS	uc004bft.3	Q16739	OTTHUMG00000020498	ENST00000374279.3:c.1162G>A	9.37:g.114695254G>A	ENSP00000363397:p.Ala388Thr		Q5T258	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.A388T	ENST00000374279.3	37	c.1162	CCDS6782.1	9	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354689	0.82243	.	.	ENSG00000148154	ENST00000374279	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.68604	0.3019	L	0.54323	1.7	0.80722	D	1	P	0.49961	0.93	P	0.49887	0.625	T	0.66650	-0.5870	9	0.40728	T	0.16	.	19.9595	0.97236	0.0:0.0:1.0:0.0	.	388	Q16739	CEGT_HUMAN	T	388	.	ENSP00000363397:A388T	A	+	1	0	UGCG	113735075	1.000000	0.71417	0.984000	0.44739	0.985000	0.73830	9.476000	0.97823	2.706000	0.92434	0.563000	0.77884	GCA	UGCG	-	NULL	ENSG00000148154		0.353	UGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGCG	HGNC	protein_coding	OTTHUMT00000053661.1	-	0.00	79	0	G	NM_003358		114695254	+1	tier1	-	no_errors	ENST00000374279	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	A
UROC1	131669	genome.wustl.edu	37	3	126224599	126224599	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:126224599C>T	ENST00000290868.2	-	8	811	c.758G>A	c.(757-759)aGt>aAt	p.S253N	UROC1_ENST00000383579.3_Missense_Mutation_p.S253N	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	253					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		CTGAGCCCCACTCATTCCGCC	0.632																																																	0													75.0	64.0	68.0					3																	126224599		2203	4300	6503	SO:0001583	missense	0			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.758G>A	3.37:g.126224599C>T	ENSP00000290868:p.Ser253Asn		E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	pfam_Urocanase,superfamily_Urocanase,pirsf_Urocanase	p.S253N	ENST00000290868.2	37	c.758	CCDS3038.1	3	.	.	.	.	.	.	.	.	.	.	c	27.5	4.837260	0.91117	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.51071	0.72;0.72	4.55	4.55	0.56014	Urocanase domain (2);	0.000000	0.85682	D	0.000000	T	0.78013	0.4217	H	0.95917	3.74	0.54753	D	0.999982	D;D	0.89917	0.991;1.0	D;D	0.97110	0.988;1.0	D	0.85708	0.1317	10	0.87932	D	0	-13.922	14.7982	0.69894	0.0:1.0:0.0:0.0	.	253;253	E9PE13;Q96N76	.;HUTU_HUMAN	N	253	ENSP00000290868:S253N;ENSP00000373073:S253N	ENSP00000290868:S253N	S	-	2	0	UROC1	127707289	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.001000	0.76297	2.070000	0.61991	0.574000	0.79327	AGT	UROC1	-	pfam_Urocanase,superfamily_Urocanase,pirsf_Urocanase	ENSG00000159650		0.632	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROC1	HGNC	protein_coding	OTTHUMT00000370325.2	-	0.00	115	0	C	NM_144639		126224599	-1	tier1	-	no_errors	ENST00000290868	ensembl	human	known	74_37	missense	8.74	94	9	SNP	1.000	T
USP34	9736	genome.wustl.edu	37	2	61577455	61577455	+	Missense_Mutation	SNP	A	A	T	rs371931763		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:61577455A>T	ENST00000398571.2	-	12	1523	c.1447T>A	c.(1447-1449)Tct>Act	p.S483T		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	483					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CTCTGTTTAGATAACTGAGCC	0.333																																																	0													100.0	93.0	95.0					2																	61577455		1832	4084	5916	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.1447T>A	2.37:g.61577455A>T	ENSP00000381577:p.Ser483Thr		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,pfscan_Peptidase_C19/C67	p.S483T	ENST00000398571.2	37	c.1447	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	A	28.5	4.927177	0.92389	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.03920	3.76	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.11495	0.0280	L	0.38531	1.155	0.58432	D	0.999999	P	0.49447	0.924	P	0.60682	0.878	T	0.38607	-0.9653	10	0.15499	T	0.54	.	15.9917	0.80211	1.0:0.0:0.0:0.0	.	483	Q70CQ2	UBP34_HUMAN	T	331;331;483	ENSP00000381577:S483T	ENSP00000263989:S331T	S	-	1	0	USP34	61430959	1.000000	0.71417	0.921000	0.36526	0.990000	0.78478	9.287000	0.95975	2.222000	0.72286	0.533000	0.62120	TCT	USP34	-	NULL	ENSG00000115464		0.333	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4		0.00	73	0	A			61577455	-1			no_errors	ENST00000398571	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.999	T
VCAM1	7412	genome.wustl.edu	37	1	101186144	101186144	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:101186144G>C	ENST00000294728.2	+	2	278	c.177G>C	c.(175-177)tgG>tgC	p.W59C	VCAM1_ENST00000347652.2_Missense_Mutation_p.W59C|VCAM1_ENST00000370119.4_Intron|VCAM1_ENST00000370115.1_Missense_Mutation_p.W59C	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	59	Ig-like C2-type 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	TTTTCTCTTGGAGAACCCAGA	0.473																																																	0													79.0	73.0	75.0					1																	101186144		2203	4300	6503	SO:0001583	missense	0			M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.177G>C	1.37:g.101186144G>C	ENSP00000294728:p.Trp59Cys		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom,prints_VCAM-1,prints_ICAM_VCAM_N	p.W59C	ENST00000294728.2	37	c.177	CCDS773.1	1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529336	0.64860	.	.	ENSG00000162692	ENST00000347652;ENST00000294728;ENST00000370115	D;D;D	0.96300	-3.97;-3.97;-3.97	5.82	5.82	0.92795	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.051491	0.85682	D	0.000000	D	0.98510	0.9503	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	D	0.99072	1.0834	9	.	.	.	-9.3404	17.8974	0.88892	0.0:0.0:1.0:0.0	.	59;59	P19320-2;P19320	.;VCAM1_HUMAN	C	59	ENSP00000304611:W59C;ENSP00000294728:W59C;ENSP00000359133:W59C	.	W	+	3	0	VCAM1	100958732	1.000000	0.71417	0.999000	0.59377	0.671000	0.39405	6.266000	0.72540	2.745000	0.94114	0.655000	0.94253	TGG	VCAM1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000162692		0.473	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCAM1	HGNC	protein_coding	OTTHUMT00000030213.1	-	0.00	51	0	G	NM_001078		101186144	+1	tier1	-	no_errors	ENST00000294728	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	C
VCP	7415	genome.wustl.edu	37	9	35060315	35060315	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:35060315C>T	ENST00000358901.6	-	13	2585	c.1690G>A	c.(1690-1692)Gac>Aac	p.D564N		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	564					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CTCACCTTGTCAAAGATTTCT	0.448																																																	0													49.0	46.0	47.0					9																	35060315		2203	4300	6503	SO:0001583	missense	0			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1690G>A	9.37:g.35060315C>T	ENSP00000351777:p.Asp564Asn		B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	p.D564N	ENST00000358901.6	37	c.1690	CCDS6573.1	9	.	.	.	.	.	.	.	.	.	.	C	33	5.193453	0.94960	.	.	ENSG00000165280	ENST00000358901	D	0.92911	-3.13	5.85	5.85	0.93711	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.89880	0.6843	N	0.20685	0.6	0.80722	D	1	B	0.28439	0.212	B	0.39217	0.294	D	0.87188	0.2232	10	0.56958	D	0.05	-30.5691	20.1577	0.98120	0.0:1.0:0.0:0.0	.	564	P55072	TERA_HUMAN	N	564	ENSP00000351777:D564N	ENSP00000351777:D564N	D	-	1	0	VCP	35050315	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.767000	0.95098	0.655000	0.94253	GAC	VCP	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	ENSG00000165280		0.448	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	HGNC	protein_coding	OTTHUMT00000052290.1		0.00	47	0	C	NM_007126		35060315	-1			no_errors	ENST00000358901	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
VDAC1	7416	genome.wustl.edu	37	5	133316708	133316709	+	Intron	DEL	TT	TT	-	rs76032174|rs76341281		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr5:133316708_133316709delTT	ENST00000265333.3	-	6	568				VDAC1_ENST00000395044.3_Intron|VDAC1_ENST00000395047.2_Intron	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1						anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GCAAGTTGTCTTTTTTTTTTTT	0.416																																					NSCLC(127;1776 1806 35523 41489 48154)												0																																										SO:0001627	intron_variant	0				CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.324-61AA>-	5.37:g.133316718_133316719delTT			B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	RNA	DEL	-	NULL	ENST00000265333.3	37	NULL	CCDS4168.1	5																																																																																			VDAC1	-	-	ENSG00000213585		0.416	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VDAC1	HGNC	protein_coding	OTTHUMT00000259208.1		0.00	22	0	TT			133316709	-1	tier1		no_errors	ENST00000492324	ensembl	human	known	74_37	rna	11.76	15	2	DEL	0.001:0.000	-
VPS4A	27183	genome.wustl.edu	37	16	69352763	69352763	+	Silent	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:69352763C>T	ENST00000254950.11	+	5	537	c.381C>T	c.(379-381)aaC>aaT	p.N127N	COG8_ENST00000564419.1_5'Flank|RP11-343C2.11_ENST00000570054.2_Silent_p.N151N	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				TACGGTGGAACGACGTGGCCG	0.627																																																	0													115.0	128.0	124.0					16																	69352763		1912	4129	6041	SO:0001819	synonymous_variant	0			AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.381C>T	16.37:g.69352763C>T				Silent	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.N127	ENST00000254950.11	37	c.381	CCDS45517.1	16																																																																																			VPS4A	-	superfamily_P-loop_NTPase	ENSG00000132612		0.627	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	HGNC	protein_coding	OTTHUMT00000430563.3	-	0.00	62	0	C	NM_013245		69352763	+1	tier1	-	no_errors	ENST00000254950	ensembl	human	known	74_37	silent	20.34	47	12	SNP	1.000	T
VPS4B	9525	genome.wustl.edu	37	18	61070965	61070965	+	Silent	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr18:61070965A>G	ENST00000238497.5	-	5	662	c.459T>C	c.(457-459)ccT>ccC	p.P153P	VPS4B_ENST00000591383.1_5'UTR	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	153					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						GAAATTTAATAGGCAGTATCA	0.368																																																	0													76.0	71.0	73.0					18																	61070965		2203	4300	6503	SO:0001819	synonymous_variant	0			AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.459T>C	18.37:g.61070965A>G			Q69HW4|Q9GZS7	Silent	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.P153	ENST00000238497.5	37	c.459	CCDS11983.1	18																																																																																			VPS4B	-	superfamily_P-loop_NTPase	ENSG00000119541		0.368	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4B	HGNC	protein_coding	OTTHUMT00000256198.2	-	0.00	97	0	A	NM_004869		61070965	-1	tier1	-	no_errors	ENST00000238497	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.642	G
WDR33	55339	genome.wustl.edu	37	2	128477915	128477915	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:128477915C>G	ENST00000322313.4	-	16	1842	c.1684G>C	c.(1684-1686)Gaa>Caa	p.E562Q		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	562					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		GCAAGTCTTTCAATTTTAAGT	0.443																																																	0													66.0	78.0	74.0					2																	128477915		2200	4291	6491	SO:0001583	missense	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.1684G>C	2.37:g.128477915C>G	ENSP00000325377:p.Glu562Gln		Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Collagen,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E562Q	ENST00000322313.4	37	c.1684	CCDS2150.1	2	.	.	.	.	.	.	.	.	.	.	C	17.39	3.378089	0.61735	.	.	ENSG00000136709	ENST00000322313	D	0.90676	-2.71	5.29	5.29	0.74685	.	0.058326	0.64402	D	0.000002	D	0.88070	0.6338	L	0.29908	0.895	0.80722	D	1	D	0.58268	0.982	P	0.46825	0.528	D	0.87198	0.2239	10	0.32370	T	0.25	-17.2682	18.9222	0.92529	0.0:1.0:0.0:0.0	.	562	Q9C0J8	WDR33_HUMAN	Q	562	ENSP00000325377:E562Q	ENSP00000325377:E562Q	E	-	1	0	WDR33	128194385	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.611000	0.67674	2.452000	0.82932	0.585000	0.79938	GAA	WDR33	-	NULL	ENSG00000136709		0.443	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2		0.00	26	0	C	NM_018383		128477915	-1			no_errors	ENST00000322313	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	G
WNK1	65125	genome.wustl.edu	37	12	922899	922899	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr12:922899A>G	ENST00000315939.6	+	2	1494	c.851A>G	c.(850-852)tAt>tGt	p.Y284C	WNK1_ENST00000447667.2_Missense_Mutation_p.Y284C|WNK1_ENST00000535572.1_Missense_Mutation_p.Y284C|WNK1_ENST00000537687.1_Missense_Mutation_p.Y284C|WNK1_ENST00000530271.2_Missense_Mutation_p.Y284C	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	284	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GTTAGATTTTATGATTCCTGG	0.348																																					Colon(19;451 567 6672 12618 28860)												0													103.0	98.0	100.0					12																	922899		2203	4300	6503	SO:0001583	missense	0			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.851A>G	12.37:g.922899A>G	ENSP00000313059:p.Tyr284Cys		A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Y284C	ENST00000315939.6	37	c.851	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	A	25.0	4.592269	0.86953	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000447667;ENST00000530271	T;T;T;T;T	0.67345	1.64;1.64;1.64;-0.26;1.64	5.83	5.83	0.93111	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000016	T	0.81365	0.4807	M	0.73217	2.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.91635	0.999;0.999;0.995	D	0.83427	0.0036	10	0.87932	D	0	-10.0738	16.1995	0.82060	1.0:0.0:0.0:0.0	.	284;284;284	F5GWT4;Q9H4A3;F6UYG0	.;WNK1_HUMAN;.	C	284	ENSP00000441972:Y284C;ENSP00000313059:Y284C;ENSP00000444465:Y284C;ENSP00000392542:Y284C;ENSP00000433548:Y284C	ENSP00000313059:Y284C	Y	+	2	0	WNK1	793160	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.287000	0.95975	2.220000	0.72140	0.459000	0.35465	TAT	WNK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000060237		0.348	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1		0.00	45	0	A	NM_018979		922899	+1			no_errors	ENST00000530271	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	G
XRCC5	7520	genome.wustl.edu	37	2	217012834	217012834	+	Missense_Mutation	SNP	G	G	T	rs548351594		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr2:217012834G>T	ENST00000392133.3	+	16	1966	c.1505G>T	c.(1504-1506)cGg>cTg	p.R502L	XRCC5_ENST00000392132.2_Missense_Mutation_p.R502L			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	502	Pro-rich.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		TTACATCCCCGGGAGCCTCTA	0.423								Non-homologous end-joining																																									0													100.0	100.0	100.0					2																	217012834		2203	4300	6503	SO:0001583	missense	0			AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.1505G>T	2.37:g.217012834G>T	ENSP00000375978:p.Arg502Leu		A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	pfam_Ku_N,pfam_Ku_PK_bind,pfam_Ku70/Ku80_beta-barrel_dom,pfam_Ku_C,superfamily_SPOC_like_C_dom,superfamily_Ku_PK_bind,smart_VWF_A,smart_Ku70/Ku80_beta-barrel_dom	p.R502L	ENST00000392133.3	37	c.1505	CCDS2402.1	2	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129688	0.37630	.	.	ENSG00000079246	ENST00000392133;ENST00000392132	T;T	0.30182	1.54;1.54	5.81	1.93	0.25924	Spen Paralogue and Orthologue SPOC, C-terminal-like (1);Ku70/Ku80 C-terminal arm (2);	0.536654	0.21329	N	0.076324	T	0.13798	0.0334	N	0.08118	0	0.23795	N	0.996823	B	0.06786	0.001	B	0.04013	0.001	T	0.17167	-1.0378	10	0.44086	T	0.13	.	6.4039	0.21654	0.5056:0.0:0.4944:0.0	.	502	P13010	XRCC5_HUMAN	L	502	ENSP00000375978:R502L;ENSP00000375977:R502L	ENSP00000375977:R502L	R	+	2	0	XRCC5	216721079	0.878000	0.30173	0.999000	0.59377	0.991000	0.79684	0.560000	0.23500	0.382000	0.24878	-0.302000	0.09304	CGG	XRCC5	-	pfam_Ku_C,superfamily_SPOC_like_C_dom	ENSG00000079246		0.423	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC5	HGNC	protein_coding	OTTHUMT00000256675.3	-	0.00	69	0	G	NM_021141		217012834	+1	tier1	-	no_errors	ENST00000392132	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.995	T
YEATS2	55689	genome.wustl.edu	37	3	183439839	183439839	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr3:183439839C>G	ENST00000305135.5	+	5	647	c.452C>G	c.(451-453)tCt>tGt	p.S151C		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	151					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GACTTCTTATCTGACAAAGAT	0.408																																																	0													115.0	106.0	109.0					3																	183439839		1912	4136	6048	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.452C>G	3.37:g.183439839C>G	ENSP00000306983:p.Ser151Cys		A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.S151C	ENST00000305135.5	37	c.452	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	C	17.63	3.437619	0.62955	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.54479	0.57	5.69	5.69	0.88448	.	0.456893	0.20679	N	0.087699	T	0.51432	0.1674	L	0.47716	1.5	0.27956	N	0.936958	D	0.54601	0.967	P	0.46718	0.525	T	0.55866	-0.8073	10	0.72032	D	0.01	-11.0762	11.7239	0.51698	0.0:0.9127:0.0:0.0873	.	151	Q9ULM3	YETS2_HUMAN	C	151	ENSP00000306983:S151C	ENSP00000306983:S151C	S	+	2	0	YEATS2	184922533	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.189000	0.42621	2.702000	0.92279	0.591000	0.81541	TCT	YEATS2	-	NULL	ENSG00000163872		0.408	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	-	0.00	52	0	C	NM_018023		183439839	+1	tier1	-	no_errors	ENST00000305135	ensembl	human	known	74_37	missense	17.33	61	13	SNP	1.000	G
ZEB1	6935	genome.wustl.edu	37	10	31809133	31809133	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr10:31809133G>C	ENST00000320985.10	+	7	980	c.870G>C	c.(868-870)aaG>aaC	p.K290N	ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Missense_Mutation_p.K223N|ZEB1_ENST00000361642.5_Missense_Mutation_p.K291N|ZEB1_ENST00000446923.2_Missense_Mutation_p.K274N|ZEB1_ENST00000560721.2_Missense_Mutation_p.K270N			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	290					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				TAAGCAGTAAGAAATGTATCA	0.443																																					Ovarian(40;423 959 14296 36701 49589)												0													93.0	90.0	91.0					10																	31809133		2203	4300	6503	SO:0001583	missense	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.870G>C	10.37:g.31809133G>C	ENSP00000319248:p.Lys290Asn		B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.K291N	ENST00000320985.10	37	c.873	CCDS7169.1	10	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543318	0.65198	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.16324	2.65;2.35;2.42;2.35;2.41	5.62	4.68	0.58851	.	0.000000	0.64402	D	0.000004	T	0.38825	0.1055	M	0.64404	1.975	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;0.999;1.0;0.999;0.999	D;D;D;D;D;D;D;D	0.87578	0.994;0.998;0.994;0.995;0.995;0.992;0.995;0.995	T	0.19811	-1.0294	10	0.72032	D	0.01	-21.9797	13.5529	0.61743	0.0793:0.0:0.9207:0.0	.	223;290;274;290;290;270;291;290	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	N	72;290;291;290;223;290;270;149;181;274	ENSP00000444282:K72N;ENSP00000354487:K291N;ENSP00000444891:K223N;ENSP00000319248:K290N;ENSP00000391612:K274N	ENSP00000319248:K290N	K	+	3	2	ZEB1	31849139	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.134000	0.57990	1.282000	0.44496	-0.345000	0.07892	AAG	ZEB1	-	NULL	ENSG00000148516		0.443	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	HGNC	protein_coding	OTTHUMT00000419083.2		0.00	53	0	G	NM_030751		31809133	+1			no_errors	ENST00000361642	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	C
ZFHX4	79776	genome.wustl.edu	37	8	77765301	77765301	+	Silent	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr8:77765301T>A	ENST00000521891.2	+	10	6592	c.6144T>A	c.(6142-6144)ccT>ccA	p.P2048P	ZFHX4_ENST00000050961.6_Silent_p.P2003P|ZFHX4_ENST00000455469.2_Silent_p.P2003P|ZFHX4_ENST00000518282.1_Silent_p.P2022P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2003	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			caccaccacctcctcctcctc	0.597										HNSCC(33;0.089)																																							0																																										SO:0001819	synonymous_variant	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6144T>A	8.37:g.77765301T>A			G3V138|Q18PS0|Q6ZN20	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.P2048	ENST00000521891.2	37	c.6144	CCDS47878.2	8																																																																																			ZFHX4	-	NULL	ENSG00000091656		0.597	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	14	0	T	NM_024721		77765301	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	silent	26.67	7	4	SNP	0.617	A
ZFYVE26	23503	genome.wustl.edu	37	14	68228958	68228958	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr14:68228958C>A	ENST00000347230.4	-	34	6469	c.6331G>T	c.(6331-6333)Gag>Tag	p.E2111*	ZFYVE26_ENST00000555452.1_Nonsense_Mutation_p.E2111*|ZFYVE26_ENST00000557306.1_5'Flank	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2111					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.E2111Q(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCTAGGTACTCAACCACATCC	0.542																																																	1	Substitution - Missense(1)	lung(1)											104.0	85.0	91.0					14																	68228958		2203	4300	6503	SO:0001587	stop_gained	0			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.6331G>T	14.37:g.68228958C>A	ENSP00000251119:p.Glu2111*		B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Nonsense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.E2111*	ENST00000347230.4	37	c.6331	CCDS9788.1	14	.	.	.	.	.	.	.	.	.	.	C	47	13.563725	0.99750	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	.	.	.	5.36	5.36	0.76844	.	0.188984	0.46758	D	0.000265	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-11.7035	13.7087	0.62654	0.0:0.7183:0.2817:0.0	.	.	.	.	X	2111;2090;2111	.	ENSP00000251119:E2111X	E	-	1	0	ZFYVE26	67298711	1.000000	0.71417	0.992000	0.48379	0.799000	0.45148	5.759000	0.68785	2.515000	0.84797	0.655000	0.94253	GAG	ZFYVE26	-	NULL	ENSG00000072121		0.542	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	HGNC	protein_coding	OTTHUMT00000412736.2		0.00	50	0	C	NM_015346		68228958	-1			no_errors	ENST00000347230	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	0.996	A
ZIK1	284307	genome.wustl.edu	37	19	58099931	58099931	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:58099931G>A	ENST00000597850.1	+	3	312	c.97G>A	c.(97-99)Gcc>Acc	p.A33T	ZIK1_ENST00000307468.4_Intron|ZIK1_ENST00000599456.1_5'UTR|ZIK1_ENST00000536878.2_Missense_Mutation_p.A20T|ZIK1_ENST00000598726.1_3'UTR	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	33	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A33T(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGAGGACATCGCCATTTACTT	0.522																																																	1	Substitution - Missense(1)	endometrium(1)											271.0	211.0	231.0					19																	58099931		2203	4300	6503	SO:0001583	missense	0			AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.97G>A	19.37:g.58099931G>A	ENSP00000472867:p.Ala33Thr		O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A33T	ENST00000597850.1	37	c.97	CCDS33135.1	19	.	.	.	.	.	.	.	.	.	.	g	16.93	3.256760	0.59321	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.03065	4.06	3.3	2.25	0.28309	Krueppel-associated box (4);	.	.	.	.	T	0.11965	0.0291	M	0.64567	1.98	0.27912	N	0.938562	D;D	0.89917	0.968;1.0	P;D	0.91635	0.447;0.999	T	0.08680	-1.0710	9	0.56958	D	0.05	.	5.188	0.15195	0.1144:0.0:0.683:0.2026	.	20;33	F5H435;Q3SY52	.;ZIK1_HUMAN	T	20;14;33	ENSP00000438487:A20T	ENSP00000303820:A33T	A	+	1	0	ZIK1	62791743	0.947000	0.32204	0.578000	0.28575	0.972000	0.66771	0.677000	0.25262	0.713000	0.32060	0.442000	0.29010	GCC	ZIK1	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000171649		0.522	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZIK1	HGNC	protein_coding	OTTHUMT00000466791.1	-	0.00	107	0	G	NM_001010879		58099931	+1	tier1	-	no_errors	ENST00000597850	ensembl	human	known	74_37	missense	31.25	66	30	SNP	0.985	A
ZNF189	7743	genome.wustl.edu	37	9	104170480	104170480	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr9:104170480G>T	ENST00000339664.2	+	3	559	c.430G>T	c.(430-432)Gaa>Taa	p.E144*	ZNF189_ENST00000374861.3_Nonsense_Mutation_p.E130*|ZNF189_ENST00000259395.4_Nonsense_Mutation_p.E102*	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	144					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				ACCAAACTCAGAAGAGAAATG	0.408																																																	0													68.0	66.0	67.0					9																	104170480		2203	4300	6503	SO:0001587	stop_gained	0			AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.430G>T	9.37:g.104170480G>T	ENSP00000342019:p.Glu144*		O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E144*	ENST00000339664.2	37	c.430	CCDS6754.1	9	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803829	0.90623	.	.	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	.	.	.	4.66	4.66	0.58398	.	0.000000	0.50627	D	0.000113	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	15.8687	0.79091	0.0:0.0:1.0:0.0	.	.	.	.	X	130;144;102	.	ENSP00000259395:E102X	E	+	1	0	ZNF189	103210301	0.825000	0.29262	1.000000	0.80357	0.971000	0.66376	0.923000	0.28757	2.873000	0.98535	0.563000	0.77884	GAA	ZNF189	-	NULL	ENSG00000136870		0.408	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF189	HGNC	protein_coding	OTTHUMT00000053447.1	-	0.00	51	0	G	NM_003452		104170480	+1	tier1	-	no_errors	ENST00000339664	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	1.000	T
ZNF200	7752	genome.wustl.edu	37	16	3274107	3274107	+	Missense_Mutation	SNP	G	G	A	rs149479712		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr16:3274107G>A	ENST00000431561.3	-	5	1585	c.973C>T	c.(973-975)Cgt>Tgt	p.R325C	AJ003147.9_ENST00000576468.1_RNA|ZNF200_ENST00000396871.4_Missense_Mutation_p.R324C|ZNF200_ENST00000414144.2_Missense_Mutation_p.R325C|ZNF200_ENST00000396870.4_Missense_Mutation_p.R324C|ZNF200_ENST00000396868.3_Missense_Mutation_p.R324C|ZNF200_ENST00000575948.1_Missense_Mutation_p.R324C	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	325					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						CCTTCATGACGACTCCGATGA	0.398																																																	0								G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4394		0,0,2197	121.0	123.0	122.0		970,970,970,973,970,973	4.3	1.0	16	dbSNP_134	122	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense,missense,missense	ZNF200	NM_001145446.1,NM_001145447.1,NM_001145448.1,NM_003454.3,NM_198087.2,NM_198088.2	180,180,180,180,180,180	0,2,6495	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	324/395,324/395,324/395,325/396,324/395,325/396	3274107	2,12992	2197	4300	6497	SO:0001583	missense	0			AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.973C>T	16.37:g.3274107G>A	ENSP00000395723:p.Arg325Cys		D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R325C	ENST00000431561.3	37	c.973	CCDS10497.1	16	.	.	.	.	.	.	.	.	.	.	G	16.29	3.080811	0.55753	0.0	2.33E-4	ENSG00000010539	ENST00000396870;ENST00000396868;ENST00000396871;ENST00000414144;ENST00000431561	T;T;T	0.02472	4.28;4.28;4.28	5.31	4.33	0.51752	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42548	D	0.000681	T	0.12263	0.0298	M	0.73372	2.23	0.32961	D	0.52102	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.959;0.959;0.989	T	0.04621	-1.0938	10	0.54805	T	0.06	-15.4539	10.8842	0.46957	0.0:0.0:0.8125:0.1875	.	324;325;324	D3DUB7;P98182;P98182-2	.;ZN200_HUMAN;.	C	325;324;324;324;325	ENSP00000380077:R324C;ENSP00000380080:R324C;ENSP00000395723:R325C	ENSP00000380077:R324C	R	-	1	0	ZNF200	3214108	0.000000	0.05858	1.000000	0.80357	0.988000	0.76386	-1.088000	0.03379	1.408000	0.46895	0.557000	0.71058	CGT	ZNF200	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000010539		0.398	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF200	HGNC	protein_coding	OTTHUMT00000437545.1		0.00	30	0	G			3274107	-1			no_errors	ENST00000414144	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.992	A
ZNF320	162967	genome.wustl.edu	37	19	53384421	53384421	+	Missense_Mutation	SNP	G	G	T	rs544563388		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:53384421G>T	ENST00000595635.1	-	8	1459	c.958C>A	c.(958-960)Cgt>Agt	p.R320S	ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.R320S|ZNF320_ENST00000597909.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TGAACTCTACGATGTCCTGCA	0.413																																																	0													101.0	93.0	96.0					19																	53384421		2203	4300	6503	SO:0001583	missense	0			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.958C>A	19.37:g.53384421G>T	ENSP00000473091:p.Arg320Ser		Q8NDR6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R320S	ENST00000595635.1	37	c.958	CCDS33095.1	19	.	.	.	.	.	.	.	.	.	.	-	9.120	1.008654	0.19199	.	.	ENSG00000182986	ENST00000391781	T	0.17691	2.26	1.74	1.74	0.24563	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17789	0.0427	L	0.37630	1.12	0.18873	N	0.999987	P	0.41345	0.746	P	0.47528	0.549	T	0.13710	-1.0499	9	0.72032	D	0.01	.	5.5468	0.17069	0.1814:0.0:0.8186:0.0	.	320	A2RRD8	ZN320_HUMAN	S	320	ENSP00000375660:R320S	ENSP00000375660:R320S	R	-	1	0	ZNF320	58076233	0.000000	0.05858	0.005000	0.12908	0.390000	0.30446	0.044000	0.13992	0.955000	0.37878	0.184000	0.17185	CGT	ZNF320	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182986		0.413	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF320	HGNC	protein_coding	OTTHUMT00000463771.1		0.00	64	0	G	NM_207333		53384421	-1			no_errors	ENST00000391781	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.515	T
ZNF396	252884	genome.wustl.edu	37	18	32953438	32953438	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr18:32953438G>T	ENST00000589332.1	-	3	675	c.544C>A	c.(544-546)Cag>Aag	p.Q182K	ZNF396_ENST00000306346.1_Missense_Mutation_p.Q182K|ZNF396_ENST00000586687.1_Missense_Mutation_p.Q182K			Q96N95	ZN396_HUMAN	zinc finger protein 396	182					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	7						CTTAAGGACTGAAGCTCCCAT	0.522																																																	0													109.0	99.0	102.0					18																	32953438		2203	4300	6503	SO:0001583	missense	0			AK055775	CCDS11913.1	18p12	2013-01-09			ENSG00000186496	ENSG00000186496		"""-"", ""Zinc fingers, C2H2-type"""	18824	protein-coding gene	gene with protein product		609600					Standard	NM_145756		Approved	ZSCAN14, FLJ31213	uc010xcf.1	Q96N95	OTTHUMG00000132562	ENST00000589332.1:c.544C>A	18.37:g.32953438G>T	ENSP00000466500:p.Gln182Lys		A1L3V0|Q8NF98|Q8TD80	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q182K	ENST00000589332.1	37	c.544		18	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279165	0.23307	.	.	ENSG00000186496	ENST00000306346;ENST00000399057	T	0.06933	3.24	4.67	2.89	0.33648	.	1.553920	0.04687	U	0.413432	T	0.06600	0.0169	N	0.24115	0.695	0.09310	N	1	B	0.32160	0.358	B	0.27500	0.08	T	0.39440	-0.9614	10	0.28530	T	0.3	.	7.3645	0.26766	0.1999:0.0:0.8001:0.0	.	182	Q96N95-3	.	K	182	ENSP00000302310:Q182K	ENSP00000302310:Q182K	Q	-	1	0	ZNF396	31207436	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.522000	0.22909	0.708000	0.31955	-0.258000	0.10820	CAG	ZNF396	-	NULL	ENSG00000186496		0.522	ZNF396-002	KNOWN	basic|appris_principal	protein_coding	ZNF396	HGNC	protein_coding	OTTHUMT00000255766.1	-	0.00	70	0	G	NM_145756		32953438	-1	tier1	-	no_errors	ENST00000589332	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.002	T
ZNF506	440515	genome.wustl.edu	37	19	19906097	19906097	+	Missense_Mutation	SNP	C	C	T	rs369665225		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:19906097C>T	ENST00000540806.2	-	4	687	c.599G>A	c.(598-600)cGc>cAc	p.R200H	ZNF506_ENST00000587461.1_Intron|ZNF506_ENST00000450683.2_Missense_Mutation_p.R168H|CTC-559E9.4_ENST00000590274.1_lincRNA|CTC-559E9.6_ENST00000591884.1_RNA|CTC-559E9.6_ENST00000589657.1_RNA|ZNF506_ENST00000443905.2_Missense_Mutation_p.R200H			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R200H(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						ACATTTATAGCGTTTCTCTCC	0.338																																																	1	Substitution - Missense(1)	large_intestine(1)											53.0	58.0	56.0					19																	19906097		2161	4279	6440	SO:0001583	missense	0			AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.599G>A	19.37:g.19906097C>T	ENSP00000440625:p.Arg200His		B3KTH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R200H	ENST00000540806.2	37	c.599	CCDS42531.1	19	.	.	.	.	.	.	.	.	.	.	g	13.84	2.358024	0.41801	.	.	ENSG00000081665	ENST00000443905;ENST00000540806;ENST00000450683	T;T;T	0.07567	3.18;3.18;3.18	0.974	-1.95	0.07548	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05777	0.0151	N	0.12182	0.205	0.27189	N	0.960457	P;D	0.63046	0.927;0.992	B;P	0.47864	0.091;0.559	T	0.33163	-0.9879	9	0.56958	D	0.05	.	6.5027	0.22178	0.0:0.3128:0.6872:0.0	.	200;168	Q5JVG8;Q5JVG8-2	ZN506_HUMAN;.	H	200;200;168	ENSP00000393835:R200H;ENSP00000440625:R200H;ENSP00000408892:R168H	ENSP00000393835:R200H	R	-	2	0	ZNF506	19767097	0.024000	0.19004	0.142000	0.22268	0.121000	0.20230	0.515000	0.22801	-0.705000	0.05035	-0.717000	0.03617	CGC	ZNF506	-	NULL	ENSG00000081665		0.338	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	ZNF506	HGNC	protein_coding	OTTHUMT00000460794.1	-	0.00	54	0	C	XM_036218		19906097	-1	tier1	-	no_errors	ENST00000443905	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.984	T
ZNF518B	85460	genome.wustl.edu	37	4	10445192	10445192	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr4:10445192T>A	ENST00000326756.3	-	3	3199	c.2761A>T	c.(2761-2763)Agg>Tgg	p.R921W		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	921					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						CTTAGTTGCCTTGCAACCTGA	0.438																																																	0													109.0	106.0	107.0					4																	10445192		2203	4300	6503	SO:0001583	missense	0			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2761A>T	4.37:g.10445192T>A	ENSP00000317614:p.Arg921Trp		Q96LN8	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R921W	ENST00000326756.3	37	c.2761	CCDS33960.1	4	.	.	.	.	.	.	.	.	.	.	T	20.8	4.047513	0.75846	.	.	ENSG00000178163	ENST00000326756	T	0.03745	3.82	6.01	3.52	0.40303	.	0.054173	0.64402	D	0.000001	T	0.13415	0.0325	L	0.60455	1.87	0.44745	D	0.99774	D	0.89917	1.0	D	0.85130	0.997	T	0.00118	-1.2034	10	0.87932	D	0	-31.0755	11.2015	0.48743	0.0:0.0:0.3223:0.6777	.	921	Q9C0D4	Z518B_HUMAN	W	921	ENSP00000317614:R921W	ENSP00000317614:R921W	R	-	1	2	ZNF518B	10054290	1.000000	0.71417	0.106000	0.21319	0.953000	0.61014	1.886000	0.39688	0.480000	0.27534	0.528000	0.53228	AGG	ZNF518B	-	NULL	ENSG00000178163		0.438	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1	-	0.00	31	0	T	NM_053042		10445192	-1	tier1	-	no_errors	ENST00000326756	ensembl	human	known	74_37	missense	36.11	23	13	SNP	0.992	A
ZNF556	80032	genome.wustl.edu	37	19	2878078	2878078	+	Silent	SNP	G	G	A	rs371373885		TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:2878078G>A	ENST00000307635.2	+	4	1209	c.1122G>A	c.(1120-1122)acG>acA	p.T374T	ZNF556_ENST00000586426.1_Silent_p.T373T	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AATGTGAAACGTGTGGGAAAA	0.488																																																	0													80.0	74.0	76.0					19																	2878078		2203	4300	6503	SO:0001819	synonymous_variant	0			BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.1122G>A	19.37:g.2878078G>A			Q96GM3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T374	ENST00000307635.2	37	c.1122	CCDS12097.1	19																																																																																			ZNF556	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000172000		0.488	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF556	HGNC	protein_coding	OTTHUMT00000451638.2	-	0.00	67	0	G	NM_024967		2878078	+1	tier1	-	no_errors	ENST00000307635	ensembl	human	known	74_37	silent	9.38	58	6	SNP	0.007	A
ZNF683	257101	genome.wustl.edu	37	1	26688515	26688515	+	Splice_Site	SNP	T	T	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:26688515T>C	ENST00000436292.1	-	7	1324		c.e7-2		ZNF683_ENST00000374204.1_Splice_Site|ZNF683_ENST00000403843.1_Splice_Site|ZNF683_ENST00000349618.3_Splice_Site			Q8IZ20	ZN683_HUMAN	zinc finger protein 683						natural killer cell differentiation (GO:0001779)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	15		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		GTGGCACACCTGACGGGAACG	0.607																																																	0													106.0	89.0	95.0					1																	26688515		2203	4300	6503	SO:0001630	splice_region_variant	0			BC029505	CCDS279.2	1p36.11	2013-01-08			ENSG00000176083	ENSG00000176083		"""Zinc fingers, C2H2-type"""	28495	protein-coding gene	gene with protein product	"""hypothetical protein MGC33414"""					12477932	Standard	NM_173574		Approved	MGC33414	uc009vsj.1	Q8IZ20	OTTHUMG00000003521	ENST00000436292.1:c.1204-2A>G	1.37:g.26688515T>C			Q5T141|Q5T146|Q5T147|Q5T149|Q8NEN4	Splice_Site	SNP	-	e6-2	ENST00000436292.1	37	c.1204-2		1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.416679	0.42918	.	.	ENSG00000176083	ENST00000403843;ENST00000436292;ENST00000374204;ENST00000349618	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1145	0.53858	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF683	26561102	1.000000	0.71417	0.994000	0.49952	0.295000	0.27426	7.416000	0.80143	2.021000	0.59480	0.459000	0.35465	.	ZNF683	-	-	ENSG00000176083		0.607	ZNF683-202	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF683	HGNC	protein_coding	OTTHUMT00000009794.2	-	0.00	44	0	T	NM_173574	Intron	26688515	-1	tier1	-	no_errors	ENST00000403843	ensembl	human	known	74_37	splice_site	10.81	33	4	SNP	1.000	C
ZNF799	90576	genome.wustl.edu	37	19	12501412	12501412	+	Silent	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:12501412G>C	ENST00000430385.3	-	4	2000	c.1800C>G	c.(1798-1800)ctC>ctG	p.L600L	ZNF799_ENST00000419318.1_Silent_p.L568L|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	600					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GCAAGGAACTGAGAGAAGCAA	0.413																																																	0													77.0	82.0	80.0					19																	12501412		2202	4296	6498	SO:0001819	synonymous_variant	0			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1800C>G	19.37:g.12501412G>C				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L600	ENST00000430385.3	37	c.1800	CCDS45989.1	19																																																																																			ZNF799	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196466		0.413	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	HGNC	protein_coding	OTTHUMT00000344099.2	-	0.00	91	0	G	NM_001080821		12501412	-1	tier1	-	no_errors	ENST00000430385	ensembl	human	known	74_37	silent	7.22	90	7	SNP	0.030	C
ZNF799	90576	genome.wustl.edu	37	19	12502895	12502895	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:12502895C>T	ENST00000430385.3	-	4	517	c.317G>A	c.(316-318)cGt>cAt	p.R106H	CTD-3105H18.16_ENST00000595562.1_Missense_Mutation_p.R106H|ZNF799_ENST00000419318.1_Missense_Mutation_p.R74H|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TCCACTCATACGGCTTTCATA	0.418																																																	0													157.0	143.0	148.0					19																	12502895		2203	4300	6503	SO:0001583	missense	0			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.317G>A	19.37:g.12502895C>T	ENSP00000411084:p.Arg106His			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R106H	ENST00000430385.3	37	c.317	CCDS45989.1	19	.	.	.	.	.	.	.	.	.	.	C	3.487	-0.104637	0.06967	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.07908	3.15;3.27	1.31	-2.61	0.06171	.	.	.	.	.	T	0.03178	0.0093	N	0.05050	-0.12	0.09310	N	1	B	0.17667	0.023	B	0.06405	0.002	T	0.35943	-0.9768	9	0.52906	T	0.07	.	1.4446	0.02361	0.17:0.4202:0.1703:0.2395	.	106	Q96GE5	ZN799_HUMAN	H	74;106	ENSP00000415278:R74H;ENSP00000411084:R106H	ENSP00000415278:R74H	R	-	2	0	ZNF799	12363895	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.730000	0.04915	-2.998000	0.00277	-0.634000	0.03986	CGT	ZNF799	-	NULL	ENSG00000196466		0.418	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	HGNC	protein_coding	OTTHUMT00000344099.2	-	0.00	76	0	C	NM_001080821		12502895	-1	tier1	-	no_errors	ENST00000430385	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.000	T
ZNF791	163049	genome.wustl.edu	37	19	12738587	12738587	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:12738587G>T	ENST00000343325.4	+	4	406	c.244G>T	c.(244-246)Gaa>Taa	p.E82*	AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000458122.3_Nonsense_Mutation_p.E50*|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000446165.1_Missense_Mutation_p.Q61H|ZNF791_ENST00000540038.1_5'UTR	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	82	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						TCAATGTGCAGAAAACTTCAG	0.418																																																	0													142.0	137.0	139.0					19																	12738587		2203	4300	6503	SO:0001587	stop_gained	0			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.244G>T	19.37:g.12738587G>T	ENSP00000342974:p.Glu82*		B7Z586|Q8NC99	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E82*	ENST00000343325.4	37	c.244	CCDS12273.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.96|15.96	2.987298|2.987298	0.53934|0.53934	.|.	.|.	ENSG00000173875|ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122|ENST00000446165	.|T	.|0.01947	.|4.54	1.51|1.51	0.451|0.451	0.16629|0.16629	.|.	.|.	.|.	.|.	.|.	.|T	.|0.04724	.|0.0128	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.44421	.|-0.9329	.|6	0.02654|0.72032	T|D	1|0.01	.|.	5.8208|5.8208	0.18526|0.18526	0.1935:0.0:0.8065:0.0|0.1935:0.0:0.8065:0.0	.|.	.|.	.|.	.|.	X|H	82;82;50|61	.|ENSP00000412981:Q61H	ENSP00000342974:E82X|ENSP00000412981:Q61H	E|Q	+|+	1|3	0|2	ZNF791|ZNF791	12599587|12599587	0.071000|0.071000	0.21146|0.21146	0.030000|0.030000	0.17652|0.17652	0.129000|0.129000	0.20672|0.20672	0.772000|0.772000	0.26647|0.26647	0.201000|0.201000	0.20466|0.20466	0.484000|0.484000	0.47621|0.47621	GAA|CAG	ZNF791	-	pfscan_Krueppel-associated_box	ENSG00000173875		0.418	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF791	HGNC	protein_coding	OTTHUMT00000344140.1	-	0.00	87	0	G	NM_153358		12738587	+1	tier1	-	no_errors	ENST00000343325	ensembl	human	known	74_37	nonsense	11.82	97	13	SNP	0.987	T
ZNF737	100129842	genome.wustl.edu	37	19	20728406	20728406	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:20728406G>C	ENST00000427401.4	-	4	697	c.603C>G	c.(601-603)ttC>ttG	p.F201L		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						CTTCACATTTGAAGGGTTTCT	0.388																																																	0													22.0	20.0	21.0					19																	20728406		692	1590	2282	SO:0001583	missense	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.603C>G	19.37:g.20728406G>C	ENSP00000395733:p.Phe201Leu		C9JHM3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F201L	ENST00000427401.4	37	c.603	CCDS54238.1	19	.	.	.	.	.	.	.	.	.	.	-	12.04	1.817521	0.32145	.	.	ENSG00000237440	ENST00000427401	T	0.21932	1.98	0.792	0.792	0.18625	.	.	.	.	.	T	0.15176	0.0366	L	0.28649	0.875	0.19945	N	0.999949	B	0.12013	0.005	B	0.22601	0.04	T	0.29243	-1.0018	9	0.87932	D	0	.	6.9353	0.24463	1.0E-4:0.0:0.9999:0.0	.	201	C9JHM3	.	L	201	ENSP00000395733:F201L	ENSP00000395733:F201L	F	-	3	2	ZNF737	20520246	0.000000	0.05858	0.337000	0.25536	0.338000	0.28826	-0.276000	0.08514	0.159000	0.19401	0.162000	0.16502	TTC	ZNF737	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000237440		0.388	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF737	HGNC	protein_coding	OTTHUMT00000447844.2	-	0.00	88	0	G	NM_145289		20728406	-1	tier1	-	no_errors	ENST00000427401	ensembl	human	known	74_37	missense	10.29	61	7	SNP	0.588	C
ZNF850	342892	genome.wustl.edu	37	19	37241026	37241026	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr19:37241026C>T	ENST00000591344.1	-	5	1074	c.916G>A	c.(916-918)Gag>Aag	p.E306K	ZNF850_ENST00000589390.1_Intron	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TAGGGTTTCTCACCAGTGTGA	0.378																																																	0																																										SO:0001583	missense	0			BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14		ENST00000591344.1:c.916G>A	19.37:g.37241026C>T	ENSP00000464976:p.Glu306Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E306K	ENST00000591344.1	37	c.916	CCDS59379.1	19																																																																																			ZNF850	-	pfscan_Znf_C2H2	ENSG00000267041		0.378	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF850	HGNC	protein_coding	OTTHUMT00000453557.1	-	0.00	119	0	C	XM_001720258		37241026	-1	tier1	-	no_errors	ENST00000591344	ensembl	human	known	74_37	missense	28.32	81	32	SNP	1.000	T
DDX27	55661	genome.wustl.edu	37	20	47858422	47858422	+	Intron	SNP	C	C	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:47858422C>A	ENST00000371764.4	+	17	1999				ZNFX1_ENST00000371754.4_Missense_Mutation_p.M1117I|ZNFX1_ENST00000469991.1_5'UTR|DDX27_ENST00000484427.1_Intron	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GCTTTCTTCTCATCCCAGTTG	0.358																																																	0													49.0	52.0	51.0					20																	47858422		2203	4300	6503	SO:0001627	intron_variant	0			AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.1991-8C>A	20.37:g.47858422C>A			A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.M1117I	ENST00000371764.4	37	c.3351	CCDS13416.1	20	.	.	.	.	.	.	.	.	.	.	C	9.107	1.005687	0.19199	.	.	ENSG00000124201	ENST00000371754	D	0.83837	-1.77	5.41	1.91	0.25777	.	.	.	.	.	T	0.70168	0.3193	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.56583	-0.7955	6	0.22109	T	0.4	.	4.6128	0.12411	0.1646:0.577:0.0:0.2585	.	.	.	.	I	1117	ENSP00000360819:M1117I	ENSP00000360819:M1117I	M	-	3	0	ZNFX1	47291829	0.000000	0.05858	0.004000	0.12327	0.877000	0.50540	0.105000	0.15333	0.651000	0.30788	0.484000	0.47621	ATG	ZNFX1	-	NULL	ENSG00000124201		0.358	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	HGNC	protein_coding	OTTHUMT00000080485.1	-	0.00	79	0	C			47858422	-1	tier1	-	no_errors	ENST00000371754	ensembl	human	known	74_37	missense	9.52	76	8	SNP	0.000	A
ZSCAN2	54993	genome.wustl.edu	37	15	85164083	85164083	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr15:85164083G>A	ENST00000448803.2	+	3	949	c.657G>A	c.(655-657)gaG>gaA	p.E219E	ZSCAN2_ENST00000538076.1_Intron|ZSCAN2_ENST00000546148.1_Silent_p.E219E|ZSCAN2_ENST00000327179.6_Silent_p.E218E|ZSCAN2_ENST00000358472.3_Silent_p.E69E|ZSCAN2_ENST00000541040.1_Intron|ZSCAN2_ENST00000485222.2_Intron	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2	219					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		ACCTAGGGGAGAAGCCCTACG	0.582																																																	0													90.0	94.0	93.0					15																	85164083		2203	4299	6502	SO:0001819	synonymous_variant	0			BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.657G>A	15.37:g.85164083G>A			A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E219	ENST00000448803.2	37	c.657	CCDS10329.2	15																																																																																			ZSCAN2	-	NULL	ENSG00000176371		0.582	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN2	HGNC	protein_coding	OTTHUMT00000396956.1	-	0.00	60	0	G	NM_017894		85164083	+1	tier1	-	no_errors	ENST00000448803	ensembl	human	known	74_37	silent	12.24	43	6	SNP	1.000	A
ZSWIM1	90204	genome.wustl.edu	37	20	44511255	44511255	+	Silent	SNP	G	G	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr20:44511255G>A	ENST00000372523.1	+	2	119	c.24G>A	c.(22-24)ccG>ccA	p.P8P	ZSWIM1_ENST00000372520.1_Silent_p.P8P	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	8						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				TCAAAGCCCCGTGGTCAGCTG	0.488																																																	0													86.0	89.0	88.0					20																	44511255		2203	4300	6503	SO:0001819	synonymous_variant	0			AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.24G>A	20.37:g.44511255G>A			Q5JZH2|Q9BR12|Q9BV30	Silent	SNP	pfam_Znf_SWIM,pfscan_Znf_SWIM	p.P8	ENST00000372523.1	37	c.24	CCDS13382.2	20																																																																																			ZSWIM1	-	NULL	ENSG00000168612		0.488	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM1	HGNC	protein_coding	OTTHUMT00000157064.2	-	0.00	71	0	G	NM_080603		44511255	+1	tier1	-	no_errors	ENST00000372520	ensembl	human	known	74_37	silent	6.33	74	5	SNP	0.000	A
ZZZ3	26009	genome.wustl.edu	37	1	78030138	78030139	+	IGR	INS	-	-	A			TCGA-VR-A8EX-01A-11D-A36J-09	TCGA-VR-A8EX-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4bd3b4e5-e2b6-4284-8795-dddc24036dab	ff38463f-abca-4748-8f03-c4eab0947896	g.chr1:78030138_78030139insA	ENST00000370801.3	-	0	4328				ZZZ3_ENST00000476275.1_5'Flank	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TTAACACTGGTAAAAAAAAAAA	0.282																																																	0																																										SO:0001628	intergenic_variant	0			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652		1.37:g.78030149_78030149dupA			B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	RNA	INS	-	NULL	ENST00000370801.3	37	NULL	CCDS677.1	1																																																																																			ZZZ3	-	-	ENSG00000036549		0.282	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1		0.00	44	0	-	NM_015534		78030139	-1	tier1		no_errors	ENST00000481346	ensembl	human	known	74_37	rna	6.45	29	2	INS	0.012:0.000	A
